COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..558329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(362..862) product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(993..1157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1407..1604) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061019.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS complement(1686..2021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 2199..2354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 2383..2643 product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527142.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(2723..2944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 3070..3870 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395198.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(4101..4445) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180940249.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(4577..5092) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991909.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(5106..5936) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327411.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(5933..6787) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527131.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(6787..7695) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378916.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(7706..8710) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(8813..10360) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527124.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 10897..11616 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314645.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 11742..12149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(12168..12629) product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527122.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene rirA CDS 12809..13852 product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(13910..14986) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968777.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(14976..16067) product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395239.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(16211..17707) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 17786..18694 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327401.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(18698..19648) product cellulose biosynthesis protein BcsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970093.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene bcsN CDS complement(19656..21608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(21605..23950) product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(23943..26204) product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970094.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene bcsA CDS complement(26361..27290) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(27287..27862) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 tRNA complement(27996..28072) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(28217..28666) product phasin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327400.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 28908..32588 product two-component system sensor histidine kinase PdhS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene pdhS1 CDS 32800..34434 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968770.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(34696..36636) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395243.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 36830..38668 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974522.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(38684..39502) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(39507..40418) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(40423..41565) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974519.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(41645..42739) product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS complement(42924..44339) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395254.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 44559..45848 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527089.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 gene aceA CDS 45951..46190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(46264..46650) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067700.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(46675..47289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(47372..49894) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327385.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(50132..50329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(50430..51611) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968760.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 51859..53220 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327382.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 53318..54601 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327381.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 54698..56170 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene zwf CDS 56180..56878 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene pgl CDS 57002..58822 product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene edd CDS complement(59014..59427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395319.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(59534..60625) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529832.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene ugpC CDS complement(60647..62299) product alpha glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027987980.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(62326..63471) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(63473..64483) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS complement(64671..66050) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 66256..67368 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968755.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(67582..68481) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706891.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene folD CDS 69008..69811 product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(69945..70475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968752.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(70472..70840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(70856..71413) product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968751.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(71693..72091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(72094..72846) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene fliR CDS complement(72843..74930) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene flhA CDS complement(75216..75482) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706883.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene fliQ CDS complement(75479..75925) product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene flgD CDS complement(75919..76365) product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706881.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene flbT CDS complement(76362..76715) product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene flaF CDS complement(76754..77821) product flagellar hook-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241348.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(77825..79237) product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene flgK CDS complement(79282..80481) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(80593..81267) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(81549..82127) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(82051..83472) product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(83469..84782) product chemotaxis protein MotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974482.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene motC CDS complement(84787..86010) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(86007..86660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(86973..88157) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 88930..93009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241405.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 note possible pseudo, frameshifted CDS 93209..95257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327298.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 95305..96597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327299.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 96610..97767 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene glf CDS complement(97846..99042) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(99372..100559) product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(100952..101698) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241360.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 gene fliP CDS complement(101695..102198) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(102228..102938) product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene flgH CDS complement(102935..103483) product MotE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968733.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(103480..104595) product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392028.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(104592..104978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(105121..105903) product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene flgG CDS complement(105913..106251) product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313017.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(106248..106667) product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529902.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene flgC CDS complement(106671..107054) product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529904.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 gene flgB CDS complement(107370..107936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(107933..109339) product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327334.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene fliI CDS complement(109346..110071) product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968729.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene flgF CDS complement(110073..110852) product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327332.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 111025..111897 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene motA CDS 111901..112848 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968727.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 112911..113489 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844029.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene fliN CDS 113519..114559 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene fliG CDS 114617..115750 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974456.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene flhB CDS 115756..116199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(116349..117092) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529926.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(117279..118058) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(118589..120283) product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312927.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene fliF CDS complement(120548..120937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392016.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(121036..121590) product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene cheD CDS complement(121587..121976) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706841.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(121976..123034) product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970952.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene cheB CDS complement(123031..123936) product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene cheR CDS complement(123933..124400) product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327318.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(124407..126677) product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529948.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(126703..127068) product chemotaxis response regulator CheY1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene cheY1 CDS complement(127065..127364) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(127506..129020) product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529954.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 128922..129137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(129622..130983) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974440.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(130988..131302) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene rhaM CDS complement(131306..132304) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(132297..133280) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241393.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(133280..134803) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968715.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(134996..135985) product rhamnose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004436001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene rhaS CDS complement(136016..136828) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS 137029..139122 product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 139133..140422 product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene rhaI CDS 140518..140772 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014761069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(140828..141859) product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(141913..142191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 142290..142928 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 142936..143577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 note possible pseudo, internal stop codon CDS 143578..143808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 note possible pseudo, internal stop codon CDS 143860..145110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973568.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(145113..145448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(145507..146889) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 147297..148853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(148922..150628) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067656.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene rpsA CDS complement(150770..151402) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene cmk CDS complement(151399..152193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS complement(152231..153577) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene aroA CDS 153471..153680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 153839..154228 product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534381.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 tRNA 154375..154450 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(154517..155119) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 155272..156213 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 156239..157306 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 157303..159375 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 159392..160309 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(160450..161652) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(161714..162676) product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339246.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 162894..163694 product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 163696..164520 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 164501..165355 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 165361..166575 product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 166572..167939 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 167962..168972 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 169042..169674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 169671..170051 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 170071..170394 product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(170407..170733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 170847..172016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 172054..172845 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330675.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(172849..173322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972625.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 173461..174096 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330674.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS complement(174111..174512) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037377824.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 174845..175360 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309974.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene fabA CDS 175439..176662 product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene fabB CDS 176680..177474 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067646.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene fabI CDS complement(177630..177818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(177945..178547) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113093.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 178678..179136 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(179140..180156) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(180242..182386) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene pnp CDS complement(182796..183065) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309908.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene rpsO CDS complement(183208..183537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(183581..185233) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202402528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(185459..186394) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534367.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene truB CDS complement(186407..186781) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene rbfA CDS complement(186890..189538) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436934.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene infB CDS complement(189640..190293) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534364.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(190323..191921) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene nusA CDS complement(192054..192665) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241712.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene rimP CDS 192974..194551 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067635.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(194599..195864) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(196034..196639) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene recR CDS 196697..197311 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309919.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(197312..197923) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533411.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(197959..198282) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533413.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(198359..200242) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968441.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 200517..200927 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067629.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 200975..201898 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398721.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene nudC CDS complement(201904..202140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(202242..203093) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398718.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(203107..203862) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398717.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS 204014..204805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(204879..205823) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 206333..211783 product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391582.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 211796..213880 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene pbpC CDS complement(214055..214855) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(214967..215842) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396254.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(215839..217824) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396257.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(217873..218256) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(218270..219877) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(219877..221040) product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(221121..224582) product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(224747..225199) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(225215..226372) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172901056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(226501..227691) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705349.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 227735..228790 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 tRNA complement(228769..228843) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 228993..229193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 229362..230654 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706806.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene murA CDS 230814..231251 product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 231296..232594 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene hisD CDS 232598..233074 product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 233079..233540 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 233686..233904 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435948.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene infA CDS 233986..234606 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435951.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 234608..234817 product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene yacG tRNA 234992..235067 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(235134..235685) product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992389.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 235907..237073 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974378.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(237080..237607) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972312.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 237721..238713 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061907.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene galE CDS complement(238717..239016) product chorismate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241439.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(239361..240365) product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene cydB CDS complement(240355..241767) product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(241997..242260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(242311..242565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 243325..243747 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 243750..245471 product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969516.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(245486..245881) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240481.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(246004..247377) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(247561..247791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 247938..248840 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009625.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(248818..250206) product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene gor CDS complement(250408..250947) product DUF2059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(250966..251664) product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene rpiA CDS 251878..252552 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975723.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(252626..253795) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378411.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(253809..254627) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530908.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(254627..255355) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391953.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(255425..256207) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968662.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(256235..257008) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 257221..258099 product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 258162..258800 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 258832..260022 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 260019..261626 product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968665.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 261902..262723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(262772..263212) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene mscL CDS 263398..266898 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391940.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(266902..267555) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530107.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(267625..268053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974374.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 268163..268510 product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 268510..269595 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241446.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 269734..270093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(270193..270681) product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968649.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(270684..270950) product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974369.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 271094..272035 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311101.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 272101..272736 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252592.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 272792..275317 product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 275336..276061 product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene pdeM CDS complement(276051..276437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 note possible pseudo, frameshifted CDS 276722..277228 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974353.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 277305..277745 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(277749..278543) product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968644.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(278540..279466) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313297.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(279979..283887) product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241884.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 284383..286179 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968641.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 286213..286452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 286509..287717 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391931.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 287911..290118 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970942.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 290461..290670 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537120.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 290786..291073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537122.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 291223..291462 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene rpsU CDS 291545..291769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 291908..292084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(292160..293215) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971982.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(293216..293662) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(293659..295155) product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316406.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(295272..296153) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532537.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 296342..297247 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040959293.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 297342..298004 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(298011..298832) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327208.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 298950..300884 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992212.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(301049..303070) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040120974.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(303178..303855) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975933.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(303836..305491) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975934.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(305552..306298) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975935.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(306513..307082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(307142..307759) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(307773..308648) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382877.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(308812..310317) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820743.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(310321..310770) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368480.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(310816..312240) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(312341..313342) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 313483..314340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(314454..315731) product NtaA/DmoA family FMN-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 315869..316663 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 316687..317673 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112993.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 317670..318734 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 318745..319698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(319759..321816) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 322095..322877 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119004.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 tRNA complement(323089..323162) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(323367..324398) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(324413..326113) product glycoside hydrolase family 37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173519786.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(326116..326928) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(326921..327865) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(327955..329187) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975930.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(329210..330352) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975931.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene ugpC CDS complement(330539..331648) product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530160.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 331933..333117 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241461.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 333244..333636 product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974342.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 gene apaG CDS complement(333821..334819) product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(335174..336085) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970889.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene argF CDS complement(336113..337303) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974339.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 337727..338257 product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241465.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(338404..339087) product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene phoB CDS complement(339107..339835) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene phoU CDS complement(339883..340698) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003514913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene pstB CDS complement(340712..342040) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene pstA CDS complement(342037..343521) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970884.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene pstC CDS complement(343690..344724) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(344911..346227) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968632.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene phoR CDS 346353..347234 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene ppk2 CDS complement(347247..348371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 349043..350005 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 tRNA 350268..350343 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 350375..350926 product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 350904..351626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(351633..351947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 352062..352388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(352667..354958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(354951..355232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(355526..356032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(356019..357185) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 357528..359714 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 359711..360988 product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 360985..361572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 361645..362370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 362377..365448 product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 365478..366422 product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(366442..367020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(367021..367338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 367504..367749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 367788..367919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 367992..368270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 368282..368539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(369174..370343) product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(370572..371762) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 372058..373758 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 373874..375499 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252578.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene pgi CDS complement(375502..376587) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530012.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(376672..377601) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310651.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(377681..378379) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970871.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(378529..378957) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968601.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 379154..379342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 379463..380167 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 380246..382090 product adenylate cyclase CyaD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene cyaD1 CDS complement(382144..382782) product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 382971..384005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(384025..385113) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 385258..386064 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531522.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 386188..386823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(386871..388118) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 tRNA complement(388345..388421) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(388558..390030) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968584.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(390235..392241) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 392830..393222 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene rnpA CDS 393222..395018 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310230.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene yidC CDS 395237..396148 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066869481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS 396201..396854 product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene yihA CDS complement(396858..397589) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327108.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 397856..398743 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968575.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene argB CDS complement(398777..399679) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327102.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 399783..400478 product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 400601..401566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(401663..402556) product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527617.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 402744..403601 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene dapD CDS 403605..403991 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 404076..405275 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391801.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene dapE CDS 405262..405858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391800.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(405883..406626) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391799.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene truA CDS complement(406626..407570) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene fmt CDS complement(407672..408196) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974268.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene def CDS 408322..409515 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391792.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 409560..410459 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 410741..413077 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974265.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(413181..413483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(413540..414481) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241535.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 414666..415097 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974263.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 415230..415487 product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(415506..416207) product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015007103.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(416215..417453) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene metK CDS complement(417656..418075) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(418224..419807) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327077.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene lnt CDS complement(419920..421071) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399659.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(421081..421590) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene ybeY CDS complement(421608..422660) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(422688..424088) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene miaB CDS complement(424145..424933) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399640.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(425061..425486) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(425526..426020) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974253.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(426025..426681) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968552.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene tsaB CDS complement(426703..427272) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378149.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(427372..427863) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974250.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(427956..429023) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene trpS CDS 429278..429730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(429737..431329) product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968549.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene murJ CDS complement(431326..434220) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(434265..437003) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 gene mutS CDS 437118..439403 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(439540..440418) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(440525..442819) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013843850.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(442876..443367) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399621.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene lspA CDS complement(443364..444218) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241559.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(444215..445282) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241560.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 445416..445865 product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(445882..446226) product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(446271..446570) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(446598..447548) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene sppA CDS 447761..448429 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327050.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene lptC CDS 448437..449000 product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378113.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 449007..449816 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene lptB CDS 449968..451530 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399612.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene rpoN CDS 451780..452355 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 gene raiA CDS 452429..452893 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene ptsN CDS complement(452967..453590) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974227.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene grpE CDS complement(453683..454759) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene hrcA CDS 454953..455669 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310174.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene rph CDS 455683..456099 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909757.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 456108..456752 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene rdgB CDS 456759..457952 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968537.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene hemW CDS complement(457953..458894) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310430.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 459031..459927 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene gcvA CDS complement(459973..461427) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015007101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene dnaA CDS complement(462402..462668) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974216.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene rpsT CDS complement(462859..463632) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330822.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(463661..464542) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330821.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene mutM CDS 464726..465502 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene ubiE CDS 465540..467114 product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene ubiB CDS 467194..470820 product signal perception protein NrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976263.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene nsrA CDS 470864..471667 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975239.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 471801..472028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 472329..473534 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene coaBC CDS complement(473527..474348) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 474728..475132 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397473.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 475136..475930 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397463.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 476015..476632 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(476637..477446) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 gene thiD CDS complement(477721..479301) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 479395..479868 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene dut CDS 479873..480760 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528691.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 481109..481726 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 481957..482925 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene cysK CDS 482980..483546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(483661..485193) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(485459..486403) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene gshB CDS complement(486476..487468) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397428.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(487465..488583) product sn-glycerol-3-phosphate import ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397425.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(488596..489438) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene ugpE CDS complement(489452..490333) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(490495..491793) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397418.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(491896..492264) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(492254..493180) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene rsmI CDS 493415..494533 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene dnaN CDS 494738..495355 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 495365..495946 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 495949..496647 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968510.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene pyrF CDS 496664..496951 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378049.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 497072..498052 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968509.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 498303..498452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(498486..499292) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397388.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 499524..500216 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330755.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 500227..501372 product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene queG CDS 501369..502244 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 502606..502968 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067726.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 503044..504333 product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529788.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 504545..505822 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970796.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 505867..507402 product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081157931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 507609..508742 product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 508742..509845 product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397356.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 509889..510344 product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970792.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 510431..510880 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 510877..511521 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 511575..513137 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene guaA CDS 513456..514652 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(515147..516169) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705723.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(516442..517248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 note possible pseudo, internal stop codon, frameshifted CDS 517449..517757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(519171..519419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 note possible pseudo, internal stop codon CDS 519588..519914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 519916..520182 product conjugal transfer protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015316600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 520186..520389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 520496..521392 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208224.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 521584..521760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(521757..522617) product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(522614..523441) product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120708963.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 523958..524419 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338351.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 524409..525269 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(525274..525834) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 525973..527031 product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968492.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 527202..528662 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(528634..529482) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(529569..530060) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 530198..531367 product tyrosine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397370.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene tatA CDS 531375..531995 product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397340.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 532075..532419 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397337.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(532524..533423) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384690.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS 533605..534831 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384689.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS 535286..536158 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 536155..537078 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 537210..537803 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 537796..538509 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384685.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 538531..539982 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384684.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 539986..540744 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(540814..540990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(541095..541628) product 2,4'-dihydroxyacetophenone dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113028.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(541653..543374) product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(543582..544298) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(544279..545043) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391538.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(545040..546047) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909953.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(546047..546910) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969845.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(547103..548275) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(548415..549470) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392062.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(549666..550280) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976277.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene pcaG CDS complement(550280..551029) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene pcaH CDS complement(551037..551441) product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392057.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene pcaC CDS complement(551434..552246) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976279.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene pcaD CDS 552342..553265 product pca operon transcription factor PcaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976280.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene pcaQ CDS 553297..554163 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(554157..555329) product 4-hydroxybenzoate 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242251.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene pobA CDS 555445..556329 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(556314..556964) product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976284.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(557161..557916) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402690.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 sequence02 source 1..237938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(268..1170) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035566.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 1265..2017 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035567.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(2176..3099) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109873241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 3221..3946 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971202.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(4521..4835) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810016.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(4874..5626) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(5636..6436) product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195445.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(6426..7226) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853567.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(7242..7757) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384583.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(7769..9514) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763658.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene betA CDS complement(9524..10558) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(10667..11713) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243759.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 11910..13211 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976921.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 13386..14219 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 14231..15070 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 15083..16168 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250726.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 16204..17685 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 17805..19250 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 19253..19912 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 20182..21789 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974764.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene betA CDS 22132..23205 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535546.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene xylF CDS 23269..24069 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972912.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 24062..25285 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972911.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(25411..26376) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973600.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 26627..27478 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092846703.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 27487..28710 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(28666..29157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05600 note possible pseudo, frameshifted CDS complement(29213..29524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 note possible pseudo, internal stop codon, frameshifted CDS 29721..29915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 29973..30200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 30586..31041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 31077..31484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05650 note possible pseudo, frameshifted CDS 31481..32122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 note possible pseudo, frameshifted CDS 32122..32490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(32393..33694) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528948.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(33701..34633) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528947.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 34838..35896 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528946.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 36005..36871 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528945.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 36868..37659 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528944.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 37656..38702 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528943.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 38720..40012 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS 40005..40367 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528941.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 40397..40744 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 40891..42396 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528938.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 42533..42832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(42919..43368) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268734.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 43531..43890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 43962..44243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 note possible pseudo, frameshifted CDS complement(44328..44462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 note possible pseudo, internal stop codon CDS complement(44505..44624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05830 note possible pseudo, internal stop codon CDS 44995..46542 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339154.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 46604..47542 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 47554..48405 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 48402..50048 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339155.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 50053..51504 product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 51511..52446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 52483..53673 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(53944..54906) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(54982..55674) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314733.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(55671..56369) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085934.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(56366..57130) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705575.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(57213..57983) product histidine ABC transporter ATP-binding protein HisP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293609.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene hisP CDS complement(58185..59081) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene gcvA CDS 59296..59685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(59739..60149) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222863.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(60552..60872) product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene sugE CDS complement(60976..61296) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035726.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 61618..61815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(61781..62671) product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene gcvA CDS complement(62703..63590) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene gcvA CDS 63718..64392 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528962.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 64389..64700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 64807..65646 product glutamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930601.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 65665..66342 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086094.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 66368..67132 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(67165..67371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 67285..67866 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(67869..69143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(69578..70861) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970031.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 71049..71567 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 71564..72265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(72330..73460) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 73588..74355 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(74429..74695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 74600..75733 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 75766..76881 product PotD/PotF family extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970990.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 76947..77891 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 77888..78688 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967209.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 78721..80049 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970988.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene hisD CDS 80055..81068 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967211.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 81121..81852 product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene hutC CDS 81878..83170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193377946.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 83172..84329 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(84610..86214) product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895690.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(86242..86964) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(86957..87652) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(87667..88776) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(88854..89882) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946872.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(89910..90698) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS complement(90695..91555) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene potB CDS complement(91552..92244) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 92535..94073 product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene tcuA CDS 94183..95052 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210056.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 95049..95756 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 95793..96506 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 96527..98005 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 98135..98584 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050979900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 98584..100086 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034850911.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 100189..101136 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene cysB CDS 101281..102279 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810803.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 102381..102911 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183459532.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 102908..103513 product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135175700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 103631..104932 product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 104967..106358 product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731591.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 106355..109057 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187807.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene acnA CDS 109129..109509 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814363.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 109606..110685 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114172.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(110825..111421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(111563..112474) product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(112504..113205) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809388.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 113407..116091 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447633.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene acnA CDS 116088..117464 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 117491..118213 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 118253..119800 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 119822..120985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 121008..121742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 121824..122879 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040409.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 122911..123687 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 123700..124470 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 124553..125842 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene hemL CDS complement(125901..126833) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene hemC CDS complement(126951..127790) product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(127886..128791) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene dapA CDS complement(128860..130629) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121537498.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(130634..131734) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(131809..132891) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(132963..134393) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970336.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 134616..135764 product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970343.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 135861..136649 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 136855..137868 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(137919..138755) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene proC CDS complement(138757..139521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 139789..140538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 140619..141476 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 141473..142579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 142581..143330 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 143381..144076 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267425.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 144162..144959 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808900.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 145092..145865 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 145909..147453 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 147450..148553 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 148578..150011 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 150099..150794 product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 150821..151609 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067241.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 151743..152858 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195843.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 152924..153874 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526290.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 153878..154873 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 154849..155673 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 155612..156313 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 156334..157101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 157216..157800 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210333952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 157829..158593 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969328.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(158641..159699) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893107.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 160218..161174 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401718.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 161171..162073 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206745.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 162073..163884 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206746.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 163909..164766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 164794..166353 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 166554..167156 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 note possible pseudo, internal stop codon CDS complement(167160..167813) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 167947..168996 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 169047..169436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 169473..170594 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813262.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 170596..171627 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384466.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 171665..172453 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(172461..172718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 172884..173384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 173493..174332 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 174348..175196 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230915.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 175193..175951 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 176062..176499 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525161.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 176508..177410 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 177706..178356 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 178611..179633 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098477.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 179675..180670 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098478.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 180667..181428 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098479.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 181659..182684 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 182827..184161 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 184223..185155 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 185148..185972 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 186000..186764 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067240.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 186823..187941 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 187970..188740 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 188860..189729 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 189849..190517 product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974124.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(190662..190994) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402120.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(190999..191553) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967265.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 191587..192099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 192096..192410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 note possible pseudo, frameshifted CDS 192431..192913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 note possible pseudo, frameshifted CDS 193236..194447 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene moeA CDS 194551..195582 product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 195583..196599 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(196653..196862) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 197084..198142 product molybdate ABC transporter substrate-binding protein MolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene molA CDS 198139..199173 product molybdate ABC transporter permease MolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene molB CDS 199163..199954 product molybdate ABC transporter ATP-binding protein MolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene molC CDS 199947..200723 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073705.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(200876..201337) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 201426..202661 product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395366.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 202658..203845 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395362.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 tRNA complement(202849..202945) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 203842..204285 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384885.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene dtd CDS 204540..206954 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973252.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 207008..207943 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 208147..208986 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 208983..209969 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973255.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 209956..210753 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973256.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 211022..211570 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973257.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 211632..212582 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973258.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 212582..212926 product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 213087..214934 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(215047..215961) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 216217..216984 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399793.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 217007..218191 product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162180331.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 218215..219342 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973070.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 219407..220639 product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS 220641..221654 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 221658..222989 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970299.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS 222994..224382 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528744.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene lpdA CDS 224366..225448 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392140.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 225450..226340 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene mmsB CDS 226361..227131 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(227287..228387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651870.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(229087..230148) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(230175..231095) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene rocF CDS 231216..231653 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313709.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(231713..232375) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(232504..233700) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532171.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(233687..234865) product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532172.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(234899..235723) product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969332.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene eutA CDS complement(235826..237208) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401297.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 237367..237516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 sequence03 source 1..237432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 710..5248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(5862..9959) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074836736.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(10476..11351) product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(12716..13627) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 13733..14410 product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(14601..15944) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388134.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(15963..16712) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(16900..18129) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080850788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(18107..18868) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(18880..19581) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(19660..20409) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 20693..21133 product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970109.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(21302..22570) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080850788.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(22618..23508) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(23744..24661) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530002.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(24836..26080) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(26092..27051) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100771272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(27051..28064) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 28411..29403 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967019.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(29422..30327) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(30410..31003) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974671.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(31133..31825) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(32222..32410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(32407..33708) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(34309..34626) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533603.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene rhaM CDS complement(34638..35642) product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene rbsC CDS complement(35762..37282) product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180345411.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene rbsA CDS complement(37337..38518) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976071.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(38592..39710) product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 39878..40606 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 40603..41379 product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 41376..42353 product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 42368..43414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 43417..44235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 44232..45038 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene fabG CDS 45035..45790 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 45814..46857 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 47490..48785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 48812..49324 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338204.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 49331..49843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(50459..50692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(50756..52633) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390984.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 53128..54801 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967307.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(54812..54994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 55425..57425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 57519..59576 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921504.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 59603..60082 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705960.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 60079..62163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 62216..62977 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246338.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 63086..64063 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 64168..65739 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 65732..66739 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 66743..68371 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 68368..68781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 68794..69576 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene fabG CDS 69605..70786 product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene rhmD CDS 70802..71548 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528170.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(71636..72688) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584091.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 73007..74284 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 74369..75115 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS 75115..75843 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243768.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 75856..76734 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 76734..77777 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 77841..78626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 78644..79570 product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 79574..80335 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 80335..81213 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088206.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 81245..82249 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085682.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 82259..82591 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 82724..83776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 84049..85212 product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727702.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 85283..86035 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 86032..86982 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066754.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 87031..88089 product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene hpaA CDS 88086..88562 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 88565..90658 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088788.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(90775..92733) product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309586.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(92737..93876) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(93873..97814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(97836..100163) product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(100135..101220) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074859.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(101523..103523) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110516.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(103568..103945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 104236..104730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992422.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(104878..105096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(105444..106517) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene ugpC CDS complement(106510..108045) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081159250.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(108047..108874) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(108871..109806) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(109817..111172) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(111280..112830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(112985..114145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 114328..115143 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 115140..115931 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816751.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 115928..116707 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 116731..117774 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974852.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 117841..118908 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 118899..119924 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 119935..120900 product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337814.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 121123..122772 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 122812..123858 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973844.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 123855..124772 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 124769..125602 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969921.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 125599..126348 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(126355..126828) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 126999..130691 product trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983981.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene putA CDS complement(130745..131323) product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(131320..132831) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970975.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(132828..133112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 132999..133439 product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 133430..134407 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 134417..135352 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080854800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(135359..135820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(135830..135985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504656.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 136104..136646 product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528653.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 136654..136929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 137087..137539 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707559.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 137624..138970 product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327923.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 139036..139848 product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327924.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 139858..141756 product nitric oxide reductase activation protein NorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(141824..143176) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967669.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene hemN CDS 143404..143682 product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252128.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 143716..145068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 145072..145605 product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327929.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 145610..145909 product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(145950..147164) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 147377..148519 product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327932.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene nirK CDS 148653..149567 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 149643..150338 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528645.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(150363..153413) product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 153540..153974 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 note possible pseudo, frameshifted CDS 154148..154930 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098513.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 155027..155692 product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016255872.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 155718..156731 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 156825..158117 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213190.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 158129..159043 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213188.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 159043..159852 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 159857..160951 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene ugpC CDS 161005..161868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 161900..163036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(163124..163804) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS 164059..165246 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391418.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 165344..166213 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386881.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 166218..167189 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983966.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 167186..167968 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879470.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 167972..168694 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252483.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 168696..169409 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252482.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(169467..169925) product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707240.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(169939..170703) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(170700..171482) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243143.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(171556..172500) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(172573..173508) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533069.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(173517..175028) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533070.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(175073..176791) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 177397..178047 product DUF2291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533075.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 178080..179582 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 179686..180726 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533073.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 180844..181791 product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 181923..182762 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 182834..184534 product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 184859..185686 product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975227.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 185791..186732 product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 186802..187440 product DUF2291 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975229.