COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence0001 source 1..952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0002 source 1..748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 215..550 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 sequence0003 source 1..878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..758) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878800.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 sequence0004 source 1..300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0005 source 1..578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0006 source 1..450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0007 source 1..937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0008 source 1..319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(62..135) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 sequence0009 source 1..729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(317..556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 sequence0010 source 1..501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0011 source 1..506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 57..290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 sequence0012 source 1..429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0013 source 1..724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0014 source 1..577 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0015 source 1..524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0016 source 1..438 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(174..437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 sequence0017 source 1..316 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0018 source 1..228802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 note possible pseudo, frameshifted CDS complement(521..916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 note possible pseudo, frameshifted CDS complement(1063..1509) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407404.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 1524..2408 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene map CDS 2482..3969 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728453.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 3966..4628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157890715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 4691..5254 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728457.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(5257..7023) product N-acetylglutaminylglutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene ngg CDS complement(7020..8822) product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728459.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(8991..10535) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 10716..12095 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893950.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 12082..12909 product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 12906..14270 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728460.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 14270..15043 product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 15059..15808 product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 15870..16211 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS 16236..19088 product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170213355.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 19207..19476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 19555..20385 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 20457..21158 product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104219.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 21155..21505 product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 21509..22282 product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene cbiQ CDS 22279..23013 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(23030..23878) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726607.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(23875..25290) product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene mtr CDS complement(25287..26300) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414553.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 26482..26928 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 26925..28748 product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 28785..29399 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893997.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene cobO CDS 29393..30775 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728476.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 30785..31981 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene cobA CDS 32014..33594 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 33665..35167 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 35195..36937 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894002.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(36965..37474) product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(37471..37935) product Tat pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 38127..38666 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene rimP CDS 38663..39664 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894006.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene nusA CDS 40188..42926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 42961..43476 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene rbfA CDS 43451..44455 product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 44489..45853 product MATE family efflux transporter Mmp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene mmp CDS 45864..46316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(46318..46884) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229991.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(46881..47648) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 47671..47952 product DUF2277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 47949..48512 product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 48601..48906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(49043..50743) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728497.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(50727..51326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 51397..52530 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 52520..53593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(53583..54170) product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728498.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 54327..55274 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894029.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 55274..55954 product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 55951..56832 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene truB CDS complement(56865..57536) product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728504.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene mntR CDS 57644..58627 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 58787..59056 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894036.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene rpsO CDS 59040..59558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 59866..62121 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS 62126..63451 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510573.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 63470..64387 product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene bla CDS 64518..64976 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728011.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(64977..66092) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene ald CDS 66184..66699 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 66721..67455 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728512.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene dapB CDS 67455..67919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728513.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 67982..68383 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414091.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS complement(68647..68820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 68970..69704 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 69794..70276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 70395..70856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(70930..71460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 note possible pseudo, internal stop codon CDS 71386..71637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(71602..72216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 note possible pseudo, internal stop codon CDS complement(72274..73191) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(73234..73971) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728517.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 74014..74826 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728518.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 74823..75308 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene dfrA CDS 75305..76519 product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728523.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 76574..77323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(77316..77903) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971632.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(77939..78238) product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104487.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 78369..79121 product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 gene thyX CDS 79147..80049 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048369.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene dapA CDS 80049..81728 product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894070.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(81734..82567) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(82606..83409) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894072.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(83409..83723) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(83808..84257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(84348..84524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 84514..86832 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877465.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 86876..87403 product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(87393..87851) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894076.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 87944..88540 product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene pgsA CDS 88669..89001 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 89107..89919 product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728531.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene pspA CDS 89977..90756 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728532.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(90753..91190) product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(91200..91640) product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414015.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene ephG CDS 91682..92854 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728535.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 92865..93059 product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(93063..93758) product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(93759..94838) product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909296.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene hypE CDS complement(94831..95931) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene hypD CDS complement(95928..96248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(96265..98553) product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene hypF CDS complement(98550..98828) product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894096.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(98833..99324) product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(99463..100854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728540.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(100851..101519) product DUF6084 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(101516..102172) product DUF5947 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(102172..103140) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(103144..104940) product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894103.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(104969..106024) product hydrogenase expression protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728543.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(106141..106908) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene hypB CDS complement(106911..107240) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894106.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 107485..108546 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894107.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene recA CDS 108515..109036 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894108.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene recX CDS 109076..109900 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(109897..110799) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(110796..111470) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894110.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(111496..112332) product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894111.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(112350..113135) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 113219..114811 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene miaB CDS 114799..115386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413999.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(115422..116033) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 116107..116886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(116883..118205) product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747198.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 118373..119248 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 119258..119941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899452.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 119938..120846 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene miaA CDS 120851..121723 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene dapF CDS 121727..123184 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894120.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene hflX CDS 123341..124087 product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242638.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS complement(124140..124379) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727888.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 124798..126840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(126837..127538) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894124.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene lexA CDS 127880..128218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 128381..128851 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057199.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene nrdR CDS complement(128861..129547) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728557.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(129579..130601) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(130634..131602) product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(131728..133143) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene sthA CDS 133277..133966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 134001..135101 product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(135098..135793) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(135918..136709) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 136623..136916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(137025..137426) product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899442.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 137484..137729 product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894138.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(137719..138726) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894139.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(138790..138981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894140.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 139112..139471 product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(139497..139700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 139639..139923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 139943..140725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729097.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(140732..141829) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 141949..142353 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467790.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 142350..143111 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728090.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene modA CDS 143210..143692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(143773..143916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(143903..144544) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(144541..144915) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(144991..145458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 145663..145956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(145953..146252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(147034..147219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(147216..147377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(147380..148552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 repeat_region 148635..148739 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttacccgtgccgagccact CDS complement(148844..149314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(149307..149588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(149588..150262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(150259..150663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(150980..151465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(151572..151892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(152177..153091) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene xerC CDS complement(153223..154770) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(154972..155778) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894143.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 155931..156785 product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894144.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(156825..157481) product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894145.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene cei CDS 157646..157948 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(157954..158433) product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 158459..158923 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene dut CDS 158925..159671 product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(159730..160533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908087.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 160565..160936 product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728569.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 160933..161649 product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 161639..163138 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(163119..163784) product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894154.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(163781..164440) product potassium uptake protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene trkA CDS 164523..166529 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181825004.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 166526..167767 product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(167799..168269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(168297..168749) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110393.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 168860..169762 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413913.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 169759..170472 product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413912.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 170472..171215 product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727708.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(171237..172865) product exporter of polyketide antibiotics inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222247.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(172865..173785) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222248.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 173980..175281 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene nhaA CDS 175291..177207 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728575.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene dxs CDS complement(177204..178868) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 178941..179849 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(179842..181137) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728577.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(181141..181722) product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728578.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 181895..182962 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728579.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene hemE CDS 182959..184335 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728580.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 184361..185056 product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894166.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 185080..186735 product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114135.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 186828..187139 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894167.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(187144..187557) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894168.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene msrB CDS complement(187671..188942) product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene aftC CDS complement(188978..190552) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139536.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(190602..191393) product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728583.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 191419..192456 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene zapE CDS complement(192432..192923) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894176.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(192927..193442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894177.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(193483..193905) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082410.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(193942..194535) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729729.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(194532..195008) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(195050..195775) product Clp protease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894179.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(195808..196296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 196371..196745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(196756..197238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(197722..197943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(198033..198329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 tRNA complement(198460..198534) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(198548..198621) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(198649..198722) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS complement(198814..199014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(198995..199351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084229.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 199290..199538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 tRNA 199664..199736 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 199797..200120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 200177..200464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(200918..201193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(201180..201515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(201657..201959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(201956..202201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(202433..204955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(205059..205250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(205243..206091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(206698..207045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(207042..207323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(207310..207609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(207606..208106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(208103..209299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(209254..209694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(209844..210089) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(210280..211518) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 211690..212001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(211998..212300) product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727127.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(212287..212697) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727128.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 213057..213539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(213799..214491) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591949.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(214879..215583) product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(215667..216164) product DUF1990 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 216240..217088 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 217136..217765 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728697.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 217762..218196 product TIGR02611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 218266..220320 product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728699.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene thrS CDS 220317..220895 product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728700.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 220895..221599 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 221596..222534 product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728702.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 222534..223727 product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728703.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene pimA CDS 223724..224755 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728704.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 224823..225731 product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728705.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene pdxS CDS 225776..226612 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894316.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene tesB CDS 226630..227193 product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728706.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene pdxT CDS 227358..227792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 227828..228793 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164689163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 sequence0019 source 1..697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0020 source 1..399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0021 source 1..507 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(254..454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 sequence0022 source 1..851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..512 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727114.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 gene dcd sequence0023 source 1..468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0024 source 1..627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0025 source 1..552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0026 source 1..439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0027 source 1..840 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0028 source 1..399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 61..219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 sequence0029 source 1..347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0030 source 1..256380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..1593) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 1658..2983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(2940..4115) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 4191..5213 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 5246..5689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(5686..6108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729260.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 6213..7019 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085150790.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 7089..7268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 7330..7902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 7928..8305 product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623907.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(8306..9076) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729258.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(9086..9541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 9741..10055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(10099..10284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 note possible pseudo, frameshifted CDS 10195..10446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(10549..11367) product LmeA family phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 11466..12779 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 12813..13004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730739.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 13034..13525 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877784.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(13937..15379) product serine/threonine protein kinase PknF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene pknF CDS complement(15402..16508) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729254.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(16508..17431) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 17451..18368 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 18368..18802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(18799..19218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(19318..21444) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729252.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene malQ CDS complement(21464..22768) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene lysA CDS 22868..23464 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 23461..24414 product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(24352..24648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(24652..24993) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065640.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 25043..26254 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139542.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(26241..26564) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895125.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(26561..26899) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729249.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(26923..27552) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080131.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(27549..28490) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971907.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 28578..30167 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729246.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 30260..31195 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895122.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 31225..31707 product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS 31711..32892 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS 33229..34560 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729243.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS 34782..35429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729241.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(35426..35866) product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729240.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 35968..36645 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 36688..37035 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224722.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS 37028..37666 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224723.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 37712..38209 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729238.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 38206..39699 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(39696..41612) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729235.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(41671..41859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(42171..43763) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 43784..45442 product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 45519..46433 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727359.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 46553..48823 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729234.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene secA2 CDS 48833..49417 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 49435..50334 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901262.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 50356..50688 product DUF1290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895106.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 50681..51514 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495981.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 51525..51932 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895104.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene gcvH CDS 52097..52576 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877774.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 52606..53346 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729229.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 53395..53889 product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895101.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 54131..54754 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409244.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS 54914..57919 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729226.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene gcvP CDS complement(57999..58883) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 58946..59770 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409255.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(59767..61839) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163738672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(61878..64085) product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(64137..65084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(65113..66177) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895093.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(66177..67538) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877770.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(67741..69177) product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729218.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(69190..70650) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene gndA CDS complement(70703..71518) product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729216.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 71457..71630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(71638..72054) product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 72293..73081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 73260..73664 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 73749..74021 product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729214.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 74018..74353 product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729213.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 74449..76182 product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 76195..76827 product urease accessory UreF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729212.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 76843..77526 product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729211.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene ureG CDS 77526..78152 product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729210.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(78149..79525) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895076.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(79639..80568) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895075.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(80636..81307) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729209.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 81437..82318 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409329.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 82315..83373 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899051.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 83592..84635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 85235..85567 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895070.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS 85646..86602 product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(86599..87090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 87191..87802 product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729205.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(87818..88618) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877763.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 88806..91271 product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776228.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 91301..92176 product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 92173..94515 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900424.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 94515..95978 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(95980..96777) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(96780..97382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(97383..98588) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS complement(98624..99346) product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(99382..99762) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112420.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(99779..102103) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene lon CDS complement(102315..103358) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729176.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(103525..104757) product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409382.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene lldD CDS complement(104766..106166) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729175.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(106163..108328) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 108382..108831 product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(108806..110047) product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729172.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(110122..110601) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729171.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(110661..111671) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729169.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(111689..112276) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895024.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 112515..113156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(113203..113985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 note possible pseudo, frameshifted CDS complement(114766..115458) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(115455..116861) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene atzF CDS complement(116919..117590) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392579.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 117640..118287 product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930138.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(118271..119089) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143535.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 119166..119720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 119780..120406 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(120378..122369) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 122750..123586 product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 123610..124329 product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene scnC CDS 124326..124697 product thiocyanate hydrolase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897690.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 124724..125440 product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729166.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 125447..125890 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899059.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 125908..126663 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 126760..128166 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(128394..129026) product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729164.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 129266..129751 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895015.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene bfr CDS 129862..131931 product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(131947..133782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(133880..135907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(135924..136325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(136322..136654) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 136947..137531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 137528..139012 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143780.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 139028..139549 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729161.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 139578..140939 product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877747.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 140955..142052 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899061.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(142057..142500) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082139.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(142490..144283) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111122.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(144369..145292) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 145311..146222 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729157.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 146300..147430 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899004.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 147463..148152 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053776210.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 148167..148559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 148571..148972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 149092..149529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 149526..150224 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(150221..150874) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224719.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 150931..152256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(152219..153454) product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene cyp124 CDS 153603..155528 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(155525..156028) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(156045..156548) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111489.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 156774..157736 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225460.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(157747..158211) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409417.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 158319..159200 product TIGR03854 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 159254..159802 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729145.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 159815..160714 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904947.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(160656..160961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 161064..161363 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228474.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 161752..162636 product cyclopropane mycolic acid synthase family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(162633..163478) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226961.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 163537..164184 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 164181..164723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(164713..165237) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(165245..165622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(165658..166653) product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene speB CDS complement(166721..167170) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894986.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 167242..168189 product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729138.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(168200..169666) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 169870..171282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 171279..171896 product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 172020..172757 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729134.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(172766..173440) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(173437..174159) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877731.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(174225..174599) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731395.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(174602..175024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(175056..175862) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729131.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 175956..176255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(176248..177516) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877729.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 177661..178347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(178356..180629) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084710.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(180622..181215) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(181298..181747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(181744..182877) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(182981..183337) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(183349..184116) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110992.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(184128..185204) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 185283..186032 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 186072..187415 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929838.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(187423..187821) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893941.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 187868..189127 product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900426.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 189178..189402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(189444..190364) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(190396..191244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(191307..191558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(191625..191990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 192089..193720 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(193722..194555) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522101.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(194586..194798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 194680..195189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495265.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(195229..195975) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729112.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene yaaA CDS complement(196002..196628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729111.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS complement(196922..198094) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894937.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 198127..209697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(209694..210974) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410095.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 211071..211862 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 211859..212578 product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 212595..213317 product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(213314..213961) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(213979..214164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 214154..215428 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228237.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(215370..216083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(216076..216849) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS complement(216858..219080) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729086.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene katG CDS complement(219114..219578) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 219847..221070 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 221122..221823 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402818.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 221820..223172 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(223169..224128) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167379699.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(224149..226437) product isocitrate lyase ICL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729276.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene aceA CDS complement(226482..227342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 227432..228088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(228092..228937) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(228937..229725) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(229769..230989) product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727635.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene lhgO CDS 231429..231968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 232016..233428 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933157.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene proS CDS complement(233422..234972) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729090.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 235049..236233 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002725028.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(236218..236919) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 236864..237253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(237268..237960) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(237999..238400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(238462..238710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(238990..239271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(239487..241445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 241494..241976 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225071.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(241984..242643) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729065.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(242695..243027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 243146..243988 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969623.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 244021..244575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(244569..245480) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729059.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 245955..247055 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112106.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 247107..247568 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 247609..248067 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 248149..248781 product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(248791..249600) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193047317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(249719..251434) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083151429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 251855..252616 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026963.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(252638..252841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 252861..253361 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082660.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 253934..255466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 255463..256275 product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene istB sequence0031 source 1..855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0032 source 1..379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0033 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0034 source 1..704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..703) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400517.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 sequence0035 source 1..324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0036 source 1..552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0037 source 1..876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0038 source 1..325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0039 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0040 source 1..718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0041 source 1..514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0042 source 1..559 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0043 source 1..809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0044 source 1..349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..256) product DUF6131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 sequence0045 source 1..966 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..941) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 sequence0046 source 1..502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0047 source 1..356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0048 source 1..642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0049 source 1..1147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(167..685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104357.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 sequence0050 source 1..753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0051 source 1..560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 sequence0052 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0053 source 1..580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0054 source 1..583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0055 source 1..979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(52..>979) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730708.1:FAD-dependent oxidoreductase locus_tag LOCUS_05430 sequence0056 source 1..386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0057 source 1..638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0058 source 1..347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0059 source 1..482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0060 source 1..796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0061 source 1..357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0062 source 1..445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0063 source 1..579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0064 source 1..523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0065 source 1..442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0066 source 1..744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(94..>744) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907893.1:nucleoside triphosphate pyrophosphatase locus_tag LOCUS_05440 sequence0067 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0068 source 1..996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ assembly_gap 511..516 estimated_length known gap_type within scaffold linkage_evidence paired-ends sequence0069 source 1..350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0070 source 1..522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0071 source 1..369 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0072 source 1..513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(14..>513) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730127.1:carboxymuconolactone decarboxylase family protein locus_tag LOCUS_05450 sequence0073 source 1..693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 sequence0074 source 1..427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0075 source 1..444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0076 source 1..747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0077 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0078 source 1..470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0079 source 1..550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0080 source 1..303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0081 source 1..439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0082 source 1..512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0083 source 1..412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0084 source 1..884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0085 source 1..340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0086 source 1..434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0087 source 1..585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0088 source 1..712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0089 source 1..517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0090 source 1..428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0091 source 1..572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0092 source 1..317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0093 source 1..729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0094 source 1..525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0095 source 1..497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0096 source 1..613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0097 source 1..705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0098 source 1..875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0099 source 1..783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0100 source 1..366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0101 source 1..428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0102 source 1..573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0103 source 1..495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0104 source 1..581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0105 source 1..396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0106 source 1..525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0107 source 1..315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0108 source 1..632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0109 source 1..540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0110 source 1..476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0111 source 1..400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0112 source 1..318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0113 source 1..395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0114 source 1..345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0115 source 1..362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0116 source 1..582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0117 source 1..380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0118 source 1..632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0119 source 1..429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0120 source 1..751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(132..512) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 sequence0121 source 1..400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0122 source 1..435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0123 source 1..524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0124 source 1..396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0125 source 1..336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0126 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0127 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0128 source 1..313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0129 source 1..398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0130 source 1..357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0131 source 1..749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0132 source 1..641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 70..369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 sequence0133 source 1..436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0134 source 1..564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0135 source 1..643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(9..335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 note possible pseudo, internal stop codon CDS complement(366..515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 note possible pseudo, internal stop codon sequence0136 source 1..635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0137 source 1..488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0138 source 1..330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0139 source 1..717 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0140 source 1..904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..373 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727688.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene rpmD CDS 370..813 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727689.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene rplO sequence0141 source 1..1099 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0142 source 1..482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 sequence0143 source 1..362 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0144 source 1..361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0145 source 1..447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0146 source 1..653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0147 source 1..448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0148 source 1..655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0149 source 1..718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0150 source 1..403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0151 source 1..536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0152 source 1..388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0153 source 1..483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 sequence0154 source 1..490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0155 source 1..372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0156 source 1..593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0157 source 1..320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0158 source 1..1052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05550 note possible pseudo, internal stop codon sequence0159 source 1..845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..786 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892903.1:ATP-binding protein locus_tag LOCUS_05560 sequence0160 source 1..426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0161 source 1..537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0162 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0163 source 1..448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0164 source 1..304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0165 source 1..662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0166 source 1..401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0167 source 1..512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 134..358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 sequence0168 source 1..867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(149..433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 562..801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 sequence0169 source 1..711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(83..>711) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727086.1:ABC transporter ATP-binding protein locus_tag LOCUS_05600 sequence0170 source 1..592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0171 source 1..445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0172 source 1..575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0173 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0174 source 1..618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0175 source 1..662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0176 source 1..402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 203..400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 sequence0177 source 1..517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0178 source 1..705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(109..>705) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104523.1:LLM class F420-dependent oxidoreductase locus_tag LOCUS_05620 sequence0179 source 1..863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0180 source 1..382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0181 source 1..490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0182 source 1..497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0183 source 1..502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0184 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0185 source 1..389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0186 source 1..896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(178..693) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 sequence0187 source 1..649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0188 source 1..511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0189 source 1..397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0190 source 1..727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0191 source 1..1275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0192 source 1..1073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(188..>1073) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729746.1:LuxR C-terminal-related transcriptional regulator locus_tag LOCUS_05640 sequence0193 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0194 source 1..889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0195 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0196 source 1..724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0197 source 1..473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0198 source 1..390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0199 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0200 source 1..478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0201 source 1..344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0202 source 1..508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0203 source 1..393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0204 source 1..364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0205 source 1..312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0206 source 1..4743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0207 source 1..472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0208 source 1..552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0209 source 1..210484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(126..1238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(1238..2371) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728110.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 2418..3020 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(3106..3882) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(3879..4532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(4532..5125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 5275..6762 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727704.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 6759..7358 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892887.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(7363..8940) product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728118.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene nuoN CDS complement(8937..10505) product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(10499..12379) product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene nuoL CDS complement(12386..12685) product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene nuoK CDS complement(12682..13446) product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893423.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS complement(13443..13967) product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893424.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene nuoI CDS complement(13960..15198) product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene nuoH CDS complement(15195..17582) product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(17583..18899) product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene nuoF CDS complement(18896..19765) product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728122.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene nuoE CDS complement(19762..21093) product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene nuoD CDS complement(21093..21800) product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728124.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(21797..22351) product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893431.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS complement(22342..22722) product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(22878..23276) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(23293..23826) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(23838..24236) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 24289..24918 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728128.