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 187442..188986 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 188986..190053 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 190065..191090 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 191087..192955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398936.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(192959..193669) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 193820..195076 product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398928.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS 195080..196381 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398926.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(196465..197226) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972010.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(197241..197807) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992320.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(197791..198165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169539114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 198573..200282 product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene kdpA CDS 200294..202330 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene kdpB CDS 202333..202902 product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene kdpC CDS 202911..205595 product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 205592..206284 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970242.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(206392..207411) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706074.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 207684..208730 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 208805..209623 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 209620..210864 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 210891..211619 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565148.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 211685..213316 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339545.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(213363..215921) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976275.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(216061..216924) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206372.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 217060..218247 product cyanate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(218296..219132) product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976208.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(219193..219864) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311533.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(220083..220529) product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252133.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(220714..221427) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336836.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 221560..222063 product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392276.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene hpaR CDS complement(222076..222882) product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392271.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene hpaI CDS complement(222892..223695) product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392273.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene hpaH CDS complement(223698..224567) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037468009.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(224641..225621) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene hpaD CDS complement(225682..227199) product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392284.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene hpaE CDS complement(227222..227608) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(227683..228195) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(228206..229765) product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392289.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 229861..230742 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392292.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 230859..231380 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087894.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene tsaA CDS complement(231437..231646) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 231822..232667 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533022.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(232668..233273) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252920.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(233270..234043) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529413.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(234045..234242) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972407.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene thiS CDS complement(234239..235225) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976312.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene thiO CDS complement(235228..237051) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972409.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene thiC sequence04 source 1..212586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..988) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973948.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1093..2115) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529235.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(2159..2812) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227935.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(2817..3566) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(3563..4528) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(4525..5421) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(5482..6771) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 7241..8782 product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039291.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 8775..9278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 9442..10668 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene accC CDS complement(10602..11096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 11037..11330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 note possible pseudo, frameshifted CDS 11503..11898 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242238.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(12454..14211) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(14214..15044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159350744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(15041..16378) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(16380..18191) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372670.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(18194..19069) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(19066..20004) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(20080..21627) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080855420.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(21661..22560) product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene ilvE CDS 22772..23611 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(23927..24556) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893820.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 24695..26119 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385764.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 26112..27788 product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385777.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 27849..28700 product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene nocT CDS 28770..29492 product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene nocQ CDS 29489..30211 product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene nocM CDS 30214..30987 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 31022..31864 product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene nocT CDS complement(31951..33012) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(33085..34074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 34300..35490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 35618..36481 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 36549..37049 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259306.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 37046..39463 product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 39656..40534 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 40531..41715 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967595.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 41727..42557 product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 42571..43035 product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(43431..44489) product maleylacetate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085467.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(44499..45380) product intradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533090.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 45506..45811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(45766..46020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(46068..46829) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338633.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(46826..47299) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene aroQ CDS complement(47296..48162) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743852.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(48224..48880) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(48962..49729) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007537433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 50124..51167 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 51229..52011 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815603.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(52021..52794) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 52902..53708 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086437.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(53729..54547) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973497.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(54656..55606) product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(55650..56549) product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814134.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(56681..57526) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(57588..58247) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967040.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(58253..58921) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(58918..60114) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(60156..61157) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973498.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene iolG CDS complement(61311..62177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS complement(62212..63102) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(63466..63633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(64343..65563) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(65636..66724) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198096.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(66717..68387) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205449.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(68560..69651) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 70082..71203 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 71246..72415 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 72449..73441 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 73488..74450 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931679.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(74466..75368) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(75499..76746) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(76774..78516) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(78688..79812) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(79844..80962) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030533.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(81031..81951) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(81948..82832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(83702..84967) product tetracycline efflux MFS transporter Tet(V) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene tet(V) CDS complement(84972..86483) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460903.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene aspA CDS complement(86491..87891) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(87935..89149) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 89263..90138 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808684.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(90169..90945) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(90950..91861) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776692.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(91866..92762) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 93324..93635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 93676..94353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 94359..95891 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 95895..96869 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037471335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 96856..97644 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967867.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(97656..97829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(98178..98426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(98727..99023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(99218..99487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(99724..100647) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819539.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 100746..101648 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(101853..102773) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(102826..103542) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642918.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(103755..104351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(104374..104691) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183828984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(104819..105562) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 105691..105945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 105949..106986 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921746.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene coxB CDS 106983..109502 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119895.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene ctaD CDS 109506..109886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 109883..110512 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119893.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS 110506..111555 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(111559..111735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(111763..112056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(112127..112357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(112453..112947) product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061658.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(113081..113593) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974715.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 113733..113963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(113956..114687) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(114866..115114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 115409..115702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 115787..116287 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 116366..116956 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067199.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(117043..118008) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(118019..118768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(118779..119042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254770.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 119211..120749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(120762..121304) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(121319..122026) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092734935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(122026..122751) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393113.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 122901..123749 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253416.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 123752..126301 product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene ligD CDS complement(126303..127100) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395528.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(127100..127321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 127437..128054 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 128057..128353 product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 128361..128876 product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399415.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(128873..129313) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170054.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 129518..129781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 130115..131491 product M10 family metallopeptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392401.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 131708..132043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 132163..132909 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 tRNA complement(132950..133024) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 133249..133545 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327634.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 133542..134486 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327633.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(134516..135427) product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 135687..136067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327631.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 136280..136537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(136550..139216) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene ppdK CDS complement(139390..139515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(139640..143104) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene smc CDS complement(143345..144175) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(144371..144892) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 145060..146157 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435801.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene mutY CDS 146247..146864 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(147232..148362) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311935.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 148570..148866 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 148866..149207 product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058065.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 149296..150966 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(151261..151608) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392606.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(151605..151934) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 152040..152720 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974742.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 153074..153763 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971150.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(153857..154405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968920.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 154733..156136 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153458433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene thrC CDS 156237..157535 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327609.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 157638..158276 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088106.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 158288..158641 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 158750..158899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 159155..159748 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 159816..162713 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392589.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(162718..163026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(163028..163363) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(163399..164460) product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(164577..164771) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309833.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(164869..165399) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 165280..165648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 165645..166433 product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974733.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 166548..167033 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241131.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(167094..167540) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241132.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene rnhA CDS complement(167537..168502) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968913.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(168512..168832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(168836..169837) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974729.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene ispH CDS complement(169931..170659) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392596.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(170676..171059) product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974727.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(171365..172282) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968909.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(172302..172922) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392602.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(172925..173065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509137.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(173065..174009) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(174284..175951) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene ctaD CDS complement(175971..176855) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327593.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene coxB CDS 177263..177793 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 177872..179287 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392640.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene tldD CDS complement(179628..180527) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 180628..180756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 180791..181846 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(182075..182695) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene pdxH CDS 182740..183186 product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 183285..184346 product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968903.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 184479..185297 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene fabI CDS 185327..185908 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974715.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(186083..186343) product DUF1344 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 186631..190185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 190273..191391 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392623.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene aroC CDS 191401..192501 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532339.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene ribB CDS 192606..193514 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762380.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 193525..194343 product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414900.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 tRNA 193627..193704 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(194354..195550) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 195732..196412 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392644.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 196406..197011 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 197048..197611 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392649.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 197616..199103 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 199081..200256 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 200267..200662 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(200648..201112) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251758.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 201113..202021 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 202091..203017 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392660.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 203020..203271 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 203317..203625 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228510.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 203594..203968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 204074..204997 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 205124..205447 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 205444..205842 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 205878..206096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089491.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 206093..206512 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975963.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 206530..206943 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089492.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 207204..209123 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033044606.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene dxs CDS 209302..209574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 209617..210369 product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 210366..211616 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327568.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(211621..212043) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(212043..212297) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614401.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 sequence05 source 1..203690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1015 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526983.1:arginine deiminase locus_tag LOCUS_12130 CDS 1032..2033 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261198.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene argF CDS 2035..2946 product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene arcC CDS 3046..3867 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391934.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 3931..5004 product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966136.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 5001..7745 product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rbbA CDS 7745..8857 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974060.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(8998..9300) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(9449..9658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 9958..11613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 11606..12247 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 12442..13452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 13694..13891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 14053..15777 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 15975..16367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(16437..18185) product sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970681.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(18196..23682) product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 24078..25157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(25193..25807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(25877..27586) product flotillin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(27593..28249) product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087241.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(28249..29358) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 29568..29810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 29950..33093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(33140..34219) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393081.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 34350..35144 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene otsB CDS complement(35202..36335) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(36578..37510) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969643.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(37521..38723) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(38742..39584) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969645.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(39581..40477) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969646.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(40535..41788) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 41935..42789 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969648.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 42809..43486 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 43664..44899 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 44968..45840 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(45902..46849) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090628.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 47195..48166 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706158.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene rbsK CDS 48230..49327 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 49476..50633 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480621.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 50651..51460 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 51509..51952 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rbsD CDS 51952..52494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 52484..53566 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 53619..54431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(54649..55458) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(55463..56740) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(56719..57780) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995458.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(57861..58904) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188909205.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(59108..60148) product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 60692..61279 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 61317..62945 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 62949..63278 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970046.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 63292..64128 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970045.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 64140..65003 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970044.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 65057..66091 product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970043.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 66244..67674 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 67941..69182 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063810.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS 69269..69700 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 69814..71001 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(71034..72509) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112356.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 72597..73172 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(73239..73538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(73568..74455) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967266.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(74452..74934) product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967265.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(74957..75712) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(75722..76753) product L-idonate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(76764..77711) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967262.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 77878..79374 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 79392..80459 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613522.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 80509..81609 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253048.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 81739..82644 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 82656..83075 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097137372.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 83181..84191 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(84188..85027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 85114..85758 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086152.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 85797..86099 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087106.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(86106..87272) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene argE CDS complement(87286..87963) product DUF1028 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(87976..88398) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(88530..89546) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106178.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(89565..90374) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106179.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(90371..91303) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(91300..92391) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(92402..94483) product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530454.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(94783..96267) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530451.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(96264..97223) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(97342..98223) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975551.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 98451..99425 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975550.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 99430..100449 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975549.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 100446..101480 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975548.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 101489..102286 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(102258..102956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(103083..103844) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062685931.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(103844..104758) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(104768..106264) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015726.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(106275..107072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 107789..109018 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528000.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 109408..111759 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene metE CDS 111783..112574 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 113066..113287 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970634.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene nrdH CDS 113297..113695 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309893.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene nrdI CDS 113692..115839 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene nrdE CDS 116019..117008 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970636.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene nrdF CDS complement(117039..117668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(117773..118456) product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013653842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(118479..119513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(119506..120303) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(120300..121301) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719558.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(121298..122146) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(122146..124065) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(124821..125327) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976217.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(125324..125812) product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976218.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(125909..126991) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968052.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(127036..127686) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170003.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 127951..129027 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968050.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 129087..130580 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968049.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 130585..131571 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968048.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 131568..132524 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968047.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS 132557..133213 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 133453..134751 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967760.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 134992..135954 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529350.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(136004..137239) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 137802..138869 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 138866..139738 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 139735..140508 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 140524..141573 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(141620..142870) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976223.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(142898..144028) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene alr CDS 144154..144618 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014332654.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(144634..145383) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 145654..147105 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 147152..148630 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(148772..150184) product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392280.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS 150766..152022 product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 152019..152672 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392298.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 152684..154048 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 154045..155328 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004110720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 155333..156322 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(156333..157343) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 157587..159788 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 159830..160930 product iron-siderophore ABC transporter substrate-binding protein YiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene yiuA CDS 160940..162019 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 162390..162581 product periplasmic nitrate reductase, NapE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene napE CDS 162592..163092 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973820.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene napF CDS 163085..163369 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973821.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 163344..165848 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973822.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 gene napA CDS 165884..166309 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973823.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 166309..167016 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(167034..167783) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975570.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(167946..168914) product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene yjfF CDS complement(168911..169936) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242089.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(169933..171453) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975871.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(171559..172521) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(173104..173787) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311027.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 173993..175027 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 175098..176090 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 176155..176655 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033042400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 176689..178227 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 178267..179205 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 179241..180941 product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976258.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(181019..182281) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389047.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(182278..182964) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389046.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(182967..183431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(183504..185258) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389044.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(185356..185982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088355.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(186108..187220) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 187341..187529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(187710..188621) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 188796..189896 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808748.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS 190036..192057 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 192219..193256 product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243787.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 193293..194351 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(194424..194918) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948542.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene rraA CDS complement(194915..195892) product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064892.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(195896..196981) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(197091..197987) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083249.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(197905..198162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(198281..199393) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538073.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 199509..200165 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966590.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(200198..201595) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965744.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(201592..202746) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036236.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene prpF CDS complement(202776..203513) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 sequence06 source 1..193673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(896..3979) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(3976..5049) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(5046..6131) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527919.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(6677..8995) product methyl-accepting chemotaxis protein McpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene mcpU CDS 9344..10297 product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969975.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 10372..10929 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(10976..12532) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969972.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(12688..12906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 13593..14990 product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(15110..15784) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402117.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 15898..16737 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(16800..16961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(17071..17640) product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844626.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 17597..17872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 18026..18772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(19542..20246) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399178.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(20243..21055) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(21126..22796) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(22808..24871) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399237.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(25190..26128) product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399193.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene nac CDS complement(26398..27606) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399197.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(27629..28372) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399206.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(28362..29135) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399209.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(29132..30118) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399212.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(30194..31066) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709905.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(31088..32281) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399216.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 32570..32713 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 33155..33388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(33843..34328) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971902.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 34504..34836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 34836..35153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 35150..35503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 35503..36381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 36378..36833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 37054..37281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 37278..39236 product transposase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 39358..40395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS 40392..40703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 40700..40993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 41006..41764 product DUF3164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 41775..42041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 42038..42244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 42241..42612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 42605..42841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 42834..43121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 43114..43398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 43395..44048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 44045..44287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 44287..44487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 44484..44882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 44994..45725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 45722..46009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 46006..46368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 46301..46582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 46582..46911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 46908..47207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 47209..47793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 47790..49127 product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 49121..50785 product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072627.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 50789..52036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(52147..52605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 52948..53871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 53890..54294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 54318..55214 product Mu-like prophage major head subunit gpT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070999.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 55335..55592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 55854..56312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 56312..56791 product phage virion morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072637.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 56788..57411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 57404..57916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 57928..58155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 58169..58567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 58570..59577 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 59574..63614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 63632..64339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 64340..65473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 65486..66241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 66243..66668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 66833..68089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 68102..68644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 68722..69222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 69350..71752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 71749..72219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 72216..72440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 72444..73457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 73457..73663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(74051..74941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(75015..75272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 tRNA complement(75583..75659) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(75791..76987) product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene mnmA CDS complement(77213..77962) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527543.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 78399..78674 product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527546.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(78740..79201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 79343..79624 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(79709..80059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329643.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 80587..81285 product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene ctrA CDS complement(81452..81814) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066826.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(81930..82583) product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393686.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 82782..83381 product DUF1134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 83519..84667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329649.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 84692..85075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(85111..85941) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066830.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(85948..86340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393682.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 86376..87401 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527565.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 87660..88565 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene rpoH CDS 88730..89278 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974264.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(89340..91559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(91662..92966) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 93188..94081 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(94300..95895) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene serA CDS complement(95971..97152) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(97330..98163) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984017.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS complement(98371..99192) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970160.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(99465..100817) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527581.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene glmM CDS complement(101100..103022) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene ftsH CDS complement(103223..104509) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene tilS CDS complement(104530..105525) product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329703.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene ybgF CDS complement(105677..106213) product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene pal CDS complement(106457..107761) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041409417.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene tolB CDS complement(108046..109158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(109168..109548) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310275.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene tolR CDS complement(109647..110363) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527594.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene tolQ CDS complement(110678..111163) product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527598.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene ybgC CDS complement(111215..112117) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970168.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(112118..113158) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243394.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene ruvB CDS complement(113199..113768) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393643.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene ruvA CDS complement(113828..114244) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(114225..114485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(114541..115053) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709296.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene ruvC CDS 115225..116220 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(116382..117128) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(117298..117792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(117808..118644) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS 118811..119347 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973282.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(119445..120269) product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(120279..120863) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 121083..121304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(121309..122295) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973872.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 122585..123547 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene tal CDS 123765..124109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(124428..124799) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066867.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(124823..125095) product DUF4164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066868.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 125452..127407 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535989.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene tkt CDS 127473..128474 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384869.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene gap CDS 128486..129049 product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970178.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 129066..130265 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393616.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(130649..130804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066876.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(130927..131166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 131080..132234 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 132231..132419 product DUF1192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018235560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS 132801..133319 product DUF1465 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066879.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(133617..133838) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970183.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene rpmE CDS 134029..135852 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 135929..136921 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526811.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(136923..137954) product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243374.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(137957..139036) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393599.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(139146..139946) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329745.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(140127..141272) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066884.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(141282..141935) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 142025..142795 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563385.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 142864..143124 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536024.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(143313..143486) product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 143705..143908 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066888.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 143925..144428 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077767952.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 gene purE CDS 144425..145483 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970190.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 145653..145778 product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497670.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene ykgO CDS 145870..146478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970192.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 146557..147564 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393578.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(147670..149046) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066892.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene pyk CDS complement(149109..149585) product DUF1036 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 149856..150671 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 150682..150987 product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970194.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 151086..151349 product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(151476..153203) product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531050.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(153445..154974) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393570.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS 155141..156988 product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066900.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 157010..158167 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 158152..158925 product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531062.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 158922..159815 product DUF3445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393562.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 159949..161400 product homospermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970200.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 161674..162045 product outer membrane lipoprotein Omp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene omp10 CDS 162251..164197 product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 164361..165425 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393586.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene hemH CDS 165523..166569 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531115.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 166572..167030 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(167193..168188) product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973310.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 168335..169831 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970203.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(169835..170722) product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066923.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene galU CDS 170941..172161 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531122.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 172312..173442 product DUF459 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(173489..174832) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(174829..175494) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(175494..175829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 175941..176204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 176256..177221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(177363..178820) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970206.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(179047..183771) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066927.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene gltB CDS 184285..185331 product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970208.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(185408..185869) product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709372.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 186318..187280 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393510.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(187338..188111) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970219.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene hisN CDS complement(188380..189264) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 189494..189817 product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene cpdR1 tRNA 189912..189986 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 190484..191968 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 192229..193260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(193323..193457) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 sequence07 source 1..190032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1666..2421) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327567.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(2667..4463) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(4647..5258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 5477..6571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(6582..7685) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392670.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(7687..8931) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 9507..10127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 10283..11257 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 11467..12897 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392675.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(13003..15324) product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241858.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 15587..16150 product DUF6101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392689.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 16316..16486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(16487..17440) product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327555.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene ubiA CDS complement(17518..18327) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 18495..18734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 19040..20317 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327551.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene purD CDS 20423..20899 product plant virulence effector HPE1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(21002..21496) product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(21510..23624) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392705.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene glyS CDS complement(23807..24286) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(24283..24618) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226526.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(24764..26707) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968865.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(26787..27335) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 27488..27733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(28119..28823) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942960.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(28852..29814) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392709.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(29906..30976) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene rfbB CDS complement(31275..31466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(31494..32369) product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991722.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(32448..33227) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379198.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(33424..33645) product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313100.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 33802..34770 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327536.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 34932..36785 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968860.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 36792..37703 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392714.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 37690..38238 product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241194.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene moaB CDS complement(38344..38874) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 39013..40203 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241196.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 40451..41119 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971095.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 41176..41511 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529706.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 41508..41867 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 41915..42538 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(42618..43103) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533637.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(43114..43761) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392730.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(43849..44076) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(44143..44895) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(44957..45352) product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379142.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(45623..46813) product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(47022..48923) product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(48937..49920) product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392739.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(50060..51241) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(51357..52100) product LuxR family transcriptional regulator NurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene nurR CDS complement(52185..52922) product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 tRNA complement(53227..53325) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 54073..54834 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992231.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 54834..55757 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241208.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 55815..56453 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 56450..57334 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 57531..58244 product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(58395..59942) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 60031..60957 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(60961..61296) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(61411..62766) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(62907..64604) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844086.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 64912..66720 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968841.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene mutL CDS 66927..67160 product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241218.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(67234..68274) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968838.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene lpxK CDS complement(68606..69340) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(69354..70667) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399514.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene waaA CDS complement(70776..71012) product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(71074..71880) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968835.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(71885..73231) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399518.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 73342..75126 product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(75332..76198) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(76241..76801) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene rsmD CDS complement(76808..78697) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563875.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 78759..79211 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537305.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(79267..79752) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(79757..80347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(80541..83432) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene ileS CDS complement(83851..84870) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252102.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(84846..85694) product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399549.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 86014..86310 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene groES CDS 86364..88004 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313163.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene groL CDS 88600..89046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971066.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(89247..92045) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399555.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(92231..93508) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153423362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(93542..94249) product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027999614.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(94325..94876) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(94878..95573) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene hisG CDS complement(95570..96703) product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(96909..98432) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene hisS CDS 98785..99105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 99167..99544 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968815.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(99615..99812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(99992..100618) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968813.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 100914..101582 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252099.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(101707..101952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 101837..102421 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(102715..104013) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971053.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene glcF CDS complement(104194..105393) product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene glcE CDS complement(105390..106826) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 106931..107827 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 107992..108483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(108576..109853) product DUF3422 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974597.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 109996..110790 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187292983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 110871..111374 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909719.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 111619..113115 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 113126..113863 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 114028..115401 product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS 115485..116330 product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401209.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(116484..116780) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706964.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 117055..118008 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527211.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 118002..118577 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(118599..119474) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527204.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(119558..119977) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527202.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(120075..120434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531701.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(120582..122078) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene guaB CDS complement(122343..123338) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401180.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(123415..123732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 123644..125053 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 repeat_region 125254..125416 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcctcctcgcggaggcgtggattgaaacc CDS complement(125539..125922) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(125922..126638) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180940261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(126635..128185) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018009496.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 tRNA 128435..128508 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(128722..129147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(129333..131216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(131434..131793) product DUF1515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456612.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(131896..132177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(132174..132560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 132775..133203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 133220..133657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(133729..134379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(134454..134693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(134578..136227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(136415..136783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 note possible pseudo, internal stop codon CDS complement(136790..137341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 note possible pseudo, internal stop codon CDS complement(137629..139416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(140194..140484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(140589..140801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS complement(140981..141388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(141385..141588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 141702..142145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 142209..142490 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 142502..142792 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531910.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 143797..143985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 144167..144436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 144462..144650 product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327642.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(144704..145252) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180939484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 145398..146735 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037403150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 146823..147182 product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(147186..148259) product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972403.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene modC CDS complement(148256..148957) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene modB CDS complement(149126..149899) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene modA CDS complement(150150..151853) product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389150.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 152240..152566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 152566..152934 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 152931..154925 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389153.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 154922..155434 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389154.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 155452..157149 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 157334..159139 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 159142..159636 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389156.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 159671..160504 product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389159.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 160504..161592 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389160.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 161715..162425 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529183.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(162844..162990) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077068125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 163389..163958 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(163962..165362) product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969287.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene chrA CDS 165496..165837 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 165852..166325 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 166322..166741 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969810.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(166744..167208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 167316..168320 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525362.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 168417..169019 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612593.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 169190..171751 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(172175..173374) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086627.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(173466..174119) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969819.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(174185..175186) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 175609..176025 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971227.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(176032..176589) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(176586..178877) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 178983..179288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 179412..180512 product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973611.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene nspC CDS 180549..181787 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(181975..183588) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene araB CDS 183475..183705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(184033..185796) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528963.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(186055..187509) product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(187509..188738) product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972122.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 misc_feature complement(188847..>190032) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184144746.1:electron transfer flavoprotein-ubiquinone oxidoreductase locus_tag LOCUS_17860 sequence08 source 1..186725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..989 product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene ybaK CDS 1058..2311 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968487.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 2308..3096 product pyrroline-5-carboxylate reductase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384670.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(3047..3961) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 4045..4527 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(4587..5177) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067696.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(5185..6771) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067695.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene xseA CDS complement(6853..8610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 8796..9785 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 9803..10510 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 10507..10872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS complement(10875..11648) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067694.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 11776..12186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 12340..13365 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398799.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 13519..14424 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929952.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 14498..15163 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330705.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(15191..16015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528661.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 16237..17220 product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968471.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(17481..19907) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968474.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene pheT CDS complement(19930..21015) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435478.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene pheS CDS complement(21008..21871) product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970767.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(21972..22376) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene rplT CDS complement(22416..22619) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene rpmI CDS complement(22837..23508) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909774.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene infC CDS 23606..24424 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970765.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 24632..25150 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310099.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(25225..25761) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398796.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(25776..26360) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047143.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 26495..27745 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241670.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 27807..29639 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173515202.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene lepA CDS complement(30485..31201) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 31245..32675 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530751.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(32689..33453) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310073.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(33542..33718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(33815..34243) product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968602.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(34244..35473) product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 35762..36787 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531511.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 37048..38157 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309889.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 38157..38936 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 38933..39556 product nucleoside triphosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970633.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 39679..40719 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970870.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene pyrC CDS complement(40778..41539) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 41707..42126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(42117..42566) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 42745..43047 product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067663.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(43088..43429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 43592..45022 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049733735.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 tRNA 45159..45243 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 45355..46158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 46195..48435 product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388583.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 48495..49163 product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384678.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene cas5c CDS 49160..50929 product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384679.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene cas8c CDS 50926..51876 product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene cas7c CDS complement(52180..53217) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973989.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(53229..53498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(53593..53778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS 54086..54991 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(55001..55480) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165023455.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(55519..55962) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970037.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(56126..57277) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 57401..58372 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(58412..58777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 58779..59924 product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 60014..61369 product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967123.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene gdhA CDS complement(61387..61911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(62073..62498) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067665.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene rnk CDS complement(62495..62860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 62859..63494 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921398.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 63466..63813 product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188847581.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 63933..65099 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844963.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene metB CDS 65157..65870 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(65834..67111) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531179.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(67108..67797) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(67995..69026) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114965.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 69183..69884 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114953.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(69994..72030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 72186..72911 product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(72894..73319) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530166.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 73459..74034 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968400.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(74024..74779) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene nth CDS 74855..75355 product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398290.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 75479..76351 product bifunctional helix-turn-helix domain-containing protein/methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(76536..77171) product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531941.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(77254..78072) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398299.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene dapB CDS complement(78152..79948) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(80069..81094) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(81145..81525) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(81782..82837) product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968392.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene mepA CDS 83035..84885 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531957.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 85038..86117 product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 86117..87256 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241780.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 87253..88887 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 88958..89917 product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067564.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(89955..90821) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(90857..91207) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014766585.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(91276..92667) product M17 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067561.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 92881..93618 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(93753..94736) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(94748..95758) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968385.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(95768..97240) product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398328.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(97277..98566) product CpaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398331.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(98623..99291) product CpaD family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241792.