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(25007..25345) product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(25342..26301) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(26298..27536) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS complement(27562..28173) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893440.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS complement(28176..29084) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(29081..30286) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(30283..31464) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728131.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(31464..32564) product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(32641..33030) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029646.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(33043..34215) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728134.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(34411..34968) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 35242..36219 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893447.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 36339..37337 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(37371..38582) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS complement(38604..40001) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(40146..41582) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(41661..42449) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene hisN CDS 42488..42835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728138.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(42841..44478) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907864.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 44368..45483 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene prfB CDS 45488..46450 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728140.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(46614..46886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 46966..47628 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728142.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene ftsE CDS 47628..48524 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene ftsX CDS 48527..49021 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene smpB CDS 49030..49896 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027715.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 49964..52252 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(52349..53110) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114809.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 53167..55059 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730594.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 55056..55715 product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224482.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 55835..56854 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728384.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 56906..57715 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894901.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(57744..58211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 58422..59615 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 59608..60762 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462348.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 60893..61717 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 61902..62558 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 62626..63756 product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728694.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 63753..64538 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070943583.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 64544..65512 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728692.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 tmRNA 65630..65998 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 66171..66380 product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407785.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 66380..66784 product type II toxin-antitoxin system toxin ribonuclease VapC11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407786.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene vapc11 CDS 67294..68280 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077888.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 68285..69145 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085987.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 69148..70215 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 70212..71222 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 71222..72262 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 72264..73427 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 73439..74476 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 74473..75447 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094759.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 75473..76192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 76202..76972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071137.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(76977..77345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(77393..78259) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 78489..80258 product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 80261..85789 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 85789..86628 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731520.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 86628..87485 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731519.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 87489..88847 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037764.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 88927..89571 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064102.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(89568..92732) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(92780..93667) product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407360.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 93742..94437 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001204.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 94491..95987 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 95974..96849 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104467.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene ygiD CDS 96910..98328 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977903.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(98529..99347) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730813.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(99350..100183) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730812.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(100187..100930) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730814.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 100991..101680 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083342.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(101687..102439) product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 102648..103484 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(103500..104426) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895075.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(104489..106255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 106387..107538 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 107543..108562 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 108559..109053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 109050..109562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 109559..110761 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS 110763..111164 product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897979.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 111169..112755 product fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730208.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene fadD1 CDS complement(112752..114008) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(114018..116267) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(116280..118619) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844465.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(118689..119288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(119316..120932) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480118.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(120929..122443) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 122560..123906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(123919..124713) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086858.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene fabG CDS complement(124737..125537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 125777..126106 product hemophore-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079616.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(126222..126842) product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 127232..128593 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084676709.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 128630..129655 product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409522.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(130043..130348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 130591..130887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104097.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(130866..132377) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(132374..133048) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139595.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 133476..133937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895392.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 134038..134370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 134367..135269 product universal stress protein TB31.7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413592.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 135327..136379 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS 136409..136990 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 137115..138005 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895400.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(138024..138674) product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene devR CDS complement(138715..139581) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(139641..140633) product FMN-binding protein Acg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene acg CDS 140726..142243 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 142274..143209 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730749.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 143206..144027 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS 144100..144369 product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 144369..145223 product universal stress protein TB31.7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 145403..146248 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 146301..147113 product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877865.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 147331..148158 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729415.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(148224..149129) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730749.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(149126..150010) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(150239..150496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(150503..151759) product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531483.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(151756..152736) product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(152733..153713) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene pdhA CDS complement(153710..155491) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene acsA CDS complement(155488..155754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 155958..156362 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727319.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 156367..156969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(156982..157779) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413594.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 157923..158912 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485753.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 159043..159996 product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(160121..161002) product universal stress protein TB31.7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413592.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 161190..161420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(161767..162672) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene arcC CDS complement(162690..163499) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100031.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(163545..164225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 164739..166313 product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 note possible pseudo, frameshifted CDS 166265..166549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 166546..167262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 167313..167876 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 167892..169373 product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 169370..169831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(169877..173512) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene otsB CDS complement(173551..175911) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene ppsA CDS 176200..177597 product diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene tgs1 CDS 177594..178967 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 178960..179421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS 179457..180209 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 180331..180765 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(180785..181471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 181686..182009 product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408522.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS 182035..184080 product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(184113..184958) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877868.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(185194..186063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(186047..187153) product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 187291..188166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 188295..188993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 189110..190774 product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(190786..192465) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 192582..193178 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 193360..193764 product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 193761..196670 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(196679..197161) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(197173..198456) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(198579..199124) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(199121..200287) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(200280..200927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(200908..202269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS 202357..204117 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(204121..204966) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(205019..205954) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067256.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene tesB CDS complement(205941..206564) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730078.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(206616..208904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(208916..209836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 sequence0210 source 1..650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0211 source 1..644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0212 source 1..396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0213 source 1..658 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0214 source 1..394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0215 source 1..900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(80..>900) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528942.1:glycosyltransferase locus_tag LOCUS_07620 sequence0216 source 1..477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0217 source 1..333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0218 source 1..830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0219 source 1..489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0220 source 1..508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0221 source 1..1080 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..876) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 sequence0222 source 1..1693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1363 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728273.1:carbamoyltransferase HypF locus_tag LOCUS_07640 CDS 1336..1611 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 sequence0223 source 1..656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0224 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0225 source 1..555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0226 source 1..651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0227 source 1..357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0228 source 1..601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0229 source 1..641 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0230 source 1..493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0231 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0232 source 1..596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0233 source 1..800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 237..791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 note possible pseudo, frameshifted sequence0234 source 1..1073 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0235 source 1..456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0236 source 1..424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0237 source 1..1184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(96..>1184) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225715.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_07670 sequence0238 source 1..670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(322..570) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410619.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene rpsR sequence0239 source 1..640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0240 source 1..355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0241 source 1..543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0242 source 1..595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0243 source 1..799 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0244 source 1..378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0245 source 1..603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0246 source 1..425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0247 source 1..470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0248 source 1..411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0249 source 1..743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0250 source 1..509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0251 source 1..756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..628 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729690.1:carbohydrate kinase family protein locus_tag LOCUS_07700 sequence0252 source 1..403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0253 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0254 source 1..491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0255 source 1..594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 sequence0256 source 1..623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0257 source 1..383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0258 source 1..466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0259 source 1..425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(57..332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 note possible pseudo, frameshifted sequence0260 source 1..728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0261 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0262 source 1..674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0263 source 1..208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0264 source 1..510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0265 source 1..748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0266 source 1..1448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 460..1116 product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419770.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 sequence0267 source 1..467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0268 source 1..469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0269 source 1..409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0270 source 1..542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0271 source 1..497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0272 source 1..764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0273 source 1..464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0274 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0275 source 1..713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0276 source 1..24541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(160..1248) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene menE CDS complement(1408..1779) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727387.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(1803..3362) product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(3362..4246) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892441.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(4322..5233) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892442.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(5230..5691) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(5702..6163) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(6160..6855) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 6900..7607 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 7604..8545 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 8542..9303 product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275383.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 9303..9926 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(9923..11173) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 11201..11473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 11457..12050 product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230842.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(12145..13746) product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene fadD8 CDS 13813..14064 product DUF3253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(14562..14810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 14710..14976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 14969..15457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(15522..15992) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 16690..18294 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727411.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 18420..19964 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223393.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(19968..20582) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(20579..21037) product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(21164..21655) product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257245.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 21700..22665 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727412.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 22728..23684 product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727413.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 23703..24440 product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 sequence0277 source 1..332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0278 source 1..484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0279 source 1..621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0280 source 1..733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0281 source 1..496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0282 source 1..338 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0283 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0284 source 1..714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0285 source 1..622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0286 source 1..749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0287 source 1..485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0288 source 1..768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0289 source 1..533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0290 source 1..732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0291 source 1..373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0292 source 1..30433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(134..574) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401063.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(591..1037) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(1065..1748) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225626.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(1829..2809) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225625.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 2939..4045 product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726685.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(4042..5808) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(5821..6444) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891452.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(6734..7357) product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 7470..9002 product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 9006..10451 product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729555.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene pntB CDS 10462..11601 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS complement(11620..12114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(12151..13050) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229360.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(13096..14277) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(14280..14876) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726671.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(15030..15491) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223540.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS 15570..16796 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876667.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 16793..17605 product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726668.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(17594..18079) product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726666.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(18097..18846) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(18870..19583) product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(19580..20548) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(20555..21418) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876665.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS complement(21431..22834) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400974.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(22937..23875) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726662.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS complement(23943..24713) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726661.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 24728..25294 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876664.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 25287..25805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 25807..27969 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726659.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(27950..28918) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 misc_feature complement(28947..>30433) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104530.1:phosphoenolpyruvate-utilizing N-terminal domain-containing protein locus_tag LOCUS_08330 sequence0293 source 1..12398 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(740..814) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(860..1324) product peroxiredoxin AhpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene ahpE CDS complement(1329..1754) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895716.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(1859..2434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895717.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 2644..5433 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene aceE CDS 5575..6840 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 6989..7897 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878004.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 7981..8280 product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895721.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 gene acpM CDS 8319..9527 product 3-oxoacyl-ACP synthase KasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 gene kasA CDS 9555..10808 product 3-oxoacyl-ACP synthase KasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene kasB CDS 10845..12266 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729738.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 sequence0294 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0295 source 1..62206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(123..2264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(2261..3031) product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728905.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene trpA CDS complement(3046..4305) product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728904.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene trpB CDS complement(4342..5190) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene trpC CDS complement(5232..5810) product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728903.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS complement(5807..7333) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894606.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(7337..8056) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 8115..8588 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111199.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 8663..9385 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728902.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS complement(9407..9775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(9776..10774) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(10771..11778) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726805.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(11788..12138) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728899.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene hisI CDS complement(12135..12908) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728898.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene hisF CDS complement(12909..13724) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894599.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(13725..14459) product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900374.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene priA CDS complement(14470..15087) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 gene hisH CDS complement(15084..15698) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407950.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene hisB CDS complement(15695..16825) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728896.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(16822..17949) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877610.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene hisD CDS 17854..18153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(18232..18744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS 18813..19226 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407939.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(19228..20253) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082704.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 20317..20883 product transcriptional regulator YxaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene yxaF CDS complement(20884..21363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(21392..22258) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894590.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene nadC CDS complement(22258..23826) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728891.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(23823..24866) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894588.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene nadA CDS 24998..25606 product DNA-binding transcriptional regulator NrtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728890.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene nrtR CDS 25649..26986 product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728889.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(26952..27584) product DUF2567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728888.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(27802..28797) product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene bioB CDS 28868..29443 product TetR family transcriptional regulator BioQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728885.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene bioQ CDS 29440..29775 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226217.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS complement(29772..30290) product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407809.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(30293..30958) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728882.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene bioD CDS complement(30955..32100) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(32161..33465) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728880.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 33489..35666 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104325.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 35666..37816 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462534.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene glgX CDS 37850..40027 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene treY CDS 40020..41747 product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728877.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene treZ CDS complement(41744..43036) product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407781.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene ilvA CDS complement(43082..43519) product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 43610..43804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(43857..44093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(44230..44631) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728875.