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(99351..100898) product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968381.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(100912..101718) product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968380.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene cpaB CDS complement(101909..102412) product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(102533..102712) product Flp family type IVb pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209602232.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 103035..103448 product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536154.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 103573..104175 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398349.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 104175..104786 product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255094.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 104885..106114 product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968375.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 106111..107079 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067546.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 107185..107814 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene upp CDS 108081..108617 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(108607..109920) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene deoA CDS complement(109922..110695) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309955.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene deoC CDS complement(110688..111500) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(111497..111889) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970669.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(111892..112863) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255101.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(112869..114002) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968370.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(113999..115534) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067539.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 115690..115920 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970665.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(116027..117019) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(117237..117887) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968425.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene msrA CDS complement(117970..118290) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067620.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 tRNA 118525..118614 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(118730..120412) product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975159.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(120617..121867) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975157.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(121875..122597) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975156.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(122590..123240) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(123253..123918) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975155.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(123984..124793) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969502.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(124972..126489) product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975153.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 126639..127676 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969504.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(127955..128917) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974065.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(129040..129744) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(129974..131035) product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968467.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(131032..132087) product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330707.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene epmA CDS 132249..132818 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene efp CDS 133097..134089 product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(134082..134621) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529993.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 134541..134771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 134802..135806 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311306.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(135988..136761) product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255075.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(136758..137882) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234781892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene recF CDS 138274..138948 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(139130..140260) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene dnaJ CDS complement(140502..142418) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241760.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene dnaK CDS 143218..143586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 143936..144112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(144122..146239) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241759.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(146545..146973) product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(147075..148022) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 147970..148158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(148219..149610) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968407.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(149728..150168) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 150602..153589 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398238.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene polA CDS complement(153764..155569) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 155885..156886 product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035286.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(156987..157175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 157329..157910 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313743.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 158219..158878 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331493.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(159020..160006) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 160267..161217 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 161221..161664 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970772.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(161686..162576) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970771.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 162729..163727 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970770.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(163916..165184) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969938.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(165432..166316) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(166360..167139) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene hyi CDS complement(167159..168943) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969935.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene gcl CDS 169209..170030 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(170214..171554) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242239.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene guaD CDS complement(171551..172792) product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 172934..173899 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061554.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS 173925..174191 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370228.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 174191..174619 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(174626..175471) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene xdhC CDS complement(175520..177886) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528240.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene xdhB CDS complement(177890..179374) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528241.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene xdhA CDS complement(179378..179743) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene uraH CDS 179906..181324 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975644.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene puuE CDS 181335..182351 product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975643.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene alc CDS 182405..182833 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392232.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 182931..183542 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 183568..184323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(184381..185673) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(186066..186524) product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532225.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 sequence09 source 1..185536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 345..1760 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 1772..2560 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2959..4251 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 4302..5174 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 5388..5564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527344.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 5623..5766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 6139..7419 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(7423..8361) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327735.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 8686..11334 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene pepN CDS 11729..14017 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391264.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(14312..17263) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391265.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(17315..18739) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391266.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(18744..19412) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974840.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(19542..21116) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844141.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(21321..21773) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(21770..23755) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391272.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(23752..24201) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527358.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene ccmE CDS complement(24198..25334) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327725.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene ccmI CDS complement(25491..25910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(26191..27609) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(27599..28270) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311298.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(28319..28570) product two-component system FeuPQ modulator FeuN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527365.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene feuN CDS complement(28663..28872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(28888..32721) product glycoside hydrolase TIM-barrel-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971295.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(32725..33273) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(33341..34231) product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(34228..34869) product TIGR02217 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971292.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(35264..35797) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972646.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(35801..35944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(36001..36363) product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719629.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(36363..36770) product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(36797..37204) product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971288.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(37201..37539) product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(37539..38108) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS complement(38305..39549) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971286.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(39622..40179) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971285.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(40328..40636) product DUF6107 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971284.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(41019..42155) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971283.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(42371..42979) product chitinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(42981..44183) product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235776816.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS complement(44485..45027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 45308..45622 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974830.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(45630..46115) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968986.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 46293..48476 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS 48506..49099 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974827.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS 49092..49643 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974826.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(49765..49953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 50559..51536 product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391296.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(51772..53424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(53623..54054) product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971254.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(54239..55690) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389429.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(55813..56526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(56498..58039) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391278.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 58552..58977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 59131..59550 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971252.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(59891..60688) product DUF6456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971251.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(60681..61040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(61355..61789) product exopolysaccharide biosynthesis transcriptional regulator MucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527383.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene mucR CDS complement(62201..62557) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527385.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene mnhG CDS complement(62557..62922) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327703.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(62922..63395) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(63397..64938) product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(64956..65333) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391284.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(65333..65752) product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974810.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(65988..68312) product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(68426..68842) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(68846..69079) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 69219..69626 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968974.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene msrB CDS complement(69661..70164) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316616.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 70395..70895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974808.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(70946..71605) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974807.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(71727..72050) product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 72262..73224 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327693.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(73852..74262) product DUF930 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 74428..75555 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971240.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 75689..75997 product sulfite-sensing transcriptional repressor BigR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973063.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene bigR CDS 75994..76404 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 76401..76835 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 76904..78997 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(79038..79397) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311244.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(79397..79660) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971270.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(79731..81803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(81941..82420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 82577..84088 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968967.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 84542..86875 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974797.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS 87362..89038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 89107..89556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 89779..90279 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537587.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 90304..90888 product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(91102..92010) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(92129..92572) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974792.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(92697..93332) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327682.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 93454..94152 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(94161..94529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(94530..94811) product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(94909..95511) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 95720..96112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(96121..97014) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973719.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 97155..98348 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974993.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 98471..99304 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971210.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 99422..100309 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 100343..101536 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166648346.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(101795..102184) product DUF2780 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327670.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 102183..102347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 102417..103994 product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241846.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 104453..105973 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(106217..106960) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(106926..107303) product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531903.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(107374..107766) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730705.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(107778..108068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(108183..108359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(108512..108934) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 109048..109539 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 109636..111555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 111558..111935 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 112365..113600 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 113686..115071 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530218.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 115563..116714 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969099.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene rnd CDS complement(116715..117122) product DUF2000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046118341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 117109..118011 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206696091.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 118068..119477 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982140.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(119690..120274) product DUF922 domain-containing Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(120283..121758) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene ppx CDS complement(121815..124031) product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156528573.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS complement(124504..125190) product DnaA regulatory inactivator HdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327870.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene hdaA CDS complement(125271..126389) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969095.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 126831..127904 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene purM CDS 127901..128566 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene purN CDS complement(128833..129585) product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033043067.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 129857..130816 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339057.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 130905..131192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(131189..132814) product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(133073..134083) product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(134336..134782) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509099.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(134846..137089) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS 137379..138746 product TIGR03808 family TAT-translocated repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532675.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(138849..139349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(139376..140764) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383117.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(140828..141211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 141466..142125 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968950.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(142085..143026) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974774.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 143130..143324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 143383..143745 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391352.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(143968..144363) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976191.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(144469..144834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026986.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 144936..145691 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226563.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(145692..145994) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(145987..146271) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(146309..147322) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 147400..148134 product DUF3750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391328.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(148234..149100) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090536.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(149104..149376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 149263..149667 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090535.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 150045..151481 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050298733.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 151598..152572 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(152652..153653) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391329.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 154016..154273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(154313..156130) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(156253..156690) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972923.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(156687..157076) product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253076.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene crcB CDS complement(157301..157849) product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391330.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 158001..158654 product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968943.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene betI CDS 158695..160224 product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968942.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene betC CDS 160226..161689 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene betB CDS complement(161700..162062) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(162066..162302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS 162363..164015 product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971180.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene betA CDS 164080..164358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(164351..164821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968939.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(164832..165215) product DUF6152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536268.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(165361..166281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 166524..167273 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974761.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 167320..168273 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974760.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene cysD CDS 168275..169765 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241104.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene cysN CDS complement(170155..171471) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338571.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(171484..173214) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338570.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(173428..173931) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 tRNA 174087..174163 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(174672..176105) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384711.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(176161..176997) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704638.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(177043..177951) product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206888.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(178073..179308) product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114387.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 179394..179879 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705238.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(179893..180582) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 180924..182759 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971035.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 182966..183703 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090610.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 183835..184578 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524570.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(184606..185310) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310912.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 sequence10 source 1..183148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(613..1485) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 1756..2616 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2613..3971 product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227202.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 3964..4266 product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 4624..5577 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384590.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 5608..6081 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537806.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 6083..7600 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 7683..8762 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 8762..9547 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 9544..10920 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 10929..11336 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253940.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(11618..12697) product threonine aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967204.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(12774..14183) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 14303..15835 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244072.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 15850..16152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 16152..18170 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 18226..20364 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392131.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene scpA CDS 20372..20773 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328000.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene mce CDS complement(20787..21773) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024324409.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 22106..23224 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394374.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(23394..24251) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969978.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 24344..25675 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 25689..26147 product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS 26144..27136 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969975.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene meaB CDS 27133..28833 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210246.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 28842..29591 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969973.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 29594..31225 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS 31460..33322 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536736.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 33348..34670 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536733.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 34683..36224 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328096.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(36478..38853) product succinoglycan biosynthesis transport protein ExoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975922.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene exoP CDS complement(38932..39837) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975921.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(39842..40873) product succinoglycan biosynthesis glycosyltransferase ExoO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975920.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene exoO CDS complement(40870..41796) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393323.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(41793..42791) product succinoglycan biosynthesis glycosyltransferase ExoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434899.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 gene exoA CDS complement(42781..43980) product succinoglycan biosynthesis glycosyltransferase ExoL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975918.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 gene exoL CDS complement(43995..44780) product endo-1,3-1,4-beta-glycanase ExoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975917.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 gene exoK CDS complement(44786..45952) product succinoglycan biosynthesis protein ExoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975916.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 gene exoH CDS complement(46282..47754) product succinoglycan biosynthesis transport protein ExoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975911.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene exoT CDS 47877..48836 product succinoglycan biosynthesis glycosyltransferase ExoW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene exoW CDS 48900..49862 product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061859.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(49887..50882) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393305.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(50983..51309) product exopolysaccharide production repressor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(51895..52116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 52091..52666 product exopolysaccharide production protein ExoY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393302.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 gene exoY CDS 52723..53994 product exopolysaccharide production protein ExoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975906.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene exoF CDS 54002..55279 product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975905.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 55276..56307 product exopolysaccharide production protein ExoZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850573.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene exoZ CDS complement(56631..58748) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974154.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(58745..59482) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 59719..60741 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974156.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 60861..61889 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974157.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 61962..64175 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 64172..65233 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974159.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 65349..66149 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS 66372..68198 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 68198..69319 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975068.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 69392..70498 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 70592..71437 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975064.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 71434..72075 product dual specificity protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969589.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 72072..73661 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(73758..74774) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975244.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 74996..75829 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209695.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS 75826..77679 product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 77690..78739 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(78759..80180) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729346.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(80203..80571) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 80720..81325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(81401..82996) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974721.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene ctaD CDS 83153..84007 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082145856.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 84186..85796 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257436.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS 86064..87053 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972850.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 87050..88882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS 88879..89676 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972853.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS 89666..90763 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972854.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS 91372..91986 product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530455.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 91983..93194 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160926.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS 93508..94734 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 94751..97201 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243547.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene nirB CDS 97213..97542 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396314.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene nirD CDS 97892..100543 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982243.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(100600..101388) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037897225.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(101385..102338) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(102325..103164) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(103161..104183) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385674.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(104571..106136) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(106170..107291) product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(107288..108832) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(108836..109351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(109585..110631) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS 110919..112253 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 112675..113622 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS 113619..114560 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 114557..114745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086351.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 114750..115847 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 115840..116835 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615005.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 116849..118468 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528083.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(118791..121973) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972354.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS complement(122293..123483) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312103.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(123530..124351) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972353.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 124493..125431 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527624.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(125808..127133) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392424.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 127430..128524 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene cyoA CDS 128570..130612 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392422.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene cyoB CDS 130617..131240 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976136.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene cyoC CDS 131237..131635 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242014.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene cyoD CDS complement(131578..131826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 131873..132592 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392415.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(132596..133192) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090341.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 133298..133975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 133997..134275 product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 134451..137849 product acyl-[ACP]--phospholipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085112.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(138039..139046) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(139043..140146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(140130..141332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(141329..142201) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(142198..143142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(143470..145095) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969597.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(145101..145586) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310724.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(145595..146938) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061522.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 147105..148202 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975616.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 148199..148933 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061519.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(149572..149991) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531302.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(150039..152750) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310719.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(152821..153972) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(153969..155429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(155446..156648) product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531308.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(156722..157897) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061528.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS complement(157894..158892) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241956.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(159119..161023) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972420.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS complement(161020..162930) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972419.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 163178..164140 product glycosyltransferase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 164566..165909 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 165906..166919 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327780.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 167190..167825 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973031.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(167878..169158) product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857525.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(169158..169499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(169625..170587) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312440.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(170633..171463) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(171460..171969) product acetone carboxylase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975282.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(171973..174165) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(174181..176310) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170065.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS 176423..177202 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975279.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(177521..177766) product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 178272..179525 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253454.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene repA CDS 179522..180589 product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene repB CDS 180851..182074 product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene repC CDS complement(182144..182392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 sequence11 source 1..178303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(462..1178) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531512.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(1210..1983) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531511.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(1970..2515) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(2570..3007) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(3012..3842) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(3857..4543) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083887.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(4540..5289) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(5282..6256) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040564.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(6259..7179) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(7249..8385) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815015.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(8604..8849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(8949..9662) product TfuA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975567.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(9659..10867) product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(10864..11124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969830.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(11154..12965) product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396844.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(12972..13415) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396295.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(13551..14312) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242414.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(14309..14989) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136505321.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(15096..15869) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067343.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 16150..17745 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975714.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 17808..18731 product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529067.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene oppB CDS 18724..19854 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391736.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 19856..21472 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 21500..22642 product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224648.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene yvcK CDS complement(22620..25295) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984024.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS 25501..26409 product phenylacetic acid degradation operon negative regulatory protein PaaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene paaX CDS 26578..27783 product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522007.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene pcaF CDS 27807..28811 product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329399.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene paaA CDS 28825..29109 product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069460051.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene paaB CDS 29109..29891 product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene paaC CDS 29901..30425 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451216.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene paaJ CDS 30446..31522 product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329395.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene paaK CDS 31534..32289 product phenylacetate-CoA oxygenase subunit PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399747.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 32333..34390 product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399720.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene paaZ CDS 34398..34910 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528002.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(35025..35621) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329392.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(35815..37125) product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene paaF CDS complement(37167..37607) product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577719.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene paaI CDS complement(37604..38392) product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene paaG CDS 38495..40156 product phenylacetic acid degradation protein PaaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene paaN CDS 40204..41355 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 41426..42298 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 42295..43257 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 43254..44039 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816696.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 44026..44727 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810743.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 44732..46792 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399723.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 46941..47867 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920257.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 47969..49390 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 49419..51398 product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene tynA CDS complement(51604..52977) product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982254.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(52974..53444) product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512341.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 53735..54679 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061567.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 54734..55894 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061568.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 55891..56829 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975668.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 56826..57569 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532238.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(57566..57886) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398599.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(57895..59550) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970552.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(59713..60492) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(60489..61997) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(62006..63121) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242400.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS complement(63126..64007) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535874.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(64004..64885) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067374.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(65051..66301) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 66608..67660 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398617.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(67708..69213) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(69213..69992) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251864.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(69985..71598) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(71604..72605) product 1,5-anhydro-D-fructose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535887.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(72602..73648) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535888.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS 74022..75194 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 CDS 75280..75975 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528805.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene ung CDS 76008..76982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775834.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS complement(77007..77957) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255265.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(78015..79250) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394078.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(79373..80227) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(80224..81096) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970362.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(81093..81962) product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992451.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(81959..82861) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688119.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 83074..83736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(83940..85433) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509030.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 gene lysS CDS complement(85447..86916) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970278.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene gltX CDS complement(87092..88864) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328762.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(89162..89911) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(90057..90716) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394092.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 90860..92062 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435151.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 92089..93678 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394130.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS 93749..94861 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS 94945..95994 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970275.1 transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 96005..97459 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene xylB CDS 97487..98797 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394143.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 gene xylA CDS 99146..100654 product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971342.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(100689..101720) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976232.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 101941..103467 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976233.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 103502..104524 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969889.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 104618..105571 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173518343.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 105860..106912 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509042.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 107090..108274 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970271.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(108317..109222) product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 109438..110811 product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329855.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 110899..113094 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(113095..114048) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153436966.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(114083..114619) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970265.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 114723..115361 product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 115497..116189 product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 116286..116975 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066992.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 116972..117184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389420.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(117195..118193) product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(118187..118828) product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394164.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(118916..119821) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 120367..121515 product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene odc2 CDS 121608..122198 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970258.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 122414..123085 product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 123287..124225 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850559.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 124495..124941 product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389404.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(125019..126185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 126435..126719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(126797..127531) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(127726..128715) product WD40 repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970256.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(128774..129904) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(130040..130831) product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970254.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 130937..131464 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066980.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 131523..132551 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970253.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 132580..133569 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066978.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 133631..134038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(134043..134822) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970251.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 135277..137586 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329826.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 137768..138541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329825.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 138770..138994 product aa3-type cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528928.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 139081..140235 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209603474.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 140235..140645 product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 140656..142053 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528935.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(142124..143023) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844854.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(143336..143563) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313768.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene rpsU CDS 143894..145147 product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003522141.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 145147..145545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 145560..145904 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970243.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 145901..148894 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329816.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 148887..149435 product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329815.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(149596..150111) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970238.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(150145..152112) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394194.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 gene glgX CDS complement(152120..153751) product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394196.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(153765..155213) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040961719.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 gene glgA CDS complement(155222..156484) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533906.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 gene glgC CDS complement(156507..158720) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533907.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene glgB CDS complement(158720..161179) product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394244.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(161383..162594) product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066953.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(162736..163623) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(163646..166042) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(166064..169381) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243330.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(169511..170284) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970229.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(170329..171063) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(171145..171606) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394231.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 171693..172097 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066939.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(172141..173976) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene ilvD CDS 174168..175217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 175228..175578 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(175582..177111) product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 177277..178023 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 sequence12 source 1..509885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..574 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869596.1:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_24650 CDS complement(877..1938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(2115..2354) product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315820.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(2357..3019) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532408.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene betI CDS 3124..4074 product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532407.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 gene choX CDS 4098..5093 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 gene adhP CDS 5329..6309 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162273436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(6299..8692) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(8689..9447) product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242998.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS complement(9444..9929) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242999.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(9922..10809) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243136.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 11023..11817 product carbon monoxide dehydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243000.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(11877..12848) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243001.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS complement(12851..13738) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243002.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(13774..14481) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552530.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(14474..15232) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243003.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 15501..16709 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243004.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 16767..17534 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243005.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 17612..18367 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707183.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 18390..19916 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243007.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 19941..21101 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243008.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 21101..21538 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243009.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(21663..22391) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089402.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(22385..23455) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095090.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(23474..24199) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315912.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(24211..24981) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086009.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(24995..26056) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene ugpC CDS complement(26066..27109) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975043.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(27142..27378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(27382..28218) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404217.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(28218..29099) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(29207..30640) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066912.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(30872..31828) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432420.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 32325..33209 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530264.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 33255..34481 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530260.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(34597..35445) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(35451..36389) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532947.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(36477..37724) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 38053..39087 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532955.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS complement(39068..40048) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827543.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(40045..41193) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 41463..42275 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(42287..43048) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532952.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS 43261..44061 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532951.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 44065..44994 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532950.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 45319..46458 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532949.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 46545..47582 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529657.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS 47582..48421 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529656.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS 48418..49227 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970485.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS 49231..49929 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 49944..50924 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 51314..52489 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene tuf CDS 52941..53552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 tRNA 53686..53761 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 53956..54156 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707741.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene secE CDS 54173..54703 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707742.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 gene nusG CDS 54903..55334 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316435.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 gene rplK CDS 55339..56031 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 gene rplA CDS 56382..56900 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507705.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene rplJ CDS 56961..57338 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316437.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 gene rplL CDS 57592..61731 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene rpoB CDS 61886..66097 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene rpoC CDS 66254..67303 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719549.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS complement(67319..67615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975168.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 68159..68530 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507760.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene rpsL CDS 68586..69056 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507761.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene rpsG CDS 69089..71188 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707752.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene fusA CDS 71253..72428 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene tuf CDS 72618..72926 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507767.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene rpsJ CDS 73118..73768 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene rplC CDS 73781..74401 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536623.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene rplD CDS 74398..74691 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536621.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 74722..75558 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707757.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene rplB CDS 75574..75852 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507772.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene rpsS CDS 75855..76244 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707758.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene rplV CDS 76244..76972 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536533.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene rpsC CDS 77011..77424 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975175.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene rplP CDS 77437..77637 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536529.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 gene rpmC CDS 77650..77886 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240643.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene rpsQ CDS 78223..78591 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707761.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene rplN CDS 78598..78915 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536524.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene rplX CDS 78908..79465 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975179.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene rplE CDS 79502..79807 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707764.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 gene rpsN CDS 79820..80218 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707765.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene rpsH CDS 80261..80794 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975182.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 gene rplF CDS 80807..81169 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313980.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene rplR CDS 81297..81863 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536510.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene rpsE CDS 81877..82080 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene rpmD CDS 82092..82571 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328073.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 gene rplO CDS 82887..84227 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536503.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene secY CDS 84224..84808 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328075.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 85088..85456 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 gene rpsM CDS 85697..86086 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene rpsK CDS 86190..87200 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707773.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 87246..87671 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707774.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 gene rplQ CDS 87833..89029 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992359.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(89184..89840) product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252723.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 gene msrQ CDS complement(89840..90781) product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401748.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 gene msrP CDS 90985..92388 product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969200.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 92385..93692 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969201.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(93708..94025) product DUF1883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252719.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 94291..95235 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532089.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(95346..95522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(95622..96260) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392204.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(96311..96481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(96546..97556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 98018..98248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(98293..98958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138787218.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS complement(99214..103032) product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971830.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(103658..104239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549603.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(104419..104916) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene gpt CDS complement(105039..105881) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(105947..106702) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969361.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 106874..107473 product NAD(P)H:quinone oxidoreductase type IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene wrbA tRNA 107701..107785 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 108055..108858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(108931..109938) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(109938..110582) product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330544.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(110698..111276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975531.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(111357..112811) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975530.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 113072..114319 product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 gene ilvA CDS 114434..114748 product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312784.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 114902..116149 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS complement(116187..116648) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975527.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 116813..117931 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328358.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 gene ald CDS complement(117980..118447) product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531464.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(118519..119553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(119753..120313) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531463.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(120413..121003) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969353.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(121003..121857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 note possible pseudo, frameshifted CDS complement(121975..122712) product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971477.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS complement(122718..123758) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328363.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(123884..125137) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531472.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS 125379..125588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 125666..125857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527526.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 tRNA complement(125942..126016) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 126202..126465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969346.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 126535..127011 product DUF2938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS complement(127220..127498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971825.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 127401..127940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(127883..128212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 128545..129039 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(129122..129376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 130136..130378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 tRNA complement(130590..130663) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(130851..131288) product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 gene exbD CDS complement(131293..132384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 132692..133345 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969269.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 133604..135004 product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975319.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 gene tolC CDS 135294..136064 product PopZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393435.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 136204..139131 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314374.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 139489..140742 product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975322.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(140804..141223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 141147..141911 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244692.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(142062..142859) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975324.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 gene xth CDS complement(142889..143221) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393432.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 gene erpA CDS 143440..144660 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534550.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 144728..146488 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328219.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 gene argS CDS 146552..150031 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435262.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 150157..151176 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969277.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene nagZ CDS 151236..152099 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129796.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 152092..152805 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 gene scpB CDS 152970..154073 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328224.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 154116..154313 product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975334.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 154460..155086 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975335.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 gene tatB CDS 155083..155919 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534569.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 gene tatC CDS 155989..157272 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 gene serS CDS 157292..158062 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971810.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 gene surE CDS 158074..158715 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 158974..159600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS 159751..161331 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393411.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(162042..162911) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393410.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 163095..163430 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534584.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 gene yajC CDS 163519..166026 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971714.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene secDF CDS 166019..166405 product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393388.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 166456..167268 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529514.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 167568..168020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328238.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(168224..169633) product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328241.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 gene trmFO CDS complement(169777..169920) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515516.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(170263..170406) product DUF1127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529522.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 171507..172610 product DUF2157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 172613..173203 product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 tRNA 173328..173412 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 173592..175070 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328265.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 gene tig CDS complement(176022..176825) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970034.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(176916..178322) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393365.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 gene sthA CDS complement(178504..179334) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969427.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene radC CDS complement(179343..180170) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537051.1 transl_table 11 codon_start 1 locus_tag LOCUS_26470 gene map CDS complement(180201..180920) product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316347.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 gene sfsA CDS complement(180933..182789) product poly(3-hydroxyalkanoate) polymerase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 gene phaC CDS 182915..183259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 183434..184654 product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515379.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 184713..186035 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393361.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 186237..188045 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975607.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene recJ tRNA complement(188078..188152) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(188254..188739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(188736..189026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972670.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 tRNA complement(189194..189268) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(189285..189584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 tRNA complement(189765..189839) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(189976..191322) product YcbK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(191652..192092) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037384441.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 192288..192866 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328282.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 192866..193363 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969419.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 tRNA 193455..193531 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 193661..193966 product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393354.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 tRNA 193991..194067 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(194157..195026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(195290..196066) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(196086..197240) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969245.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(197242..198450) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS complement(198549..199577) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975279.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 199933..201123 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312602.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(201317..202477) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(202500..202748) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535025.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 202915..203700 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 203791..204624 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393467.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene cysE CDS 204719..204922 product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535016.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 205341..205694 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244664.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 206000..206329 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975286.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene clpS CDS 206339..208849 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975287.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene clpA CDS 209088..209822 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393451.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 209819..210163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(210340..210765) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535003.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(210783..211976) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328189.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS complement(211978..212703) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328190.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(212703..213167) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 213347..214174 product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534995.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 214518..215279 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312546.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 gene rpsB CDS 215524..216450 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534991.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 gene tsf CDS 216658..217380 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534989.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 gene pyrH CDS 217438..217998 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244675.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 gene frr CDS 218041..218787 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328197.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 218787..219620 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969257.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 219646..220779 product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534980.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 gene rseP CDS 221077..223350 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969258.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene bamA CDS 223400..224467 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969259.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 gene lpxD CDS 224460..224927 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969260.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene fabZ CDS 224930..225739 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244681.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene lpxA CDS 225745..226623 product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969262.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS 226620..227798 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393442.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene lpxB CDS complement(227828..229117) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328205.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene gltA CDS complement(229359..229640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 229566..231881 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129945.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(231872..232591) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene lexA CDS complement(232690..233913) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328326.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(233913..234410) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969379.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene moaC CDS complement(234424..235239) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314425.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 gene trpC CDS complement(235248..236270) product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328329.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene trpD CDS complement(236286..238175) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969377.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 238457..240106 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328331.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 240252..241625 product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533259.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene glmU CDS 241740..243566 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969375.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene glmS CDS 243563..244060 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707040.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 244096..244788 product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392752.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(245112..245327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018010623.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(245427..247520) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969373.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 gene recG CDS 247531..247950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 247947..251453 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969372.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 gene mfd CDS 251520..252152 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532149.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS complement(252159..252830) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240310.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(253027..254838) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969364.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 255114..255740 product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528049.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(255815..256147) product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene hspQ CDS 256300..257343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 257412..258443 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339192.