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 44730..45350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(45355..46152) product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088098.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(46152..49637) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728872.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene dnaE CDS complement(49711..49893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(49903..50859) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728870.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene rarD CDS complement(50856..51770) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(51782..52357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 52400..53323 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908193.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(53354..54697) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728865.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 54746..55501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 55492..56535 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 56532..56747 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728864.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(56740..59880) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728863.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene ileS CDS complement(60133..60894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 60924..61307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104108.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 61349..62086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894553.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 sequence0296 source 1..623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0297 source 1..544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0298 source 1..459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0299 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0300 source 1..667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0301 source 1..375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0302 source 1..5617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(137..1585) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729941.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(1585..2460) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(2475..3722) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729942.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 3796..4677 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729943.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 4674..5498 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 sequence0303 source 1..409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0304 source 1..485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0305 source 1..381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0306 source 1..802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(603..800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 sequence0307 source 1..467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0308 source 1..462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0309 source 1..458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0310 source 1..1557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 note possible pseudo, internal stop codon, frameshifted misc_feature complement(615..>1557) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403850.1:phosphoglycerate mutase PE_PGRS11 locus_tag LOCUS_09150 sequence0311 source 1..669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 167..589 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 sequence0312 source 1..622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0313 source 1..407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0314 source 1..752 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0315 source 1..612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0316 source 1..653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..611 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893199.1:sulfurtransferase locus_tag LOCUS_09170 sequence0317 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0318 source 1..601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0319 source 1..917 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0320 source 1..767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0321 source 1..421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09180 sequence0322 source 1..411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0323 source 1..34761 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 623..1840 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727945.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1837..2010 product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893232.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 2007..2189 product rubredoxin RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417044.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene rubB CDS 2299..2868 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104226.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 2996..4456 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080862.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene ahcY CDS complement(4467..4832) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 5056..6339 product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112318.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(6347..7033) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 7112..7741 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 7790..8476 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727971.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene mtrA CDS 8551..10110 product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene mtrB CDS 10107..11864 product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727973.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene lpqB CDS 11962..12615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 12608..13177 product DUF6529 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 13192..13644 product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731351.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(13664..14971) product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 15025..15663 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 15989..16678 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727974.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene raiA CDS 16778..19594 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727975.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene secA CDS complement(19609..19935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 20313..21722 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 21778..23523 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727978.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 23533..24030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 24083..25246 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727980.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 25316..26563 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893267.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 26756..26983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(27032..28015) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727982.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene rsgA CDS complement(28012..29286) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene aroA CDS 29349..30107 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877238.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 30164..30385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104552.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 30382..31248 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 31284..31493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895047.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 31557..32138 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 32145..32996 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 33035..33754 product YqjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409685.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(33751..34599) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877239.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 sequence0324 source 1..681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0325 source 1..85518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..870) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(867..2564) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109789858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene lnt CDS complement(2557..4143) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729377.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(4144..4611) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene fxsA CDS complement(4652..5038) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(5111..5491) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(5509..9057) product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene cobN CDS 9136..9972 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531211.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 9983..10384 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(10381..10578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(10615..12072) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(12195..12488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 12585..13748 product precorrin-3B synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729385.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene cobG CDS 13758..14384 product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895323.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 14381..15856 product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 15869..16936 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(16914..17645) product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877850.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(17645..18400) product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene cobM CDS complement(18397..19575) product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729388.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(19572..20387) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 20360..20785 product F420-dependent biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895331.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(20782..21957) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729390.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 22084..23019 product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877851.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(23020..23847) product DUF4333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(23886..26675) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729394.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(26659..27609) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729395.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene tatC CDS complement(27660..27938) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene tatA CDS complement(27969..28937) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(28934..29938) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 29961..30551 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(30544..31887) product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729397.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene pafA CDS 32055..33656 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726883.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 33705..34589 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729398.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(34594..35325) product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895345.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene prcA CDS complement(35322..36218) product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene prcB CDS complement(36215..36409) product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411026.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(36514..38010) product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895348.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene dop CDS 38155..39300 product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411031.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 39331..40485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(40482..41114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 41314..41598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(41628..41858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09960 note possible pseudo, frameshifted CDS complement(41755..43404) product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895355.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene arc note possible pseudo, frameshifted CDS 43550..44041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 44070..44612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 44623..44919 product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075541644.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(44940..45743) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895359.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 45864..46745 product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS 46742..47539 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895361.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 47632..47949 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729618.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 47946..48443 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 48446..49093 product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(49044..50414) product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(50425..50907) product DUF4126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895565.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(50976..51830) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877960.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene hisG CDS complement(51827..52174) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895567.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 52183..52554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(52658..54133) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(54216..54899) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(54945..58712) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021268943.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene metH CDS 59009..59872 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729625.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(59886..61322) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729626.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(61322..62200) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729627.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(62243..63532) product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729628.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene mshC CDS complement(63540..64313) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895577.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(64328..65125) product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729629.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(65157..65744) product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(65802..66518) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729631.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(66515..67363) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729632.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(67390..67560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 68002..68865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729634.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 68862..69119 product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 69127..70194 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877967.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(70191..70721) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895586.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(70763..72106) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036453339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 tRNA 72214..72300 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 72304..72924 product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533542.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(72921..76685) product bifunctional nitrate reductase/sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(76711..78099) product NarK family nitrate/nitrite MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(78309..78701) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(78698..80254) product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877971.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(80241..80765) product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729642.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(80762..81745) product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250323.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 81838..83466 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510656.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 83459..84124 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729645.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(84110..85396) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 sequence0326 source 1..736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0327 source 1..741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0328 source 1..603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0329 source 1..920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..533 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727285.1:polyphosphate kinase 2 family protein locus_tag LOCUS_10400 sequence0330 source 1..863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0331 source 1..533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0332 source 1..410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0333 source 1..541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..516 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730990.1:flavin reductase family protein locus_tag LOCUS_10410 sequence0334 source 1..734 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0335 source 1..586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0336 source 1..381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0337 source 1..107595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(241..2136) product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730981.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(2133..2879) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897426.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(2876..4252) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730982.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 4415..5284 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730983.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 5303..6076 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 6229..7392 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(7396..8310) product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(8307..8684) product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 8735..9514 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878534.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 9514..9762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(9759..10322) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(10322..11221) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(11218..12108) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(12122..13306) product flavin-dependent monooxygenase oxygenase subunit HsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene hsaA CDS 13463..14515 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730993.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(14524..14691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 14633..15103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897439.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(15100..17193) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730994.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 17404..18075 product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878540.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene kstR CDS 18078..18824 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730996.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene otsB CDS complement(18821..19876) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 20023..20928 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114975.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 20936..21739 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175266318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 21732..22592 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(22589..23395) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894627.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 23402..24100 product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731004.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene bluB CDS 24097..24852 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731005.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(24863..25894) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727430.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 25961..26359 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800667.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 26377..27297 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731014.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 27288..28529 product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104175.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 28634..29410 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742086.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(29407..30348) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731016.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene rlmB CDS complement(30348..31748) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731017.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene cysS CDS complement(31769..32248) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731018.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene ispF CDS complement(32254..32742) product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731020.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene carD CDS 32982..33545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731021.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(33601..33828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 33764..35008 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene radA CDS 35079..36137 product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731023.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene disA CDS complement(36134..36892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731024.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(36964..37593) product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene canB CDS 37583..38452 product A/G-specific adenine glycosylase MutY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731026.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene mutY CDS 38466..39824 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(39836..40822) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 40894..41148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(41122..41892) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 41891..42238 product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731028.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene mhuD CDS 42210..43571 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731029.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(43716..44267) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897489.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(44341..45147) product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(45173..45388) product CbtB-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897491.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(45614..48154) product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731031.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 gene clpC1 CDS complement(48424..48765) product iron-regulated nucleoid-associated protein Lsr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene lsr2 CDS complement(48890..50398) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731034.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene lysS CDS 50422..51657 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731035.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(51667..52482) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(52486..52893) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419523.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS complement(52893..53825) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene panC CDS complement(53822..54751) product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731037.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(54831..56060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(56193..56669) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419535.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS complement(56669..57181) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897502.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene folK CDS complement(57178..57507) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene folB CDS complement(57551..58354) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene folP CDS complement(58363..58971) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731040.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene folE CDS complement(59006..61306) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897506.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene ftsH CDS 61513..62412 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 62480..63193 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193046641.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(63190..65418) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(65429..66016) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene hpt CDS complement(66030..66905) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899608.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene tilS CDS complement(66971..68035) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731046.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(68023..69402) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene dacB CDS 69548..70036 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 70105..70620 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897516.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(70673..71227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 71557..72708 product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895366.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(72740..73969) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897538.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 74086..77973 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731067.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 77970..79307 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731068.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 79304..80554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419582.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(80540..81136) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(81138..82919) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 82995..83963 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene galE CDS 83960..85744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419613.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 tRNA complement(85840..85913) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(85968..87176) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(87628..87765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 88152..88826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 note possible pseudo, frameshifted CDS complement(88823..91630) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene topA CDS complement(91766..92344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419642.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(92469..92672) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 92946..95276 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 95584..96567 product DUF5628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731081.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(96553..96882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 96839..97225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(97222..97401) product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419673.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(97455..98030) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731085.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(98027..98518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 98501..98725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(98818..99984) product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(99981..101054) product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510600.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 101575..102384 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731091.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(102765..103547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 103656..105662 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878580.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 gene acs CDS 105682..106992 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 sequence0338 source 1..622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(453..620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 sequence0339 source 1..382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0340 source 1..603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0341 source 1..546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0342 source 1..612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0343 source 1..412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0344 source 1..712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0345 source 1..410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0346 source 1..561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0347 source 1..106509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 20..1513 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731372.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1517..2314) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(2317..3516) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728360.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(3549..5726) product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(5739..6656) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163686145.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(6764..7537) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(7582..7926) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(7974..8288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 8605..9147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 9149..10468 product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 10479..11480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729272.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(11497..12390) product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731422.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(12390..13562) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145857281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(13595..13930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139576.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS complement(13927..15228) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(15225..16112) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728712.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(16123..17088) product TIGR03621 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222573.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 17185..17877 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730095.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(17895..18518) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966858.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(18546..19331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(19328..19456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 19576..20223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(20236..21114) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896200.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(21141..22412) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730081.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(22409..23650) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(23663..25111) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(25140..26168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(26175..27308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(27310..28425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(28487..29404) product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(29401..31080) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110170977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS 31171..32145 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 32327..32881 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898046.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 32985..34328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(34332..35219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(35223..36335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(36364..37560) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730165.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(37604..38671) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 38962..40068 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(40075..40380) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414710.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(40428..41171) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728344.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(41181..42053) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728343.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene lepB CDS complement(42089..42559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 42737..43654 product LppW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(43705..44400) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene trmD CDS complement(44397..44912) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene rimM CDS complement(44919..45161) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS complement(45170..45673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 45852..46334 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(46338..46772) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 46815..47693 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893799.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 47766..48590 product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728339.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 48687..50309 product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079611.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(50306..51400) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(51403..52962) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728337.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene ffh CDS complement(53088..55565) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893793.