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(258681..260090) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328343.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 gene glnA CDS complement(260151..260489) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975544.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 260856..262340 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 262416..263147 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967295.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS complement(263197..264000) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(264038..264661) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084232.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(264666..267584) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975397.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene uvrA CDS 267876..268379 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 268460..268867 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163086.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS complement(269195..269824) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969300.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 270136..272847 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436050.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 gene gyrA CDS complement(273069..273215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(273229..273354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 273604..274098 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383413.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene coaD CDS 274132..274701 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328446.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 274784..275299 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529604.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 275380..275829 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531824.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 275838..276905 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975428.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene queA CDS 276902..278032 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328449.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene tgt CDS complement(278057..278473) product DUF4864 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909625.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(278687..279208) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327899.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS 279600..280556 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS complement(280544..281371) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396450.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(281374..282153) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS complement(282154..283704) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975450.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene metG CDS complement(283782..284813) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969338.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS complement(284810..285493) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969339.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene tmk CDS complement(285602..286765) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328465.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS complement(286843..287859) product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396470.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(288062..288277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 288531..289292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401782.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS 289503..290876 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244600.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 291042..291314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969213.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 291376..292392 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068883688.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(292379..293413) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215921.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 note possible pseudo, frameshifted CDS complement(293497..293934) product DUF1489 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328107.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(294011..295342) product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328106.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 295988..296677 product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844304.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 296783..297790 product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244595.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 297795..298268 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969210.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(298276..298662) product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515319.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(298780..300210) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 gene mgtE CDS 300514..301008 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328099.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 301110..301358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 tRNA complement(301451..301535) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 301730..302476 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 gene lipB CDS complement(302449..303693) product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(303785..304735) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992293.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 304879..305283 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536742.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 305366..306493 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384665.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 306490..306954 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 306994..307455 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975200.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 307452..308108 product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328088.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS 308129..308962 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969204.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene fghA CDS 309119..309433 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240659.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 gene sugE CDS complement(309445..309828) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(309931..310581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(310655..311440) product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(311433..312098) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537405.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(312098..313090) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975196.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(313162..313398) product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313966.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 313613..313894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 314308..315447 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129718.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene gcvT CDS 315621..315983 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971640.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene gcvH CDS 315983..318853 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969293.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene gcvP CDS complement(319020..319427) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889309.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(319411..321276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(321496..321888) product Fe-S cluster assembly scaffold SufA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253204.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene sufA CDS complement(322174..322554) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018239791.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(322567..323805) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393009.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(323872..325146) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 gene sufD CDS complement(325171..325926) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531483.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene sufC CDS complement(325975..326136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(326251..327720) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene sufB CDS complement(327859..329028) product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253209.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 329243..329920 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531477.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(329995..331173) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393001.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(331264..332397) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037435942.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 332528..333781 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240393.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 gene tyrS CDS complement(333931..337323) product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 337473..337940 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971896.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 gene bcp CDS 337963..338790 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650909.1 transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 338885..340165 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392990.1 transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 340359..341858 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 341867..342277 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(342278..344392) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396106.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(344501..344818) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383518.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(344822..346432) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392955.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS complement(346429..347127) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532111.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(347127..347453) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975638.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(347464..348705) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392949.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(348709..349635) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969441.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(349663..350157) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392944.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 350333..351397 product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253217.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS 351397..352398 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392939.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS 352467..353144 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 gene rpe CDS 353141..353875 product DUF2259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392934.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 353878..354408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969446.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 354473..355780 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971906.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene purB CDS complement(355726..355884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 355883..356119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(356216..357019) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383546.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS 357189..357749 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240413.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 357835..360423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(360489..360809) product ATPase inhibitor subunit zeta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531408.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 361025..361789 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 361818..362060 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531405.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene purS CDS 362080..362337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 362334..363005 product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396502.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene purQ CDS 363029..363445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314093.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS complement(363455..363670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 363766..365184 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396508.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS complement(365128..365400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 365288..367525 product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251802.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene purL CDS 367544..367777 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531391.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 367785..368048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173516618.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 368091..368507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 368624..368959 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708163.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene grxD CDS 369048..370295 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971915.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(370551..371372) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975664.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(371359..372240) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240432.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene ttcA CDS complement(372272..373201) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328488.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS complement(373441..374058) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533017.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene rpsD CDS complement(374278..375789) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969467.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(375910..376722) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975669.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 gene murI CDS complement(376709..377542) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240436.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(377612..378193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992313.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS 378409..379623 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037385982.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 379735..380370 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314066.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(380399..381268) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396530.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 381453..383126 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969476.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(383195..384388) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971503.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS complement(384760..387420) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240440.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 gene alaS CDS complement(387734..388783) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708181.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene recA CDS 389061..390008 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396535.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 390016..390969 product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969480.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 tRNA 390907..391005 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(391285..392559) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975249.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene eno CDS complement(392690..393529) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 gene kdsA CDS complement(393531..394496) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328141.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 394727..395812 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973590.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 395912..396652 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088429.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 396652..398073 product bifunctional serine/threonine-protein kinase/universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088428.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(398293..399246) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537828.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 399348..399893 product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066818.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 400278..401429 product ceramide glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533639.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS complement(401437..402027) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782279.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS 402147..403370 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401429.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(403650..405287) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975246.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(405426..405908) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975245.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 gene secG CDS complement(406174..406944) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400467.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 gene tpiA CDS 407095..408681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 408707..409303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS complement(409397..410281) product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018011123.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 410560..412617 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534725.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene parE CDS 412771..413196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400454.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(413338..414396) product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328130.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 414595..415239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(415278..415901) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971839.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(415891..416475) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328127.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 416577..417569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534713.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(417650..418498) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531975.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(418626..420596) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534711.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 gene thrS CDS complement(420834..422531) product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(422813..423730) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090207.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 gene prmB CDS 423929..424756 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395831.1 transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 424877..425461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(425464..425991) product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314347.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS complement(425988..426407) product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534706.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(426412..426777) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534704.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene yidD CDS complement(426784..427230) product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328120.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 427625..428236 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026613810.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene folE CDS 428313..428765 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534698.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 gene hisI CDS 428876..429133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 429193..430089 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328117.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(430170..430598) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975223.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(430785..431525) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534691.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 431818..432453 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577809.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 432599..433210 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534682.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 433696..434295 product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328111.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(434437..435411) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984186.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 435700..436140 product BA14K family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975918.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(436300..437223) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972680.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(437220..437561) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257518.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(437699..440830) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189169828.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(440995..441762) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920133.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS 442113..442316 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216621.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(442328..442708) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336897.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS complement(442711..443688) product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(443761..443973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(444048..444242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(444308..445273) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061685.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 445563..446648 product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140099.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(446789..447688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 447917..450034 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974935.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 tRNA complement(450241..450330) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 450722..450934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313906.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 451125..451649 product DUF992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973508.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS 451732..451995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328763.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 452021..452368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 452448..454232 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529559.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene ybaL CDS complement(454272..455015) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS complement(455282..456352) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314293.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS complement(456404..457324) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328322.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(457324..458418) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328321.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(458408..459946) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401904.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(460028..460999) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401901.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(461024..461746) product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene pcs CDS 461989..463197 product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844473.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(463165..464127) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(464268..465017) product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 tRNA 465247..465322 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 465439..465780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(465999..467552) product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388622.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(467552..469084) product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086389.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(469231..470124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(470192..473545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(473651..474952) product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(475150..475371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 475558..476913 product M10 family metallopeptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392401.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 477064..477684 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244654.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(477739..478554) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(478767..479267) product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969243.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(479279..480952) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244652.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(480962..481279) product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328167.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(481281..482720) product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393480.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene cysG CDS 482918..483505 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971632.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS 483514..484350 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383231.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene mazG CDS complement(484538..485860) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244647.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene hflX CDS complement(485938..486180) product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535434.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene hfq CDS complement(486278..487141) product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969239.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS complement(487180..488562) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535437.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 gene trkA CDS complement(488587..489951) product two-component system response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328161.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 gene ntrX CDS complement(489941..492214) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244644.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(492422..493876) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 gene ntrC CDS complement(493876..495024) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393483.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(495021..496022) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383211.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 gene dusB CDS 496193..497404 product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033044475.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 497401..497904 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975261.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(497906..498745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(498827..499276) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315362.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(499286..499852) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971624.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(500033..501094) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(501153..502130) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971620.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene lipA CDS complement(502348..503805) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312480.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 gene lpdA CDS complement(503882..504148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(504209..504850) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328148.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(504847..505287) product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077414893.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS complement(505368..506726) product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874322.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(506742..508139) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975253.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(508157..509203) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975252.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene pdhA CDS complement(509353..509661) product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400478.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 sequence13 source 1..164621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 318..1934 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530047.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS complement(1949..3469) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173520038.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 3552..4733 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 gene dgoD CDS 4735..6231 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 6405..7481 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 7564..8637 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 8643..9512 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530806.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 9515..10372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(10408..11304) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529342.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(11386..12324) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529341.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(12390..13343) product inner-membrane translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529340.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(13401..14927) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529339.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(14924..16318) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529338.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(16315..17094) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529337.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 17285..18367 product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969789.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS 18364..19641 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 19638..20480 product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976283.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(20647..22134) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037403146.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene otsA CDS complement(22356..25505) product nodulation protein NolG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967460.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene nolG CDS complement(25509..26618) product nodulation protein NolF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970885.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 gene nolF CDS complement(26915..27709) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724163.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(27803..28666) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339272.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(28663..29736) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339273.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(29856..30911) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339274.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(30970..31632) product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS complement(31744..32547) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339275.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS complement(32652..33548) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339276.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS complement(33636..34406) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 34582..36132 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 36153..37097 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970012.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 37094..37909 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS 37914..39575 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 39572..41140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 41133..41996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 41989..42675 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 42672..43547 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368433.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 43571..44404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(44407..45279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(45288..46232) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 46440..47012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 47153..48484 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(48485..49258) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252448.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 49451..50902 product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023004215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 51127..52236 product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031356.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 52307..53251 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192875.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 53338..54459 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192697.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 54459..55235 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 55371..56492 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 56512..57501 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255196.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS 57642..59078 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927099.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 59090..59905 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 59906..60895 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970705.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 60898..62406 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 62403..63419 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721763.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 63450..64397 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 64567..65478 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(65604..66605) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 gene iolG CDS 66735..67910 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858057.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 68000..69841 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223774.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 gene iolD CDS 69941..70432 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530535.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(70485..70748) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887983.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene minE CDS complement(70745..71560) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314831.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene minD CDS complement(71592..72341) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311178.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 gene minC CDS complement(72841..74643) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974102.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(74646..75506) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314855.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(75503..76453) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972897.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(76465..77982) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS complement(78042..79571) product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973438.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 80298..81161 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331848.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(81281..81580) product DUF6522 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967629.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(81577..82044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(82041..82829) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329369.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(82842..83051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS complement(83048..83926) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329370.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 gene ccoP CDS complement(83930..84100) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(84105..84836) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970725.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene ccoO CDS complement(84839..86497) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967313.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 gene ccoN CDS complement(86518..86955) product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene nsrR CDS complement(87134..87808) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS complement(87820..88362) product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063705.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(88509..89225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444153.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(89261..89908) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204186.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(90076..91470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(91675..92271) product DUF4360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028347.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 92492..92749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(92759..93877) product 5-methylthioribulose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(93877..94878) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893542.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(94881..95816) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098399.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(95821..96915) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 gene mtnA CDS complement(96912..98183) product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene mtnK CDS 98330..99847 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976317.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS 99844..100893 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456749.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 100940..101983 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976315.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 102101..102376 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888120.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 102376..102699 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(102749..104803) product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(104864..105835) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970687.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(106015..106755) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS 106857..107480 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(107484..107900) product DUF2000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082428.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS 108031..108522 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266867.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(108538..109458) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS 109592..110776 product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257273.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS 110758..111699 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 111696..112529 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 112534..114204 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 114232..115083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 115117..116661 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217481233.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 116832..117917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(118126..118476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(118750..119079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(119206..119910) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104658.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 120056..120487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312655.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 120748..121392 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067653415.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS 121486..122985 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970602.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 123136..124491 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393205.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 124558..125022 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 125092..126405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 126649..127674 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310267.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS 127680..128543 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530875.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene cysT CDS 128533..129393 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396228.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene cysW CDS 129412..130464 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971173.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(130504..131406) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196222.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 131662..132438 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103315.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS 132462..132704 product acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533152.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 132701..134086 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533153.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 134086..134961 product carboxyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533154.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 134951..135922 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533155.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS complement(136249..137259) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010207837.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 137838..138884 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 138936..139835 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561538.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 139839..140684 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855566.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 140684..141418 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764784.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 141645..142412 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764783.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 CDS 142512..143744 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175401.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 143802..144896 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887944.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 144928..145809 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554892.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 146000..146332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339639.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 146325..147401 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268747.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 147401..148633 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764787.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 148636..149997 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS complement(150033..151226) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198032110.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene lhgO CDS 151629..152543 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973164.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene yghU CDS complement(152549..153715) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166648346.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS complement(153739..153942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 154075..155580 product winged helix-turn-helix domain-containing tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095517487.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 155678..156547 product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS 156669..157961 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969686.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 158172..159008 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974327.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS 159033..160154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 160207..161952 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967271.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 161949..163049 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967272.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS 163046..163651 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967273.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(163741..164325) product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970153.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 sequence14 source 1..145589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1448..1627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS complement(1703..2332) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384669.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 2480..4516 product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972390.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS 4968..5135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 5328..6206 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533591.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS complement(6294..7433) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243488.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(7468..8568) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969593.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(8568..10412) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(10454..11416) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808591.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene phnD CDS 11516..12196 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038450.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 12196..13584 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038449.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 13584..14585 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038448.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 14645..15169 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974030.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(15189..16064) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209712.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 16179..17831 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975820.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 17935..19137 product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456681.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 19157..20419 product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975822.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene phnA CDS 20430..21884 product phosphonoacetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene phnY CDS 22181..23203 product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 23284..24447 product putative 2-aminoethylphosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527142.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 24450..26465 product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(26505..27548) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003259.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 27831..28532 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975817.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 28621..31071 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975818.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(31153..31599) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970165.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(31808..33187) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969803.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(33184..35025) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398965.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 35250..36581 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033042429.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(36633..37091) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329027.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 37217..38500 product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313410.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(38504..38773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(38848..39723) product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071494957.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(39780..40664) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200833.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene choW CDS complement(40689..41921) product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene proV CDS 42372..43037 product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 gene ric CDS complement(43120..43986) product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967620.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 44188..46407 product regulatory protein NosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967621.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 46430..48343 product TAT-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967622.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene nosZ CDS 48345..49718 product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967623.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS 49715..50617 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967624.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 50614..51429 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083150.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 51426..51959 product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 51956..52933 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967627.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(52980..54200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS 54594..55901 product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975290.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 gene ugpB CDS 55986..56867 product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975291.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 gene ugpA CDS 56877..57725 product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972831.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 gene ugpE CDS 57725..58771 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972832.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 gene ugpC CDS complement(58797..59681) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393373.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(59678..60712) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577349.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS 60878..61672 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887692.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(61683..62372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393402.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 62749..64551 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393370.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 64643..65956 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328258.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 gene hisD CDS 66017..67264 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328259.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 67333..68226 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 68219..69094 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912452.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 69099..70199 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328262.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene ugpC CDS 70210..71712 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393367.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 71712..73358 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328264.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 73434..74063 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 74060..74842 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388934.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS 74861..75865 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606692.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 75906..77114 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS 77228..78802 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254871.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(78700..79632) product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975013.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 79992..80576 product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037716.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 80554..81366 product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037717.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 81380..82318 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037718.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(82399..82896) product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967764.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(82905..83255) product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969987.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(83380..84288) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(84285..85904) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525262.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS complement(85906..87054) product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene dgoD CDS complement(87051..88115) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392167.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene ugpC CDS complement(88117..88935) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(88941..89837) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(89899..91260) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967606.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 91490..92200 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918668.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(92219..92713) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387969.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 92860..95220 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725056.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(95364..95867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(96003..97334) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330452.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS complement(97368..98156) product 1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525022.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(98153..99181) product benzoate 1,2-dioxygenase electron transfer component BenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109537.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene benC CDS complement(99218..99706) product benzoate 1,2-dioxygenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 gene benB CDS complement(99703..101061) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(101138..102076) product catechol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene catA CDS complement(102125..102415) product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897236.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 gene catC CDS complement(102428..103609) product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190537.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(104088..104870) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969833.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene pcaD CDS 105049..105972 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204291.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS complement(105988..106374) product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976106.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS complement(106527..107930) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162304032.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS complement(108044..108910) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 109380..109907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 109904..111172 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 111311..112432 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731115.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 112842..113969 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969718.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene repA CDS 113973..114989 product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243826.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene repB CDS 115155..116354 product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244395.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 gene repC CDS 117321..117506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 117503..118141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 118598..119788 product formaldehyde dehydrogenase, glutathione-independent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216779.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 gene fdhA CDS complement(120115..120456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 120889..121194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS complement(121432..121701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS complement(121883..123055) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529310.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(123067..123810) product acetoacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529311.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(123849..124655) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529312.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 124938..126017 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438693.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 gene pstS CDS 126061..127794 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 127907..128935 product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS 128995..130443 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254000.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 130492..131532 product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921017.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 131781..132689 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965809.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene ppk2 CDS 132735..133712 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241170.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(133818..134030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 133992..134576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 134643..135761 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385515.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 135755..136714 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 136724..138403 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385517.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS complement(138981..139469) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931206.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(139447..140232) product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975387.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(140236..141090) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534478.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(141159..141440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 141667..142221 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 142223..142858 product NrsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529421.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS 143183..143374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 note possible pseudo, frameshifted CDS 143371..144375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 144406..145473 product 4-oxalomesaconate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969456.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 sequence15 source 1..140653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 629..946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(1115..2287) product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 gene repC CDS complement(2530..3549) product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974268.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 gene repB CDS complement(3546..4769) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215636.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene repA CDS complement(4991..6244) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(6465..7442) product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530929.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS complement(7527..8771) product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(8824..10422) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355196.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(10468..12642) product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528128.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 12791..13930 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 13941..15209 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494209.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS 15206..15853 product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528133.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS complement(15857..17155) product acetoin dehydrogenase dihydrolipoyllysine-residue acetyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067244.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(17179..18036) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173527.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 18221..19234 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528138.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 19248..20075 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528137.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 20084..21070 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528136.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 21067..22101 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528135.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 22098..23357 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528134.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 23401..25353 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339391.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 25370..26809 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS complement(26829..27110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS complement(27107..27739) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401654.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(27752..29014) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115085.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(29016..31121) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(31230..32084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS complement(32181..33335) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968431.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(33346..35343) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968430.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(35340..36581) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530006.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 36704..37702 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968428.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 38027..38584 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975991.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 38700..39200 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061898.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(39242..40219) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(40234..41058) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975551.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(41384..42253) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061891.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(42266..43675) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243160.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(43737..44564) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975551.1 transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(44594..45364) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975550.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS complement(45379..46245) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061895.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(46242..47696) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061896.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene argH CDS 47821..48729 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975547.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS 48908..49363 product DUF3597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973558.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 49853..50881 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974341.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 50885..51586 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969611.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(51751..52869) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969612.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(52874..53830) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969613.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 gene pdxA CDS complement(53827..55020) product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969614.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 55370..56857 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170059.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 56913..57860 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532054.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS 57872..58795 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969617.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 58788..60407 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969618.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 60434..61315 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969619.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(61328..62620) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528035.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(62617..63558) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402896.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(63561..64610) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402893.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS complement(64600..66126) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402890.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(66251..67276) product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402907.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(67529..68776) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 69038..70147 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391635.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(70318..71358) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530862.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 71599..72675 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene ugpC CDS 72716..73951 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972909.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 74032..74967 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992469.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 74971..75825 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314872.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 75822..77555 product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083210.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 gene araD CDS 77567..78370 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704294.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 gene hpaI CDS 78381..79265 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703193.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS 79275..80033 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 80045..82036 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972911.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 82039..82809 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810210.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 82806..84275 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968294.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 gene gabD CDS complement(84620..85864) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868921.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 86271..87284 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731545.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 87378..88364 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731544.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS 88364..89131 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230844.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 89155..90186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 90183..91205 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209518.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS complement(91347..92576) product zinc metallochaperone AztD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969726.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 gene aztD CDS 92972..94129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 tRNA complement(92996..93089) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 94126..95526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS 95554..96612 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532971.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 96688..97797 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532860.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 97794..98660 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 98671..99459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 99481..100986 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339389.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(101115..101960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS complement(101973..103163) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817124.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 103047..103487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 103564..104631 product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973985.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(104691..105221) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106726554.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 105367..105672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970158.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(105816..106598) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528764.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene hisN CDS complement(106607..107344) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193736.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(107344..108036) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967252.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(108033..108728) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967253.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(108795..109607) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967254.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 109794..110906 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528916.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS complement(110943..111764) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338992.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(111825..113060) product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532103.1 transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(113177..114223) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047175.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS 114334..115434 product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393209.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS 115431..116267 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210829.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 gene kduI CDS 116264..118747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973963.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS 118825..120093 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973466.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS 120308..121327 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316520.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS 121324..122376 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092773148.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 122386..123432 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 gene ugpC CDS 123446..124204 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393179.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 gene kduD CDS 124217..125107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(125179..125472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(125531..125731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(125945..126979) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974273.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(127101..127982) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091889128.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(127990..128496) product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 transl_table 11 codon_start 1 locus_tag LOCUS_33670 gene hxlB CDS complement(128481..129140) product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776031.1 transl_table 11 codon_start 1 locus_tag LOCUS_33680 gene hxlA CDS complement(129154..129912) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892760.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(129912..130901) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971942.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS complement(130942..131901) product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759000.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 gene rbsB CDS complement(132175..132927) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401353.1 transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(132933..133685) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(133682..134725) product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401358.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(134710..136179) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401360.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(136216..137448) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401363.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(137512..138390) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401366.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene dapA CDS complement(138424..138717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 138963..139682 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 139685..140467 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973483.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 sequence16 source 1..131433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..1015) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529066.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 1095..2105 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067217.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene obgE CDS 2107..3279 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330090.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 gene proB CDS 3272..4549 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393804.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 4551..5195 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393806.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS 5305..5709 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330094.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 gene rsfS CDS 5789..6271 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067222.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 gene rlmH CDS 6411..7841 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844910.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 7870..9153 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330097.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(9069..9353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 9340..10542 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330098.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 10552..11079 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330099.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS complement(11141..11626) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330100.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 gene bfr CDS complement(11592..11903) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531270.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 12273..12707 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310993.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS complement(12835..13041) product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393782.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(13038..13949) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209276.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 14112..14360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067235.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 14520..15125 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531292.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 gene leuD CDS 15131..15511 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531294.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 15721..16830 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535893.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 gene leuB CDS 16946..17650 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398638.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS complement(17708..19597) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970564.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS 20080..21114 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 21346..22167 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970568.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(22281..22922) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242643.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS complement(23021..23896) product pyridoxal kinase PdxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563606.1 transl_table 11 codon_start 1 locus_tag LOCUS_34070 gene pdxY CDS 24173..28954 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398663.1 transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 29158..30534 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970572.1 transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(30705..32315) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970573.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 gene purH CDS complement(32415..34097) product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242378.1 transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(34214..35620) product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970575.1 transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(35617..36582) product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 transl_table 11 codon_start 1 locus_tag LOCUS_34130 gene htpX CDS 36794..36991 product DUF1674 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067398.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(37173..39128) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34150 gene acs CDS 39361..40062 product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390453.1 transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(40234..42150) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398676.1 transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(42273..42932) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398678.1 transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 43131..45761 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067403.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 gene leuS CDS 45748..46272 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398682.1 transl_table 11 codon_start 1 locus_tag LOCUS_34200 gene lptE CDS 46280..47314 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398683.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 gene holA CDS complement(47340..48230) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330363.1 transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(48255..49049) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330364.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(49063..49698) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970584.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 gene rsmG CDS complement(49695..51584) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398688.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 gene mnmG CDS complement(51651..52976) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398690.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene mnmE CDS complement(53101..54366) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970587.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 gene rho CDS complement(54553..55092) product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311068.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene hemJ CDS complement(55089..56051) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398694.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 gene hemE CDS 56529..57350 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067414.1 transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 57375..57971 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508611.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 57964..58824 product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398698.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 58821..59411 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067417.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene coaE CDS 59411..60115 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067418.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 gene dnaQ CDS complement(60199..60675) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067419.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene secB CDS complement(60745..61203) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene fxsA CDS 61358..62062 product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067421.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 62077..63192 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398216.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 63179..63745 product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 63742..64122 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531717.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 64256..66688 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene gyrB CDS complement(66822..67415) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968293.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 67576..69027 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067427.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 gene gabD CDS 69091..69891 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067428.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 gene hpaI CDS complement(69968..71074) product D-mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336877.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(71085..71963) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330385.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 72157..73176 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067431.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 73203..73649 product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532181.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS 73859..74845 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968299.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 74934..76487 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251839.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 76516..77490 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067434.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 77573..78514 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330392.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS 78693..79985 product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390504.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 gene phaZ CDS 80114..80548 product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067439.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 80768..81529 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968304.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(81554..81751) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812201.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 81882..82565 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330397.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 82562..83782 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067442.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 gene trpB CDS 83784..84623 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970607.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 gene trpA CDS 84713..85615 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536448.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 gene accD CDS 85638..86981 product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968306.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(87036..87356) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067446.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 gene trxA CDS complement(87475..91032) product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968308.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene addA CDS complement(91025..94207) product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968309.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 gene addB CDS complement(94204..94938) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067449.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS complement(94952..96448) product bifunctional tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE/phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067450.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(96455..98908) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330406.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(99199..100599) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330407.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 gene ahcY CDS complement(100755..101027) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330408.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(101043..101444) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067454.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(101595..102056) product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532002.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(102259..104067) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398169.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(104153..104884) product two-component system response regulator ChvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330412.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene chvI CDS 105197..106807 product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067458.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 106935..107369 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970617.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene arfB CDS 107477..107992 product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067460.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 gene lysM CDS 107999..108616 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(108681..109676) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968317.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene coaA CDS complement(109676..109996) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876448.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS complement(110007..110783) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970619.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 gene hisF CDS 111117..111674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(111810..112550) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531989.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 gene hisA CDS 112829..113110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS complement(113107..113748) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242309.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene hisH CDS complement(113751..114221) product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531987.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(114293..114886) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390535.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 gene hisB CDS 115976..116533 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709882.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 gene hslV CDS 116523..117065 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968321.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 117062..118372 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 gene hslU CDS 118549..119496 product DUF1402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531977.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(119643..120197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 120338..122344 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398133.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 122530..124692 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968325.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(124774..125436) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531973.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 125804..126334 product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067477.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(126441..127010) product global response regulator transcription factor ActR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067478.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 gene actR CDS complement(127088..128389) product ActS/PrrB/RegB family redox-sensitive histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398122.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(128615..131083) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968330.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 gene hrpB sequence17 source 1..113182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(192..803) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167367.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(854..1612) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018238032.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(1629..2807) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(2804..4672) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336752.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(4672..5583) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336751.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(5592..6581) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722098.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS complement(6650..8179) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562511.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 8882..9958 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770316.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 9959..10663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 10945..12192 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 12257..13126 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035215689.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 gene urtB CDS 13155..14282 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974751.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene urtC CDS 14279..15043 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974752.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 gene urtD CDS 15036..15731 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974753.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 gene urtE CDS 15743..16777 product aliphatic amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083793.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS 16848..18179 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729038.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 18238..19257 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898152.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 19315..20115 product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS 20141..22330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 22604..23260 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140035.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS 23257..25656 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 25646..26692 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336817.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(27188..28075) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970324.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS complement(28200..29288) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970325.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS 29550..30395 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970326.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS 30521..31444 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970327.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 31444..32229 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234820896.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS complement(32323..33261) product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970329.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(33272..33982) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970330.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(34001..35002) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970331.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 35154..36680 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163897449.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 tRNA 35494..35590 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 36722..37561 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS complement(37758..38828) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970685.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 39054..39890 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970684.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS 39947..41455 product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970683.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 41469..42476 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS 42522..43646 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974269.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(43653..44648) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243788.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 44811..46391 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727398.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 46433..47155 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868218.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 47182..48066 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS 48071..49018 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969282.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS 49030..50550 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243012.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 50574..51599 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 51734..52483 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 52494..53273 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 53296..54270 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807397.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 54331..55941 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 55953..56246 product muconolactone Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728004.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene catC CDS 56319..58139 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973857.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS complement(58307..59335) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS 59481..61211 product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968847.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 61275..61928 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218129451.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 62020..63117 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400384.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 63129..64199 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400387.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 64192..65898 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782273.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 65895..66983 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405591.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS 66980..68680 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 68730..69512 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201787933.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 69554..70207 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 70514..71428 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969920.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(71409..72485) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902083.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 72679..73923 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969913.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 74007..75035 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969914.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 75046..75927 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969915.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS 75933..76997 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969916.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 gene ugpC CDS 77003..77533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 77538..78848 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969917.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 gene hisD CDS 78845..79618 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969919.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 79627..80604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 80610..81581 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969921.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 81578..82276 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036036.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 82315..83016 product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969922.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS complement(83148..84146) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967753.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(84164..85237) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975559.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene ugpC CDS complement(85248..86072) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253348.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(86077..86967) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244087.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 CDS complement(87097..88497) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967707.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(88590..89105) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967754.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(89131..90762) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970552.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(90857..91864) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529706.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(91889..92548) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967752.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS 92804..93913 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528694.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 93992..94957 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527033.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 94966..96471 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967750.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 96480..97421 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967749.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 97431..98465 product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528693.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS 98489..99985 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967747.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 99985..101580 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967746.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(101632..102450) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845505.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 102564..104159 product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967743.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 104156..104929 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(104948..105226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS 105107..106228 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967741.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(106269..107285) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 107439..108581 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967739.1 transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 108578..109357 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967738.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 109367..110515 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967737.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS 110519..111376 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967736.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS 111388..112137 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970096.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS 112165..113094 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394692.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 sequence18 source 1..98618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..926) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655294.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS complement(1165..3783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 4024..4287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(4562..5572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(5569..6981) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228635.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(7326..7550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(7738..8157) product type II toxin-antitoxin system HigA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527219.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(8168..8449) product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS 8507..8722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(8617..9210) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836185.1 transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 9404..10999 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974405.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 10996..12261 product capsule biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252603.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS 12647..19981 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563188.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 19987..21372 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391972.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 21374..22189 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 22275..23102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36150 CDS 23141..24190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 24203..25450 product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811220.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 25458..26111 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975455.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 26140..27411 product RkpR, polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867747.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 27421..28539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS 28529..29326 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811217.1 transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 29333..31519 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120706319.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS 31860..32981 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706035.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 gene wecB CDS 32978..34279 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011236.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene wecC CDS 34474..37770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 37864..39294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(39303..41117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS complement(41108..42442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(42879..43517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(43535..45100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS 45495..46130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS 46134..48878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 49102..51009 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776746.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 CDS 51135..53033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS 52963..53706 product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112407.1 transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(53687..54592) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974013.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 gene rfbD CDS complement(54599..55666) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983494.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 gene rfbB CDS 55837..56721 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532727.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene rfbA CDS 56718..57278 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene rfbC CDS complement(57286..59682) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975444.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(59892..62579) product galactosyltransferase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061911.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(62597..63874) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975457.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(63920..65821) product bifunctional sulfate adenylyltransferase/adenylyl-sulfate kinase NodQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970895.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene nodQ CDS complement(65821..66750) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene cysD CDS 66929..68149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 68770..69084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS complement(69159..71891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(72274..74583) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975444.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS complement(74745..75080) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969345.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(75131..76717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(76804..77436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 77670..78833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(78910..79218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS complement(79218..79901) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 80789..80971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS 81032..81382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(81494..82177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 82689..83690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS 84035..85723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 85733..87112 product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329916.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 87203..88429 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS complement(88502..90043) product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 90292..92139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 92213..92806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(92781..94037) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(94101..95108) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984085.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS complement(95101..96822) product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538035.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 96936..97931 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175783.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS 98032..98184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36690 sequence19 source 1..95917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(642..953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 1093..2253 product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 2290..3462 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256149.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS 3575..5014 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 5662..6750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 6747..7637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 7634..8983 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 8980..9663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 9665..9862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 9862..10851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS complement(10928..12301) product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS 12505..13266 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384591.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 13267..13755 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390210.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 13758..14756 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764786.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS 15091..16083 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973995.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS 16148..16918 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728490.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS 16969..17769 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816301.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS 17951..19534 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972360.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 19551..20984 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163901150.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS 21441..21662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 note possible pseudo, frameshifted CDS complement(21669..23009) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974675.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(23010..23588) product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974674.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(23590..24090) product CMD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969487.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(24118..25590) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969486.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(25607..26683) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975169.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(26683..27474) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969484.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(27485..28465) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975171.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(28538..29638) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975172.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(29640..30683) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974668.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 30885..31967 product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969480.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 32269..33525 product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530650.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 33567..34127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(34158..35384) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085703.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(35455..36954) product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene dhaS CDS complement(36980..37279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(37312..38025) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013985.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 gene urtE CDS complement(38015..38737) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene urtD CDS complement(38734..39771) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS complement(39768..40634) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 gene urtB CDS complement(40701..41918) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974749.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(42233..43063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 43049..43573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS 43584..44000 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083032.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 44502..44822 product DUF4112 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967229.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(44950..46014) product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559340.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 46301..46834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 note possible pseudo, frameshifted CDS 47417..48286 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207989.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS 48801..49811 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523134.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 49843..51120 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065231.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 51244..52095 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228343.1 transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 52092..52925 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228342.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 52938..53996 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173056.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 54020..55282 product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228344.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(55252..56235) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435265.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS 56410..57615 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397986.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 57673..58416 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329982.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS 58418..59119 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 59124..60011 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313872.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 60013..61017 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313874.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS 61117..62712 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973582.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 62776..63663 product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331270.1 transl_table 11 codon_start 1 locus_tag LOCUS_37310 gene mmsB CDS complement(63687..66107) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967776.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS complement(66330..67217) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527002.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 67446..68981 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967775.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 68998..69990 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014990157.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS 70082..71386 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969995.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS 71398..72066 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967772.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS 72091..72753 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967771.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 72750..73865 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967770.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS 73862..74620 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969991.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS 74644..75534 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967768.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 75674..76798 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969989.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 76795..77802 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967766.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 77828..78730 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967768.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS 78819..79754 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528698.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(79751..80278) product sarcosine oxidase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612973.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(80271..83234) product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973655.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS complement(83231..83500) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973656.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(83513..84763) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 84862..85842 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS complement(85862..86764) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130010930.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS 86855..88306 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929684.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS 88311..89306 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS 89303..90997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS 90994..91566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 91577..92581 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969988.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS 92729..93688 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971233.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 93805..94677 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810306.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS 94682..95827 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 sequence20 source 1..87509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 189..767 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(784..2001) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(2181..4547) product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965926.1 transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(4623..4961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 5169..6569 product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524980.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 6566..7747 product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540302.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 7806..8672 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS 8698..11433 product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(11486..12316) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967600.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS 12597..13019 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971663.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 gene arsC CDS complement(13104..13430) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529048.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(13441..14196) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919366.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene kduD CDS complement(14193..15035) product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967114.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene kduI CDS complement(15066..15797) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(15797..16744) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311331.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS complement(16886..17836) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967117.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS complement(17961..19475) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970125.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 19599..20300 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845097.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(20411..21487) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012849.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 21662..22642 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975769.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 22776..24266 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061669.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 24268..25278 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975767.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 25290..26273 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527174.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(26293..26736) product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310047.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene rirA CDS complement(26849..27814) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(27895..29127) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390089.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(29197..31485) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470621.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(31633..32559) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446272.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(32834..33550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(33547..35352) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387947.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS complement(35349..37118) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140326.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS 37480..46572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 46572..49919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS 49916..50686 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267336.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 50701..51966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104612.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 51947..53278 product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 gene megL CDS 53275..54321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(54284..55018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 55284..59618 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973237.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS 59630..63655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS 63652..66954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS 66954..68171 product isochorismate synthase DhbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243699.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene dhbC CDS 68175..69827 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205428.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 69831..70178 product isochorismate lyase PchB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106950.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene pchB CDS 70182..73727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(73771..74820) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(74835..75473) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976190.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(75470..76732) product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765391.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS complement(76752..77417) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(77564..78640) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198096.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(78633..80393) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205449.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(80458..81564) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198094.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(81694..82731) product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139076345.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 CDS complement(82875..83801) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016558605.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 83983..86553 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974570.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 gene acnA CDS 86743..87123 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 sequence21 source 1..70780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1186 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184144746.1:electron transfer flavoprotein-ubiquinone oxidoreductase locus_tag LOCUS_38160 CDS 1620..2102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS 2181..2810 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311709.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS 3183..4181 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393023.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS 4327..5214 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393024.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS 5291..5875 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972243.1 transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(5879..6787) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391255.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS 6928..7398 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327744.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(7506..7922) product multidrug efflux RND transporter inhibitory subunit MexG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093607.1 transl_table 11 codon_start 1 locus_tag LOCUS_38240 gene mexG CDS complement(8134..9372) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050813472.1 transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 9727..10665 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327745.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS complement(10837..12195) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037491.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS 12343..13716 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992255.1 transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(13722..14111) product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 CDS complement(14108..14338) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971328.1 transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(14403..15905) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391249.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS complement(16020..16340) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254519.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS complement(16462..16638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441068.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(16670..16834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(17183..17521) product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311505.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS 17988..18257 product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241004.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(18334..19455) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971332.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(19581..20009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(20136..20492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS complement(20609..21832) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS 22062..23090 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827650.1 transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(23211..24005) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397477.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 gene iolB CDS complement(24041..24961) product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528373.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 gene iolE CDS complement(25107..26957) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968521.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene iolD CDS complement(27039..28973) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528371.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 gene iolC CDS complement(29095..29952) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397484.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 CDS 30166..31287 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973913.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 31386..34739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(35112..36224) product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844483.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 tRNA 36471..36560 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(37302..38129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 note possible pseudo, frameshifted CDS complement(38126..38515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38510 note possible pseudo, frameshifted CDS 38574..38846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38520 note possible pseudo, frameshifted CDS 38954..39673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 note possible pseudo, frameshifted CDS 39935..40420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS complement(40512..40751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS complement(40853..41233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS 41617..42450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(42500..42778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS 42936..43262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS complement(43455..44222) product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114245.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS complement(44235..44432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557208.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 44953..45564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(45553..46092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS 46475..47872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(47795..48181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(48183..48758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS complement(49119..49412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS complement(49409..50692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS complement(50828..51196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS complement(51196..51399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS complement(51399..51740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 51844..52092 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391325.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(52132..52368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38730 CDS complement(52428..52637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(52808..53758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS complement(53890..54075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 54330..55097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS 55094..55537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(55806..56144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS complement(56253..56705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS complement(57250..57552) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243280.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 CDS complement(57873..58262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(58301..61705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 CDS complement(61708..62787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(62901..63230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(63332..63628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(63621..63803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(63800..64711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(64713..66143) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337085.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(66140..66589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(66586..66894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133033982.1 transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(66891..67103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS complement(67115..67291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS complement(67429..68196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38940 CDS complement(68189..69397) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS complement(69600..70556) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526650.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 sequence22 source 1..53492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..1633) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387630.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(1793..2746) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329274.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 2993..4354 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563248.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 CDS 4370..5683 product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969942.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 gene preA CDS complement(5965..6603) product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971485.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 6766..7695 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114958.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 CDS 7801..8997 product OpgC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973266.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene opgC CDS complement(8978..9628) product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525590.1 transl_table 11 codon_start 1 locus_tag LOCUS_39040 gene rutR CDS 9897..11147 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394455.1 transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 11152..11793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 11790..13244 product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651148.1 transl_table 11 codon_start 1 locus_tag LOCUS_39070 gene hydA CDS 13241..13606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(13822..14235) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS 14358..15161 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066592.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS 15161..15496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528672.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 15500..16384 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394444.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 16381..17250 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969952.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 CDS 17274..18266 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 18634..19791 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066597.1 transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 19994..23305 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969955.1 transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 23455..24138 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315015.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS complement(24160..24771) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394427.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 gene ureG CDS complement(24866..25537) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394469.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(25530..25865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 25830..26060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39210 CDS complement(26109..26942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39220 CDS complement(27080..28786) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315008.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene ureC CDS complement(28911..29531) product Urease operon accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132073684.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS complement(29543..29977) product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255339.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS complement(29979..30284) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240195.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS complement(30295..30549) product DUF1272 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528396.1 transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS complement(30554..30856) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS complement(30954..31799) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969965.1 transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(32009..33127) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525631.1 transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS complement(33240..33584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329310.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(33691..34416) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314982.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS complement(34416..35324) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066618.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS complement(35324..36712) product high-affinity branched-chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394369.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene livM CDS complement(36716..37618) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525638.1 transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(37902..40328) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530888.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS complement(40451..41005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(41015..43972) product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968344.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS complement(43969..44244) product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973656.1 transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(44252..45502) product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067492.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 45696..46523 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061494.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene cysQ CDS 46706..48118 product capsule polysaccharide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061905.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 48143..48934 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930466.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 48934..49617 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867744.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 CDS complement(49702..51090) product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161827.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(51291..53318) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930473.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 sequence23 source 1..504125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..368 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855945.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 CDS complement(533..1315) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969976.1 transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(1380..2177) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525654.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(2174..3028) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329325.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(3025..4059) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329326.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(4138..5226) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240233.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(5295..6347) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329331.1 transl_table 11 codon_start 1 locus_tag LOCUS_39530 gene speB CDS 6532..7548 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017264593.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS 7565..8737 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969980.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS 8852..9067 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811035.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 9142..11622 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992271.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS 11619..12029 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975862.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 gene cueR CDS complement(12033..12434) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 CDS complement(12434..12670) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261287.1 transl_table 11 codon_start 1 locus_tag LOCUS_39600 gene vapB CDS complement(12741..13133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39610 CDS complement(13153..13779) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531384.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 13861..14985 product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531383.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 15179..16042 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531382.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 16045..16833 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531381.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 16830..17915 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531380.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS 17923..18651 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531379.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS 18664..20097 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969982.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS 20385..21263 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066636.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(21300..23084) product IlvD/Edd family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967127.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 23253..24158 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311167.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS complement(24171..24638) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969738.1 transl_table 11 codon_start 1 locus_tag LOCUS_39720 CDS 24761..26851 product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396305.1 transl_table 11 codon_start 1 locus_tag LOCUS_39730 CDS 26855..28054 product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243544.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 28051..29454 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388970.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 gene lpdA CDS 29655..30737 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728502.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(31193..31657) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968668.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS 32156..33160 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254850.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 gene tauA CDS 33353..34159 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393164.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 34156..34998 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982269.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS complement(35068..35724) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528559.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS complement(35705..36775) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528558.1 transl_table 11 codon_start 1 locus_tag LOCUS_39820 CDS complement(36860..37708) product MetQ/NlpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528557.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(37910..38725) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331794.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 38964..40241 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391726.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS 40337..41818 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242183.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(41854..42249) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918525.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(42249..42491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39880 CDS complement(42549..43193) product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067046.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene maiA CDS complement(43198..44214) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034855886.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 44330..44890 product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529722.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS complement(44893..46224) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970302.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene hmgA CDS 46306..46764 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970303.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 CDS 46852..47106 product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084508.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 47347..48558 product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858029.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 gene repA CDS 48546..49589 product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858028.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 gene repB CDS 49746..51068 product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970061.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene repC CDS 51162..51455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 CDS complement(51458..52039) product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327214.1 transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS 52187..52687 product heme-degrading domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329975.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 52789..54612 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391770.1 transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 54609..55964 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391769.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 56164..57147 product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974952.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS 57295..57756 product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974953.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 57766..59271 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309942.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 59403..60287 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976269.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 60433..62649 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170156.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(62749..63771) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313850.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(64166..64516) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973855.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(64540..65136) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003499036.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(65232..65591) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530464.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(65611..66996) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530465.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(67015..68121) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530466.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS complement(68125..68910) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530467.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(68915..69853) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027160916.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(70107..71180) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530469.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS complement(71223..71840) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530470.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(72001..73962) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS 74178..74783 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095727.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(74786..75664) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091135.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 75907..76704 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969901.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS 76829..78343 product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816379.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 78483..79529 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975633.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 CDS 79522..80544 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975634.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 80790..81617 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534077.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 81614..82390 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975636.1 transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 82383..83411 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061540.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS 83408..84340 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975637.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS 84337..86127 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061542.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 86124..87026 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061416.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS 87043..88344 product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705259.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(88423..89778) product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188297.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(89839..91521) product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(91437..93197) product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969299.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 93440..94432 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533169.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(94469..95947) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975808.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 96088..97104 product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975809.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene tauA CDS 97189..98001 product taurine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975810.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS 97994..98821 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061777.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 98932..99318 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061778.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 99336..100736 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975813.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 100773..102548 product sulfoacetaldehyde acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975814.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 gene xsc CDS 102621..103658 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061784.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS 103658..104659 product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061785.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene pta CDS 104839..105063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969104.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(105091..106155) product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967920.1 transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(106152..106973) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967921.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(106970..108004) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS complement(108007..109050) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014531406.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(109047..110039) product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445481.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 110331..112466 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169987.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(112473..113348) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967926.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS 113808..114287 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395894.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 114287..115654 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395892.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 gene accC CDS 115641..116108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395890.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 116105..116803 product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973704.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 gene pxpB CDS 116800..117792 product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395886.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 117802..118569 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973706.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 118601..119803 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395882.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS complement(119800..120711) product nitrogen assimilation transcriptional regulator NAC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973708.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 gene nac CDS 120862..121614 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973709.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 121611..122318 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973710.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 122315..123067 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973711.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 123064..123831 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315969.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 123858..124694 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973712.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS 124777..125463 product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973713.1 transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS complement(125513..126322) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133012.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS complement(126346..127041) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318320.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS complement(127041..127754) product nopaline ABC transporter permease NocQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891638.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 gene nocQ CDS complement(127751..128911) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089925.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS complement(128904..130304) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040457.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS complement(130400..130705) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089927.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(130793..131641) product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 gene nocT CDS 131865..132692 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973042.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS complement(132790..133926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(133923..135011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(135197..136519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS complement(136754..138751) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397063.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS complement(138842..140425) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976313.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 140567..141361 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969808.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(141384..142337) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530452.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS 142439..143848 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028604.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 143848..144696 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532993.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 gene urtB CDS 144693..145673 product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532994.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS 145670..146356 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532995.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 146356..147051 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532996.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 147104..148270 product substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532997.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 148258..149559 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(149617..150093) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172160.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS 150219..151190 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090584.1 transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS complement(151276..152190) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084684.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS 152306..153193 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090839.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS 153259..153918 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090840.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 153915..154691 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090841.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 154716..155837 product muconate cycloisomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090843.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS 155932..157209 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089551.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 157247..159001 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807539.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 159030..159788 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969950.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS complement(159801..161381) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524564.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS complement(161389..162819) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315769.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS complement(162809..163816) product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080864.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene fabK CDS complement(163821..165443) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218852620.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS complement(165433..166212) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030262.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS complement(166212..167399) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064882.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(167399..168145) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(168154..169080) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389693.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(169160..169705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS 169928..170947 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528515.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 170970..172037 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528516.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS 172034..172936 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528517.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 172936..173745 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528518.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 173788..175170 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389794.1 transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS 175183..176202 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS 176272..176565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS 176821..177423 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501867.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 177666..178919 product sarcosine oxidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528148.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS 178929..179213 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528149.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS 179194..182001 product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528150.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS 181994..182524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528151.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 182584..183699 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532613.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS complement(183906..184934) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921512.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 185145..186437 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921636.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 186507..187382 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089095.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 187393..188217 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089094.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 188223..189221 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089093.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 189226..190302 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089092.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene ugpC CDS 190299..191210 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089091.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 191222..192268 product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089090.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS 192296..193774 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 193774..194517 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089098.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 194525..195694 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812102.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS 195691..196464 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810210.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(196493..197191) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(197309..198415) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530811.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(198444..199550) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976324.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(199562..201712) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954085.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS 202115..202666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(202733..204337) product RNA repair transcriptional activator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122266.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 gene rtcR CDS 204551..206107 product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123257.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS 206766..208190 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS 208163..208360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 208422..209639 product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074621948.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS 209626..210246 product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602086.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 gene prfH CDS complement(210334..211119) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067339.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(211169..212119) product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067338.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(212142..213611) product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067337.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(213695..214663) product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067336.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(214663..215472) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310901.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 215682..216656 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067334.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 216775..217707 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067333.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 217729..219216 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067332.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 219231..220019 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314013.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS 220316..220951 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314017.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 gene ribB CDS complement(221033..222364) product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976222.1 transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS complement(222515..223411) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976224.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 gene purU CDS complement(223432..224322) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976225.1 transl_table 11 codon_start 1 locus_tag LOCUS_41560 gene folD CDS complement(224420..225697) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976226.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 225829..226797 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976227.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS 227053..228084 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976228.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS 228186..229361 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976229.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS 229358..230488 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976230.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 230518..231276 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976231.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS complement(231322..231570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035216164.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(231749..232627) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975551.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 232718..233632 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158693500.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 233958..236054 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399322.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 236070..237728 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399319.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 237863..238669 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399313.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 238669..239862 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399310.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS complement(239882..240613) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399305.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 240790..241539 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399300.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 241532..242275 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399298.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(242294..243085) product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 gene hexR CDS complement(243129..243986) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191664.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(243983..245080) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975241.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(245086..246768) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(246935..247870) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS 248327..249175 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975032.1 transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 249360..250274 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532054.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 250278..251204 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969617.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS 251197..252831 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975058.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 252828..253802 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384661.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS complement(253790..254503) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 254649..256385 product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165224571.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 gene araD CDS 256479..257189 product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973471.1 transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 257330..258235 product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339506.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 gene kdgD CDS 258235..259140 product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106713570.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS 259291..260811 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974335.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS 260875..261930 product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003378.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS 262035..262517 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241287.1 transl_table 11 codon_start 1 locus_tag LOCUS_41900 gene greA CDS complement(262522..263220) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084166.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(263213..263587) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084165.1 transl_table 11 codon_start 1 locus_tag LOCUS_41920 CDS 263722..264153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS 264225..265697 product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028720319.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 265821..266270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 266446..268020 product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339153.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS 268154..269005 product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967047.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS 269141..270178 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967048.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS 270175..270975 product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS complement(270947..271960) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967049.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 272101..273726 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 273783..275375 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967051.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 275460..276395 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967052.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 276401..277222 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967053.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 277219..278130 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967054.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS 278127..279089 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967055.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 279176..281047 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969665.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 CDS 281210..282283 product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974116.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 CDS 282350..284149 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176058.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 CDS complement(284226..285599) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975296.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(285857..287353) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975297.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 CDS complement(287485..287967) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS 288070..289455 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401297.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS 289578..290363 product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525885.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 gene ehuA CDS 290450..291277 product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969335.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 gene ehuB CDS 291470..292141 product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525889.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 gene ehuC CDS 292144..292806 product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969333.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 gene ehuD CDS 292806..293582 product ectoine utilization protein EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401284.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 gene eutA CDS 293586..294593 product hydroxyectoine utilization dehydratase EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401316.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 gene eutB CDS 294590..295582 product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 gene eutC CDS 295617..296798 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969329.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 gene doeA CDS 296802..297809 product N(2)-acetyl-L-2,4-diaminobutanoate deacetylase DoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014530717.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 gene doeB CDS complement(297916..298767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS complement(298974..299300) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(299560..300405) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974708.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(300527..301687) product tricarballylate utilization protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811143.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene tcuB CDS complement(301703..303121) product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228705.1 transl_table 11 codon_start 1 locus_tag LOCUS_42270 gene tcuA CDS complement(303273..304919) product amino acid ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087236.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS complement(305047..306027) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387478.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(306036..307238) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092809287.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(307323..308759) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939933.1 transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS 308941..310593 product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376432.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS 310583..312691 product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 312691..314301 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142798.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 314313..315098 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS 315111..316025 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 316034..316528 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086736.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS complement(316561..317310) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975340.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS complement(317447..318901) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089926.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS complement(318898..319200) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040456.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 CDS complement(319362..319712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS complement(319818..320243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 320127..320378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(320623..322809) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064868.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(322859..323287) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467030.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(323291..324436) product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS complement(324436..325428) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS complement(325481..326662) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090004.1 transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS complement(326673..327881) product pimeloyl-CoA dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090542.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 gene pimC CDS 328137..328967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 329030..329500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS 329510..330289 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 330317..330505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS 330502..331893 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090641.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS complement(331966..333177) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401398.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(333179..333874) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975845.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(333884..334420) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(334491..334976) product Spy/CpxP family protein refolding chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037462585.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS complement(335143..336129) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533353.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS 336354..337178 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389905.1 transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 337192..337851 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886243.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS 337863..338594 product nopaline ABC transporter permease NocM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523894.1 transl_table 11 codon_start 1 locus_tag LOCUS_42620 gene nocM CDS 338584..339750 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533357.1 transl_table 11 codon_start 1 locus_tag LOCUS_42630 gene alr CDS 339752..340597 product nopaline ABC transporter substrate-binding protein NocT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891637.1 transl_table 11 codon_start 1 locus_tag LOCUS_42640 gene nocT CDS 340667..341911 product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533354.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 CDS complement(341928..342401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS 342603..345392 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS 345717..347102 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061450.1 transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS complement(347166..347501) product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976253.1 transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(347684..348244) product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528153.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene msuE CDS complement(348413..348937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS complement(349001..349618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS complement(349608..349793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS 350128..351081 product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269279.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS 351081..351917 product aliphatic sulfonate ABC transporter permease SsuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120785.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 gene ssuC CDS 351914..352657 product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105420.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 gene ssuB CDS 352706..353746 product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530313.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 353782..354630 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094922.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 gene cysE CDS complement(354687..355856) product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973029.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 gene ssuD CDS 356336..357370 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089195.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS 357375..358376 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089194.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 358373..359161 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089193.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 359151..359450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 359477..360838 product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626023.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS 361059..362291 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206502.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 362297..363349 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038713.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 363339..363998 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097004.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 364019..364831 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093057.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS 364906..366171 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528154.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS 366207..367574 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266344.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS 367731..368735 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202597.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS 368797..370329 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268053.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS 370319..371368 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104324.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS 371370..372347 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104323.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 CDS 372374..373588 product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975951.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 CDS complement(373744..374955) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104714.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS 375220..376632 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107490.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 CDS 376640..378124 product FAD/NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061451.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS 378257..378532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075628183.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS complement(378598..379284) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120280.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS 379378..380598 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530682.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 380595..383717 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972395.1 transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS complement(383775..384470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 CDS complement(384470..385249) product ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209942632.1 transl_table 11 codon_start 1 locus_tag LOCUS_43040 gene ehuA CDS complement(385246..385899) product ectoine/hydroxyectoine ABC transporter permease subunit EhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812579.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 gene ehuD CDS complement(385899..386627) product ectoine/hydroxyectoine ABC transporter permease subunit EhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812581.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 gene ehuC CDS complement(386691..387521) product ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039638.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 gene ehuB CDS 387745..388926 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974131.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 gene doeA CDS 388959..390107 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339317.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 390115..391371 product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821029.