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(55645..55983) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(56017..57381) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(57565..58923) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728334.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 gene ftsY CDS 58949..59983 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747543.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene fni CDS complement(60035..63634) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728333.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene smc CDS complement(63649..63933) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(63917..64333) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893786.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(64438..65109) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728330.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene mutM CDS complement(65288..65992) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728329.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene rnc CDS complement(65985..66497) product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(66620..67357) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893781.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(67562..68128) product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893780.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(68211..68687) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene coaD CDS complement(68711..69220) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415001.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene rsmD CDS complement(69262..72657) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(72681..73313) product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(73310..74104) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(74139..75179) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877378.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 75235..76065 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 76071..76913 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(76910..77617) product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728321.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(77614..79878) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene recG CDS complement(79881..81515) product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728319.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 81741..81935 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rpmB CDS complement(81992..82672) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(82711..83667) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415034.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 83742..83984 product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728315.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 83995..84567 product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(84564..85721) product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(85783..86799) product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728313.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(86890..87888) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 87933..88577 product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene cofC CDS 88631..90838 product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 90890..91819 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(91925..92563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 note possible pseudo, internal stop codon, frameshifted CDS complement(92756..93349) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene leuD CDS complement(93360..94796) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728310.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 gene leuC CDS 94859..95536 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 tRNA complement(95608..95683) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA complement(95778..95852) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(95970..97448) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728308.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene gltX CDS complement(97445..98233) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728307.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 98348..99532 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893748.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(99535..99699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(99722..100114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(100119..101129) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899576.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(101126..102712) product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899578.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 gene serA CDS 102743..104173 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 104211..104423 product DUF2945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(104495..105310) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224982.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 105409..105888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250160.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 105933..106385 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230535.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 sequence0348 source 1..766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0349 source 1..465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0350 source 1..664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0351 source 1..522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0352 source 1..23406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3360 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296786.1:non-ribosomal peptide synthetase locus_tag LOCUS_12550 CDS 3500..4576 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726805.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(4564..5241) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112583.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 5407..7347 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411855.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene htpG CDS complement(7357..8151) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(8213..10405) product SGNH hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624217.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 10927..11160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 11590..13134 product long-chain-fatty acid--ACP ligase MbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893504.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene mbtM CDS 13181..13933 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(13924..14697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(14760..15731) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893402.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 15871..16809 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728105.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(16799..18166) product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 18204..19166 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 19207..20682 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 20693..22180 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728107.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(22137..22898) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728108.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 22934..23305 product DUF4345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728109.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 sequence0353 source 1..611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 sequence0354 source 1..872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0355 source 1..742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0356 source 1..471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0357 source 1..408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0358 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0359 source 1..644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0360 source 1..40556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 83..514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(581..1039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(1088..1960) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246384.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(2050..2250) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892186.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(2247..2654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(2651..3886) product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene yjiB CDS 4012..5202 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(5199..6161) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(6158..7039) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(7036..8043) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729985.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(8040..9203) product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729984.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 9275..10279 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 10593..12548 product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896022.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 12545..13615 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878091.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 13683..14216 product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729980.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 15267..15587 product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 15811..16290 product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496003.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(16305..17471) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(17494..18024) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224846.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(18021..18419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 18516..20510 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729974.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 20521..21774 product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 21879..22499 product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896008.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 22574..25225 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 25222..26646 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene folC CDS 26643..27044 product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074540.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 27055..27465 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729972.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene ndk CDS 27777..30542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 30720..31043 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene rplU CDS 31057..31323 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene rpmA CDS 31407..32852 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729970.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene obgE CDS 32849..33946 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412568.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene proB CDS complement(34001..34654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(34660..35496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(35512..36057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(36179..36718) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 36762..38804 product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729965.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(38801..39409) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(39434..40081) product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495802.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(40045..40374) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082154.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 sequence0361 source 1..587 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0362 source 1..483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0363 source 1..676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 sequence0364 source 1..469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0365 source 1..647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0366 source 1..739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0367 source 1..589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0368 source 1..379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0369 source 1..679 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 sequence0370 source 1..529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 sequence0371 source 1..76481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(159..2642) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728362.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(2639..3682) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(3679..5256) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815878.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(5257..6273) product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 6461..6850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 6922..7623 product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(7628..8446) product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 8509..8949 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 8949..10460 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 10457..11590 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene dprA CDS 11657..12508 product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728392.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 12533..13693 product lactate 2-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728393.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 13726..14628 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728395.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(14684..15169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 15453..16289 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076880.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene rpsB CDS 16302..17117 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893881.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene tsf CDS 17206..18648 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728400.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(18643..19773) product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728407.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(19794..20219) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899525.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 20266..20943 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728418.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 21030..21809 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene pyrH CDS 21854..22411 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene frr CDS 22411..23289 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728419.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(23197..24132) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 24205..25350 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene rlmN CDS complement(25427..25852) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(25849..27333) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(27390..27938) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(27972..29087) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 29143..30309 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(30322..30873) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728433.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS 30927..32168 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728434.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS 32177..32368 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 32422..33174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(33171..33986) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(33983..34738) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728436.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 34869..35573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728437.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 35570..36820 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877431.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 36822..37787 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 37784..38527 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 38524..39246 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 39251..40774 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS 40774..41694 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728443.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(41696..42163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(42167..42835) product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727149.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 42892..44049 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891999.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(44131..45063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(45060..45371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 45255..46256 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(46274..47464) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(47457..48998) product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467246.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(48995..49933) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227174.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(49930..51060) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093421.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 51059..51841 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111103.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(51838..53733) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(53813..54427) product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893928.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 54615..56045 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726815.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 56165..56692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730120.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(56689..56949) product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893930.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 57039..57872 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS complement(57865..59154) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS 59194..60063 product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404819.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 60101..60511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(60522..60965) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(60958..61392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 61483..62340 product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene sigI CDS complement(62404..62982) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414644.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(63074..64813) product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(64891..65577) product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene mpt83 CDS 65735..66937 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728448.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene dxr CDS 66934..68148 product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893934.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 68160..69332 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950793.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene ispG CDS 69421..70275 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877435.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS 70302..70961 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 71075..72847 product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 72925..73506 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(73499..74680) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(74677..75792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 75791..76393 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225734.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 sequence0372 source 1..41870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..1898) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223305.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(1901..2956) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(3003..3527) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(3529..4395) product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 4812..5258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(5314..5742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 5881..6222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 6314..6853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS 6857..7948 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(7952..8941) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624176.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(9019..10284) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene hisS CDS complement(10284..10955) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728735.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 11061..11939 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 12023..12967 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139596.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(12974..13267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(13319..15694) product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894345.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(15767..16276) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(16294..17946) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728725.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(17952..19223) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728724.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene secF CDS complement(19228..21042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(21115..21459) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728722.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene yajC CDS 21599..22012 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532560.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 22158..23498 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728721.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene gabT CDS 23518..24951 product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(24985..25893) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113846.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(25901..26092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 26012..26356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(26581..27174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 27456..30950 product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(30965..31351) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728710.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(31363..32421) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728709.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene ruvB CDS complement(32418..33005) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene ruvA CDS complement(33002..33568) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene ruvC CDS complement(33700..34008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 34150..35376 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(35350..35955) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 36021..36866 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731517.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(36845..37603) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(37673..38110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(38112..38660) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730440.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS 38766..40484 product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 40536..41747 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 sequence0373 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0374 source 1..370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 27..218 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 sequence0375 source 1..740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0376 source 1..421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 55..381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 sequence0377 source 1..66868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(105..1211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1208..1780) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 1812..3065 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(3078..3443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 3497..4282 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727332.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(4297..5331) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(5328..5594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 5685..5840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727327.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(5854..6876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(7026..8000) product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 gene ccsB CDS complement(8017..9615) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496094.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(9675..10475) product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892398.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(10472..11083) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(11080..11688) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462582.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(11685..13001) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892395.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene hemL CDS complement(13052..13438) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088836.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS 13462..13842 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(13839..15206) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496091.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(15203..15688) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892388.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(15708..16019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(16064..16660) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(16647..17510) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079707.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 17627..19027 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(19039..19308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(19305..19829) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727315.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(19793..20185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(20206..20619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(20616..21596) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene hemB CDS complement(21618..23300) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624021.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(23331..24272) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727310.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene hemC CDS complement(24276..25622) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727309.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(25737..26003) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 26042..26944 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892375.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 26996..27535 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727307.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(27543..28613) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(28652..29728) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(30017..30274) product cell division/environmental response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(30414..31253) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene proC CDS complement(31342..32154) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(32172..33017) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727302.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(33046..34164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727301.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(34222..35187) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS 35236..36030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727299.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 36027..36311 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767500.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(36319..37005) product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene regX CDS complement(37013..38194) product two-component system sensor histidine kinase SenX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene senX3 CDS complement(38342..39088) product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(39098..39637) product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(39634..40911) product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727296.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene mshA CDS complement(40999..42198) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 42446..43204 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727295.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS complement(43263..44507) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496089.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(44577..45632) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 45659..46171 product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 46229..47020 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 47040..47840 product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 47861..48787 product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727292.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(48791..50560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(50584..52227) product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727775.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(52184..52459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(52556..53266) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402347.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene deoC CDS complement(53266..53754) product DUF2599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(53672..53953) product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727289.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(54042..54680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(54765..55214) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(55306..56622) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727287.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 56729..57433 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 57426..58301 product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(58421..59275) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062138.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(59378..60637) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene aceA CDS complement(60869..61642) product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727282.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 61759..63186 product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892333.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene ramB CDS 63201..63752 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(63749..64021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(64018..65412) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene lpdA CDS complement(65423..65893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(65883..66161) product putative holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094873.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(66188..66733) product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 sequence0378 source 1..406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0379 source 1..409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0380 source 1..54794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(539..961) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(965..1309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1872..2354) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227513.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 2483..2743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(2757..3329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS complement(3334..3768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 3989..4966 product 5-dehydro-4-deoxyglucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731064.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 4966..5970 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528521.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(6009..7010) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(7257..7517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(7592..7801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(7949..8167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(8215..8733) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(8798..10195) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(10401..10946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 note possible pseudo, internal stop codon CDS complement(10948..11367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(11373..12167) product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281389.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene hcaB CDS complement(12434..12718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 12743..13186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(13749..14702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(14722..15951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(15988..16500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(16503..17819) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(17819..18601) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(19170..19733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(19854..20732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(20822..21265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(21365..21868) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808137.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(21916..23331) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(23583..23780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(23811..24857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(24844..25098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(25339..26505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(26502..27755) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(27810..28841) product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene bdhA CDS complement(28948..29490) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(29487..30821) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(31161..31589) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730697.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(31579..33039) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730698.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(33355..34821) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(34957..36105) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(36169..36828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(36825..37472) product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899109.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(37469..38929) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726871.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(38929..40068) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726870.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(40065..41414) product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899106.