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 391382..391648 product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821030.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS 391645..394569 product sarcosine oxidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531141.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS 394562..395053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS 395195..395815 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528422.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 395954..396895 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972724.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 396966..397766 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266621.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 397763..398773 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972725.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS 398775..399866 product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414790.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 399895..400659 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532007.1 transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 400685..401596 product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339536.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 CDS 401593..402435 product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339537.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 402441..403676 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972730.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(403680..404984) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970057.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 CDS complement(404998..405666) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970056.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS complement(405663..406691) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970055.1 transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS complement(406704..407594) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970054.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 CDS complement(407600..408307) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970053.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 CDS complement(408300..409034) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434161.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 CDS complement(409087..410259) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970052.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 CDS complement(410381..411031) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844806.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS complement(411031..411837) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434152.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 CDS 411985..412881 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434149.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 CDS 412889..414184 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970230.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 414267..414500 product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090751.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS complement(414564..415334) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528029.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS 415557..416522 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532888.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS 416686..417636 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532889.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS 417641..419674 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 419674..420585 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528030.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS 420582..423023 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528031.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 423113..423385 product Ni(II)/Co(II)-sensing transcriptional repressor DmeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971229.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 gene dmeR CDS 423473..424468 product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971230.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 gene dmeF CDS complement(424482..425123) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170453.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS 425204..426109 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528033.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS 426312..427340 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242815.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS 427565..429085 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242816.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 429108..430097 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242817.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS 430099..431106 product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242818.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS 431103..432098 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255513.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 432111..433859 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255514.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 433832..434674 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160785845.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS 434704..436233 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982203.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 436251..437855 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242823.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS 437926..438174 product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395819.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS 438171..438584 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528323.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS complement(438641..439303) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973419.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS 439547..440812 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315508.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 CDS 440831..441598 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973420.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS 441608..442417 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973421.1 transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 442425..444017 product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973422.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 444028..445758 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973423.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS complement(445962..446807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(446836..447402) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028020.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(447435..448520) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(448550..449389) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315206.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(449391..450299) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976104.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS complement(450301..451374) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532490.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 gene ugpC CDS complement(451371..452315) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 CDS complement(452312..453097) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804961.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 gene nagB CDS complement(453094..453969) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612349.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(454081..455349) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061333.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 455663..456004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 CDS complement(456167..456883) product DUF6065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970027.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(456988..457296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327215.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS complement(457289..457825) product DUF6151 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066657.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS complement(457776..458456) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(458917..459657) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967077.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS complement(459654..460184) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS 460308..461696 product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967075.1 transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS complement(461778..462767) product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061276.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 gene nadE CDS complement(462764..464302) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525355.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(464316..464570) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392338.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS complement(464573..466528) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392336.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 gene asnB CDS complement(466533..467609) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061288.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS complement(467791..468573) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967150.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 CDS 468625..469029 product MerR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967151.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 CDS 469263..470381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 470436..471986 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970036.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS 471990..472961 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523896.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS 472976..474511 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533079.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 474508..475284 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533078.1 transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS 475281..477011 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167355198.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS 477008..478006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(478085..484879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391988.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS complement(485067..487082) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061583.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 CDS complement(487088..487564) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067313.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS 487727..490021 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992291.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 490018..490287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971704.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS complement(490465..492561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(492642..494519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(494528..496747) product antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339364.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(496744..497184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS complement(497300..498976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS complement(499391..500341) product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975367.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 gene araH CDS complement(500338..501852) product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969238.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 gene araG CDS complement(501931..502914) product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975369.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 CDS 503100..503870 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028053684.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 sequence24 source 1..43629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 53..826 product L-iditol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240170.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS 883..2367 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969938.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS 2432..3139 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525568.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 3139..4722 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969937.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS complement(5055..5849) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394504.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS 5981..6187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 6195..6749 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329263.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 CDS 6872..8377 product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969936.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 CDS complement(8409..8840) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS complement(8904..9302) product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394510.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS complement(9429..10217) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394513.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 CDS complement(10222..11343) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240161.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS complement(11330..12271) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329256.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS complement(12350..13396) product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329255.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 CDS 13630..14061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394543.1 transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS 14108..15019 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066558.1 transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS 15175..15819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS 15843..16085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44250 CDS 16157..16471 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536354.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 16468..16839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(16842..17210) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969927.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(17215..17631) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329247.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS 17770..18330 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329246.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS 18372..18713 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536339.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS 18821..19606 product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312095.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 19614..20657 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033050513.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 CDS complement(20660..21676) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401259.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS 21984..23123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44350 CDS complement(23323..24942) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972717.1 transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(24966..25313) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311983.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS complement(25329..26651) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972710.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS complement(26656..27537) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972711.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(27549..28499) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972712.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(28610..30256) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972713.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS complement(30320..31657) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972714.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS complement(31657..32361) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972715.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS complement(32358..32843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS complement(33080..34015) product bestrophin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853391.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS 34196..36463 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919123.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 CDS 36556..37968 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968659.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS 37974..38978 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968658.1 transl_table 11 codon_start 1 locus_tag LOCUS_44480 gene cydB CDS 39109..39273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 39283..39867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS complement(39933..41165) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921042.1 transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 41468..43348 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083506.1 transl_table 11 codon_start 1 locus_tag LOCUS_44520 gene dnaK sequence25 source 1..43589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44530 CDS complement(785..2005) product plasmid replication protein RepC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244395.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 gene repC CDS complement(2161..3135) product plasmid partitioning protein RepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858028.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 gene repB CDS complement(3206..4414) product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858029.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 gene repA CDS 4863..5864 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968073.1 transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 6038..7072 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243941.1 transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS 7069..7380 product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968075.1 transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS 7459..8403 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243939.1 transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 8452..9657 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878467.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS 9657..10505 product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234782017.1 transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(10517..13168) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243656.1 transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS complement(13202..13573) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396390.1 transl_table 11 codon_start 1 locus_tag LOCUS_44640 CDS complement(13599..15350) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061346.1 transl_table 11 codon_start 1 locus_tag LOCUS_44650 gene treZ CDS 15649..17733 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396397.1 transl_table 11 codon_start 1 locus_tag LOCUS_44660 gene glgX CDS 17743..18768 product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242618.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(18779..19081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44680 CDS complement(19066..19332) product DUF982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976125.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 CDS complement(19329..19721) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061317.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(19735..19941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44710 CDS 20078..20860 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061320.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS 21045..24770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS 24858..25049 product DUF3008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014762197.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 CDS 25072..25449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44750 CDS complement(25537..27120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS complement(27318..27905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44770 note possible pseudo, frameshifted CDS complement(27839..28255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(28371..30131) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971373.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS 30398..31351 product DUF1403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525334.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS 31354..32040 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525335.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 CDS complement(32078..33523) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970007.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 CDS complement(33654..35198) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970008.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(35228..36091) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170158.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS complement(36093..37721) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972985.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS complement(37718..38536) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066662.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS complement(38533..39477) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066663.1 transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS complement(39654..40559) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972988.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS complement(40773..41906) product tricarballylate utilization 4Fe-4S protein TcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085110.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 gene tcuB CDS complement(41903..43324) product FAD-dependent tricarballylate dehydrogenase TcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966591.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 gene tcuA sequence26 source 1..41089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..861) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336749.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 1060..1869 product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014528764.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 gene hisN CDS 1896..2963 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808774.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS 2960..4603 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808776.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS 4705..5706 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(5834..6841) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(6869..8215) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(8212..9717) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331281.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(9714..10619) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331282.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(10818..11843) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395757.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 CDS 12015..13010 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252613.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS 13081..15105 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395834.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS complement(15152..16189) product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105384672.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS complement(16182..17069) product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241012.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(17202..18203) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434654.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 CDS complement(18314..19663) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331280.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS complement(19667..20551) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186540.1 transl_table 11 codon_start 1 locus_tag LOCUS_45070 CDS 20822..21535 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101372.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(21768..27758) product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061269.1 transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS 28074..31391 product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 gene cas9 CDS 31445..32371 product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 transl_table 11 codon_start 1 locus_tag LOCUS_45110 gene cas1 CDS 32443..32742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 repeat_region 32815..34829 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agcctagcagttcagaaatcgcaggccaaccgcaac tRNA complement(35579..35655) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(35823..36608) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396011.1 transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS complement(36623..37936) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396013.1 transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS complement(38153..39193) product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329224.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 gene xylF CDS 39437..40657 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976024.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 sequence27 source 1..40541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..1034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240927.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(1031..1564) product tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379686.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 CDS complement(1569..2198) product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532680.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS complement(2195..3040) product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971363.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS 3212..3817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973694.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS complement(3821..4603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391177.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS complement(4620..4877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969047.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS complement(4982..5398) product TIGR02301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974910.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS complement(5401..5835) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974911.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS 5896..6675 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971366.1 transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS complement(6707..6889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS complement(7065..7247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS 7494..8927 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971378.1 transl_table 11 codon_start 1 locus_tag LOCUS_45290 gene cysS CDS 9086..9490 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971377.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS 9487..9969 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969049.1 transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS 9966..10463 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969051.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS 10460..10579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS 10590..11072 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532558.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS 11069..12028 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969052.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 gene pip CDS 12211..13827 product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974919.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 gene cimA CDS 13936..14880 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391171.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 gene rarD CDS 14884..15417 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS complement(15454..16074) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974921.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS 16237..18624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS 18815..20710 product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969054.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS complement(20711..21358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 21900..22598 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969055.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS 22699..23550 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974925.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 gene pssA CDS 23689..24144 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969062.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS 24141..25844 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969063.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS 25850..26887 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974937.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS complement(27076..27816) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240909.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 CDS complement(27828..29321) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314558.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 gene purF CDS complement(29516..30124) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379721.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS complement(30268..31671) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971380.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 gene radA CDS complement(31794..32963) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327819.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 gene alr CDS 33101..33670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(33839..35338) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531702.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(35526..36812) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532522.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS 36696..36902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS complement(37036..37611) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531697.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 gene rplI CDS complement(37632..38606) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327825.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 CDS complement(38819..39067) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707461.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 gene rpsR CDS complement(39092..39544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS 39915..40271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45610 sequence28 source 1..40306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 914..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS 1677..1919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS 2121..2342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS 2495..2839 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 2836..3138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS complement(3162..3416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS complement(3450..4379) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103973.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 CDS complement(4457..4888) product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703394.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 CDS complement(5011..5469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45710 CDS complement(5479..6204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45720 CDS complement(6284..6613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS 6923..7300 product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388103.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS complement(7578..7856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45750 CDS 7834..8163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 8181..9629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS 9626..11575 product conjugal transfer protein TraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533272.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS 11572..12129 product conjugative transfer signal peptidase TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970269.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 gene traF CDS 12126..12899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 12896..16138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS 16253..18271 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829508.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 gene topA CDS 18268..18438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS 18435..18803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS 18872..19408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS 20224..20868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS 21031..21315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS complement(21386..21607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS 21699..21932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45890 CDS 21935..22558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS 22616..22849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS 22939..23163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS 23257..24048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45930 CDS 24390..24653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45940 CDS complement(24739..26052) product IncP-type conjugal transfer protein TrbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974832.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 gene trbI CDS complement(26045..26521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS complement(26524..27438) product P-type conjugative transfer protein TrbG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974834.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 gene trbG CDS complement(27459..28157) product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS complement(28252..29823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS complement(29823..29993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS complement(29993..30754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46010 CDS complement(30732..33230) product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970257.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS complement(33241..33555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS complement(33552..33947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS complement(33951..34916) product P-type conjugative transfer ATPase TrbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633597.1 transl_table 11 codon_start 1 locus_tag LOCUS_46050 gene trbB CDS complement(35166..35414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 35584..36183 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088057164.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 CDS 36281..36913 product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368641.1 transl_table 11 codon_start 1 locus_tag LOCUS_46080 gene parA CDS 36910..37197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS 37315..37635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 CDS 37833..39281 product replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042065.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS 39450..39749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015042066.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS 39899..40192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46130 sequence29 source 1..39546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..1129) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983961.1 transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS complement(1327..3396) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526651.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 CDS 3720..4604 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974875.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 gene dapA CDS 4606..5085 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974876.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 gene smpB CDS complement(5110..5580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(5802..6377) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311253.1 transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS complement(6681..6863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 6789..7193 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311530.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 gene rpoZ CDS 7382..9613 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327768.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 9785..9937 product DUF3563 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064506643.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 10085..10636 product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655338.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 10633..11043 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971345.1 transl_table 11 codon_start 1 locus_tag LOCUS_46250 gene acpS CDS complement(11009..11203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46260 CDS 11270..12040 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527287.1 transl_table 11 codon_start 1 locus_tag LOCUS_46270 gene lepB CDS 12037..12756 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969021.1 transl_table 11 codon_start 1 locus_tag LOCUS_46280 gene rnc CDS 12765..13709 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974885.1 transl_table 11 codon_start 1 locus_tag LOCUS_46290 gene era CDS complement(13714..14679) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969027.1 transl_table 11 codon_start 1 locus_tag LOCUS_46300 CDS complement(14749..17112) product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968870.1 transl_table 11 codon_start 1 locus_tag LOCUS_46310 CDS complement(17099..18193) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392694.1 transl_table 11 codon_start 1 locus_tag LOCUS_46320 CDS 18377..20686 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391213.1 transl_table 11 codon_start 1 locus_tag LOCUS_46330 CDS 20832..21725 product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445499.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 gene bla CDS complement(21757..22080) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969033.1 transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS 22152..22640 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527272.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS 22655..23017 product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974894.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 CDS complement(23064..23795) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379663.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS 24001..24765 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552519.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 gene recO CDS 24762..25271 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532579.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS complement(25374..26279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS 26443..29295 product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974897.1 transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS 29332..29985 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532655.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 CDS 30065..30910 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391196.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS complement(30907..31899) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968502.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 gene corA CDS 32245..33435 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969038.1 transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS 33606..34685 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974901.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 gene nadA CDS 34906..36504 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391192.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS 36691..37095 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971377.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS 37092..37997 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391199.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 gene nadC CDS 38067..38582 product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129937.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS complement(38586..39416) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971360.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 sequence30 source 1..38647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 77..280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 273..530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS 527..889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS 902..1738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS 2215..2979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS 3265..3939 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074390.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 CDS 3936..4232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 4286..4690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS complement(4719..5051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS complement(5048..5302) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS complement(5423..5794) product DUF1515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456612.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS complement(5902..6144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153451468.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS complement(6141..6938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS complement(7019..9283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS complement(9301..9978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(9989..11764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46680 CDS complement(11764..12153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS complement(12156..12731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149765254.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS complement(12728..16018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS 16158..16634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS 16672..17307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS complement(17300..17467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(17500..17979) product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975483.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS complement(17976..18413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS complement(18441..18830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS complement(18827..19255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(19252..19431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS complement(19431..19823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS complement(19823..20371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS complement(20374..20556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS complement(20620..21900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS complement(21999..22583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(22567..23835) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS complement(23835..25652) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS complement(25636..26100) product P27 family phage terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336919.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 CDS complement(26350..26736) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183394652.1 transl_table 11 codon_start 1 locus_tag LOCUS_46880 CDS complement(26850..27527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46890 CDS complement(27511..28347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46900 note possible pseudo, frameshifted CDS complement(28337..28690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46910 CDS complement(28687..29013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46920 CDS complement(29015..29551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972614.1 transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS complement(29548..30357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46940 CDS complement(30354..32516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46950 CDS complement(32518..32769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS complement(32772..33278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970897.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 CDS 33396..33716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS 33862..34575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46990 CDS complement(34572..34817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS 35018..35215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS 35278..35448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS 35445..35657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47030 CDS 35654..35917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47040 CDS 35910..36248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47050 CDS 36241..36780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS 36770..37132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS 37125..37337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS 37330..37881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47090 CDS complement(37878..38207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS complement(38209..38475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47110 sequence31 source 1..35060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 416..1600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537581.1 transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS complement(1605..2618) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086752.1 transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS complement(2644..2988) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086753.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS complement(3015..4328) product amino acid deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086758.1 transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(4321..5277) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113699.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 CDS complement(5274..6215) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974943.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS complement(6212..7177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS complement(7174..8682) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530864.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS complement(8716..9786) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969741.1 transl_table 11 codon_start 1 locus_tag LOCUS_47200 CDS 10011..10793 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018012046.1 transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS complement(10804..12021) product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401262.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS 12127..12528 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS complement(12554..14176) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973389.1 transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS 14352..15089 product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724361.1 transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS 15297..16559 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS 16855..17064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS 17061..17249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS 17748..18215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS 18212..18430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS 18464..18985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS 19107..19778 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921628.1 transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS 20048..20269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 20269..20523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 20520..22016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS 22028..22642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 22730..23428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47370 CDS complement(23636..23848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS 23772..24824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 24841..27075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS complement(27240..27524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 27575..27883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS 28061..28483 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS complement(28545..29105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS 29122..29385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS complement(29336..29533) product DUF2158 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527958.1 transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS 29656..29835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS complement(29921..30196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS 31295..31954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS 31955..32269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47500 tRNA complement(32508..32597) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 32922..33293 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067213.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 gene rplU CDS 33319..33588 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492686.1 transl_table 11 codon_start 1 locus_tag LOCUS_47520 gene rpmA CDS 33714..34346 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310872.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS 34343..34933 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067216.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 sequence32 source 1..35035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..1387) product D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972812.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS complement(1384..2355) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257467.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS 2697..4010 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257469.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS 4150..4920 product galactitol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972809.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS 4924..5946 product D-altritol 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972808.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS 6040..7071 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972807.1 transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS complement(7120..8058) product choline kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400536.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS complement(8070..8999) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336754.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(8986..10254) product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268181.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS complement(10247..11005) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364616.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS complement(10995..12818) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336752.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS complement(12818..13735) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336751.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS complement(13737..14717) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722098.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS complement(14781..16346) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562511.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS complement(16319..17788) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463318.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS 18042..18707 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337082.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS 18783..19343 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140078.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS 19340..20317 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337080.1 transl_table 11 codon_start 1 locus_tag LOCUS_47720 gene bioB CDS complement(20386..21828) product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090565.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS complement(21825..22331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS complement(22399..23454) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090563.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(23727..25148) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122347.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 gene cls CDS 25226..25630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS complement(25650..26042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47780 CDS complement(26039..26269) product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031814.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS complement(26297..27097) product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113207.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS complement(27090..28145) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063707.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS complement(28199..28393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS complement(28452..28706) product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967854.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 CDS complement(28732..31341) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 gene clpB CDS complement(31510..33543) product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS complement(33536..34921) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 sequence33 source 1..34966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..1333) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972801.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS 1445..2266 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972800.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS 2394..3173 product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528807.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 gene cobF CDS complement(3182..3673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS 3614..4519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS 4516..5148 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067032.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 5145..5888 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528814.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS 5885..6649 product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970291.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS complement(6613..7383) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531081.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS 7376..8638 product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394056.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS 8635..9399 product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970288.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 gene cobM CDS complement(9396..10259) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971057.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS 10392..11369 product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256280.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 CDS complement(11376..15170) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530215.1 transl_table 11 codon_start 1 locus_tag LOCUS_48000 gene metH CDS complement(15254..15469) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS 16208..24706 product cyclic beta-(1,2)-glucan synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400777.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 gene ndvB CDS 24732..25901 product OpgC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970543.1 transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(25911..27668) product glucan ABC transporter ATP-binding protein/ permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330307.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS 27982..28710 product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390409.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 28929..32387 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400767.1 transl_table 11 codon_start 1 locus_tag LOCUS_48060 gene pyc CDS 32519..33070 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393929.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS complement(33075..33449) product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310858.1 transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS complement(33858..34577) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970510.1 transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS 34705..34923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48100 sequence34 source 1..330120 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..1157) product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387540.1 transl_table 11 codon_start 1 locus_tag LOCUS_48110 gene iolG CDS complement(1285..2304) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530546.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS complement(2357..3895) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530544.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS complement(4000..4929) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530542.1 transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(5187..5999) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392194.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS complement(6164..7195) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975437.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS 7358..8443 product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061916.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS 8470..8784 product MocE family 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061915.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS 8837..10060 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456630.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS 10081..10875 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393072.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS 10936..11160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329220.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS complement(11191..11694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976018.1 transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(11706..12713) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850489.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS 12970..14043 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329217.1 transl_table 11 codon_start 1 locus_tag LOCUS_48240 gene chvE CDS 14162..15697 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061407.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 gene gguA CDS 15697..16905 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535527.1 transl_table 11 codon_start 1 locus_tag LOCUS_48260 gene gguB CDS 17035..18030 product GguC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976015.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 gene gguC CDS 18079..19512 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329213.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS 19566..21305 product L-arabinonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976013.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 gene araD CDS complement(21512..21898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48300 CDS 21818..22201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48310 note possible pseudo, frameshifted CDS complement(22303..23124) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396033.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(23137..24078) product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329210.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(24083..25474) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850494.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS 25824..26708 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329207.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(26944..28374) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976005.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(28731..29831) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651665.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS 30045..30497 product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061418.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(30516..32165) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531197.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS 32363..36004 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972238.1 transl_table 11 codon_start 1 locus_tag LOCUS_48400 CDS complement(36009..36731) product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972237.1 transl_table 11 codon_start 1 locus_tag LOCUS_48410 gene mnmD CDS 36730..37908 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976003.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS complement(37916..38290) product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214685.1 transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS 38427..39359 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976001.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 gene puuE CDS 39356..39853 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972234.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 gene uraD CDS 39905..40399 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061424.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 CDS 40407..40769 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329197.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 gene uraH CDS complement(40766..42073) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975974.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 gene guaD CDS complement(42079..43311) product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396043.1 transl_table 11 codon_start 1 locus_tag LOCUS_48490 CDS 43471..44184 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976098.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS complement(44188..45081) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242665.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 CDS 45183..45362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48520 CDS complement(45359..46198) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162991820.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 gene xdhC CDS complement(46354..47127) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396047.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS 47324..48817 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396049.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 gene glpK CDS 48864..49481 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973484.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS 49582..49956 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527752.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS 49953..51209 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968534.1 transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS 51289..51771 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252527.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS 51830..52081 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766946.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 CDS 52081..52503 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766948.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 CDS 52586..53647 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396053.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS 53693..54445 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387469.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 gene map CDS 54701..55966 product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242673.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 gene sbmA CDS complement(55976..56989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242674.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS 57129..57713 product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972211.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 CDS 57815..58486 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329180.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 CDS 58579..60012 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396062.1 transl_table 11 codon_start 1 locus_tag LOCUS_48680 gene der CDS complement(60208..61122) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396064.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS complement(61141..62145) product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024501902.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS 62297..63940 product alpha-glucosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396066.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS complement(64007..64276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS complement(64273..64473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530089.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS complement(64531..66225) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992329.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 gene ade CDS complement(66306..67175) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193666682.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 CDS 67339..67839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS 67871..68281 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS 68278..69900 product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205826934.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS complement(69953..71278) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066540.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS complement(71466..71804) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066532.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS complement(71985..72749) product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969914.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS complement(72829..73869) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329172.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 gene choV CDS complement(73866..74738) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396090.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 gene choW CDS complement(75004..75963) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396076.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 CDS 76193..76780 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969910.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS 76809..77186 product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242689.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS 77358..78446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066527.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 CDS 78634..79782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066526.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 CDS 79941..81851 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982167.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 CDS 82167..82574 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968936.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS 82585..83886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396098.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS 83879..85027 product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242696.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 CDS 85272..86951 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS complement(87181..87687) product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396102.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS complement(87794..88324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS complement(88716..89024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS 89418..91607 product anthranilate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396108.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS 91739..92659 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066517.1 transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS 92646..93110 product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066516.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 gene queF CDS complement(93141..93719) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396117.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS 93965..94543 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 CDS 95044..96753 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969894.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 gene leuA CDS complement(96844..97701) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066508.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 CDS complement(97701..98144) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329149.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 CDS complement(98416..99033) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329148.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 CDS complement(99163..100065) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329147.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS 100176..100673 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976409.1 transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS complement(100676..101662) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS 101874..102476 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028001159.1 transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS complement(102645..103178) product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254559.1 transl_table 11 codon_start 1 locus_tag LOCUS_49100 CDS complement(103366..105438) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969885.1 transl_table 11 codon_start 1 locus_tag LOCUS_49110 CDS complement(105440..108247) product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969884.1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 CDS complement(108244..109164) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976403.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS complement(109179..110192) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400794.1 transl_table 11 codon_start 1 locus_tag LOCUS_49140 CDS 110387..111004 product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534495.1 transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS 111001..111633 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976400.1 transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS 111630..112907 product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969879.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 CDS complement(113001..113192) product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976398.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 CDS complement(113358..113606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49190 CDS complement(113692..114603) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396602.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 gene hemF CDS 114775..115032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975698.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 CDS complement(115037..115429) product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088015.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS 115525..116397 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532847.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS 116510..117790 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530058.1 transl_table 11 codon_start 1 locus_tag LOCUS_49240 CDS complement(117829..118263) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969496.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 gene soxR CDS 118362..118934 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396586.1 transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS 118931..120139 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS complement(120216..120677) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254662.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS 121130..122983 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975693.1 transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS 123092..123364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 123361..123672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS 123749..125617 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972168.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS 125882..126460 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975691.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 gene petA CDS 126475..127743 product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240454.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 CDS 127771..128649 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969491.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS 128757..129299 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534501.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 CDS complement(129488..129955) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976396.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS complement(129942..130418) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976395.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS complement(130425..131528) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972160.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 gene ychF CDS 131687..131998 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708843.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 gene clpS CDS 132039..132404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS complement(132408..133163) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037437113.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 gene pth CDS complement(133196..133945) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400818.1 transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS complement(133966..136359) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400820.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 CDS complement(136591..137199) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311165.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 CDS 137434..138888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49460 CDS complement(138892..140049) product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054209.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 CDS 140509..141438 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969872.1 transl_table 11 codon_start 1 locus_tag LOCUS_49480 CDS 141589..143097 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329122.1 transl_table 11 codon_start 1 locus_tag LOCUS_49490 CDS 143225..143599 product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329121.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 CDS complement(143770..144330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49510 CDS complement(144406..145338) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532875.1 transl_table 11 codon_start 1 locus_tag LOCUS_49520 CDS complement(145463..146227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532877.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS complement(146345..147496) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976382.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS complement(147534..148325) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969870.1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 gene pgeF CDS complement(148429..149529) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844743.1 transl_table 11 codon_start 1 locus_tag LOCUS_49560 CDS complement(149542..150384) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651060.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 gene lgt CDS 150595..150852 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969867.1 transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS 151244..151744 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532890.1 transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS 151747..152565 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969866.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 gene proC CDS 152759..153100 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969865.1 transl_table 11 codon_start 1 locus_tag LOCUS_49610 CDS 153094..153282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS complement(153279..153863) product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS complement(153941..155323) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532899.1 transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS complement(155460..156167) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976373.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS complement(156200..156706) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976372.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS 156947..157834 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 CDS complement(157889..158101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49680 CDS complement(158406..159509) product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532312.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 gene hppD CDS 159639..160097 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532311.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 CDS 160235..160399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS 160547..161194 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532905.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 CDS complement(161536..161997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS complement(162132..162347) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003494703.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS complement(162808..163980) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396744.1 transl_table 11 codon_start 1 locus_tag LOCUS_49750 CDS complement(164055..164255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49760 CDS complement(164429..165349) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316373.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 CDS 165661..166863 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329081.1 transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS 167099..167341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49790 CDS complement(167424..168518) product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972133.1 transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS complement(168672..169793) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975407.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 CDS complement(169825..170130) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969306.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 CDS complement(170634..171530) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529555.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS complement(171643..172617) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240370.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 gene trxB CDS 172870..173337 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310592.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS complement(173392..174351) product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920689.1 transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS complement(174353..176584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS 176698..177429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS complement(177531..178481) product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639972.1 transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS complement(178482..179552) product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857595.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 gene gmd CDS complement(179606..180682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49910 CDS complement(180700..181176) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529568.1 transl_table 11 codon_start 1 locus_tag LOCUS_49920 gene greA CDS complement(181571..185053) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969315.1 transl_table 11 codon_start 1 locus_tag LOCUS_49930 gene carB CDS complement(185242..185856) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS 185902..187083 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 CDS complement(187236..188042) product OXA-42 family oxacillin-hydrolyzing class D beta-lactamase OXA-59 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524931.1 transl_table 11 codon_start 1 locus_tag LOCUS_49960 gene blaOXA CDS 188153..189040 product LysR family transcriptional regulator AmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101291.1 transl_table 11 codon_start 1 locus_tag LOCUS_49970 gene ampR CDS complement(189037..190068) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969316.1 transl_table 11 codon_start 1 locus_tag LOCUS_49980 CDS complement(190137..190796) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530077.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS complement(190875..191672) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004430439.1 transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS 191763..192284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS 192394..193332 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975420.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(193316..193906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS complement(194107..195105) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397659.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS 195210..196112 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397661.1 transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS 196256..197509 product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969318.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS 197661..199046 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397667.1 transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS complement(199314..200522) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396757.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 gene carA CDS 200846..201295 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532937.1 transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 201545..201883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214922.1 transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS 201969..203957 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 gene dnaG CDS complement(203973..204356) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063783.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS 204499..206364 product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969854.1 transl_table 11 codon_start 1 locus_tag LOCUS_50130 gene recQ CDS 206438..206917 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392267.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS complement(206934..207704) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314989.1 transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS 207838..208566 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969706.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 CDS 208695..209150 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS 209197..210384 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242757.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS 210418..211455 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329071.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 gene tdh CDS 211470..211817 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189643.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 CDS 212235..214289 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387243.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 gene rpoD CDS complement(214571..214954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS 215130..216776 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976330.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS complement(216777..217550) product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312207.1 transl_table 11 codon_start 1 locus_tag LOCUS_50240 gene tam CDS complement(217562..218212) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241077.1 transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS complement(218478..219518) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327675.1 transl_table 11 codon_start 1 locus_tag LOCUS_50260 CDS 219703..220584 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241072.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 CDS complement(220880..221986) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314633.1 transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS 222288..222860 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537532.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 CDS 222952..223461 product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS 223567..223920 product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387235.1 transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS 223973..224098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS 224110..224532 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396765.1 transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS 224673..225023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS 225136..225519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS complement(225947..226702) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537551.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 tRNA 226857..226932 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(226889..228538) product 5-guanidino-2-oxopentanoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974947.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS complement(228540..229505) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974948.1 transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS complement(229499..231226) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974949.1 transl_table 11 codon_start 1 locus_tag LOCUS_50390 CDS complement(231255..232838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974950.1 transl_table 11 codon_start 1 locus_tag LOCUS_50400 CDS 232955..233863 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974951.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 CDS 233968..235059 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974952.1 transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS 235125..236240 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974953.1 transl_table 11 codon_start 1 locus_tag LOCUS_50430 CDS 236249..237082 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974954.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS 237084..237890 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974955.1 transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS 237924..239318 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530415.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS complement(239376..240884) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939112.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 CDS complement(240926..241819) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938368.1 transl_table 11 codon_start 1 locus_tag LOCUS_50480 CDS complement(241804..242850) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 CDS complement(242847..244370) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 transl_table 11 codon_start 1 locus_tag LOCUS_50500 CDS complement(244432..245502) product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970675.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 CDS complement(245612..245932) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810016.1 transl_table 11 codon_start 1 locus_tag LOCUS_50520 CDS complement(245929..247560) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 transl_table 11 codon_start 1 locus_tag LOCUS_50530 CDS complement(247563..248414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS 248639..249316 product HTH-type transcriptional regulator RutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708997.1 transl_table 11 codon_start 1 locus_tag LOCUS_50550 gene rutR CDS 249718..251478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS 251506..252723 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 CDS 252779..253663 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975588.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS 253660..254487 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532946.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS 254491..255270 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 CDS 255273..256031 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970645.1 transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS 256043..257113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528388.1 transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS 257115..258167 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606037.1 transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS 258167..259027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS 259024..260169 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027054.1 transl_table 11 codon_start 1 locus_tag LOCUS_50650 CDS 260174..261403 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970568.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 CDS complement(261505..262473) product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS complement(262470..263486) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS complement(263495..264412) product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS complement(264433..265302) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047036674.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 CDS complement(265310..266269) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089452.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 CDS complement(266516..268102) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS complement(268099..268830) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727258.1 transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS 269064..270605 product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827463.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS 270639..271805 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056548.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS 271973..273526 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528016.1 transl_table 11 codon_start 1 locus_tag LOCUS_50760 CDS 273681..274139 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528017.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 CDS 274189..274548 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528018.1 transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS 274777..275637 product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971568.1 transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS complement(275687..276319) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974561.1 transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS complement(276353..277573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241289.1 transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS 277660..278358 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040854.1 transl_table 11 codon_start 1 locus_tag LOCUS_50820 CDS 278404..279618 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969494.1 transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(279753..280052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS complement(280105..280302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS 280879..281898 product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201215949.1 transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS 282078..283226 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815068.1 transl_table 11 codon_start 1 locus_tag LOCUS_50870 CDS 283228..284322 product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815066.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS 284315..285757 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925697.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS 285855..287444 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650617.1 transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS 287441..288037 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971405.1 transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS 288145..288630 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS 288792..289760 product cellulose biosynthesis protein BcsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970093.