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(41411..42739) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876746.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(42736..43764) product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899104.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(43823..45166) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726866.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(45172..46029) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726865.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(46026..46835) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167316264.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(46969..47487) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene pcaG CDS complement(47490..47888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(47917..48414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(48408..49589) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809837.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(49586..50671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(50686..51711) product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119007.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(51769..52587) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(52616..53983) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(54145..54690) product aromatic-ring-hydroxylating dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105327.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 sequence0381 source 1..586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0382 source 1..906 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0383 source 1..612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0384 source 1..600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0385 source 1..421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0386 source 1..770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(80..>770) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029762.1:APC family permease locus_tag LOCUS_15780 sequence0387 source 1..404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0388 source 1..462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..292 product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 sequence0389 source 1..521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0390 source 1..655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0391 source 1..386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0392 source 1..451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 sequence0393 source 1..374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0394 source 1..534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0395 source 1..491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0396 source 1..776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 80..571 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 sequence0397 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 81..401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 note possible pseudo, frameshifted sequence0398 source 1..333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0399 source 1..455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0400 source 1..675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0401 source 1..534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0402 source 1..491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0403 source 1..404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0404 source 1..334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0405 source 1..618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0406 source 1..155152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..1463 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1469..2143) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005122144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(2153..3760) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730298.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(3757..4698) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730297.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(4664..5350) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(5453..6118) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896481.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 6449..7084 product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730296.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene sigE CDS 7173..7574 product anti-sigma E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896479.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene rseA CDS 7643..9133 product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene htrA CDS 9136..9558 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene tatB CDS complement(9555..10697) product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104279.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(10731..12134) product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462438.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(12309..12860) product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(12860..14152) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896472.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 14238..15134 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS complement(15146..15532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(15550..16257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 16377..16901 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 17077..18471 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 18468..19379 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896467.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 19379..20215 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 20220..21407 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730288.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene ugpC CDS 21404..21997 product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 22157..22588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 22598..23305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 23313..24134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(24115..24675) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 24836..25216 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS 25290..25667 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226049.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(25674..26777) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730286.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene corA CDS 26918..27907 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 27956..29140 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 29150..29998 product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900301.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(30002..30829) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898788.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(30851..31681) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730283.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(31774..35463) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(35688..36440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896454.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 36679..37917 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 37999..39999 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730278.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(40075..41427) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730277.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(41424..44843) product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(44894..45397) product LppP/LprE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896449.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 45333..45536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 45536..47224 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 47221..48360 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730275.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 48488..50893 product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene atsD CDS 51105..51437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 51509..51802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730324.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(51812..52396) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730273.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(52396..53637) product cytochrome P450 Cyp130 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406352.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene cyp130 CDS complement(53719..55086) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730270.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(55115..56470) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731564.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 note possible pseudo, frameshifted CDS complement(56446..56772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 note possible pseudo, frameshifted CDS 56889..59510 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729639.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 59533..61101 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(61091..62398) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406359.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 62544..63242 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730268.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(63181..63732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 63889..65121 product FAD-binding domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 65135..66172 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896435.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(66173..66616) product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(66620..67048) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730267.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 67107..68483 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS complement(68517..70295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(70292..73411) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726759.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(73475..73975) product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 73963..75132 product adenylate cyclase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730263.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 75193..75606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 75636..76535 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(76536..78731) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(78733..79617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(79617..79880) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730261.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS 79889..80320 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112231.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene dtd CDS complement(80325..81026) product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 81251..81457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS 81531..82115 product transcriptional regulator AbmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406375.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene abmR CDS complement(82112..84205) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(84319..86217) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730255.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(86214..87950) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730254.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 88066..88650 product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200806175.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 88647..89213 product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(89215..89733) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730252.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 89799..90347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 90627..92057 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS 92105..93709 product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 93702..94229 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 94232..95446 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731367.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 95519..96817 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461770.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 96892..98082 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730251.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 98079..100724 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730250.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 100774..102309 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(102313..102726) product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 102808..104079 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730246.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 104207..105580 product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene tnpB CDS complement(105613..107292) product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519688.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(107303..109141) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(109138..110022) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730243.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(110019..111011) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730242.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS 111236..111448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 111561..111800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(111805..112335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS 112469..113227 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878204.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 113343..114788 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730237.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 114812..116692 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730236.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 116749..118008 product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730235.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 118049..119959 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730234.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 119959..120558 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(120563..120988) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104285.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 121155..122081 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911471.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 gene cysD CDS 122081..123925 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730228.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene cysN CDS 123922..124653 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 124662..125138 product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730224.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(125135..125776) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 125885..126787 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 126774..127433 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410207.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(127402..127812) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 127850..128374 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878199.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 128375..129391 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 129564..130775 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(130868..131281) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 131280..132212 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(132197..132631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 132661..133329 product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(133326..134144) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(134147..134980) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(134982..136235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(136235..137425) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(137430..137873) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 137903..138847 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731359.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(138834..139778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(139872..140855) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 141500..142132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(142140..142502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(142483..142896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(142897..143085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 143003..143833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 144475..144936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 tRNA complement(145481..145556) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 145661..147313 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730214.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene argS CDS 147310..148728 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730213.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene lysA CDS 148733..150058 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 150055..151170 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730211.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene thrC CDS 151182..152126 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730210.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene thrB CDS 152427..154346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(154343..154957) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896342.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 sequence0407 source 1..676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0408 source 1..780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(35..109) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 sequence0409 source 1..676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0410 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0411 source 1..91828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..977 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495647.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 979..2001 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS 1965..2186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 2193..3002 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729305.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 2999..3922 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 3922..5682 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene recN CDS complement(5687..6178) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 6294..6671 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061577.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 6769..7947 product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene steA CDS 7956..8897 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 9016..10791 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895192.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 10784..11404 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895191.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 11401..12348 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene xerD CDS complement(12356..13174) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014848103.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 13301..14098 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104155.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 14095..14952 product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 14942..15682 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene scpB CDS 15675..16418 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895185.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS 16415..17098 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729300.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene cmk CDS 17095..18498 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729299.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene der CDS 18705..19640 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS 19676..20458 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729298.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(20455..21942) product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484182.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 tRNA 22033..22107 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 22254..23678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(23822..25081) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404402.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(25078..26187) product S-sulfocysteine synthase CysK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene cysK2 CDS complement(26294..26704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(27147..28070) product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(28241..28480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 note possible pseudo, internal stop codon CDS 28827..29537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 29738..30001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 29998..31368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(31471..31755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(31765..32025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 32322..32885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(32924..33565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(33902..34084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 34110..34616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(34650..35780) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091654.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(35777..36517) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 36777..37955 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 37959..39074 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731331.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(39131..40090) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225050.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(40374..41282) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396441.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(41272..42090) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 42444..43262 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 43371..44072 product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 44190..44594 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891724.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS 44591..45736 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029664.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 45800..46762 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(46763..47431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408495.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 47631..48950 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729279.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(48947..51820) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729784.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(51959..52594) product cutinase Cfp21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409976.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene cfp21 CDS 52960..54324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(54418..54867) product DUF5078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877718.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS complement(54881..55204) product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(55201..58110) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(58107..58643) product siderophore transporter accessory protein MmpS5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene mmpS5 CDS complement(58701..59210) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730986.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 59375..60208 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 60219..61418 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 61464..61691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(61753..63330) product fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730208.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene fadD1 CDS 63354..64418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 64518..65879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 65873..67558 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256282.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(67636..68457) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064915.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(68467..69687) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(69684..70757) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS complement(70754..71911) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228920.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 71994..72197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 72257..72562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 72577..73539 product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 73551..74549 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929922.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 74542..74781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 74804..75670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 75680..77215 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(77217..78374) product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(78371..79606) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 79663..80019 product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 80016..81068 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 81065..82207 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878153.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(82253..82969) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(82979..83788) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036341485.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 83991..86201 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(86205..87449) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 87560..88693 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462182.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 88693..90294 product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259624.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS 90303..90716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 90713..91243 product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 91240..91680 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086609.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 sequence0412 source 1..367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0413 source 1..617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0414 source 1..610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0415 source 1..556 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0416 source 1..649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0417 source 1..629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0418 source 1..620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0419 source 1..609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(82..>609) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877975.1:YggS family pyridoxal phosphate-dependent enzyme note possible pseudo, internal stop codon, frameshifted locus_tag LOCUS_18190 sequence0420 source 1..598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0421 source 1..781 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0422 source 1..367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0423 source 1..339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0424 source 1..530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0425 source 1..360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0426 source 1..311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0427 source 1..604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0428 source 1..468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0429 source 1..440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0430 source 1..666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0431 source 1..498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0432 source 1..619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0433 source 1..530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0434 source 1..494 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0435 source 1..605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0436 source 1..118197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(418..1758) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene tyrS CDS 1780..2481 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183580.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(2491..3123) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408373.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 3163..3918 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895205.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 3861..4688 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 4694..5308 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(5291..5506) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895208.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS complement(5516..6076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895209.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(6178..9111) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 9279..11033 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(11030..12442) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene argH CDS complement(12445..13659) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(13662..14153) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(14146..15075) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene argF CDS complement(15072..16250) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729315.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(16247..17119) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene argB CDS complement(17116..18330) product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408160.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene argJ CDS complement(18327..19304) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898960.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene argC CDS complement(19380..20264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(20295..20663) product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081152.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(20705..23191) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene pheT CDS complement(23191..24198) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895223.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene pheS CDS complement(24263..25135) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495987.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 25300..26346 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 26352..27590 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(27587..27913) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110193.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 27987..28766 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207902.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(28843..29589) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729329.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(29613..29948) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene rplT CDS complement(30000..30194) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408106.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene rpmI CDS complement(30206..30634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 30521..30835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 30963..31388 product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(31349..31588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 31503..34766 product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877820.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene lysX CDS 34871..35191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 35191..35556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(35550..36713) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230195.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(36710..37366) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003993508.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 37460..38812 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 38829..39146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(39140..40228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112183.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(40225..41535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086251.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 41638..42069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(42070..43305) product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(43287..44909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112187.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(44972..45457) product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895248.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 45574..46749 product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(46739..49642) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene uvrA CDS 49729..50400 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898956.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 50542..50871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(51023..51793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 52648..52908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(52957..54258) product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene cyp124 CDS 54478..55362 product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729118.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(56776..57285) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895256.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(57379..59010) product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(59021..59443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(59452..60894) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 60886..61473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 61470..62090 product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399871.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 62120..62767 product UdgX family uracil-DNA binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 62782..63642 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417254.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(63723..64157) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407748.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 tRNA complement(64182..64255) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 64366..65103 product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062896.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 65122..65838 product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727877.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(65833..67233) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729346.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 67491..67763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(68133..70358) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895262.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene uvrB CDS 70347..70877 product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 70959..71534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(71538..72749) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene coaE CDS complement(72826..74274) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895279.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene rpsA CDS 74553..75641 product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296531.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(76003..78711) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene polA CDS complement(78758..79252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(79268..79654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 79818..80255 product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 80252..81451 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729364.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 81578..82414 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532545.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 82429..82743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(82799..83512) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728924.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(83526..84353) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728923.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(84350..85540) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894640.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(85537..86583) product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(86666..87829) product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS complement(88083..88715) product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 tRNA 88804..88878 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 89427..90722 product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408035.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene cya CDS complement(90747..91235) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(91291..93093) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(93139..93768) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(93768..94898) product DUF5931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728916.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(94898..95659) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(95656..96591) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(96602..97519) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894624.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 97731..98303 product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS 98366..99826 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 99836..100885 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene cydB CDS 100927..102486 product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene cydD CDS 102479..103984 product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111158.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene cydC CDS 103981..104520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(104517..105377) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(105398..106828) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 gene pyk CDS complement(106843..108351) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728909.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(108344..112876) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene gltB CDS complement(112963..113382) product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(113372..113791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(113818..114387) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228754.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 114470..115285 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060018.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 115321..116742 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084767.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(116789..118075) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936020.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 sequence0437 source 1..456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 sequence0438 source 1..775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0439 source 1..671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..668 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728282.1:phytoene/squalene synthase family protein locus_tag LOCUS_19320 sequence0440 source 1..358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0441 source 1..488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0442 source 1..151626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(308..1030) product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(1538..1693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(1751..2248) product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162234095.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2326..3696) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730565.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(3843..5240) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(5330..5983) product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene mprA CDS complement(6106..6279) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907574.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene rpmF CDS 6564..8285 product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404960.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 8282..9442 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730569.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 9439..11034 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 11040..12974 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730570.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 12983..14143 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730571.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 14143..14913 product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730572.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 14923..16428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 16503..16904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 16920..17681 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730579.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 17900..18421 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(18443..20422) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730584.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(20415..21797) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878358.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 21952..22209 product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(22278..23846) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730588.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene purH CDS complement(23843..24472) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109748.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene purN CDS complement(24483..25988) product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730590.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(26048..26890) product DUF5336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 27326..28174 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896922.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(28171..29703) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730593.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(29789..30691) product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene sucD CDS complement(30704..31867) product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730595.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene sucC CDS 32164..33201 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878362.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 33202..33771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(33768..35996) product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730603.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene pcrA CDS 36332..36604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(36707..38644) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730604.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(38733..40181) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730606.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS 40230..41897 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730607.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene pgi CDS complement(41957..42502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730608.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(42477..42785) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(42894..43271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(43319..44014) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404829.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 44122..44667 product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(44660..45523) product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(45539..45940) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730612.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(45966..46709) product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896950.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 gene cobF CDS 46831..47721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 note possible pseudo, frameshifted CDS 47718..48005 product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(47945..49159) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(49187..49402) product DUF4235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898066.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 49392..50396 product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404819.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(50393..51358) product linear amide C-N hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 51624..52586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 52704..53318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(53315..56296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(56386..58680) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 58712..58942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(58951..60441) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906521.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(60537..61856) product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068617.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(61858..62937) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene ugpC CDS complement(62966..63835) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(63835..64809) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896978.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(64809..66173) product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896979.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(66193..67251) product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896980.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 67331..68332 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 68329..69717 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730628.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 69714..70661 product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730629.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 70671..71591 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878394.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(71595..72257) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895430.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 72330..73415 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 73583..74374 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 74385..75461 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 75492..75809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 76011..76220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 76296..77525 product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730641.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 77525..78589 product poly-gamma-glutamate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730642.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 78638..79936 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 79930..80673 product DUF1365 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402266.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 80670..81944 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402250.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 81967..82752 product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 82785..83330 product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene sigK CDS 83327..84046 product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene rskA CDS complement(84043..85143) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 85269..86138 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878396.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(86139..86417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(86417..87007) product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194694.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(87004..87621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150135106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 tRNA 87839..87914 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(87954..89252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(89257..89466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(89456..90496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(91652..91903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(92080..92511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 92749..93657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(94201..95352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(95349..95837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(96142..96567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 96738..97337 product DUF1942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113064.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 97353..97937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 97934..98893 product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(99090..99686) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727323.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(99746..100345) product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(100342..100848) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042743.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene lspA CDS complement(100845..102806) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(102803..103141) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(103294..104670) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 104834..105688 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 105741..106028 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(106094..107074) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091887.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS complement(107102..107713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 107986..108618 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072078.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 108618..109289 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083597.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 109282..109932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(110232..111170) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(111806..112930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 113718..114980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 114988..115992 product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897959.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS complement(116133..116468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 116870..119692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(119785..120318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(120377..120835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(120832..121524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(121502..122257) product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898119.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 122399..123613 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 123615..125138 product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS 125139..126032 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897017.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS 126138..126587 product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(126670..127293) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(127263..127700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878404.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 127699..128169 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(128174..128551) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 128711..129367 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(129364..130272) product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene couO CDS 130214..130600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(130656..132080) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(132109..133821) product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(133841..134788) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878405.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(134788..135948) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730660.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(135945..136865) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929514.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(136862..137788) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(137785..138951) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897029.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(138955..140115) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730662.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(140108..141034) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(141036..142895) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(142964..144376) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(144389..145234) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 145373..146977 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 146974..147720 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730668.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 147717..149264 product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730669.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 149266..150036 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730670.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 150033..151499 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730671.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 sequence0443 source 1..1041 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..1040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 sequence0444 source 1..683 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0445 source 1..535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0446 source 1..142258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..1018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 1237..1878 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892752.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene rplJ CDS 1922..2314 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892753.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rplL CDS 2409..2936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 3139..4332 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403363.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 4339..6540 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112075.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 6651..8474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 8887..12369 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 12411..16361 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892756.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 16401..17390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041179691.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(17452..18090) product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 18120..19199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 19235..19987 product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727639.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 20135..21244 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218045413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 21257..22009 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776214.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 22064..23692 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 23689..24627 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892776.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 24630..25358 product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104527.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 25355..26155 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727645.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(26172..26573) product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892781.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(26570..26953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 26840..27088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 27102..27638 product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892783.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 27639..28184 product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892784.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 28287..28877 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 29190..29564 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007167812.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene rpsL CDS 29564..30034 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene rpsG CDS 30123..32228 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene fusA CDS 32322..33512 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892789.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene tuf CDS complement(33582..34586) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421550.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 34710..35573 product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892791.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 note possible pseudo, internal stop codon CDS complement(35548..36876) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190031345.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 37025..37864 product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727649.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 37888..39336 product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420667.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 39363..40607 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727650.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene arcA CDS 40674..41528 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727651.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(41614..42495) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727652.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(42492..43994) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727653.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(44010..45260) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene rocD CDS complement(45257..46030) product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411960.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 46234..46680 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727656.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 46711..47901 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727657.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS complement(47964..49256) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892803.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(49253..49777) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892804.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(49832..50443) product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403482.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene mftR CDS 50633..50950 product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene mftB CDS 50956..52131 product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727659.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene mftC CDS 52135..53325 product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898557.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene mftD CDS 53547..54203 product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877069.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene mftE CDS 54200..55612 product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727662.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene mftF CDS 55622..57052 product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene mftG CDS complement(56951..58660) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359439.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 58752..59381 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727665.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(59409..60662) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727666.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 60823..62358 product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727668.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 62886..63191 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003883485.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene rpsJ CDS 63206..63859 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055632.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene rplC CDS 63859..64536 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727671.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene rplD CDS 64536..64838 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892825.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene rplW CDS 64869..65708 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727672.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene rplB CDS 65718..65999 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908582.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 gene rpsS CDS 65999..66682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 66682..67548 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892829.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene rpsC CDS 67551..67967 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892830.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene rplP CDS 67967..68200 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892831.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene rpmC CDS 68200..68514 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727674.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene rpsQ CDS 68640..70586 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013411.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(70594..71991) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(71999..72652) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906326.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(72799..74259) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(74505..75218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(75280..77316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 77533..78945 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 79046..80347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 80326..81243 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730913.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 81257..82753 product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(82760..83815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(83812..84702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(84704..85657) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(85685..86785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(86878..88083) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(88101..89612) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene zwf CDS complement(89698..90396) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777055.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 90448..91137 product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 91149..93500 product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene atsA CDS 93509..94222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 94482..94850 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892852.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene rplN CDS 94851..95168 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892853.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene rplX CDS 95170..95736 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892854.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene rplE CDS 95741..95926 product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892855.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 96018..96416 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892856.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene rpsH CDS 96439..96978 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene rplF CDS 96981..97388 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene rplR CDS 97414..98085 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene rpsE CDS 98088..98267 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene rpmD CDS 98270..98710 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727689.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene rplO CDS 98858..99205 product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897187.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 99249..101048 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727691.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene sppA CDS complement(101034..101687) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403695.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(101681..102637) product D-3-phosphoglycerate dehydrogenase SerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene serA CDS 102689..104017 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403701.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(104064..104906) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404349.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(104913..105827) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(105824..106759) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892869.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS 107033..108370 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892870.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene secY CDS 108367..108915 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892871.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 108923..109720 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene map CDS 109859..110383 product sigma-70 family RNA polymerase sigma factor SigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403731.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene sigL CDS 110380..111114 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727694.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(111073..111312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 111211..112893 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877086.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 112874..113545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892876.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 113545..114555 product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727696.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 114537..115592 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877088.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(115602..115955) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 116046..116558 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892879.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(116555..117781) product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727698.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(117778..118449) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 118646..119359 product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727700.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 119457..120695 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 120711..121907 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486733.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(121898..122788) product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727701.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene mmsB CDS complement(122802..123977) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403845.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(123978..125495) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727703.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(125573..126178) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418610.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 gene rfbC CDS complement(126175..127161) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892900.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene rfbB CDS complement(127164..127784) product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284350.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(127821..128663) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(128675..129520) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104471.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(129579..131084) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892903.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(131118..132125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 note possible pseudo, frameshifted CDS complement(132232..132822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 note possible pseudo, frameshifted CDS 132940..133323 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(133308..133616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 133865..134086 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene infA CDS 134410..134784 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004571523.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene rpsM CDS 134784..135203 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene rpsK CDS 135218..135823 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene rpsD CDS 135910..136962 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892912.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS 137022..137633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS 137641..138510 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418344.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene truA CDS complement(138507..139178) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(139234..139827) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727721.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(139942..140700) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447246.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(140765..141787) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892918.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 141862..142239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 sequence0447 source 1..654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..534) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401601.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 sequence0448 source 1..962 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(27..716) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727393.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 sequence0449 source 1..480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0450 source 1..416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0451 source 1..661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 sequence0452 source 1..168561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..1460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730381.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(1464..2366) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2366..3124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(3121..3852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(3816..5264) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726871.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(5266..6423) product Mce family lipoprotein LprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899107.