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 gene bcsN CDS 289842..292013 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970094.1 transl_table 11 codon_start 1 locus_tag LOCUS_50940 gene bcsA CDS 292013..294361 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876943.1 transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS 294577..296751 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254932.1 transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS 296787..297167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529504.1 transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(297179..297838) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554867.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS 298158..299849 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970803.1 transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS 299936..300613 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313721.1 transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS 300610..301995 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973503.1 transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS 302168..302389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 302539..303924 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074304.1 transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS 303917..305929 product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074303.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 CDS 306167..307819 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974092.1 transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS 308003..308779 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392253.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS complement(309107..309361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(309432..310280) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329023.1 transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS 310410..312860 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329022.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 CDS 312857..315304 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969822.1 transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS 315301..316146 product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098657.1 transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS 316139..317677 product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396876.1 transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS complement(317695..318138) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577593.1 transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS 318248..318808 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329018.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 CDS complement(318905..319420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969820.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS complement(319479..320588) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976324.1 transl_table 11 codon_start 1 locus_tag LOCUS_51160 CDS complement(320585..321343) product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969818.1 transl_table 11 codon_start 1 locus_tag LOCUS_51170 gene fhuF CDS complement(321348..323522) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396885.1 transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS complement(323665..323838) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887622.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS complement(324221..325648) product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534222.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 CDS complement(325764..326579) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969816.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS complement(326569..327519) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969815.1 transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS complement(327516..328511) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976318.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 CDS complement(328756..329916) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969813.1 transl_table 11 codon_start 1 locus_tag LOCUS_51240 sequence35 source 1..15612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(439..1863) product malonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845126.1 transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS complement(1860..3176) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970023.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS complement(3173..3748) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970022.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS complement(3819..4790) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967084.1 transl_table 11 codon_start 1 locus_tag LOCUS_51280 gene dctP CDS 4940..5614 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970020.1 transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS 5941..6840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS complement(6929..7135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51310 CDS 7049..8014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51320 note possible pseudo, frameshifted CDS 7969..8430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS complement(8628..9335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS complement(9453..10346) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528510.1 transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 10480..11667 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528509.1 transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS 11783..12133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS 12176..13279 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528508.1 transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS complement(13473..14381) product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530654.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS complement(14452..14694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51400 CDS 14579..15442 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003071365.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 sequence36 source 1..10471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 350..1171 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391934.1 transl_table 11 codon_start 1 locus_tag LOCUS_51420 CDS 1210..3798 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 transl_table 11 codon_start 1 locus_tag LOCUS_51430 gene mgtA CDS 3859..4452 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967613.1 transl_table 11 codon_start 1 locus_tag LOCUS_51440 CDS complement(4466..5449) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396347.1 transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS complement(5521..5946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS complement(6064..6264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095080464.1 transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS complement(6301..6705) product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974418.1 transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS complement(6780..7427) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525373.1 transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS complement(7541..8167) product response regulator FixJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967648.1 transl_table 11 codon_start 1 locus_tag LOCUS_51500 gene fixJ CDS complement(8157..9665) product oxygen sensor histidine kinase FixL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967649.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 gene fixL CDS 9791..10048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51520 sequence37 source 1..6401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 393..1873 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 2128..2204 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 2321..2396 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 rRNA 2906..5778 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 CDS 5812..6027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51530 rRNA 6112..6221 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 6325..6401 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 sequence38 source 1..2876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..2876 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393923.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 gene acnA sequence39 source 1..2799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 74..874 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972813.1 transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS 943..1767 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528415.1 transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 1791..2792 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528416.1 transl_table 11 codon_start 1 locus_tag LOCUS_51570 sequence40 source 1..2516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 980..1504 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526659.1 transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS 1564..1992 product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 misc_feature complement(1943..>2516) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869596.1:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_51600 sequence41 source 1..2499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..663 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973949.1:3-oxoacid CoA-transferase subunit A locus_tag LOCUS_51610 CDS 660..1364 product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973950.1 transl_table 11 codon_start 1 locus_tag LOCUS_51620 sequence42 source 1..1780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 21..1490 product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267884.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 gene arcD sequence43 source 1..1499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence44 source 1..1140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence45 source 1..310901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 145..789 product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067291.1 transl_table 11 codon_start 1 locus_tag LOCUS_51640 gene ccmA CDS 786..1445 product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982179.1 transl_table 11 codon_start 1 locus_tag LOCUS_51650 gene ccmB CDS 1519..2289 product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970511.1 transl_table 11 codon_start 1 locus_tag LOCUS_51660 CDS 2286..2453 product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529719.1 transl_table 11 codon_start 1 locus_tag LOCUS_51670 gene ccmD CDS 2450..3067 product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067295.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 CDS complement(3112..5172) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398653.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS 5564..6682 product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061326.1 transl_table 11 codon_start 1 locus_tag LOCUS_51700 CDS complement(6861..7025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164497529.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS complement(7189..8706) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530573.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS complement(8717..9202) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969883.1 transl_table 11 codon_start 1 locus_tag LOCUS_51730 CDS complement(9199..10179) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530569.1 transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(10360..11427) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101804541.1 transl_table 11 codon_start 1 locus_tag LOCUS_51750 CDS 11506..12180 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972345.1 transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS 12177..13568 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392187.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS 13858..14343 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876608.1 transl_table 11 codon_start 1 locus_tag LOCUS_51780 CDS 14340..15557 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393947.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 CDS complement(15629..16822) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330161.1 transl_table 11 codon_start 1 locus_tag LOCUS_51800 CDS 17037..17888 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972478.1 transl_table 11 codon_start 1 locus_tag LOCUS_51810 CDS 18036..18677 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252343.1 transl_table 11 codon_start 1 locus_tag LOCUS_51820 CDS complement(18684..19295) product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104401.1 transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS complement(19355..20149) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529683.1 transl_table 11 codon_start 1 locus_tag LOCUS_51840 CDS complement(20149..21027) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067273.1 transl_table 11 codon_start 1 locus_tag LOCUS_51850 CDS complement(21154..22107) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529687.1 transl_table 11 codon_start 1 locus_tag LOCUS_51860 CDS complement(22445..23683) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970499.1 transl_table 11 codon_start 1 locus_tag LOCUS_51870 gene rlmN CDS complement(23833..24726) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968433.1 transl_table 11 codon_start 1 locus_tag LOCUS_51880 CDS 24856..26244 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968432.1 transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS complement(26308..26811) product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330158.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS complement(27229..27618) product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242441.1 transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS complement(27691..27999) product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709729.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 CDS complement(28078..28788) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS complement(28891..30072) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390321.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS 30364..30942 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065997962.1 transl_table 11 codon_start 1 locus_tag LOCUS_51950 gene phaR CDS complement(30976..31383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS complement(31720..31905) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535764.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 gene rpmF CDS complement(32053..32700) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390319.1 transl_table 11 codon_start 1 locus_tag LOCUS_51980 CDS complement(32777..33532) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067328.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 gene mtgA CDS 33668..34585 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970531.1 transl_table 11 codon_start 1 locus_tag LOCUS_52000 CDS 34590..35645 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390315.1 transl_table 11 codon_start 1 locus_tag LOCUS_52010 gene hisC CDS complement(35718..36971) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067340.1 transl_table 11 codon_start 1 locus_tag LOCUS_52020 gene ispG CDS complement(37109..38302) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535755.1 transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS complement(38336..39109) product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577770.1 transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS complement(39266..40126) product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970526.1 transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(40390..40959) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709746.1 transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS complement(41329..41718) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067320.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS complement(41860..42279) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242426.1 transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS complement(42284..45337) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563365.1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 CDS 45728..46366 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531515.1 transl_table 11 codon_start 1 locus_tag LOCUS_52100 CDS complement(46399..46980) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972484.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 gene thpR CDS complement(47063..47707) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067280.1 transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS 47767..48483 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330154.1 transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS 48480..51032 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970504.1 transl_table 11 codon_start 1 locus_tag LOCUS_52140 CDS 51214..51957 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS complement(52201..53679) product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330170.1 transl_table 11 codon_start 1 locus_tag LOCUS_52160 CDS complement(53870..54589) product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393967.1 transl_table 11 codon_start 1 locus_tag LOCUS_52170 gene thiQ CDS complement(54582..56207) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970523.1 transl_table 11 codon_start 1 locus_tag LOCUS_52180 gene thiP CDS complement(56209..57216) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393959.1 transl_table 11 codon_start 1 locus_tag LOCUS_52190 gene thiB CDS complement(57610..58917) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969983.1 transl_table 11 codon_start 1 locus_tag LOCUS_52200 CDS complement(58917..60266) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969984.1 transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS 60403..61098 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969985.1 transl_table 11 codon_start 1 locus_tag LOCUS_52220 CDS complement(61100..61807) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529020.1 transl_table 11 codon_start 1 locus_tag LOCUS_52230 CDS 61958..63226 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527152.1 transl_table 11 codon_start 1 locus_tag LOCUS_52240 CDS complement(63471..63911) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242567.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS 64024..65124 product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970366.1 transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS complement(65279..66511) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330316.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS complement(66518..68041) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242406.1 transl_table 11 codon_start 1 locus_tag LOCUS_52280 CDS complement(68063..69481) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330314.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 CDS complement(69493..70890) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242408.1 transl_table 11 codon_start 1 locus_tag LOCUS_52300 CDS 71061..71957 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535214.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS 72078..73361 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972400.1 transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS 73480..73650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52330 CDS complement(73608..73799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52340 CDS 73783..74166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(74186..75364) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066792.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 CDS complement(75404..76483) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970131.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 CDS 76651..77811 product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133034483.1 transl_table 11 codon_start 1 locus_tag LOCUS_52380 tRNA 77858..77934 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(78246..78626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52390 CDS complement(78657..79373) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067091.1 transl_table 11 codon_start 1 locus_tag LOCUS_52400 CDS 79564..80739 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329990.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 gene dxr CDS complement(80760..81974) product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312336.1 transl_table 11 codon_start 1 locus_tag LOCUS_52420 gene hemA CDS complement(82217..83014) product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970338.1 transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS complement(83026..85377) product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067095.1 transl_table 11 codon_start 1 locus_tag LOCUS_52440 CDS complement(85485..85976) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242602.1 transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS 86440..86703 product glycine zipper domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312335.1 transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS 87064..88899 product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577638.1 transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS 89004..93173 product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972439.1 transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS 93362..93838 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709572.1 transl_table 11 codon_start 1 locus_tag LOCUS_52490 CDS 94233..96002 product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970347.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 CDS complement(96064..96333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52510 CDS complement(96343..97176) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398018.1 transl_table 11 codon_start 1 locus_tag LOCUS_52520 gene fdhD CDS complement(97186..100065) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970349.1 transl_table 11 codon_start 1 locus_tag LOCUS_52530 gene fdhF CDS complement(100121..100336) product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061368.1 transl_table 11 codon_start 1 locus_tag LOCUS_52540 CDS complement(100333..101889) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970350.1 transl_table 11 codon_start 1 locus_tag LOCUS_52550 CDS complement(101886..102365) product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530346.1 transl_table 11 codon_start 1 locus_tag LOCUS_52560 CDS complement(102546..103439) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398030.1 transl_table 11 codon_start 1 locus_tag LOCUS_52570 CDS 103536..104531 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 transl_table 11 codon_start 1 locus_tag LOCUS_52580 CDS complement(104546..105316) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398033.1 transl_table 11 codon_start 1 locus_tag LOCUS_52590 CDS 105463..106233 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330015.1 transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS 106347..107864 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398036.1 transl_table 11 codon_start 1 locus_tag LOCUS_52610 gene glpD CDS 107905..108987 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390044.1 transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS 108998..110068 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242578.1 transl_table 11 codon_start 1 locus_tag LOCUS_52630 CDS 110071..110937 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067118.1 transl_table 11 codon_start 1 locus_tag LOCUS_52640 CDS 110949..111830 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067119.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS 111830..112249 product DUF2160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067120.1 transl_table 11 codon_start 1 locus_tag LOCUS_52660 CDS 112325..114046 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530325.1 transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS complement(114188..114817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS 114968..115876 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS 115873..116439 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090887.1 transl_table 11 codon_start 1 locus_tag LOCUS_52700 CDS 116558..117832 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709166.1 transl_table 11 codon_start 1 locus_tag LOCUS_52710 CDS 117919..120186 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329508.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 gene ptsP CDS 120209..121291 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973615.1 transl_table 11 codon_start 1 locus_tag LOCUS_52730 gene prfA CDS 121288..122160 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970073.1 transl_table 11 codon_start 1 locus_tag LOCUS_52740 gene prmC CDS 122489..123151 product DUF4167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066721.1 transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS 123402..126008 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970072.1 transl_table 11 codon_start 1 locus_tag LOCUS_52760 gene clpB CDS 126148..126813 product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393953.1 transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS 126817..128643 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970520.1 transl_table 11 codon_start 1 locus_tag LOCUS_52780 CDS 128774..129019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS 129258..130181 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972516.1 transl_table 11 codon_start 1 locus_tag LOCUS_52800 gene metA CDS 130185..130637 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529104.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 CDS 130731..131747 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252333.1 transl_table 11 codon_start 1 locus_tag LOCUS_52820 CDS 131991..133898 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968581.1 transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS complement(133966..135033) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398980.1 transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS 135175..136185 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068883688.1 transl_table 11 codon_start 1 locus_tag LOCUS_52850 CDS complement(136918..138405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52860 CDS complement(138426..140807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52870 CDS complement(140807..142258) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS complement(142255..142992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS complement(142992..145424) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS 146182..146376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS 146373..148961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52920 CDS 149352..150626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS 150766..150960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52940 CDS complement(151112..151666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52950 CDS complement(151727..152452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52960 CDS 152989..153516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52970 CDS 153678..154880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52980 tRNA complement(155113..155187) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 155408..155917 product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330108.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 CDS 155975..156937 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970479.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 gene trxA CDS 157066..157746 product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970480.1 transl_table 11 codon_start 1 locus_tag LOCUS_53010 CDS 157757..157945 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709672.1 transl_table 11 codon_start 1 locus_tag LOCUS_53020 CDS complement(158020..159255) product ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393779.1 transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS 159370..160227 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970482.1 transl_table 11 codon_start 1 locus_tag LOCUS_53040 gene tesB CDS 160470..160796 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709636.1 transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS 160826..162187 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970483.1 transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS 162429..165095 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970484.1 transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS 165194..165865 product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910010.1 transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS 165960..166766 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529670.1 transl_table 11 codon_start 1 locus_tag LOCUS_53090 CDS complement(166917..167372) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067262.1 transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS complement(167443..168126) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310886.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS 168282..168782 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092733832.1 transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS 168913..169743 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS complement(169874..170422) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS complement(170461..171870) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393760.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 gene leuC CDS complement(172137..172943) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529754.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS complement(172953..173750) product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970519.1 transl_table 11 codon_start 1 locus_tag LOCUS_53170 CDS complement(173901..174419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53180 CDS complement(174595..174855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53190 CDS 174824..175570 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970518.1 transl_table 11 codon_start 1 locus_tag LOCUS_53200 CDS complement(175552..176313) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067306.1 transl_table 11 codon_start 1 locus_tag LOCUS_53210 gene trmD CDS complement(176249..176827) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310897.1 transl_table 11 codon_start 1 locus_tag LOCUS_53220 gene rimM CDS complement(176943..177308) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529742.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 gene rpsP CDS complement(177345..177668) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310875.1 transl_table 11 codon_start 1 locus_tag LOCUS_53240 CDS complement(177680..179236) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242460.1 transl_table 11 codon_start 1 locus_tag LOCUS_53250 gene ffh CDS 179503..179862 product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087188.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 CDS 179894..181006 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972496.1 transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS 181086..181985 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972495.1 transl_table 11 codon_start 1 locus_tag LOCUS_53280 gene dapF CDS 181982..183259 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393886.1 transl_table 11 codon_start 1 locus_tag LOCUS_53290 gene mtaB CDS 183274..184797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS 184794..185444 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970512.1 transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS 185561..187123 product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067187.1 transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS 187258..189087 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330113.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 gene typA CDS 189304..189810 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531187.1 transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS complement(189827..190429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531186.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS 190564..191100 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310823.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 gene ppa CDS complement(191106..191432) product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242528.1 transl_table 11 codon_start 1 locus_tag LOCUS_53370 CDS complement(191429..191725) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310858.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 CDS complement(191851..192567) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970397.1 transl_table 11 codon_start 1 locus_tag LOCUS_53390 CDS complement(192571..193056) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067180.1 transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS complement(193153..194760) product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330120.1 transl_table 11 codon_start 1 locus_tag LOCUS_53410 CDS complement(194774..196063) product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310857.1 transl_table 11 codon_start 1 locus_tag LOCUS_53420 CDS complement(196162..196887) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067177.1 transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS complement(196893..197822) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970392.1 transl_table 11 codon_start 1 locus_tag LOCUS_53440 gene hemC CDS 197898..198992 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393860.1 transl_table 11 codon_start 1 locus_tag LOCUS_53450 gene tsaD CDS 198989..199975 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330125.1 transl_table 11 codon_start 1 locus_tag LOCUS_53460 CDS 199994..200287 product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330126.1 transl_table 11 codon_start 1 locus_tag LOCUS_53470 CDS 200293..200724 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389839.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 CDS 200780..201442 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508815.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS complement(201458..201922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53500 CDS 202223..202615 product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067169.1 transl_table 11 codon_start 1 locus_tag LOCUS_53510 gene sdhC CDS 202626..203006 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026615499.1 transl_table 11 codon_start 1 locus_tag LOCUS_53520 gene sdhD CDS 203013..204854 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067167.1 transl_table 11 codon_start 1 locus_tag LOCUS_53530 gene sdhA CDS 204873..205652 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531162.1 transl_table 11 codon_start 1 locus_tag LOCUS_53540 CDS 205796..206329 product protease inhibitor Inh/omp19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037456298.1 transl_table 11 codon_start 1 locus_tag LOCUS_53550 CDS 206368..207561 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972456.1 transl_table 11 codon_start 1 locus_tag LOCUS_53560 gene zapE CDS 207728..208690 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393726.1 transl_table 11 codon_start 1 locus_tag LOCUS_53570 gene mdh CDS 208718..209911 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242550.1 transl_table 11 codon_start 1 locus_tag LOCUS_53580 gene sucC CDS 209929..210831 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034802559.1 transl_table 11 codon_start 1 locus_tag LOCUS_53590 gene sucD CDS 210966..213962 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 transl_table 11 codon_start 1 locus_tag LOCUS_53600 CDS 214062..215300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53610 note possible pseudo, internal stop codon CDS 215343..215744 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972451.1 transl_table 11 codon_start 1 locus_tag LOCUS_53620 CDS 215741..216385 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067150.1 transl_table 11 codon_start 1 locus_tag LOCUS_53630 CDS 216389..216877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984018.1 transl_table 11 codon_start 1 locus_tag LOCUS_53640 CDS 216865..217626 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393736.1 transl_table 11 codon_start 1 locus_tag LOCUS_53650 CDS 217652..219058 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393711.1 transl_table 11 codon_start 1 locus_tag LOCUS_53660 gene lpdA CDS 219133..219639 product DUF2867 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330046.1 transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS complement(219643..220725) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393706.1 transl_table 11 codon_start 1 locus_tag LOCUS_53680 CDS complement(220906..221841) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393732.1 transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS 221988..223124 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067142.1 transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS 223183..225387 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067138.1 transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS 225491..225874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330039.1 transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS 226136..226702 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330038.1 transl_table 11 codon_start 1 locus_tag LOCUS_53730 CDS 226702..228231 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530298.1 transl_table 11 codon_start 1 locus_tag LOCUS_53740 gene atpA CDS 228347..229228 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389782.1 transl_table 11 codon_start 1 locus_tag LOCUS_53750 CDS 229255..230784 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067133.1 transl_table 11 codon_start 1 locus_tag LOCUS_53760 gene atpD CDS 230889..231296 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242660.1 transl_table 11 codon_start 1 locus_tag LOCUS_53770 CDS 231519..232946 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655408.1 transl_table 11 codon_start 1 locus_tag LOCUS_53780 CDS complement(232953..233702) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315679.1 transl_table 11 codon_start 1 locus_tag LOCUS_53790 CDS complement(233825..234454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53800 CDS complement(234454..235215) product DUF6030 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970364.1 transl_table 11 codon_start 1 locus_tag LOCUS_53810 CDS complement(235362..236273) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331304.1 transl_table 11 codon_start 1 locus_tag LOCUS_53820 CDS 236377..237519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53830 CDS 237528..239027 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339389.1 transl_table 11 codon_start 1 locus_tag LOCUS_53840 CDS 239053..240177 product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS 240272..241021 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066727.1 transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS complement(241047..241625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS complement(241625..242053) product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394735.1 transl_table 11 codon_start 1 locus_tag LOCUS_53880 CDS complement(242050..242907) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394733.1 transl_table 11 codon_start 1 locus_tag LOCUS_53890 CDS complement(242918..243175) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844816.1 transl_table 11 codon_start 1 locus_tag LOCUS_53900 gene grxC CDS complement(243211..244002) product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066731.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 CDS 244065..244934 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970081.1 transl_table 11 codon_start 1 locus_tag LOCUS_53920 CDS complement(244936..245118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53930 CDS complement(245157..245474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329520.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS complement(245583..246005) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709175.1 transl_table 11 codon_start 1 locus_tag LOCUS_53950 gene mutT CDS complement(246002..246760) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394699.1 transl_table 11 codon_start 1 locus_tag LOCUS_53960 CDS complement(246849..248081) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970084.1 transl_table 11 codon_start 1 locus_tag LOCUS_53970 gene argJ CDS complement(248132..249031) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066738.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 CDS 249269..251995 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533499.1 transl_table 11 codon_start 1 locus_tag LOCUS_53990 gene secA CDS 252272..253699 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533497.1 transl_table 11 codon_start 1 locus_tag LOCUS_54000 CDS 253689..254957 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970087.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS complement(255006..256649) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329527.1 transl_table 11 codon_start 1 locus_tag LOCUS_54020 CDS complement(256726..256989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS complement(257365..257697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS 258109..258666 product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266826.1 transl_table 11 codon_start 1 locus_tag LOCUS_54050 CDS 258653..261220 product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972107.1 transl_table 11 codon_start 1 locus_tag LOCUS_54060 CDS 261440..261697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54070 CDS complement(261625..261972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54080 CDS complement(262042..262428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54090 CDS 262578..262760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54100 tRNA complement(262842..262926) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 263097..263606 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329529.1 transl_table 11 codon_start 1 locus_tag LOCUS_54110 CDS complement(263677..264234) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310944.1 transl_table 11 codon_start 1 locus_tag LOCUS_54120 CDS complement(264341..264997) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970091.1 transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS 265142..266050 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970092.1 transl_table 11 codon_start 1 locus_tag LOCUS_54140 gene gluQRS CDS complement(265997..266941) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970093.1 transl_table 11 codon_start 1 locus_tag LOCUS_54150 CDS 267131..267979 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533481.1 transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS 268081..268278 product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533478.1 transl_table 11 codon_start 1 locus_tag LOCUS_54170 CDS 268286..268864 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 transl_table 11 codon_start 1 locus_tag LOCUS_54180 CDS 268899..269684 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970095.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 CDS 269868..270617 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 transl_table 11 codon_start 1 locus_tag LOCUS_54200 CDS 270641..271570 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066754.1 transl_table 11 codon_start 1 locus_tag LOCUS_54210 CDS 271719..272591 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066755.1 transl_table 11 codon_start 1 locus_tag LOCUS_54220 CDS 272734..273717 product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973096.1 transl_table 11 codon_start 1 locus_tag LOCUS_54230 gene cysP CDS 273850..274671 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973095.1 transl_table 11 codon_start 1 locus_tag LOCUS_54240 gene cysT CDS 274674..275561 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973094.1 transl_table 11 codon_start 1 locus_tag LOCUS_54250 gene cysW CDS 275566..276588 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973093.1 transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS complement(276608..277405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54270 CDS 277305..278708 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441598.1 transl_table 11 codon_start 1 locus_tag LOCUS_54280 gene argH CDS 278813..278998 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066758.1 transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS 279072..280340 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394686.1 transl_table 11 codon_start 1 locus_tag LOCUS_54300 gene lysA CDS 280459..283089 product TIGR02302 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970102.1 transl_table 11 codon_start 1 locus_tag LOCUS_54310 CDS complement(283096..283479) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066761.1 transl_table 11 codon_start 1 locus_tag LOCUS_54320 CDS complement(283631..284179) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497442.1 transl_table 11 codon_start 1 locus_tag LOCUS_54330 gene hpt CDS complement(284272..284946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54340 CDS 285151..285810 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066764.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 gene ftsE CDS 285803..286810 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066765.1 transl_table 11 codon_start 1 locus_tag LOCUS_54360 CDS 286881..287594 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329550.1 transl_table 11 codon_start 1 locus_tag LOCUS_54370 CDS 287730..288518 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970106.1 transl_table 11 codon_start 1 locus_tag LOCUS_54380 CDS complement(288519..289058) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329552.1 transl_table 11 codon_start 1 locus_tag LOCUS_54390 CDS 289156..290163 product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066769.1 transl_table 11 codon_start 1 locus_tag LOCUS_54400 CDS complement(290166..291095) product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844824.1 transl_table 11 codon_start 1 locus_tag LOCUS_54410 CDS complement(291160..291909) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394662.1 transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS 291999..292763 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240047.1 transl_table 11 codon_start 1 locus_tag LOCUS_54430 gene gloB CDS 292763..293185 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394656.1 transl_table 11 codon_start 1 locus_tag LOCUS_54440 CDS complement(293186..294067) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970113.1 transl_table 11 codon_start 1 locus_tag LOCUS_54450 CDS complement(294108..294899) product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394650.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS 295141..295431 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527451.1 transl_table 11 codon_start 1 locus_tag LOCUS_54470 gene rpmB CDS 295592..296230 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973191.1 transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS complement(296352..297353) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394645.1 transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS complement(297385..299235) product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066780.1 transl_table 11 codon_start 1 locus_tag LOCUS_54500 gene cobT CDS complement(299303..300301) product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709224.1 transl_table 11 codon_start 1 locus_tag LOCUS_54510 gene cobS CDS complement(300419..301042) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844827.1 transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS 301161..301442 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066783.1 transl_table 11 codon_start 1 locus_tag LOCUS_54530 CDS complement(301545..302465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54540 CDS complement(302462..303589) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577439.1 transl_table 11 codon_start 1 locus_tag LOCUS_54550 gene aroB CDS complement(303600..304181) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066786.1 transl_table 11 codon_start 1 locus_tag LOCUS_54560 CDS 304242..304625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54570 CDS 304667..305569 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970125.1 transl_table 11 codon_start 1 locus_tag LOCUS_54580 gene xerD CDS 305645..306598 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394627.1 transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS 306803..308305 product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240034.1 transl_table 11 codon_start 1 locus_tag LOCUS_54600 CDS 308302..308550 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066791.1 transl_table 11 codon_start 1 locus_tag LOCUS_54610 CDS complement(308643..310598) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329503.1 transl_table 11 codon_start 1 locus_tag LOCUS_54620 sequence46 source 1..1097 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence47 source 1..1035 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..777 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091833899.1:J domain-containing protein locus_tag LOCUS_54630 sequence48 source 1..1027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 272..1027 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013420942.1 transl_table 11 codon_start 1 locus_tag LOCUS_54640 sequence49 source 1..961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence50 source 1..889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence51 source 1..859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence52 source 1..838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence53 source 1..728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence54 source 1..669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence55 source 1..634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54650 sequence56 source 1..307394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(474..3092) product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396539.1 transl_table 11 codon_start 1 locus_tag LOCUS_54660 CDS 3404..4393 product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396540.1 transl_table 11 codon_start 1 locus_tag LOCUS_54670 CDS complement(4570..4989) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708186.1 transl_table 11 codon_start 1 locus_tag LOCUS_54680 gene dksA CDS 5351..7321 product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918781.1 transl_table 11 codon_start 1 locus_tag LOCUS_54690 CDS 7395..7919 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975678.1 transl_table 11 codon_start 1 locus_tag LOCUS_54700 CDS 8078..9553 product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532993.1 transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS 9550..10611 product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969485.1 transl_table 11 codon_start 1 locus_tag LOCUS_54720 CDS 10812..11360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396548.1 transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS complement(11353..11871) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396552.1 transl_table 11 codon_start 1 locus_tag LOCUS_54740 gene folK CDS complement(11861..12229) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708193.1 transl_table 11 codon_start 1 locus_tag LOCUS_54750 gene folB CDS complement(12253..13125) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396569.1 transl_table 11 codon_start 1 locus_tag LOCUS_54760 gene folP CDS 13364..13975 product DUF922 domain-containing Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311444.1 transl_table 11 codon_start 1 locus_tag LOCUS_54770 CDS complement(14412..14732) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532979.1 transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS complement(15057..15425) product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312581.1 transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS 15955..22671 product kinesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396557.1 transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS 22877..23848 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975992.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 CDS complement(24076..24693) product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328525.1 transl_table 11 codon_start 1 locus_tag LOCUS_54820 CDS complement(24828..26198) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328526.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS complement(26259..27044) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328527.1 transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS complement(27053..28204) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240468.1 transl_table 11 codon_start 1 locus_tag LOCUS_54850 CDS 28336..29319 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975705.1 transl_table 11 codon_start 1 locus_tag LOCUS_54860 CDS complement(29289..30506) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969506.1 transl_table 11 codon_start 1 locus_tag LOCUS_54870 CDS complement(30614..31450) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534112.1 transl_table 11 codon_start 1 locus_tag LOCUS_54880 CDS 31686..33998 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534110.1 transl_table 11 codon_start 1 locus_tag LOCUS_54890 CDS complement(34112..34435) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144188.1 transl_table 11 codon_start 1 locus_tag LOCUS_54900 CDS 34585..35292 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114283.1 transl_table 11 codon_start 1 locus_tag LOCUS_54910 CDS complement(35452..37038) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974107.1 transl_table 11 codon_start 1 locus_tag LOCUS_54920 CDS complement(37190..38251) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 transl_table 11 codon_start 1 locus_tag LOCUS_54930 CDS 38519..39625 product DUF2865 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975711.1 transl_table 11 codon_start 1 locus_tag LOCUS_54940 CDS complement(39618..40310) product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396627.1 transl_table 11 codon_start 1 locus_tag LOCUS_54950 gene bluB CDS complement(40634..41452) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969509.1 transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS complement(41684..43144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54970 CDS complement(43295..43642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS complement(43646..45343) product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971777.1 transl_table 11 codon_start 1 locus_tag LOCUS_54990 CDS 45639..47567 product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086018623.1 transl_table 11 codon_start 1 locus_tag LOCUS_55000 CDS complement(47680..49554) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975724.1 transl_table 11 codon_start 1 locus_tag LOCUS_55010 CDS 50085..51476 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240627.1 transl_table 11 codon_start 1 locus_tag LOCUS_55020 gene fumC CDS 51644..52714 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396658.1 transl_table 11 codon_start 1 locus_tag LOCUS_55030 CDS 53019..53666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS complement(53702..54463) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987089.1 transl_table 11 codon_start 1 locus_tag LOCUS_55050 CDS complement(54585..54971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502648.1 transl_table 11 codon_start 1 locus_tag LOCUS_55060 CDS complement(55050..55658) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535083.1 transl_table 11 codon_start 1 locus_tag LOCUS_55070 CDS complement(55732..56640) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844514.1 transl_table 11 codon_start 1 locus_tag LOCUS_55080 CDS 56685..57167 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026161061.1 transl_table 11 codon_start 1 locus_tag LOCUS_55090 CDS complement(57267..58478) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973428.1 transl_table 11 codon_start 1 locus_tag LOCUS_55100 CDS complement(58663..60489) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971803.1 transl_table 11 codon_start 1 locus_tag LOCUS_55110 CDS complement(60547..60921) product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328553.1 transl_table 11 codon_start 1 locus_tag LOCUS_55120 CDS 61062..62108 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971804.1 transl_table 11 codon_start 1 locus_tag LOCUS_55130 gene moaA CDS 62131..62778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55140 CDS complement(63112..65655) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396673.1 transl_table 11 codon_start 1 locus_tag LOCUS_55150 CDS 66040..66948 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328556.1 transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS 67012..67647 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975733.1 transl_table 11 codon_start 1 locus_tag LOCUS_55170 gene mobA CDS 67644..68165 product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328558.1 transl_table 11 codon_start 1 locus_tag LOCUS_55180 gene mobB CDS complement(68225..70201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55190 CDS complement(70385..72532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55200 tRNA 71021..71113 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 72872..73654 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535100.1 transl_table 11 codon_start 1 locus_tag LOCUS_55210 CDS 73824..74627 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975738.1 transl_table 11 codon_start 1 locus_tag LOCUS_55220 CDS 74624..75454 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969531.1 transl_table 11 codon_start 1 locus_tag LOCUS_55230 CDS 75599..75865 product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708254.1 transl_table 11 codon_start 1 locus_tag LOCUS_55240 CDS complement(75879..76607) product DUF2270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240630.1 transl_table 11 codon_start 1 locus_tag LOCUS_55250 CDS 76739..77554 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400622.1 transl_table 11 codon_start 1 locus_tag LOCUS_55260 CDS 77737..78609 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975744.1 transl_table 11 codon_start 1 locus_tag LOCUS_55270 CDS 78611..78985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55280 CDS complement(79013..79501) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507846.1 transl_table 11 codon_start 1 locus_tag LOCUS_55290 CDS complement(79568..80212) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969535.1 transl_table 11 codon_start 1 locus_tag LOCUS_55300 CDS complement(80294..80857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55310 CDS 81130..82665 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400593.1 transl_table 11 codon_start 1 locus_tag LOCUS_55320 CDS complement(82847..83224) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400603.1 transl_table 11 codon_start 1 locus_tag LOCUS_55330 CDS complement(83325..84341) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328572.1 transl_table 11 codon_start 1 locus_tag LOCUS_55340 gene cobT CDS 84761..85543 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975752.1 transl_table 11 codon_start 1 locus_tag LOCUS_55350 CDS 85581..85802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55360 CDS 85799..86497 product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400587.1 transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS complement(86494..87255) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328580.1 transl_table 11 codon_start 1 locus_tag LOCUS_55380 CDS complement(87252..88178) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328581.1 transl_table 11 codon_start 1 locus_tag LOCUS_55390 CDS complement(88270..89091) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400599.1 transl_table 11 codon_start 1 locus_tag LOCUS_55400 CDS complement(89462..90661) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400572.1 transl_table 11 codon_start 1 locus_tag LOCUS_55410 CDS complement(91414..93234) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400568.1 transl_table 11 codon_start 1 locus_tag LOCUS_55420 CDS 93434..93826 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975762.1 transl_table 11 codon_start 1 locus_tag LOCUS_55430 CDS 93844..94434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975763.1 transl_table 11 codon_start 1 locus_tag LOCUS_55440 CDS complement(94437..95606) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972739.1 transl_table 11 codon_start 1 locus_tag LOCUS_55450 CDS complement(95616..97082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55460 CDS complement(97140..97493) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535339.1 transl_table 11 codon_start 1 locus_tag LOCUS_55470 CDS complement(97551..97811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55480 CDS complement(97808..98395) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967186.1 transl_table 11 codon_start 1 locus_tag LOCUS_55490 CDS 98484..99452 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967187.1 transl_table 11 codon_start 1 locus_tag LOCUS_55500 CDS complement(99397..100173) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405048.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS complement(100178..101269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55520 CDS 101473..102105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS complement(102157..103101) product DUF3137 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530035.1 transl_table 11 codon_start 1 locus_tag LOCUS_55540 CDS 103215..106292 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971990.1 transl_table 11 codon_start 1 locus_tag LOCUS_55550 gene uvrB CDS complement(106307..108307) product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250346.1 transl_table 11 codon_start 1 locus_tag LOCUS_55560 CDS 108930..109352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55570 CDS complement(109368..109973) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969551.1 transl_table 11 codon_start 1 locus_tag LOCUS_55580 CDS complement(110176..111204) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395492.1 transl_table 11 codon_start 1 locus_tag LOCUS_55590 gene dusA CDS 111358..112437 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 transl_table 11 codon_start 1 locus_tag LOCUS_55600 CDS 112552..112779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55610 CDS 112875..113261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55620 CDS 113341..113595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55630 CDS 113576..115882 product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975506.1 transl_table 11 codon_start 1 locus_tag LOCUS_55640 CDS complement(116166..116348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55650 CDS complement(116416..116646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55660 CDS 116864..118126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55670 CDS 118374..118766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55680 CDS 118759..119691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55690 CDS 119684..120109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55700 CDS 120530..120796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55710 CDS 120810..123101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55720 CDS 123172..125517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55730 CDS 125637..125804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55740 CDS 126176..127054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55750 CDS 127645..127986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55760 CDS complement(128004..128552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55770 CDS complement(128537..129568) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069331975.1 transl_table 11 codon_start 1 locus_tag LOCUS_55780 CDS 129823..130347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55790 CDS complement(130603..131079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55800 CDS 131191..131424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55810 CDS complement(131492..132661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55820 CDS 132831..133034 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 transl_table 11 codon_start 1 locus_tag LOCUS_55830 CDS complement(133084..133269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244278.1 transl_table 11 codon_start 1 locus_tag LOCUS_55840 CDS 133459..133647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55850 CDS 133735..133932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55860 CDS 134229..134756 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975835.1 transl_table 11 codon_start 1 locus_tag LOCUS_55870 CDS 134857..136872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55880 CDS complement(137112..137507) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536852.1 transl_table 11 codon_start 1 locus_tag LOCUS_55890 CDS complement(137504..138334) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240526.1 transl_table 11 codon_start 1 locus_tag LOCUS_55900 gene znuB CDS complement(138327..139256) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844580.1 transl_table 11 codon_start 1 locus_tag LOCUS_55910 CDS 139356..140381 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240528.1 transl_table 11 codon_start 1 locus_tag LOCUS_55920 CDS 140712..141917 product zinc metallochaperone GTPase ZigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972825.1 transl_table 11 codon_start 1 locus_tag LOCUS_55930 gene zigA CDS complement(141964..142995) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395477.1 transl_table 11 codon_start 1 locus_tag LOCUS_55940 gene mgrA CDS complement(143209..144342) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969565.1 transl_table 11 codon_start 1 locus_tag LOCUS_55950 CDS complement(144355..145116) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395473.1 transl_table 11 codon_start 1 locus_tag LOCUS_55960 CDS complement(145132..147591) product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395471.1 transl_table 11 codon_start 1 locus_tag LOCUS_55970 CDS complement(148011..149093) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315197.1 transl_table 11 codon_start 1 locus_tag LOCUS_55980 CDS complement(149097..150026) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969569.1 transl_table 11 codon_start 1 locus_tag LOCUS_55990 CDS complement(150019..150921) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972962.1 transl_table 11 codon_start 1 locus_tag LOCUS_56000 CDS complement(151061..152290) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975867.1 transl_table 11 codon_start 1 locus_tag LOCUS_56010 CDS 152710..153753 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975869.1 transl_table 11 codon_start 1 locus_tag LOCUS_56020 CDS complement(153968..155404) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975871.1 transl_table 11 codon_start 1 locus_tag LOCUS_56030 gene gndA CDS complement(155750..158038) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971692.1 transl_table 11 codon_start 1 locus_tag LOCUS_56040 CDS complement(158035..158532) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971693.1 transl_table 11 codon_start 1 locus_tag LOCUS_56050 CDS complement(158532..160103) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967640.1 transl_table 11 codon_start 1 locus_tag LOCUS_56060 gene ccoG CDS 160224..160979 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969574.1 transl_table 11 codon_start 1 locus_tag LOCUS_56070 CDS 161044..161460 product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975873.1 transl_table 11 codon_start 1 locus_tag LOCUS_56080 CDS 161457..161813 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969576.1 transl_table 11 codon_start 1 locus_tag LOCUS_56090 CDS 161933..162670 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528483.1 transl_table 11 codon_start 1 locus_tag LOCUS_56100 CDS complement(162750..163613) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316282.1 transl_table 11 codon_start 1 locus_tag LOCUS_56110 gene ccoP CDS complement(163616..163768) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316283.1 transl_table 11 codon_start 1 locus_tag LOCUS_56120 CDS complement(163780..164511) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967643.1 transl_table 11 codon_start 1 locus_tag LOCUS_56130 gene ccoO CDS complement(164522..166144) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967644.1 transl_table 11 codon_start 1 locus_tag LOCUS_56140 gene ccoN CDS 166352..166834 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563285.1 transl_table 11 codon_start 1 locus_tag LOCUS_56150 CDS complement(166839..167465) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395427.1 transl_table 11 codon_start 1 locus_tag LOCUS_56160 CDS complement(167786..168715) product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844587.1 transl_table 11 codon_start 1 locus_tag LOCUS_56170 CDS complement(168726..169754) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969578.1 transl_table 11 codon_start 1 locus_tag LOCUS_56180 CDS complement(169768..171054) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975877.1 transl_table 11 codon_start 1 locus_tag LOCUS_56190 CDS complement(171064..172263) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971732.1 transl_table 11 codon_start 1 locus_tag LOCUS_56200 CDS complement(172266..172748) product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316342.1 transl_table 11 codon_start 1 locus_tag LOCUS_56210 CDS complement(172865..173149) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495848.1 transl_table 11 codon_start 1 locus_tag LOCUS_56220 CDS complement(173275..174624) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971733.1 transl_table 11 codon_start 1 locus_tag LOCUS_56230 gene hemN CDS 174623..174928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56240 CDS 174835..175560 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395422.1 transl_table 11 codon_start 1 locus_tag LOCUS_56250 CDS complement(175570..175998) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529305.1 transl_table 11 codon_start 1 locus_tag LOCUS_56260 CDS complement(176148..177128) product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969582.1 transl_table 11 codon_start 1 locus_tag LOCUS_56270 gene cbiB CDS complement(177125..178138) product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975882.1 transl_table 11 codon_start 1 locus_tag LOCUS_56280 gene cobD CDS complement(178135..179442) product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328702.1 transl_table 11 codon_start 1 locus_tag LOCUS_56290 CDS complement(179439..180281) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969585.1 transl_table 11 codon_start 1 locus_tag LOCUS_56300 gene cobA CDS complement(180281..180757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56310 CDS complement(180958..182028) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640075.1 transl_table 11 codon_start 1 locus_tag LOCUS_56320 CDS 182133..182984 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975886.1 transl_table 11 codon_start 1 locus_tag LOCUS_56330 CDS complement(183169..183810) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254597.1 transl_table 11 codon_start 1 locus_tag LOCUS_56340 gene cobO CDS complement(183812..184198) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102978.1 transl_table 11 codon_start 1 locus_tag LOCUS_56350 CDS complement(184198..188325) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873425.1 transl_table 11 codon_start 1 locus_tag LOCUS_56360 gene cobN CDS complement(188828..189877) product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969596.1 transl_table 11 codon_start 1 locus_tag LOCUS_56370 gene cobW CDS complement(189881..190405) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395402.1 transl_table 11 codon_start 1 locus_tag LOCUS_56380 gene cobU CDS complement(190407..191201) product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396855.1 transl_table 11 codon_start 1 locus_tag LOCUS_56390 CDS complement(191214..191390) product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708714.1 transl_table 11 codon_start 1 locus_tag LOCUS_56400 CDS complement(191886..193760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56410 CDS complement(193911..195374) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240566.1 transl_table 11 codon_start 1 locus_tag LOCUS_56420 CDS 195621..195764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975904.1 transl_table 11 codon_start 1 locus_tag LOCUS_56430 CDS 196528..197526 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395398.1 transl_table 11 codon_start 1 locus_tag LOCUS_56440 CDS 197783..198694 product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971232.1 transl_table 11 codon_start 1 locus_tag LOCUS_56450 CDS 198687..199730 product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530709.1 transl_table 11 codon_start 1 locus_tag LOCUS_56460 CDS 200040..201053 product betaine--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240571.1 transl_table 11 codon_start 1 locus_tag LOCUS_56470 gene bmt CDS 201224..201553 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529383.1 transl_table 11 codon_start 1 locus_tag LOCUS_56480 CDS complement(201550..202689) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969607.1 transl_table 11 codon_start 1 locus_tag LOCUS_56490 CDS complement(202686..203333) product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969608.1 transl_table 11 codon_start 1 locus_tag LOCUS_56500 CDS 203518..203865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240572.1 transl_table 11 codon_start 1 locus_tag LOCUS_56510 CDS complement(203850..204734) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529404.1 transl_table 11 codon_start 1 locus_tag LOCUS_56520 CDS 204832..205131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56530 CDS complement(205516..207603) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395394.1 transl_table 11 codon_start 1 locus_tag LOCUS_56540 CDS complement(207618..208139) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240574.1 transl_table 11 codon_start 1 locus_tag LOCUS_56550 CDS complement(208221..208973) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969609.1 transl_table 11 codon_start 1 locus_tag LOCUS_56560 CDS complement(209027..209719) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873467.1 transl_table 11 codon_start 1 locus_tag LOCUS_56570 CDS complement(209827..211410) product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328727.1 transl_table 11 codon_start 1 locus_tag LOCUS_56580 CDS 211749..212444 product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386375.1 transl_table 11 codon_start 1 locus_tag LOCUS_56590 CDS complement(212496..212654) product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003515706.1 transl_table 11 codon_start 1 locus_tag LOCUS_56600 CDS 212723..213313 product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395377.1 transl_table 11 codon_start 1 locus_tag LOCUS_56610 CDS 213556..214323 product formyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082912520.1 transl_table 11 codon_start 1 locus_tag LOCUS_56620 CDS 214434..214736 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173512816.1 transl_table 11 codon_start 1 locus_tag LOCUS_56630 CDS 214729..215313 product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530675.1 transl_table 11 codon_start 1 locus_tag LOCUS_56640 CDS 215317..216411 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328733.1 transl_table 11 codon_start 1 locus_tag LOCUS_56650 CDS 216643..217608 product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873494.1 transl_table 11 codon_start 1 locus_tag LOCUS_56660 CDS 217610..217930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084435433.1 transl_table 11 codon_start 1 locus_tag LOCUS_56670 CDS 217967..220039 product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153435973.1 transl_table 11 codon_start 1 locus_tag LOCUS_56680 CDS complement(220234..221151) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975926.1 transl_table 11 codon_start 1 locus_tag LOCUS_56690 CDS 221268..221486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56700 CDS 221592..221795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56710 CDS complement(221882..222490) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084228.1 transl_table 11 codon_start 1 locus_tag LOCUS_56720 CDS 222789..223796 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311620.1 transl_table 11 codon_start 1 locus_tag LOCUS_56730 CDS complement(223925..225214) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395355.1 transl_table 11 codon_start 1 locus_tag LOCUS_56740 CDS complement(225392..226219) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708389.1 transl_table 11 codon_start 1 locus_tag LOCUS_56750 CDS complement(226405..226653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844605.1 transl_table 11 codon_start 1 locus_tag LOCUS_56760 CDS 226613..226906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56770 CDS complement(226815..229334) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969631.1 transl_table 11 codon_start 1 locus_tag LOCUS_56780 CDS complement(229394..229951) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975940.1 transl_table 11 codon_start 1 locus_tag LOCUS_56790 CDS 230103..231500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56800 CDS 231781..232086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56810 CDS complement(232100..232999) product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974036.1 transl_table 11 codon_start 1 locus_tag LOCUS_56820 CDS 233168..235342 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974037.1 transl_table 11 codon_start 1 locus_tag LOCUS_56830 gene katG CDS complement(235476..235655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56840 CDS complement(235727..236758) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971997.1 transl_table 11 codon_start 1 locus_tag LOCUS_56850 CDS complement(236746..238140) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971998.1 transl_table 11 codon_start 1 locus_tag LOCUS_56860 note possible pseudo, frameshifted CDS complement(238459..239436) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173509960.1 transl_table 11 codon_start 1 locus_tag LOCUS_56870 CDS 239676..240566 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 transl_table 11 codon_start 1 locus_tag LOCUS_56880 CDS complement(240618..241556) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705479.1 transl_table 11 codon_start 1 locus_tag LOCUS_56890 CDS 241640..242608 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 transl_table 11 codon_start 1 locus_tag LOCUS_56900 CDS complement(242593..242949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56910 CDS complement(243060..244109) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976196.1 transl_table 11 codon_start 1 locus_tag LOCUS_56920 gene ugpC CDS complement(244183..245787) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705053.1 transl_table 11 codon_start 1 locus_tag LOCUS_56930 CDS complement(246069..247415) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976194.1 transl_table 11 codon_start 1 locus_tag LOCUS_56940 CDS complement(247445..248326) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976193.1 transl_table 11 codon_start 1 locus_tag LOCUS_56950 CDS complement(248323..249240) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976192.1 transl_table 11 codon_start 1 locus_tag LOCUS_56960 CDS 249548..250057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531938.1 transl_table 11 codon_start 1 locus_tag LOCUS_56970 CDS complement(250109..250342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56980 CDS complement(250386..251210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56990 CDS complement(251416..252111) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972304.1 transl_table 11 codon_start 1 locus_tag LOCUS_57000 gene urtE CDS complement(252105..252338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57010 CDS complement(252341..253114) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398878.1 transl_table 11 codon_start 1 locus_tag LOCUS_57020 gene urtD CDS complement(253111..254274) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244009.1 transl_table 11 codon_start 1 locus_tag LOCUS_57030 gene urtC CDS complement(254271..255890) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 transl_table 11 codon_start 1 locus_tag LOCUS_57040 gene urtB CDS complement(256264..257556) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244008.1 transl_table 11 codon_start 1 locus_tag LOCUS_57050 gene urtA CDS 257941..261312 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398915.1 transl_table 11 codon_start 1 locus_tag LOCUS_57060 CDS 261309..262223 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244002.1 transl_table 11 codon_start 1 locus_tag LOCUS_57070 CDS complement(262365..263558) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973818.1 transl_table 11 codon_start 1 locus_tag LOCUS_57080 CDS complement(263555..264307) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973817.1 transl_table 11 codon_start 1 locus_tag LOCUS_57090 CDS complement(264304..265113) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 transl_table 11 codon_start 1 locus_tag LOCUS_57100 CDS complement(265118..266107) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 transl_table 11 codon_start 1 locus_tag LOCUS_57110 CDS complement(266118..268298) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973814.1 transl_table 11 codon_start 1 locus_tag LOCUS_57120 CDS complement(268426..270120) product copper resistance CopC/CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529536.1 transl_table 11 codon_start 1 locus_tag LOCUS_57130 CDS complement(270186..270716) product YcnI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162471704.1 transl_table 11 codon_start 1 locus_tag LOCUS_57140 CDS complement(270958..271350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57150 CDS complement(271469..272629) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974401.1 transl_table 11 codon_start 1 locus_tag LOCUS_57160 CDS complement(272634..273332) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093405.1 transl_table 11 codon_start 1 locus_tag LOCUS_57170 CDS complement(273335..274285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57180 CDS complement(274584..275735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57190 CDS complement(275735..276757) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969914.1 transl_table 11 codon_start 1 locus_tag LOCUS_57200 CDS complement(276826..278052) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969913.1 transl_table 11 codon_start 1 locus_tag LOCUS_57210 CDS complement(278107..279162) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969916.1 transl_table 11 codon_start 1 locus_tag LOCUS_57220 gene ugpC CDS 279472..280485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57230 CDS 280504..281310 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 transl_table 11 codon_start 1 locus_tag LOCUS_57240 CDS 281310..282008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57250 CDS 282002..283216 product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266421.1 transl_table 11 codon_start 1 locus_tag LOCUS_57260 CDS 283228..283857 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170138703.1 transl_table 11 codon_start 1 locus_tag LOCUS_57270 CDS complement(283870..284934) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369259.1 transl_table 11 codon_start 1 locus_tag LOCUS_57280 CDS 285221..286384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57290 CDS complement(286472..286690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57300 CDS complement(286785..287108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57310 CDS 287246..287623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57320 CDS 287616..288137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 transl_table 11 codon_start 1 locus_tag LOCUS_57330 CDS 288164..288997 product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024924750.1 transl_table 11 codon_start 1 locus_tag LOCUS_57340 gene sigJ CDS 289146..289568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57350 CDS complement(289637..290707) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061266.1 transl_table 11 codon_start 1 locus_tag LOCUS_57360 gene ugpC CDS complement(290752..291774) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729463.1 transl_table 11 codon_start 1 locus_tag LOCUS_57370 CDS complement(291798..292616) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086175.1 transl_table 11 codon_start 1 locus_tag LOCUS_57380 CDS complement(292613..293473) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 transl_table 11 codon_start 1 locus_tag LOCUS_57390 CDS complement(293537..294844) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 transl_table 11 codon_start 1 locus_tag LOCUS_57400 CDS complement(294870..295712) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253736.1 transl_table 11 codon_start 1 locus_tag LOCUS_57410 CDS complement(295990..297771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57420 CDS complement(297989..298924) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707197.1 transl_table 11 codon_start 1 locus_tag LOCUS_57430 CDS complement(298917..300491) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082910117.1 transl_table 11 codon_start 1 locus_tag LOCUS_57440 CDS complement(300488..301654) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 transl_table 11 codon_start 1 locus_tag LOCUS_57450 CDS complement(301765..302886) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 transl_table 11 codon_start 1 locus_tag LOCUS_57460 CDS complement(302932..303744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57470 CDS 303931..305283 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 transl_table 11 codon_start 1 locus_tag LOCUS_57480 CDS 305294..306307 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243020.1 transl_table 11 codon_start 1 locus_tag LOCUS_57490 CDS complement(306350..306817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57500 note possible pseudo, internal stop codon, frameshifted CDS 306767..307015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57510 sequence57 source 1..633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence58 source 1..575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence59 source 1..535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 287..296 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence60 source 1..524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence61 source 1..281563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..1825) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 transl_table 11 codon_start 1 locus_tag LOCUS_57520 CDS complement(1846..3027) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529819.1 transl_table 11 codon_start 1 locus_tag LOCUS_57530 CDS complement(3106..4131) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531376.1 transl_table 11 codon_start 1 locus_tag LOCUS_57540 CDS complement(4182..4985) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529816.1 transl_table 11 codon_start 1 locus_tag LOCUS_57550 CDS complement(4978..5901) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 transl_table 11 codon_start 1 locus_tag LOCUS_57560 CDS complement(5904..7004) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529814.1 transl_table 11 codon_start 1 locus_tag LOCUS_57570 CDS 7262..7948 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389010.1 transl_table 11 codon_start 1 locus_tag LOCUS_57580 CDS 8057..8224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577192.1 transl_table 11 codon_start 1 locus_tag LOCUS_57590 CDS complement(8414..8620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57600 CDS complement(8832..9368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57610 CDS 9892..10851 product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337349.1 transl_table 11 codon_start 1 locus_tag LOCUS_57620 CDS complement(10871..11308) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532092.1 transl_table 11 codon_start 1 locus_tag LOCUS_57630 CDS 11392..12354 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532093.1 transl_table 11 codon_start 1 locus_tag LOCUS_57640 CDS complement(12453..13481) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532102.1 transl_table 11 codon_start 1 locus_tag LOCUS_57650 CDS complement(13478..13969) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 transl_table 11 codon_start 1 locus_tag LOCUS_57660 CDS complement(13979..14908) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532100.1 transl_table 11 codon_start 1 locus_tag LOCUS_57670 CDS complement(14918..16288) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532099.1 transl_table 11 codon_start 1 locus_tag LOCUS_57680 CDS complement(16335..17099) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532097.1 transl_table 11 codon_start 1 locus_tag LOCUS_57690 CDS complement(17096..17755) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532096.1 transl_table 11 codon_start 1 locus_tag LOCUS_57700 CDS complement(17758..18408) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532095.1 transl_table 11 codon_start 1 locus_tag LOCUS_57710 CDS complement(18483..19268) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532094.1 transl_table 11 codon_start 1 locus_tag LOCUS_57720 CDS complement(19464..21911) product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972413.1 transl_table 11 codon_start 1 locus_tag LOCUS_57730 CDS complement(21923..22891) product DUF1839 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196302.1 transl_table 11 codon_start 1 locus_tag LOCUS_57740 CDS complement(22894..23808) product amino acid--[acyl-carrier-protein] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080728814.1 transl_table 11 codon_start 1 locus_tag LOCUS_57750 CDS complement(23813..24985) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972410.1 transl_table 11 codon_start 1 locus_tag LOCUS_57760 CDS complement(24982..25236) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003504852.1 transl_table 11 codon_start 1 locus_tag LOCUS_57770 CDS 25811..27115 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085115.1 transl_table 11 codon_start 1 locus_tag LOCUS_57780 gene pncB CDS complement(27169..27852) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969683.1 transl_table 11 codon_start 1 locus_tag LOCUS_57790 CDS complement(27860..29317) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844627.1 transl_table 11 codon_start 1 locus_tag LOCUS_57800 CDS 29435..30319 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969685.1 transl_table 11 codon_start 1 locus_tag LOCUS_57810 CDS complement(30423..31265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972623.1 transl_table 11 codon_start 1 locus_tag LOCUS_57820 CDS complement(31415..32878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57830 CDS complement(33012..34328) product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257384.1 transl_table 11 codon_start 1 locus_tag LOCUS_57840 CDS complement(34401..35663) product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530606.1 transl_table 11 codon_start 1 locus_tag LOCUS_57850 CDS complement(35660..37621) product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089039.1 transl_table 11 codon_start 1 locus_tag LOCUS_57860 CDS complement(37618..38871) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 transl_table 11 codon_start 1 locus_tag LOCUS_57870 CDS complement(38852..40159) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764140.1 transl_table 11 codon_start 1 locus_tag LOCUS_57880 CDS complement(40248..41567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57890 CDS complement(41564..42772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57900 CDS complement(42772..43647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57910 CDS complement(43899..44579) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222476.1 transl_table 11 codon_start 1 locus_tag LOCUS_57920 CDS 44757..46010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57930 CDS 46214..48022 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174047161.1 transl_table 11 codon_start 1 locus_tag LOCUS_57940 CDS 48178..49023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972623.1 transl_table 11 codon_start 1 locus_tag LOCUS_57950 CDS 49054..49311 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972661.1 transl_table 11 codon_start 1 locus_tag LOCUS_57960 CDS 49308..50831 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971788.1 transl_table 11 codon_start 1 locus_tag LOCUS_57970 CDS 50824..52143 product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 transl_table 11 codon_start 1 locus_tag LOCUS_57980 CDS 52145..53272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57990 CDS 53388..53855 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310156.1 transl_table 11 codon_start 1 locus_tag LOCUS_58000 CDS 53917..55086 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704802.1 transl_table 11 codon_start 1 locus_tag LOCUS_58010 gene ugd CDS complement(55122..55283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58020 CDS 55662..56903 product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992327.1 transl_table 11 codon_start 1 locus_tag LOCUS_58030 CDS 57002..57409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58040 CDS complement(57420..58316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58050 CDS 58590..59639 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265602.1 transl_table 11 codon_start 1 locus_tag LOCUS_58060 CDS 59729..61102 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528228.1 transl_table 11 codon_start 1 locus_tag LOCUS_58070 CDS 61099..62487 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528229.1 transl_table 11 codon_start 1 locus_tag LOCUS_58080 CDS 62490..63524 product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529811.1 transl_table 11 codon_start 1 locus_tag LOCUS_58090 CDS complement(63528..63818) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973871.1 transl_table 11 codon_start 1 locus_tag LOCUS_58100 CDS complement(63825..64076) product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973870.1 transl_table 11 codon_start 1 locus_tag LOCUS_58110 CDS complement(64103..65251) product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 transl_table 11 codon_start 1 locus_tag LOCUS_58120 CDS complement(65696..66739) product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391732.1 transl_table 11 codon_start 1 locus_tag LOCUS_58130 gene fba CDS complement(66986..69709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58140 CDS complement(69817..70884) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329344.1 transl_table 11 codon_start 1 locus_tag LOCUS_58150 gene ugpC CDS complement(70896..71726) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972816.1 transl_table 11 codon_start 1 locus_tag LOCUS_58160 CDS complement(71731..72690) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434064.1 transl_table 11 codon_start 1 locus_tag LOCUS_58170 CDS complement(72741..74000) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972818.1 transl_table 11 codon_start 1 locus_tag LOCUS_58180 CDS complement(74041..75213) product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434058.1 transl_table 11 codon_start 1 locus_tag LOCUS_58190 CDS complement(75210..75932) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066641.1 transl_table 11 codon_start 1 locus_tag LOCUS_58200 CDS complement(76110..76505) product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970945.1 transl_table 11 codon_start 1 locus_tag LOCUS_58210 gene mnhG CDS complement(76502..76783) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313274.1 transl_table 11 codon_start 1 locus_tag LOCUS_58220 CDS complement(76780..77256) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970946.1 transl_table 11 codon_start 1 locus_tag LOCUS_58230 CDS complement(77258..78895) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162687984.1 transl_table 11 codon_start 1 locus_tag LOCUS_58240 CDS complement(78892..79230) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493763.1 transl_table 11 codon_start 1 locus_tag LOCUS_58250 CDS complement(79230..82136) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972638.1 transl_table 11 codon_start 1 locus_tag LOCUS_58260 CDS complement(82250..82543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58270 CDS 83036..83362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58280 CDS 83742..84107 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 transl_table 11 codon_start 1 locus_tag LOCUS_58290 CDS 84115..85554 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971478.1 transl_table 11 codon_start 1 locus_tag LOCUS_58300 CDS complement(85666..86268) product phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391674.1 transl_table 11 codon_start 1 locus_tag LOCUS_58310 gene phnN CDS complement(86265..87404) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975693.1 transl_table 11 codon_start 1 locus_tag LOCUS_58320 CDS complement(87406..88113) product DUF1045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391678.1 transl_table 11 codon_start 1 locus_tag LOCUS_58330 CDS complement(88219..89721) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061595.1 transl_table 11 codon_start 1 locus_tag LOCUS_58340 gene phnE CDS complement(89731..90693) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061596.1 transl_table 11 codon_start 1 locus_tag LOCUS_58350 gene phnE CDS complement(90910..91815) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391685.1 transl_table 11 codon_start 1 locus_tag LOCUS_58360 gene phnD CDS complement(91897..92745) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975699.1 transl_table 11 codon_start 1 locus_tag LOCUS_58370 gene phnC CDS complement(92909..93523) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529516.1 transl_table 11 codon_start 1 locus_tag LOCUS_58380 CDS complement(93520..94227) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976256.1 transl_table 11 codon_start 1 locus_tag LOCUS_58390 gene phnL CDS complement(94293..95069) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969858.1 transl_table 11 codon_start 1 locus_tag LOCUS_58400 gene phnK CDS complement(95266..96150) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440334.1 transl_table 11 codon_start 1 locus_tag LOCUS_58410 CDS complement(96147..97247) product carbon-phosphorus lyase complex subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440333.1 transl_table 11 codon_start 1 locus_tag LOCUS_58420 CDS complement(97252..97860) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392105.1 transl_table 11 codon_start 1 locus_tag LOCUS_58430 gene phnH CDS complement(97860..98330) product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530625.1 transl_table 11 codon_start 1 locus_tag LOCUS_58440 gene phnG CDS 98450..99205 product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976252.1 transl_table 11 codon_start 1 locus_tag LOCUS_58450 gene phnF CDS complement(99150..99959) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974982.1 transl_table 11 codon_start 1 locus_tag LOCUS_58460 CDS complement(99959..100408) product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252943.1 transl_table 11 codon_start 1 locus_tag LOCUS_58470 CDS complement(100408..101208) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969708.1 transl_table 11 codon_start 1 locus_tag LOCUS_58480 CDS complement(101205..102233) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399815.1 transl_table 11 codon_start 1 locus_tag LOCUS_58490 CDS complement(102230..103273) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399818.1 transl_table 11 codon_start 1 locus_tag LOCUS_58500 CDS complement(103691..104605) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370101.1 transl_table 11 codon_start 1 locus_tag LOCUS_58510 CDS complement(104602..105672) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376560.1 transl_table 11 codon_start 1 locus_tag LOCUS_58520 CDS 105903..106919 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140151.1 transl_table 11 codon_start 1 locus_tag LOCUS_58530 CDS 106921..107823 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529815.1 transl_table 11 codon_start 1 locus_tag LOCUS_58540 CDS 107836..108666 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112952.1 transl_table 11 codon_start 1 locus_tag LOCUS_58550 CDS 108669..109802 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974502.1 transl_table 11 codon_start 1 locus_tag LOCUS_58560 CDS complement(109815..110186) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244589.1 transl_table 11 codon_start 1 locus_tag LOCUS_58570 CDS complement(110256..111704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58580 CDS 111954..113432 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196037.1 transl_table 11 codon_start 1 locus_tag LOCUS_58590 CDS 113487..114491 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530262.1 transl_table 11 codon_start 1 locus_tag LOCUS_58600 CDS 114659..115645 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388000.1 transl_table 11 codon_start 1 locus_tag LOCUS_58610 CDS 115707..116480 product D-threitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729199.1 transl_table 11 codon_start 1 locus_tag LOCUS_58620 CDS 116517..117509 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975196.1 transl_table 11 codon_start 1 locus_tag LOCUS_58630 CDS 117524..118165 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008606.1 transl_table 11 codon_start 1 locus_tag LOCUS_58640 gene dhaL CDS complement(118260..118808) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 transl_table 11 codon_start 1 locus_tag LOCUS_58650 CDS complement(118813..119280) product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338294.1 transl_table 11 codon_start 1 locus_tag LOCUS_58660 CDS 119444..119806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58670 CDS complement(120557..120970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58680 CDS 120977..121444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58690 CDS 121537..122286 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651594.1 transl_table 11 codon_start 1 locus_tag LOCUS_58700 CDS 122550..123614 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064355.1 transl_table 11 codon_start 1 locus_tag LOCUS_58710 CDS complement(123634..124515) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966549.1 transl_table 11 codon_start 1 locus_tag LOCUS_58720 CDS complement(124559..124771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58730 CDS 124670..125323 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966548.1 transl_table 11 codon_start 1 locus_tag LOCUS_58740 CDS complement(125837..126604) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 transl_table 11 codon_start 1 locus_tag LOCUS_58750 CDS complement(126658..127479) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974329.1 transl_table 11 codon_start 1 locus_tag LOCUS_58760 CDS 127605..128069 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974328.1 transl_table 11 codon_start 1 locus_tag LOCUS_58770 tRNA 128163..128246 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 128341..129405 product adenylate cyclase Cya2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969098.1 transl_table 11 codon_start 1 locus_tag LOCUS_58780 CDS complement(129881..130669) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112653.1 transl_table 11 codon_start 1 locus_tag LOCUS_58790 CDS complement(130654..131454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58800 note possible pseudo, frameshifted CDS complement(131456..132322) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206757.1 transl_table 11 codon_start 1 locus_tag LOCUS_58810 CDS complement(132393..133457) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206772.1 transl_table 11 codon_start 1 locus_tag LOCUS_58820 CDS complement(133538..133861) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530816.1 transl_table 11 codon_start 1 locus_tag LOCUS_58830 CDS complement(133858..135477) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730601.1 transl_table 11 codon_start 1 locus_tag LOCUS_58840 CDS 135895..137271 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269247.1 transl_table 11 codon_start 1 locus_tag LOCUS_58850 CDS 137313..138281 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393023.1 transl_table 11 codon_start 1 locus_tag LOCUS_58860 CDS 138285..139133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58870 CDS 139130..140623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58880 CDS 140620..142092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58890 CDS 142417..143241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58900 CDS complement(143157..144125) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382910.1 transl_table 11 codon_start 1 locus_tag LOCUS_58910 CDS 144364..145644 product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894844.1 transl_table 11 codon_start 1 locus_tag LOCUS_58920 CDS complement(145664..146404) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533434.1 transl_table 11 codon_start 1 locus_tag LOCUS_58930 CDS complement(146401..147375) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525195.1 transl_table 11 codon_start 1 locus_tag LOCUS_58940 CDS complement(147434..148267) product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525194.1 transl_table 11 codon_start 1 locus_tag LOCUS_58950 CDS complement(148416..148805) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525193.1 transl_table 11 codon_start 1 locus_tag LOCUS_58960 CDS complement(148798..149610) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525192.1 transl_table 11 codon_start 1 locus_tag LOCUS_58970 CDS complement(149613..150689) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525191.1 transl_table 11 codon_start 1 locus_tag LOCUS_58980 CDS complement(150713..152227) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525190.1 transl_table 11 codon_start 1 locus_tag LOCUS_58990 CDS complement(152229..153221) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525189.1 transl_table 11 codon_start 1 locus_tag LOCUS_59000 CDS complement(153348..155150) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974489.1 transl_table 11 codon_start 1 locus_tag LOCUS_59010 CDS 155317..155904 product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525187.1 transl_table 11 codon_start 1 locus_tag LOCUS_59020 CDS complement(155967..157043) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397743.1 transl_table 11 codon_start 1 locus_tag LOCUS_59030 CDS complement(157040..157840) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970933.1 transl_table 11 codon_start 1 locus_tag LOCUS_59040 CDS complement(157842..158693) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397738.1 transl_table 11 codon_start 1 locus_tag LOCUS_59050 CDS complement(158763..159773) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973676.1 transl_table 11 codon_start 1 locus_tag LOCUS_59060 CDS complement(159807..160136) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397896.1 transl_table 11 codon_start 1 locus_tag LOCUS_59070 CDS complement(160142..161605) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397733.1 transl_table 11 codon_start 1 locus_tag LOCUS_59080 CDS complement(161613..162650) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536944.1 transl_table 11 codon_start 1 locus_tag LOCUS_59090 CDS complement(162654..163553) product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973672.1 transl_table 11 codon_start 1 locus_tag LOCUS_59100 CDS complement(163609..164400) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397724.1 transl_table 11 codon_start 1 locus_tag LOCUS_59110 CDS complement(164375..164974) product amino acid synthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973670.1 transl_table 11 codon_start 1 locus_tag LOCUS_59120 CDS 165075..165755 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703493.1 transl_table 11 codon_start 1 locus_tag LOCUS_59130 CDS complement(165851..167047) product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310345.1 transl_table 11 codon_start 1 locus_tag LOCUS_59140 CDS complement(167120..168121) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113175527.1 transl_table 11 codon_start 1 locus_tag LOCUS_59150 CDS complement(168118..169098) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267759.1 transl_table 11 codon_start 1 locus_tag LOCUS_59160 CDS complement(169095..170000) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113175525.1 transl_table 11 codon_start 1 locus_tag LOCUS_59170 CDS complement(170005..170955) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267757.1 transl_table 11 codon_start 1 locus_tag LOCUS_59180 CDS complement(171053..172663) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 transl_table 11 codon_start 1 locus_tag LOCUS_59190 gene ggt CDS complement(172660..173514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 transl_table 11 codon_start 1 locus_tag LOCUS_59200 CDS complement(173572..175146) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974513.1 transl_table 11 codon_start 1 locus_tag LOCUS_59210 CDS 175562..176101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59220 CDS 176273..177346 product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533235.1 transl_table 11 codon_start 1 locus_tag LOCUS_59230 CDS 177446..178951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59240 CDS complement(179179..180441) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087835.1 transl_table 11 codon_start 1 locus_tag LOCUS_59250 CDS complement(180438..180971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59260 CDS complement(181045..182049) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037087840.1 transl_table 11 codon_start 1 locus_tag LOCUS_59270 CDS complement(182136..183161) product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206051.1 transl_table 11 codon_start 1 locus_tag LOCUS_59280 CDS complement(183158..184021) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969403.1 transl_table 11 codon_start 1 locus_tag LOCUS_59290 CDS complement(184045..184806) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092584909.1 transl_table 11 codon_start 1 locus_tag LOCUS_59300 CDS 184978..185913 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875267.1 transl_table 11 codon_start 1 locus_tag LOCUS_59310 CDS 186020..186871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59320 CDS 186894..187886 product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975196.1 transl_table 11 codon_start 1 locus_tag LOCUS_59330 CDS 187901..188542 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008606.1 transl_table 11 codon_start 1 locus_tag LOCUS_59340 gene dhaL CDS 188678..190780 product bifunctional sugar-binding transcriptional regulator/dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975194.1 transl_table 11 codon_start 1 locus_tag LOCUS_59350 CDS 190794..191429 product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015008607.1 transl_table 11 codon_start 1 locus_tag LOCUS_59360 gene dhaL CDS complement(191464..192300) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975163.1 transl_table 11 codon_start 1 locus_tag LOCUS_59370 CDS 192392..193276 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969490.1 transl_table 11 codon_start 1 locus_tag LOCUS_59380 CDS 193273..194610 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975165.1 transl_table 11 codon_start 1 locus_tag LOCUS_59390 CDS 194632..195372 product glutamine ABC transporter substrate-binding protein GlnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210235.1 transl_table 11 codon_start 1 locus_tag LOCUS_59400 gene glnH CDS 195433..196089 product glutamine ABC transporter permease GlnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811112.1 transl_table 11 codon_start 1 locus_tag LOCUS_59410 gene glnP CDS 196086..196814 product glutamine ABC transporter ATP-binding protein GlnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569093.1 transl_table 11 codon_start 1 locus_tag LOCUS_59420 gene glnQ CDS 196804..197847 product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190976.1 transl_table 11 codon_start 1 locus_tag LOCUS_59430 CDS complement(197894..199168) product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651334.1 transl_table 11 codon_start 1 locus_tag LOCUS_59440 CDS complement(199215..199949) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061880.1 transl_table 11 codon_start 1 locus_tag LOCUS_59450 CDS complement(199969..200418) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163926.1 transl_table 11 codon_start 1 locus_tag LOCUS_59460 CDS complement(200432..201499) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533030.1 transl_table 11 codon_start 1 locus_tag LOCUS_59470 CDS complement(201703..202032) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533029.1 transl_table 11 codon_start 1 locus_tag LOCUS_59480 CDS complement(202036..203154) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533028.1 transl_table 11 codon_start 1 locus_tag LOCUS_59490 CDS complement(203156..204253) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975559.1 transl_table 11 codon_start 1 locus_tag LOCUS_59500 gene ugpC CDS complement(204257..205123) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533026.1 transl_table 11 codon_start 1 locus_tag LOCUS_59510 CDS complement(205139..206035) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533025.1 transl_table 11 codon_start 1 locus_tag LOCUS_59520 CDS complement(206105..206338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59530 CDS complement(206591..207907) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975557.1 transl_table 11 codon_start 1 locus_tag LOCUS_59540 CDS 208065..208877 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975556.1 transl_table 11 codon_start 1 locus_tag LOCUS_59550 CDS complement(208903..210048) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533016.1 transl_table 11 codon_start 1 locus_tag LOCUS_59560 CDS complement(210048..211208) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533015.1 transl_table 11 codon_start 1 locus_tag LOCUS_59570 CDS complement(211389..212282) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970634.1 transl_table 11 codon_start 1 locus_tag LOCUS_59580 CDS complement(212282..213037) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970635.1 transl_table 11 codon_start 1 locus_tag LOCUS_59590 CDS complement(213045..213776) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970636.1 transl_table 11 codon_start 1 locus_tag LOCUS_59600 CDS complement(213773..214756) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967034.1 transl_table 11 codon_start 1 locus_tag LOCUS_59610 CDS complement(214824..215801) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445392.1 transl_table 11 codon_start 1 locus_tag LOCUS_59620 CDS complement(215845..216537) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967032.1 transl_table 11 codon_start 1 locus_tag LOCUS_59630 CDS complement(216609..217808) product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970640.1 transl_table 11 codon_start 1 locus_tag LOCUS_59640 CDS complement(217811..218542) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967030.1 transl_table 11 codon_start 1 locus_tag LOCUS_59650 CDS 218644..219537 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967028.1 transl_table 11 codon_start 1 locus_tag LOCUS_59660 CDS 219613..220404 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970645.1 transl_table 11 codon_start 1 locus_tag LOCUS_59670 CDS 220425..221672 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445390.1 transl_table 11 codon_start 1 locus_tag LOCUS_59680 CDS complement(221895..225083) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972863.1 transl_table 11 codon_start 1 locus_tag LOCUS_59690 CDS complement(225080..226507) product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257431.1 transl_table 11 codon_start 1 locus_tag LOCUS_59700 CDS complement(226515..227306) product ImuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967468.1 transl_table 11 codon_start 1 locus_tag LOCUS_59710 CDS 227451..227756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59720 CDS complement(227867..228190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59730 CDS complement(228267..229286) product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391989.1 transl_table 11 codon_start 1 locus_tag LOCUS_59740 CDS complement(229465..230316) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531253.1 transl_table 11 codon_start 1 locus_tag LOCUS_59750 CDS 230653..232047 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965040.1 transl_table 11 codon_start 1 locus_tag LOCUS_59760 CDS complement(232044..232826) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967928.1 transl_table 11 codon_start 1 locus_tag LOCUS_59770 CDS complement(232830..234008) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967929.1 transl_table 11 codon_start 1 locus_tag LOCUS_59780 CDS complement(234005..235072) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076795.1 transl_table 11 codon_start 1 locus_tag LOCUS_59790 CDS complement(235297..236349) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967931.1 transl_table 11 codon_start 1 locus_tag LOCUS_59800 CDS complement(236560..237300) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170044.1 transl_table 11 codon_start 1 locus_tag LOCUS_59810 CDS complement(237373..238053) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967933.1 transl_table 11 codon_start 1 locus_tag LOCUS_59820 CDS 238318..239385 product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041169989.1 transl_table 11 codon_start 1 locus_tag LOCUS_59830 CDS 239388..240704 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967935.1 transl_table 11 codon_start 1 locus_tag LOCUS_59840 CDS complement(241486..241824) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083946.1 transl_table 11 codon_start 1 locus_tag LOCUS_59850 CDS complement(241847..242026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59860 CDS complement(242143..243072) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532378.1 transl_table 11 codon_start 1 locus_tag LOCUS_59870 CDS complement(243072..243725) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532377.1 transl_table 11 codon_start 1 locus_tag LOCUS_59880 CDS complement(243722..244159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59890 CDS complement(244156..245490) product phosphatase PAP2/dual specificity phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532375.1 transl_table 11 codon_start 1 locus_tag LOCUS_59900 CDS complement(245498..247234) product bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174564966.1 transl_table 11 codon_start 1 locus_tag LOCUS_59910 CDS 247354..247950 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105549.1 transl_table 11 codon_start 1 locus_tag LOCUS_59920 CDS complement(247954..249270) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384271.1 transl_table 11 codon_start 1 locus_tag LOCUS_59930 CDS complement(249400..250170) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976272.1 transl_table 11 codon_start 1 locus_tag LOCUS_59940 CDS complement(250179..251153) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969842.1 transl_table 11 codon_start 1 locus_tag LOCUS_59950 CDS complement(251186..252037) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976274.1 transl_table 11 codon_start 1 locus_tag LOCUS_59960 CDS complement(252047..253399) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529494.1 transl_table 11 codon_start 1 locus_tag LOCUS_59970 CDS complement(253522..254061) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973028.1 transl_table 11 codon_start 1 locus_tag LOCUS_59980 CDS complement(254264..254656) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105171.1 transl_table 11 codon_start 1 locus_tag LOCUS_59990 CDS complement(254731..255819) product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973437.1 transl_table 11 codon_start 1 locus_tag LOCUS_60000 CDS complement(255928..256677) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528511.1 transl_table 11 codon_start 1 locus_tag LOCUS_60010 tRNA complement(257246..257325) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(257570..258850) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970317.1 transl_table 11 codon_start 1 locus_tag LOCUS_60020 CDS complement(258915..259673) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339141.1 transl_table 11 codon_start 1 locus_tag LOCUS_60030 CDS complement(259670..260611) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221668.1 transl_table 11 codon_start 1 locus_tag LOCUS_60040 CDS complement(260604..261581) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068954875.1 transl_table 11 codon_start 1 locus_tag LOCUS_60050 CDS complement(261578..262480) product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 transl_table 11 codon_start 1 locus_tag LOCUS_60060 CDS complement(262514..262813) product DUF2218 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339024.1 transl_table 11 codon_start 1 locus_tag LOCUS_60070 CDS complement(262914..264521) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146602274.1 transl_table 11 codon_start 1 locus_tag LOCUS_60080 CDS complement(264521..266692) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065177.1 transl_table 11 codon_start 1 locus_tag LOCUS_60090 CDS 266906..267799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60100 CDS 268029..268541 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972994.1 transl_table 11 codon_start 1 locus_tag LOCUS_60110 CDS 268599..269606 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972993.1 transl_table 11 codon_start 1 locus_tag LOCUS_60120 CDS 269739..272048 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339007.1 transl_table 11 codon_start 1 locus_tag LOCUS_60130 CDS 272093..272998 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339025.1 transl_table 11 codon_start 1 locus_tag LOCUS_60140 CDS complement(273002..274066) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982245.1 transl_table 11 codon_start 1 locus_tag LOCUS_60150 CDS complement(274063..274986) product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456656.1 transl_table 11 codon_start 1 locus_tag LOCUS_60160 CDS complement(274987..276003) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396185.1 transl_table 11 codon_start 1 locus_tag LOCUS_60170 CDS complement(276006..276851) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975587.1 transl_table 11 codon_start 1 locus_tag LOCUS_60180 CDS complement(276851..277735) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396180.1 transl_table 11 codon_start 1 locus_tag LOCUS_60190 CDS complement(277805..279043) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396179.1 transl_table 11 codon_start 1 locus_tag LOCUS_60200 CDS 279233..280438 product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396177.1 transl_table 11 codon_start 1 locus_tag LOCUS_60210 CDS complement(280682..281458) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969234.1 transl_table 11 codon_start 1 locus_tag LOCUS_60220 sequence62 source 1..266702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(749..934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60230 CDS complement(1030..1257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60240 CDS 1148..2950 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402494.1 transl_table 11 codon_start 1 locus_tag LOCUS_60250 CDS complement(3089..3883) product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 transl_table 11 codon_start 1 locus_tag LOCUS_60260 gene gltC CDS complement(4103..4786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60270 CDS complement(4810..5799) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038796.1 transl_table 11 codon_start 1 locus_tag LOCUS_60280 CDS complement(5815..6921) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 transl_table 11 codon_start 1 locus_tag LOCUS_60290 CDS complement(7017..8063) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384670.1 transl_table 11 codon_start 1 locus_tag LOCUS_60300 CDS complement(8097..9149) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529319.1 transl_table 11 codon_start 1 locus_tag LOCUS_60310 CDS complement(9191..10936) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930994.1 transl_table 11 codon_start 1 locus_tag LOCUS_60320 CDS complement(10976..12193) product flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085289.1 transl_table 11 codon_start 1 locus_tag LOCUS_60330 CDS complement(12697..14253) product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186939.1 transl_table 11 codon_start 1 locus_tag LOCUS_60340 gene betC CDS complement(14265..15017) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827580.1 transl_table 11 codon_start 1 locus_tag LOCUS_60350 CDS complement(15037..16131) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530398.1 transl_table 11 codon_start 1 locus_tag LOCUS_60360 CDS complement(16148..17302) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530399.1 transl_table 11 codon_start 1 locus_tag LOCUS_60370 CDS complement(17376..18413) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530400.1 transl_table 11 codon_start 1 locus_tag LOCUS_60380 CDS 18598..19317 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244148.1 transl_table 11 codon_start 1 locus_tag LOCUS_60390 tRNA complement(19536..19609) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(19634..19718) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 19988..20863 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969188.1 transl_table 11 codon_start 1 locus_tag LOCUS_60400 CDS complement(20933..21556) product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969187.1 transl_table 11 codon_start 1 locus_tag LOCUS_60410 CDS 21688..22635 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975154.1 transl_table 11 codon_start 1 locus_tag LOCUS_60420 tRNA 22690..22765 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS 23028..23222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328794.1 transl_table 11 codon_start 1 locus_tag LOCUS_60430 CDS 23348..24121 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401481.1 transl_table 11 codon_start 1 locus_tag LOCUS_60440 CDS 24157..24666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969184.1 transl_table 11 codon_start 1 locus_tag LOCUS_60450 CDS complement(24788..25816) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101777569.1 transl_table 11 codon_start 1 locus_tag LOCUS_60460 gene prfB CDS complement(26021..28468) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969182.1 transl_table 11 codon_start 1 locus_tag LOCUS_60470 CDS complement(28733..29974) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401505.1 transl_table 11 codon_start 1 locus_tag LOCUS_60480 CDS 30610..33480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60490 CDS 33671..34435 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226013866.1 transl_table 11 codon_start 1 locus_tag LOCUS_60500 CDS complement(34518..35669) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969178.1 transl_table 11 codon_start 1 locus_tag LOCUS_60510 CDS 35876..36634 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533078.1 transl_table 11 codon_start 1 locus_tag LOCUS_60520 CDS 36784..37221 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975144.1 transl_table 11 codon_start 1 locus_tag LOCUS_60530 gene aroQ CDS 37242..37709 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383006.1 transl_table 11 codon_start 1 locus_tag LOCUS_60540 gene accB CDS 37720..39066 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533072.1 transl_table 11 codon_start 1 locus_tag LOCUS_60550 gene accC CDS 39079..39693 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975141.1 transl_table 11 codon_start 1 locus_tag LOCUS_60560 gene aat CDS complement(39924..40379) product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975140.1 transl_table 11 codon_start 1 locus_tag LOCUS_60570 CDS complement(40559..40954) product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328036.1 transl_table 11 codon_start 1 locus_tag LOCUS_60580 CDS complement(41108..41608) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533058.1 transl_table 11 codon_start 1 locus_tag LOCUS_60590 CDS complement(41674..43176) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401529.1 transl_table 11 codon_start 1 locus_tag LOCUS_60600 gene gatB CDS 43361..43762 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968525.1 transl_table 11 codon_start 1 locus_tag LOCUS_60610 CDS 43848..44750 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118999.1 transl_table 11 codon_start 1 locus_tag LOCUS_60620 CDS 44942..45199 product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312635.1 transl_table 11 codon_start 1 locus_tag LOCUS_60630 CDS complement(45234..45746) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328030.1 transl_table 11 codon_start 1 locus_tag LOCUS_60640 CDS complement(45890..47035) product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531225.1 transl_table 11 codon_start 1 locus_tag LOCUS_60650 tRNA complement(47450..47521) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(47851..49332) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240741.1 transl_table 11 codon_start 1 locus_tag LOCUS_60660 gene gatA CDS complement(49351..49815) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531786.1 transl_table 11 codon_start 1 locus_tag LOCUS_60670 CDS complement(49819..50106) product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 transl_table 11 codon_start 1 locus_tag LOCUS_60680 gene gatC CDS complement(50210..50914) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256572.1 transl_table 11 codon_start 1 locus_tag LOCUS_60690 CDS 51032..51328 product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974886.1 transl_table 11 codon_start 1 locus_tag LOCUS_60700 CDS 51340..51825 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971538.1 transl_table 11 codon_start 1 locus_tag LOCUS_60710 gene ruvX CDS complement(51771..52097) product DUF6105 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972656.1 transl_table 11 codon_start 1 locus_tag LOCUS_60720 CDS 52436..53371 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240746.1 transl_table 11 codon_start 1 locus_tag LOCUS_60730 CDS complement(53353..55005) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328023.1 transl_table 11 codon_start 1 locus_tag LOCUS_60740 CDS 55177..56118 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975127.1 transl_table 11 codon_start 1 locus_tag LOCUS_60750 CDS 56115..57407 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969167.1 transl_table 11 codon_start 1 locus_tag LOCUS_60760 CDS 57610..58224 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975125.1 transl_table 11 codon_start 1 locus_tag LOCUS_60770 gene plsY CDS 58227..59378 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240751.1 transl_table 11 codon_start 1 locus_tag LOCUS_60780 gene dprA CDS complement(59310..59564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60790 CDS 59899..62532 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533027.1 transl_table 11 codon_start 1 locus_tag LOCUS_60800 gene topA CDS 62537..64888 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399477.1 transl_table 11 codon_start 1 locus_tag LOCUS_60810 gene rnr CDS 64944..65420 product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252183.1 transl_table 11 codon_start 1 locus_tag LOCUS_60820 CDS 65417..66079 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399475.1 transl_table 11 codon_start 1 locus_tag LOCUS_60830 CDS 66093..67277 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975119.1 transl_table 11 codon_start 1 locus_tag LOCUS_60840 CDS 67371..67538 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707650.1 transl_table 11 codon_start 1 locus_tag LOCUS_60850 gene rpmG CDS complement(68222..69589) product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537641.1 transl_table 11 codon_start 1 locus_tag LOCUS_60860 CDS complement(69606..69977) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003496409.1 transl_table 11 codon_start 1 locus_tag LOCUS_60870 CDS 70146..70418 product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328012.1 transl_table 11 codon_start 1 locus_tag LOCUS_60880 CDS 70542..71888 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650680.1 transl_table 11 codon_start 1 locus_tag LOCUS_60890 CDS 72019..73335 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969159.1 transl_table 11 codon_start 1 locus_tag LOCUS_60900 CDS complement(73440..74030) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402250.1 transl_table 11 codon_start 1 locus_tag LOCUS_60910 CDS 74182..74580 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315324.1 transl_table 11 codon_start 1 locus_tag LOCUS_60920 CDS complement(74584..78081) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969158.1 transl_table 11 codon_start 1 locus_tag LOCUS_60930 gene dnaE CDS 78427..79008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328006.1 transl_table 11 codon_start 1 locus_tag LOCUS_60940 CDS complement(79126..79812) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975112.1 transl_table 11 codon_start 1 locus_tag LOCUS_60950 CDS complement(79824..81131) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208662.1 transl_table 11 codon_start 1 locus_tag LOCUS_60960 CDS complement(81168..82496) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240764.1 transl_table 11 codon_start 1 locus_tag LOCUS_60970 CDS complement(83210..83479) product DUF1467 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975099.1 transl_table 11 codon_start 1 locus_tag LOCUS_60980 CDS complement(83617..85284) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975097.1 transl_table 11 codon_start 1 locus_tag LOCUS_60990 CDS complement(85300..86067) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975096.1 transl_table 11 codon_start 1 locus_tag LOCUS_61000 CDS complement(86064..87506) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969150.1 transl_table 11 codon_start 1 locus_tag LOCUS_61010 gene nuoN CDS complement(87524..89035) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531857.1 transl_table 11 codon_start 1 locus_tag LOCUS_61020 CDS complement(89035..91032) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531855.1 transl_table 11 codon_start 1 locus_tag LOCUS_61030 gene nuoL CDS complement(91040..91348) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531854.1 transl_table 11 codon_start 1 locus_tag LOCUS_61040 gene nuoK CDS complement(91376..91990) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707629.1 transl_table 11 codon_start 1 locus_tag LOCUS_61050 CDS complement(92098..92589) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 transl_table 11 codon_start 1 locus_tag LOCUS_61060 gene nuoI CDS complement(92626..93672) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531848.1 transl_table 11 codon_start 1 locus_tag LOCUS_61070 gene nuoH CDS complement(93693..95771) product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975089.1 transl_table 11 codon_start 1 locus_tag LOCUS_61080 gene nuoG CDS complement(95890..96537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240776.1 transl_table 11 codon_start 1 locus_tag LOCUS_61090 CDS complement(96542..97846) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312708.1 transl_table 11 codon_start 1 locus_tag LOCUS_61100 gene nuoF CDS complement(97858..98991) product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971510.1 transl_table 11 codon_start 1 locus_tag LOCUS_61110 CDS complement(99008..99250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327988.1 transl_table 11 codon_start 1 locus_tag LOCUS_61120 CDS complement(99250..100440) product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327987.1 transl_table 11 codon_start 1 locus_tag LOCUS_61130 CDS 100636..100917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61140 CDS complement(100925..101527) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327986.1 transl_table 11 codon_start 1 locus_tag LOCUS_61150 CDS complement(101547..102128) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975082.1 transl_table 11 codon_start 1 locus_tag LOCUS_61160 CDS complement(102119..102484) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707618.1 transl_table 11 codon_start 1 locus_tag LOCUS_61170 tRNA complement(102913..102989) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(103038..103114) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(103163..103239) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 tRNA 103483..103558 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS 103850..105616 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066587.1 transl_table 11 codon_start 1 locus_tag LOCUS_61180 CDS 105742..105921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61190 CDS 105918..106106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61200 CDS complement(106278..107510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61210 CDS complement(107657..108199) product DUF5706 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976262.1 transl_table 11 codon_start 1 locus_tag LOCUS_61220 CDS 108383..110341 product CHASE2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050996810.1 transl_table 11 codon_start 1 locus_tag LOCUS_61230 CDS complement(110345..111154) product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072642950.1 transl_table 11 codon_start 1 locus_tag LOCUS_61240 gene hutC CDS complement(111186..112532) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532304.1 transl_table 11 codon_start 1 locus_tag LOCUS_61250 CDS 112646..113869 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 transl_table 11 codon_start 1 locus_tag LOCUS_61260 gene hutI CDS 113912..115447 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061588.1 transl_table 11 codon_start 1 locus_tag LOCUS_61270 gene hutH CDS 115773..116576 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975686.1 transl_table 11 codon_start 1 locus_tag LOCUS_61280 gene hutG CDS 116593..118269 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975685.1 transl_table 11 codon_start 1 locus_tag LOCUS_61290 CDS 118312..118899 product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973439.1 transl_table 11 codon_start 1 locus_tag LOCUS_61300 CDS 118994..119980 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 transl_table 11 codon_start 1 locus_tag LOCUS_61310 CDS 120048..120881 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969901.1 transl_table 11 codon_start 1 locus_tag LOCUS_61320 CDS complement(121026..121241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61330 CDS 121385..122341 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061600.1 transl_table 11 codon_start 1 locus_tag LOCUS_61340 CDS 122426..123550 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061599.1 transl_table 11 codon_start 1 locus_tag LOCUS_61350 CDS complement(123586..126123) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327248.1 transl_table 11 codon_start 1 locus_tag LOCUS_61360 gene secD CDS complement(126231..126653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61370 CDS complement(126792..130262) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975072.1 transl_table 11 codon_start 1 locus_tag LOCUS_61380 CDS complement(130266..131534) product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969142.1 transl_table 11 codon_start 1 locus_tag LOCUS_61390 CDS 131793..132257 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975070.1 transl_table 11 codon_start 1 locus_tag LOCUS_61400 CDS complement(132378..134573) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969141.1 transl_table 11 codon_start 1 locus_tag LOCUS_61410 CDS complement(134762..135037) product DNA-binding protein HupB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531811.1 transl_table 11 codon_start 1 locus_tag LOCUS_61420 gene hupB CDS complement(135243..137666) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531808.1 transl_table 11 codon_start 1 locus_tag LOCUS_61430 gene lon CDS complement(138207..139484) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531807.1 transl_table 11 codon_start 1 locus_tag LOCUS_61440 gene clpX CDS complement(139771..140403) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327975.1 transl_table 11 codon_start 1 locus_tag LOCUS_61450 gene clpP CDS 140676..142430 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974729.1 transl_table 11 codon_start 1 locus_tag LOCUS_61460 gene ggt CDS complement(142433..142819) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 transl_table 11 codon_start 1 locus_tag LOCUS_61470 CDS complement(142816..143073) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 transl_table 11 codon_start 1 locus_tag LOCUS_61480 CDS 143142..144410 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971502.1 transl_table 11 codon_start 1 locus_tag LOCUS_61490 CDS 144419..144988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61500 CDS complement(145051..145395) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327970.1 transl_table 11 codon_start 1 locus_tag LOCUS_61510 CDS complement(145609..146892) product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 transl_table 11 codon_start 1 locus_tag LOCUS_61520 CDS complement(147012..147440) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529220.1 transl_table 11 codon_start 1 locus_tag LOCUS_61530 CDS complement(147506..147943) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529220.1 transl_table 11 codon_start 1 locus_tag LOCUS_61540 CDS 148206..149042 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969133.1 transl_table 11 codon_start 1 locus_tag LOCUS_61550 CDS 149101..149370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61560 CDS 149367..149636 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972002.1 transl_table 11 codon_start 1 locus_tag LOCUS_61570 CDS complement(149641..150456) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391002.1 transl_table 11 codon_start 1 locus_tag LOCUS_61580 CDS 150596..151027 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969131.1 transl_table 11 codon_start 1 locus_tag LOCUS_61590 CDS 151257..151721 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707596.1 transl_table 11 codon_start 1 locus_tag LOCUS_61600 gene rplM CDS 151724..152200 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975055.1 transl_table 11 codon_start 1 locus_tag LOCUS_61610 gene rpsI CDS complement(152221..152466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61620 CDS 152387..153340 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391007.1 transl_table 11 codon_start 1 locus_tag LOCUS_61630 gene speB CDS 153474..154406 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969129.1 transl_table 11 codon_start 1 locus_tag LOCUS_61640 gene argC CDS complement(154414..154809) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 transl_table 11 codon_start 1 locus_tag LOCUS_61650 CDS complement(154806..155060) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892665.1 transl_table 11 codon_start 1 locus_tag LOCUS_61660 CDS complement(155114..156193) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969128.1 transl_table 11 codon_start 1 locus_tag LOCUS_61670 CDS 156394..156612 product DUF2842 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379956.1 transl_table 11 codon_start 1 locus_tag LOCUS_61680 CDS complement(156614..157057) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967328.1 transl_table 11 codon_start 1 locus_tag LOCUS_61690 CDS 157228..158499 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327954.1 transl_table 11 codon_start 1 locus_tag LOCUS_61700 CDS complement(158506..160779) product exopolysaccharide transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969123.1 transl_table 11 codon_start 1 locus_tag LOCUS_61710 CDS 160994..161569 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327952.1 transl_table 11 codon_start 1 locus_tag LOCUS_61720 CDS 161575..162741 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391038.1 transl_table 11 codon_start 1 locus_tag LOCUS_61730 CDS 162811..164379 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969121.1 transl_table 11 codon_start 1 locus_tag LOCUS_61740 CDS 164376..165611 product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529257.1 transl_table 11 codon_start 1 locus_tag LOCUS_61750 CDS 165619..166779 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969120.1 transl_table 11 codon_start 1 locus_tag LOCUS_61760 CDS complement(166850..167101) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313814.1 transl_table 11 codon_start 1 locus_tag LOCUS_61770 CDS 167413..168654 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074377.1 transl_table 11 codon_start 1 locus_tag LOCUS_61780 CDS 168654..169154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61790 CDS 169222..169425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61800 CDS 169422..170198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61810 CDS 170261..170599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61820 CDS 170666..170932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61830 CDS 170910..172358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61840 CDS 172625..172834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61850 CDS complement(172918..173082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61860 CDS complement(173212..173394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61870 CDS complement(173433..173699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61880 CDS 173876..174736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61890 CDS 175061..175414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61900 CDS 175411..176364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61910 CDS 176354..177088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61920 CDS 177212..177403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61930 CDS 177494..177781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61940 CDS 177798..180086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61950 CDS 180095..181237 product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970909.1 transl_table 11 codon_start 1 locus_tag LOCUS_61960 CDS complement(181250..181978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61970 CDS complement(182042..182269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61980 CDS 182250..182489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_61990 CDS 182482..182775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62000 CDS complement(182858..183163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62010 CDS complement(183163..183351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62020 CDS 183541..183717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62030 CDS complement(183763..184107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62040 CDS complement(184194..184643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62050 CDS complement(184698..185057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62060 CDS complement(185380..185883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62070 CDS complement(185894..186130) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167391325.1 transl_table 11 codon_start 1 locus_tag LOCUS_62080 CDS 186252..186833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62090 CDS 186830..186994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62100 CDS 187034..187261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62110 tRNA 187268..187342 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 CDS complement(187624..187824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62120 CDS complement(188008..188193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244278.1 transl_table 11 codon_start 1 locus_tag LOCUS_62130 CDS 188385..188573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62140 tRNA complement(188658..188734) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 CDS 189219..189431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034857441.1 transl_table 11 codon_start 1 locus_tag LOCUS_62150 CDS complement(189589..190119) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529274.1 transl_table 11 codon_start 1 locus_tag LOCUS_62160 CDS complement(190247..190585) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529278.1 transl_table 11 codon_start 1 locus_tag LOCUS_62170 CDS complement(190808..191779) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529280.1 transl_table 11 codon_start 1 locus_tag LOCUS_62180 CDS complement(191781..192839) product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529283.1 transl_table 11 codon_start 1 locus_tag LOCUS_62190 gene plsX CDS complement(192957..193511) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327907.1 transl_table 11 codon_start 1 locus_tag LOCUS_62200 CDS complement(193523..194083) product ubiquinol-cytochrome C chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327906.1 transl_table 11 codon_start 1 locus_tag LOCUS_62210 CDS 194237..194716 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707542.1 transl_table 11 codon_start 1 locus_tag LOCUS_62220 CDS complement(194801..196936) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969115.1 transl_table 11 codon_start 1 locus_tag LOCUS_62230 CDS complement(197129..198355) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971445.1 transl_table 11 codon_start 1 locus_tag LOCUS_62240 CDS complement(198370..198852) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707539.1 transl_table 11 codon_start 1 locus_tag LOCUS_62250 gene nusB CDS complement(198849..199310) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529297.1 transl_table 11 codon_start 1 locus_tag LOCUS_62260 gene ribH CDS 199511..200014 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252217.1 transl_table 11 codon_start 1 locus_tag LOCUS_62270 CDS complement(200020..201156) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531843.1 transl_table 11 codon_start 1 locus_tag LOCUS_62280 CDS complement(201288..201905) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391077.1 transl_table 11 codon_start 1 locus_tag LOCUS_62290 CDS complement(201905..203194) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529307.1 transl_table 11 codon_start 1 locus_tag LOCUS_62300 gene ribD CDS complement(203195..203674) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529310.1 transl_table 11 codon_start 1 locus_tag LOCUS_62310 gene nrdR CDS complement(203684..204982) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037431185.1 transl_table 11 codon_start 1 locus_tag LOCUS_62320 CDS complement(205314..206636) product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529314.1 transl_table 11 codon_start 1 locus_tag LOCUS_62330 CDS complement(206924..207436) product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975011.1 transl_table 11 codon_start 1 locus_tag LOCUS_62340 CDS complement(207568..208038) product DUF6163 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225996759.1 transl_table 11 codon_start 1 locus_tag LOCUS_62350 CDS 208161..209177 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391123.1 transl_table 11 codon_start 1 locus_tag LOCUS_62360 gene hemB CDS 209423..209887 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327890.1 transl_table 11 codon_start 1 locus_tag LOCUS_62370 CDS 210039..210803 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327889.1 transl_table 11 codon_start 1 locus_tag LOCUS_62380 CDS 210882..211796 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969107.1 transl_table 11 codon_start 1 locus_tag LOCUS_62390 CDS 211848..212069 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405518.1 transl_table 11 codon_start 1 locus_tag LOCUS_62400 CDS 212066..212458 product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387746.1 transl_table 11 codon_start 1 locus_tag LOCUS_62410 CDS complement(212459..214711) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975004.1 transl_table 11 codon_start 1 locus_tag LOCUS_62420 gene parC CDS 214921..216117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391097.1 transl_table 11 codon_start 1 locus_tag LOCUS_62430 CDS complement(216358..217794) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992270.1 transl_table 11 codon_start 1 locus_tag LOCUS_62440 gene creD CDS complement(217973..218302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62450 CDS complement(218398..220185) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971433.1 transl_table 11 codon_start 1 locus_tag LOCUS_62460 gene aspS CDS complement(220561..221157) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971421.1 transl_table 11 codon_start 1 locus_tag LOCUS_62470 CDS complement(221179..223293) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391112.1 transl_table 11 codon_start 1 locus_tag LOCUS_62480 CDS 223405..224265 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391113.1 transl_table 11 codon_start 1 locus_tag LOCUS_62490 CDS 224262..225071 product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391115.1 transl_table 11 codon_start 1 locus_tag LOCUS_62500 CDS 225188..225778 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391116.1 transl_table 11 codon_start 1 locus_tag LOCUS_62510 CDS complement(226197..226838) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327858.1 transl_table 11 codon_start 1 locus_tag LOCUS_62520 CDS 227197..227961 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974981.1 transl_table 11 codon_start 1 locus_tag LOCUS_62530 CDS 227958..230009 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969086.1 transl_table 11 codon_start 1 locus_tag LOCUS_62540 gene uvrC CDS 230077..230544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133033266.1 transl_table 11 codon_start 1 locus_tag LOCUS_62550 CDS 230700..231284 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312874.1 transl_table 11 codon_start 1 locus_tag LOCUS_62560 gene pgsA CDS 231286..231540 product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327854.1 transl_table 11 codon_start 1 locus_tag LOCUS_62570 gene moaD CDS 231544..232011 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240872.1 transl_table 11 codon_start 1 locus_tag LOCUS_62580 CDS complement(232199..233128) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969084.1 transl_table 11 codon_start 1 locus_tag LOCUS_62590 CDS 233215..233769 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327851.1 transl_table 11 codon_start 1 locus_tag LOCUS_62600 CDS 233766..234272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531615.1 transl_table 11 codon_start 1 locus_tag LOCUS_62610 CDS 234331..235740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62620 CDS complement(235812..236234) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707487.1 transl_table 11 codon_start 1 locus_tag LOCUS_62630 gene ndk CDS complement(236340..237029) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240876.1 transl_table 11 codon_start 1 locus_tag LOCUS_62640 CDS 237162..237671 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874483.1 transl_table 11 codon_start 1 locus_tag LOCUS_62650 CDS 237870..238154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62660 CDS 238344..239426 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992266.1 transl_table 11 codon_start 1 locus_tag LOCUS_62670 CDS 239516..241402 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969079.1 transl_table 11 codon_start 1 locus_tag LOCUS_62680 CDS 241491..242318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62690 CDS complement(242325..243167) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391143.1 transl_table 11 codon_start 1 locus_tag LOCUS_62700 CDS 243435..244523 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937856.1 transl_table 11 codon_start 1 locus_tag LOCUS_62710 CDS complement(244765..246537) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066873328.1 transl_table 11 codon_start 1 locus_tag LOCUS_62720 CDS complement(246534..247109) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605350.1 transl_table 11 codon_start 1 locus_tag LOCUS_62730 CDS 247357..248283 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391146.1 transl_table 11 codon_start 1 locus_tag LOCUS_62740 CDS complement(248448..248897) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240883.1 transl_table 11 codon_start 1 locus_tag LOCUS_62750 CDS complement(248905..250395) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531642.1 transl_table 11 codon_start 1 locus_tag LOCUS_62760 CDS 250662..251846 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531650.1 transl_table 11 codon_start 1 locus_tag LOCUS_62770 gene lptF CDS 251843..252925 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391153.1 transl_table 11 codon_start 1 locus_tag LOCUS_62780 gene lptG CDS 252925..255261 product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969074.1 transl_table 11 codon_start 1 locus_tag LOCUS_62790 CDS 255449..256345 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327836.1 transl_table 11 codon_start 1 locus_tag LOCUS_62800 CDS 256428..257462 product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327835.1 transl_table 11 codon_start 1 locus_tag LOCUS_62810 gene pdxA CDS 257462..258289 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969072.1 transl_table 11 codon_start 1 locus_tag LOCUS_62820 gene rsmA CDS complement(258454..259113) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971396.1 transl_table 11 codon_start 1 locus_tag LOCUS_62830 gene gmk CDS complement(259117..260004) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969071.1 transl_table 11 codon_start 1 locus_tag LOCUS_62840 CDS complement(260245..261426) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327831.1 transl_table 11 codon_start 1 locus_tag LOCUS_62850 gene mltG CDS complement(261661..262920) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391159.1 transl_table 11 codon_start 1 locus_tag LOCUS_62860 gene fabF CDS complement(263027..263263) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531676.1 transl_table 11 codon_start 1 locus_tag LOCUS_62870 CDS complement(263571..264308) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531678.1 transl_table 11 codon_start 1 locus_tag LOCUS_62880 gene fabG CDS complement(264421..265365) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974943.1 transl_table 11 codon_start 1 locus_tag LOCUS_62890 gene fabD CDS 265559..266602 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327827.1 transl_table 11 codon_start 1 locus_tag LOCUS_62900 sequence63 source 1..247250 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..1157) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976316.1 transl_table 11 codon_start 1 locus_tag LOCUS_62910 CDS 1260..2171 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976315.1 transl_table 11 codon_start 1 locus_tag LOCUS_62920 CDS 2168..2584 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 transl_table 11 codon_start 1 locus_tag LOCUS_62930 CDS 2581..2934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62940 CDS 3042..3260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_62950 CDS complement(3164..4795) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242873.1 transl_table 11 codon_start 1 locus_tag LOCUS_62960 CDS complement(4788..5615) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976310.1 transl_table 11 codon_start 1 locus_tag LOCUS_62970 CDS complement(5612..6721) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242874.1 transl_table 11 codon_start 1 locus_tag LOCUS_62980 CDS complement(6721..8310) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 transl_table 11 codon_start 1 locus_tag LOCUS_62990 CDS complement(8588..9370) product carnitinyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387085.1 transl_table 11 codon_start 1 locus_tag LOCUS_63000 CDS complement(9367..11457) product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242877.1 transl_table 11 codon_start 1 locus_tag LOCUS_63010 CDS complement(11612..12844) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969804.1 transl_table 11 codon_start 1 locus_tag LOCUS_63020 CDS complement(12952..14445) product carnitine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537893.1 transl_table 11 codon_start 1 locus_tag LOCUS_63030 CDS complement(14673..15587) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397047.1 transl_table 11 codon_start 1 locus_tag LOCUS_63040 CDS 15702..16676 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397044.1 transl_table 11 codon_start 1 locus_tag LOCUS_63050 CDS complement(16673..17836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63060 CDS 18000..19538 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530835.1 transl_table 11 codon_start 1 locus_tag LOCUS_63070 CDS 19551..20930 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535871.1 transl_table 11 codon_start 1 locus_tag LOCUS_63080 CDS 20930..22216 product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926512.1 transl_table 11 codon_start 1 locus_tag LOCUS_63090 CDS 22201..23298 product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521482.1 transl_table 11 codon_start 1 locus_tag LOCUS_63100 CDS 23502..25163 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521481.1 transl_table 11 codon_start 1 locus_tag LOCUS_63110 CDS 25179..25751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081632.1 transl_table 11 codon_start 1 locus_tag LOCUS_63120 CDS 25964..26926 product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061899.1 transl_table 11 codon_start 1 locus_tag LOCUS_63130 CDS complement(26961..27560) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395469.1 transl_table 11 codon_start 1 locus_tag LOCUS_63140 CDS 27767..28450 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061287.1 transl_table 11 codon_start 1 locus_tag LOCUS_63150 CDS complement(28550..29311) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536404.1 transl_table 11 codon_start 1 locus_tag LOCUS_63160 CDS complement(29317..30141) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969801.1 transl_table 11 codon_start 1 locus_tag LOCUS_63170 CDS complement(30141..31007) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180941516.1 transl_table 11 codon_start 1 locus_tag LOCUS_63180 CDS 31083..31298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63190 CDS complement(31285..32448) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969799.1 transl_table 11 codon_start 1 locus_tag LOCUS_63200 CDS complement(32479..33558) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976297.1 transl_table 11 codon_start 1 locus_tag LOCUS_63210 CDS 33754..34551 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310827.1 transl_table 11 codon_start 1 locus_tag LOCUS_63220 CDS complement(34811..35287) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397025.1 transl_table 11 codon_start 1 locus_tag LOCUS_63230 CDS complement(35654..36715) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969779.1 transl_table 11 codon_start 1 locus_tag LOCUS_63240 CDS complement(36725..37507) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310499.1 transl_table 11 codon_start 1 locus_tag LOCUS_63250 CDS complement(37504..38394) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328991.1 transl_table 11 codon_start 1 locus_tag LOCUS_63260 CDS complement(38479..39582) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328990.1 transl_table 11 codon_start 1 locus_tag LOCUS_63270 CDS complement(39686..40585) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529191.1 transl_table 11 codon_start 1 locus_tag LOCUS_63280 CDS 40757..41518 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397019.1 transl_table 11 codon_start 1 locus_tag LOCUS_63290 CDS 41652..42161 product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 transl_table 11 codon_start 1 locus_tag LOCUS_63300 CDS 42158..43480 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 transl_table 11 codon_start 1 locus_tag LOCUS_63310 CDS 43612..44667 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 transl_table 11 codon_start 1 locus_tag LOCUS_63320 CDS 44743..46113 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397017.1 transl_table 11 codon_start 1 locus_tag LOCUS_63330 CDS 46321..47700 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969774.1 transl_table 11 codon_start 1 locus_tag LOCUS_63340 CDS 47706..48851 product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969773.1 transl_table 11 codon_start 1 locus_tag LOCUS_63350 CDS 49072..49788 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397009.1 transl_table 11 codon_start 1 locus_tag LOCUS_63360 CDS 50044..51567 product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918316.1 transl_table 11 codon_start 1 locus_tag LOCUS_63370 CDS complement(51797..53215) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397006.1 transl_table 11 codon_start 1 locus_tag LOCUS_63380 CDS 53551..54405 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972080.1 transl_table 11 codon_start 1 locus_tag LOCUS_63390 CDS 54564..54902 product TIGR01244 family sulfur transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976253.1 transl_table 11 codon_start 1 locus_tag LOCUS_63400 CDS complement(55090..56739) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969768.1 transl_table 11 codon_start 1 locus_tag LOCUS_63410 CDS complement(56736..57932) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972076.1 transl_table 11 codon_start 1 locus_tag LOCUS_63420 CDS 57838..58173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63430 CDS complement(58104..59051) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976250.1 transl_table 11 codon_start 1 locus_tag LOCUS_63440 CDS complement(59048..60007) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396993.1 transl_table 11 codon_start 1 locus_tag LOCUS_63450 CDS 60197..60964 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242904.1 transl_table 11 codon_start 1 locus_tag LOCUS_63460 CDS 61116..62789 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242905.1 transl_table 11 codon_start 1 locus_tag LOCUS_63470 gene ettA CDS 62938..63945 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969763.1 transl_table 11 codon_start 1 locus_tag LOCUS_63480 CDS 63947..64849 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969762.1 transl_table 11 codon_start 1 locus_tag LOCUS_63490 gene metF CDS complement(65349..66284) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976244.1 transl_table 11 codon_start 1 locus_tag LOCUS_63500 CDS complement(66427..67623) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969761.1 transl_table 11 codon_start 1 locus_tag LOCUS_63510 CDS complement(67782..68561) product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529163.1 transl_table 11 codon_start 1 locus_tag LOCUS_63520 CDS complement(68754..69422) product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530975.1 transl_table 11 codon_start 1 locus_tag LOCUS_63530 CDS 69671..71218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63540 CDS 71284..72690 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 transl_table 11 codon_start 1 locus_tag LOCUS_63550 CDS complement(72675..73076) product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972626.1 transl_table 11 codon_start 1 locus_tag LOCUS_63560 CDS 73260..73847 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992379.1 transl_table 11 codon_start 1 locus_tag LOCUS_63570 CDS complement(74038..74967) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529156.1 transl_table 11 codon_start 1 locus_tag LOCUS_63580 CDS complement(75100..75729) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252464.1 transl_table 11 codon_start 1 locus_tag LOCUS_63590 CDS complement(75812..77026) product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969756.1 transl_table 11 codon_start 1 locus_tag LOCUS_63600 CDS 77322..78005 product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328962.1 transl_table 11 codon_start 1 locus_tag LOCUS_63610 CDS 78002..78766 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976234.1 transl_table 11 codon_start 1 locus_tag LOCUS_63620 CDS 78992..79654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63630 CDS 79728..80909 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969753.1 transl_table 11 codon_start 1 locus_tag LOCUS_63640 CDS 81768..82208 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310455.1 transl_table 11 codon_start 1 locus_tag LOCUS_63650 gene mraZ CDS 82223..83248 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529142.1 transl_table 11 codon_start 1 locus_tag LOCUS_63660 gene rsmH CDS 83252..83644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976219.1 transl_table 11 codon_start 1 locus_tag LOCUS_63670 CDS 83644..85392 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969751.1 transl_table 11 codon_start 1 locus_tag LOCUS_63680 CDS 85457..86908 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328956.1 transl_table 11 codon_start 1 locus_tag LOCUS_63690 CDS 86905..88338 product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042777133.1 transl_table 11 codon_start 1 locus_tag LOCUS_63700 CDS 88455..89555 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328954.1 transl_table 11 codon_start 1 locus_tag LOCUS_63710 gene mraY CDS 89563..90960 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242926.1 transl_table 11 codon_start 1 locus_tag LOCUS_63720 gene murD CDS 91134..92288 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529129.1 transl_table 11 codon_start 1 locus_tag LOCUS_63730 gene ftsW CDS 92467..93603 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252472.1 transl_table 11 codon_start 1 locus_tag LOCUS_63740 gene murG CDS 93600..95015 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396961.1 transl_table 11 codon_start 1 locus_tag LOCUS_63750 gene murC CDS 95012..95986 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969746.1 transl_table 11 codon_start 1 locus_tag LOCUS_63760 gene murB CDS 96121..96855 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969745.1 transl_table 11 codon_start 1 locus_tag LOCUS_63770 gene aqpZ CDS 96986..97672 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969745.1 transl_table 11 codon_start 1 locus_tag LOCUS_63780 gene aqpZ CDS complement(97736..99043) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972049.1 transl_table 11 codon_start 1 locus_tag LOCUS_63790 CDS 98934..99230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63800 CDS 99476..100402 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969744.1 transl_table 11 codon_start 1 locus_tag LOCUS_63810 CDS 100420..101310 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969743.1 transl_table 11 codon_start 1 locus_tag LOCUS_63820 gene ftsQ CDS 101307..102638 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242933.1 transl_table 11 codon_start 1 locus_tag LOCUS_63830 gene ftsA CDS 102737..104467 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969741.1 transl_table 11 codon_start 1 locus_tag LOCUS_63840 gene ftsZ CDS 104821..105783 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386944.1 transl_table 11 codon_start 1 locus_tag LOCUS_63850 gene lpxC CDS 105924..106790 product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529108.1 transl_table 11 codon_start 1 locus_tag LOCUS_63860 CDS 106809..108479 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969739.1 transl_table 11 codon_start 1 locus_tag LOCUS_63870 gene recN CDS 108708..110867 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972042.1 transl_table 11 codon_start 1 locus_tag LOCUS_63880 gene ligA CDS complement(110854..111795) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838160.1 transl_table 11 codon_start 1 locus_tag LOCUS_63890 CDS complement(111881..112291) product TIGR02588 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973591.1 transl_table 11 codon_start 1 locus_tag LOCUS_63900 CDS complement(112299..113129) product TIGR02587 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973592.1 transl_table 11 codon_start 1 locus_tag LOCUS_63910 CDS complement(113367..115280) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528794.1 transl_table 11 codon_start 1 locus_tag LOCUS_63920 CDS 115590..116459 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242940.1 transl_table 11 codon_start 1 locus_tag LOCUS_63930 gene panC CDS 116461..117285 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969735.1 transl_table 11 codon_start 1 locus_tag LOCUS_63940 gene panB CDS 117634..118362 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396901.1 transl_table 11 codon_start 1 locus_tag LOCUS_63950 CDS 118365..118676 product AzlD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708618.1 transl_table 11 codon_start 1 locus_tag LOCUS_63960 CDS complement(118666..120501) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158318.1 transl_table 11 codon_start 1 locus_tag LOCUS_63970 CDS complement(120665..121189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_63980 CDS complement(121618..122499) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972037.1 transl_table 11 codon_start 1 locus_tag LOCUS_63990 CDS complement(122579..123178) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242948.1 transl_table 11 codon_start 1 locus_tag LOCUS_64000 CDS complement(123298..123456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64010 CDS 123723..124187 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708610.1 transl_table 11 codon_start 1 locus_tag LOCUS_64020 CDS 124384..124746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64030 CDS complement(124802..125308) product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401014.1 transl_table 11 codon_start 1 locus_tag LOCUS_64040 CDS complement(125400..126146) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 transl_table 11 codon_start 1 locus_tag LOCUS_64050 CDS complement(126169..127224) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394527.1 transl_table 11 codon_start 1 locus_tag LOCUS_64060 CDS complement(127309..128469) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968419.1 transl_table 11 codon_start 1 locus_tag LOCUS_64070 gene nagA CDS complement(128466..129512) product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183532.1 transl_table 11 codon_start 1 locus_tag LOCUS_64080 CDS complement(129509..130273) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255060.1 transl_table 11 codon_start 1 locus_tag LOCUS_64090 CDS complement(130270..131157) product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400508.1 transl_table 11 codon_start 1 locus_tag LOCUS_64100 CDS 131355..132248 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400505.1 transl_table 11 codon_start 1 locus_tag LOCUS_64110 CDS 132293..133552 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066871940.1 transl_table 11 codon_start 1 locus_tag LOCUS_64120 CDS 133874..134824 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330567.1 transl_table 11 codon_start 1 locus_tag LOCUS_64130 CDS 134840..135679 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533465.1 transl_table 11 codon_start 1 locus_tag LOCUS_64140 CDS 135676..136740 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533467.1 transl_table 11 codon_start 1 locus_tag LOCUS_64150 CDS 136751..137752 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844988.1 transl_table 11 codon_start 1 locus_tag LOCUS_64160 CDS 137910..139205 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844987.1 transl_table 11 codon_start 1 locus_tag LOCUS_64170 note possible pseudo, frameshifted CDS 139217..142354 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398234.1 transl_table 11 codon_start 1 locus_tag LOCUS_64180 CDS 142361..142987 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255068.1 transl_table 11 codon_start 1 locus_tag LOCUS_64190 CDS complement(142957..143214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64200 CDS complement(143216..144448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64210 CDS complement(144445..146001) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920957.1 transl_table 11 codon_start 1 locus_tag LOCUS_64220 CDS complement(145988..147607) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 transl_table 11 codon_start 1 locus_tag LOCUS_64230 CDS 147759..148589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64240 CDS 148586..149296 product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564165.1 transl_table 11 codon_start 1 locus_tag LOCUS_64250 CDS 149325..150407 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 transl_table 11 codon_start 1 locus_tag LOCUS_64260 CDS complement(150573..151682) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337929.1 transl_table 11 codon_start 1 locus_tag LOCUS_64270 CDS complement(151698..152522) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 transl_table 11 codon_start 1 locus_tag LOCUS_64280 CDS complement(152519..153436) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 transl_table 11 codon_start 1 locus_tag LOCUS_64290 CDS 153698..155122 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188164.1 transl_table 11 codon_start 1 locus_tag LOCUS_64300 CDS complement(155321..156517) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 transl_table 11 codon_start 1 locus_tag LOCUS_64310 CDS complement(156682..156912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64320 CDS complement(157011..157799) product DUF1194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976338.1 transl_table 11 codon_start 1 locus_tag LOCUS_64330 CDS 157984..159072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64340 CDS complement(159074..159682) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 transl_table 11 codon_start 1 locus_tag LOCUS_64350 CDS 159862..160353 product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969827.1 transl_table 11 codon_start 1 locus_tag LOCUS_64360 CDS 160418..161836 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115242.1 transl_table 11 codon_start 1 locus_tag LOCUS_64370 CDS 162261..163280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64380 CDS complement(163493..165949) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972026.1 transl_table 11 codon_start 1 locus_tag LOCUS_64390 CDS complement(166052..166465) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534958.1 transl_table 11 codon_start 1 locus_tag LOCUS_64400 CDS complement(166516..167337) product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534956.1 transl_table 11 codon_start 1 locus_tag LOCUS_64410 CDS 167637..168809 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242957.1 transl_table 11 codon_start 1 locus_tag LOCUS_64420 CDS 168809..171985 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969721.1 transl_table 11 codon_start 1 locus_tag LOCUS_64430 CDS 172247..173668 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969720.1 transl_table 11 codon_start 1 locus_tag LOCUS_64440 CDS 173711..177508 product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976160.1 transl_table 11 codon_start 1 locus_tag LOCUS_64450 CDS complement(177602..177826) product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976159.1 transl_table 11 codon_start 1 locus_tag LOCUS_64460 CDS complement(177984..178193) product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242963.1 transl_table 11 codon_start 1 locus_tag LOCUS_64470 CDS complement(178203..178721) product SspB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969716.1 transl_table 11 codon_start 1 locus_tag LOCUS_64480 CDS 179503..179814 product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311776.1 transl_table 11 codon_start 1 locus_tag LOCUS_64490 CDS 179902..180696 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969714.1 transl_table 11 codon_start 1 locus_tag LOCUS_64500 CDS 180712..181233 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976149.1 transl_table 11 codon_start 1 locus_tag LOCUS_64510 CDS 181390..182511 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534926.1 transl_table 11 codon_start 1 locus_tag LOCUS_64520 gene hflK CDS 182511..183461 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534924.1 transl_table 11 codon_start 1 locus_tag LOCUS_64530 CDS 183469..183657 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976146.1 transl_table 11 codon_start 1 locus_tag LOCUS_64540 CDS 183785..185308 product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534918.1 transl_table 11 codon_start 1 locus_tag LOCUS_64550 CDS complement(185400..185957) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976143.1 transl_table 11 codon_start 1 locus_tag LOCUS_64560 CDS complement(185957..186847) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976142.1 transl_table 11 codon_start 1 locus_tag LOCUS_64570 gene serB CDS 186849..187775 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534915.1 transl_table 11 codon_start 1 locus_tag LOCUS_64580 gene miaA CDS complement(187839..189899) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328903.1 transl_table 11 codon_start 1 locus_tag LOCUS_64590 CDS 190264..192021 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386810.1 transl_table 11 codon_start 1 locus_tag LOCUS_64600 CDS 192093..192665 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507555.1 transl_table 11 codon_start 1 locus_tag LOCUS_64610 gene ilvN CDS complement(192894..193694) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328901.1 transl_table 11 codon_start 1 locus_tag LOCUS_64620 CDS 193866..194459 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533855.1 transl_table 11 codon_start 1 locus_tag LOCUS_64630 CDS 194500..195129 product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066879389.1 transl_table 11 codon_start 1 locus_tag LOCUS_64640 gene nthA CDS 195126..195785 product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400923.1 transl_table 11 codon_start 1 locus_tag LOCUS_64650 gene nthB CDS 195772..196185 product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174839376.1 transl_table 11 codon_start 1 locus_tag LOCUS_64660 CDS complement(196182..197270) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976128.1 transl_table 11 codon_start 1 locus_tag LOCUS_64670 CDS 197418..198545 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400932.1 transl_table 11 codon_start 1 locus_tag LOCUS_64680 CDS complement(198625..199305) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328878.1 transl_table 11 codon_start 1 locus_tag LOCUS_64690 CDS complement(199630..200694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976117.1 transl_table 11 codon_start 1 locus_tag LOCUS_64700 CDS 200974..201726 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533813.1 transl_table 11 codon_start 1 locus_tag LOCUS_64710 CDS complement(201770..202657) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328871.1 transl_table 11 codon_start 1 locus_tag LOCUS_64720 CDS 202827..203234 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252508.1 transl_table 11 codon_start 1 locus_tag LOCUS_64730 CDS 203280..204524 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531061.1 transl_table 11 codon_start 1 locus_tag LOCUS_64740 CDS complement(204466..205479) product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161075.1 transl_table 11 codon_start 1 locus_tag LOCUS_64750 CDS complement(205631..205840) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309931.1 transl_table 11 codon_start 1 locus_tag LOCUS_64760 CDS complement(206043..206405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64770 CDS complement(206416..206715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64780 CDS complement(206832..207212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850287.1 transl_table 11 codon_start 1 locus_tag LOCUS_64790 CDS 207542..208264 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969679.1 transl_table 11 codon_start 1 locus_tag LOCUS_64800 CDS 208324..209343 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972004.1 transl_table 11 codon_start 1 locus_tag LOCUS_64810 gene ilvC CDS 209868..211091 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972000.1 transl_table 11 codon_start 1 locus_tag LOCUS_64820 CDS complement(211273..212916) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976219.1 transl_table 11 codon_start 1 locus_tag LOCUS_64830 CDS 213055..213471 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061303.1 transl_table 11 codon_start 1 locus_tag LOCUS_64840 CDS complement(213485..215101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64850 CDS 215269..216375 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397197.1 transl_table 11 codon_start 1 locus_tag LOCUS_64860 CDS 216505..217422 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328810.1 transl_table 11 codon_start 1 locus_tag LOCUS_64870 tRNA 217539..217614 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS complement(217884..218237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64880 CDS 218360..218524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64890 CDS 218892..219080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64900 CDS 219159..219959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64910 CDS 220310..220570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64920 note possible pseudo, internal stop codon CDS complement(220792..221310) product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398911.1 transl_table 11 codon_start 1 locus_tag LOCUS_64930 CDS 221354..221722 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975859.1 transl_table 11 codon_start 1 locus_tag LOCUS_64940 CDS 221715..222932 product arsenite efflux MFS transporter ArsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061806.1 transl_table 11 codon_start 1 locus_tag LOCUS_64950 gene arsK CDS complement(223001..223423) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971663.1 transl_table 11 codon_start 1 locus_tag LOCUS_64960 gene arsC CDS complement(223426..224484) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971664.1 transl_table 11 codon_start 1 locus_tag LOCUS_64970 gene arsB CDS complement(224484..225011) product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398896.1 transl_table 11 codon_start 1 locus_tag LOCUS_64980 CDS complement(225027..225464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_64990 CDS complement(225461..225814) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971665.1 transl_table 11 codon_start 1 locus_tag LOCUS_65000 CDS complement(226067..226948) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120072.1 transl_table 11 codon_start 1 locus_tag LOCUS_65010 CDS complement(226945..227475) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967173.1 transl_table 11 codon_start 1 locus_tag LOCUS_65020 CDS complement(227888..228463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65030 note possible pseudo, internal stop codon, frameshifted CDS complement(228471..230519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65040 CDS 231021..231245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65050 CDS 231617..232465 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941847.1 transl_table 11 codon_start 1 locus_tag LOCUS_65060 CDS 232583..233047 product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535926.1 transl_table 11 codon_start 1 locus_tag LOCUS_65070 CDS complement(233082..234638) product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088812.1 transl_table 11 codon_start 1 locus_tag LOCUS_65080 CDS 234986..236608 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087406.1 transl_table 11 codon_start 1 locus_tag LOCUS_65090 gene groL CDS 236728..237558 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967600.1 transl_table 11 codon_start 1 locus_tag LOCUS_65100 CDS 237685..238110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65110 CDS 238157..238657 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310780.1 transl_table 11 codon_start 1 locus_tag LOCUS_65120 CDS complement(238702..239955) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397527.1 transl_table 11 codon_start 1 locus_tag LOCUS_65130 CDS 240159..241958 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445450.1 transl_table 11 codon_start 1 locus_tag LOCUS_65140 CDS complement(241966..242421) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254192.1 transl_table 11 codon_start 1 locus_tag LOCUS_65150 CDS complement(242741..243460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65160 CDS 243790..244020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65170 CDS 244053..244721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65180 note possible pseudo, internal stop codon, frameshifted CDS 244913..245212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65190 note possible pseudo, internal stop codon, frameshifted CDS 245230..245448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65200 note possible pseudo, frameshifted CDS complement(245474..246376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65210 CDS complement(246373..247062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_65220 note possible pseudo, frameshifted