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene lprM CDS complement(6420..7745) product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(7742..9097) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876746.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(9094..10125) product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899104.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS complement(10172..11629) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726866.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(11634..12452) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726865.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(12506..13273) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167316264.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS complement(13466..13936) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031562.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(13938..14582) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 14670..15542 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730384.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 15539..18448 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 18610..18996 product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742207.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(18993..19946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 19993..20772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(20769..20933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896614.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 20975..21667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896615.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(21664..22425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(22715..24022) product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730565.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 24153..25286 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406347.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 25318..25611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(25612..26358) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730386.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS complement(26355..26894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229320.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 27033..27461 product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727512.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 gene arr CDS complement(27509..28270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(28428..29501) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene ychF CDS 29634..30596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878271.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(30598..31581) product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 31653..32216 product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730397.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 32238..33470 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878273.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene xseA CDS 33467..33679 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896629.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 33758..34855 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896630.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 34980..36521 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 36606..38078 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 38078..38998 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065472.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 38991..39869 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969423.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS complement(39859..40518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(40524..41486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 note possible pseudo, frameshifted CDS complement(41560..42024) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859290.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS 42086..42853 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730402.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 42850..43677 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS 43687..44919 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730404.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(44900..45697) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(45706..46353) product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730406.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 46408..47436 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730407.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 gene glpX CDS 47468..48886 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730408.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 49004..49762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 50488..50670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 50687..54034 product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439724.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 54154..54690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 54774..56762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(56766..58040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(58070..58474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 58776..60251 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 60274..63069 product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 63160..64803 product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 64895..65197 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 65281..67992 product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133431295.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 67989..68990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 68987..70921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 70918..71811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 72973..73293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 73791..74804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(75002..76189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS complement(76192..81747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 82382..83443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(83954..88582) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(88579..91971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131721717.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 92430..93626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 93789..94202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 94601..95470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 95490..95657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS complement(95700..95879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 96642..96845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 note possible pseudo, frameshifted CDS 97089..98525 product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(98623..99069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(99066..99617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 100193..100885 product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891691.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 100878..104318 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726887.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(104453..105148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 105959..110326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 110323..111810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 112425..112613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23160 note possible pseudo, frameshifted CDS complement(112633..113187) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(113184..113846) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878688.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(113923..114600) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048367.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 114657..114932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 115029..115244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 115252..116466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 116463..117347 product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030485.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 117360..117884 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228353.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 117936..118811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(118838..119056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(119139..119384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 119443..119655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS 119957..121315 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899248.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(121433..123922) product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene ponA2 CDS 124707..125123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(125143..126351) product type II sulfide:quinone oxidoreductase Sqr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033018.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene sqr CDS 126420..127205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 127306..127881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 note possible pseudo, internal stop codon CDS 127927..128772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 note possible pseudo, internal stop codon CDS 128769..129659 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892596.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(129677..130051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 130162..131031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(131016..131435) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091304020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(131479..132348) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078164.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(132418..132636) product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 132922..133251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 133255..135540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 135573..136403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142282774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 136481..137446 product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028208.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 137443..137631 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 137636..138826 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 138832..139998 product FAD-binding domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898508.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(140434..141003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 140900..141298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(141313..142554) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729845.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS complement(142564..143529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 143591..144226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 144394..144672 product hemophore-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(144688..146070) product serine/threonine protein kinase PknF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene pknF CDS complement(146208..146873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(146899..147453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(147627..148094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(148224..149771) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878013.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 150151..151062 product cyclopropane mycolic acid synthase family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727496.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 151107..151991 product cyclopropane mycolic acid synthase family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727495.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(151992..153242) product KasA/KasB family beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727494.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 153309..154259 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062218.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene ppk2 CDS complement(154187..154741) product DUF5994 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS complement(155120..155323) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 155710..157005 product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 157045..157776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS complement(157781..158104) product DUF4333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896292.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(158422..159885) product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730171.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 160013..161626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(161620..162498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(162690..164435) product bifunctional serine/threonine-protein kinase/transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727491.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(164564..165850) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 166056..168428 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727490.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 sequence0453 source 1..654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0454 source 1..608 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0455 source 1..404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0456 source 1..681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0457 source 1..574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0458 source 1..308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0459 source 1..333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0460 source 1..741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0461 source 1..686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0462 source 1..823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0463 source 1..343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0464 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0465 source 1..327 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0466 source 1..571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0467 source 1..684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0468 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 sequence0469 source 1..466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0470 source 1..325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0471 source 1..581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0472 source 1..422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0473 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0474 source 1..527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 sequence0475 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0476 source 1..666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0477 source 1..1008 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0478 source 1..703 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0479 source 1..570 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0480 source 1..613 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0481 source 1..553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0482 source 1..828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0483 source 1..311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0484 source 1..357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0485 source 1..843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(103..>843) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886153.1:alpha/beta hydrolase locus_tag LOCUS_23770 sequence0486 source 1..706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..505 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084188.1:DUF2855 family protein locus_tag LOCUS_23780 sequence0487 source 1..180119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(85..996) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727626.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS complement(996..1541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727625.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(1538..5719) product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(5737..6504) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 6549..7100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727622.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 7097..7939 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026878.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(7936..8775) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967176.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(8775..8996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(9075..9497) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403137.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(9481..9726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(9777..10718) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 10802..11338 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727620.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 11341..11949 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727619.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 11959..12867 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112079.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(12864..13193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110193.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(13685..14077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(14105..14728) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892743.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 14798..15787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 15849..17195 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727618.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 17196..18095 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892740.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 18252..19133 product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892739.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 gene pcaA CDS 19221..20120 product hydroxymycolate synthase MmaA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900195.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 gene mmaA4 CDS complement(20191..21825) product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 21981..22682 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727617.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 22693..23922 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089001.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 24013..24237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(24801..25508) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892735.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene rplA CDS complement(25578..26006) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892734.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 gene rplK CDS complement(26040..26861) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727616.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 gene nusG CDS complement(26888..27310) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727615.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 gene secE tRNA complement(27388..27461) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(27614..28141) product (3R)-hydroxyacyl-ACP dehydratase subunit HadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892731.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 gene hadC CDS complement(28145..28573) product (3R)-hydroxyacyl-ACP dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903106.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene hadB CDS complement(28560..29039) product (3R)-hydroxyacyl-ACP dehydratase subunit HadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727614.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene hadA CDS complement(29089..29256) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898538.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 gene rpmG tRNA complement(29290..29364) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(29400..29473) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 29562..30422 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727501.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 30436..31146 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 31254..31928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 32064..33068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 33262..33960 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727608.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 33970..34560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 34711..35460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 35537..37054 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706871.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS 37103..37855 product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 CDS 37873..38841 product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891444.1 transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(38845..39972) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972026.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(40115..41305) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726879.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 41398..42129 product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519618.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 42225..42842 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 42914..43177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420563.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 43209..46448 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877040.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 gene recC CDS 46448..49732 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727605.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 gene recB CDS 49729..51420 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727604.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene recD CDS complement(51427..51861) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082353.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 51918..52364 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416053.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 52357..54162 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727566.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS 54587..56248 product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896832.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 56297..57103 product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228306.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(57105..57860) product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(57886..58593) product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227393.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(58596..59759) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727502.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 60168..61271 product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(61279..62448) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 62600..64204 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 64201..65271 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229618.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(65273..67066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(67152..67505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 67559..68560 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 68624..69652 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898002.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 69776..71122 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(71308..72246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(72255..72821) product TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131022173.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 72974..73360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(73248..74060) product DUF1206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728971.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 74193..74807 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532259.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(74804..76342) product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(76508..77659) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089721.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS 77771..79348 product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 79398..80171 product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727375.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 80223..81833 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS 82058..82744 product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950912.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(82751..83161) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(83158..83415) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(83460..84185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 84414..84689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 84686..86707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624058.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 86704..87027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS 87372..87854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 87865..88359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 88362..88784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 89102..89593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 89590..89916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS 89909..90172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(90271..91044) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896717.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(91041..92504) product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896718.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(92708..93049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24730 CDS 93374..93664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409871.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(93843..94166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS complement(94376..95029) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727552.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 95138..96568 product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727554.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 96568..97305 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727551.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(97576..98451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS complement(98482..99054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS 99238..99498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(99585..99806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 100014..101285 product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727550.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(101982..102329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(102326..104761) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073950391.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS complement(104766..105116) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277350.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS 105167..106237 product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727557.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 106608..108800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 108880..109104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS complement(109109..110452) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(110613..111440) product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730414.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(111495..112943) product glycine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730415.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(112970..114139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104479.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 114215..115153 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730417.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene coaA CDS complement(115239..115649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(115741..116154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730420.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(116224..117579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730421.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(117595..118392) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163757333.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 118446..119180 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730422.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(119188..119559) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730423.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(119570..121594) product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405750.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(121581..121838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896661.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS complement(121835..122689) product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896662.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 gene mca CDS 122844..123263 product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896663.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS 123410..123994 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908869.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene greA CDS 124033..124695 product GPP34 family phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730425.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS complement(124687..125844) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(125916..126455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS complement(126574..127320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 note possible pseudo, internal stop codon, frameshifted CDS 127266..127613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS complement(127691..128032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(128208..129620) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(129665..130501) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104481.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(130739..131155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 131072..131890 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730433.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS 131923..133140 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066508.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(133177..134046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405722.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(134205..135053) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896676.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 135200..136246 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730435.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 136243..137019 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730436.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 137029..138729 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730437.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(138726..139043) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(139106..139633) product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405649.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 139905..140351 product lipoprotein LpqV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730439.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene lpqV CDS 140367..141317 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519616.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(141319..142152) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 142253..143296 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730444.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 143293..144039 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084048.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(144036..145085) product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730445.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 145240..146379 product response regulator transcription factor EmbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406553.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene embR CDS 146430..148175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS 148296..148637 product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406629.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS 148702..149892 product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS 149922..150215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS complement(150273..150548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(150722..152095) product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896702.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 152182..153084 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 CDS 153081..154622 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730457.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS 154619..155305 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730458.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(155337..156395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730461.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(156837..157298) product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731059.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(157331..157678) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731058.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(157907..158413) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112830.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(158446..159729) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene clcA CDS 159916..161130 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112974.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(161194..161805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 161888..163021 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111935.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(163022..163444) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 163586..163960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730475.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 164400..164864 product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729400.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 gene ectA CDS 164882..166171 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729399.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene ectB CDS 166204..166596 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895350.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 166683..167507 product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895349.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene thpD CDS complement(167571..168449) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 168611..169441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(169502..171001) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402133.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(171055..171738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(171847..173499) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228746.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(173590..173808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 174039..176447 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235190878.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS complement(176461..177108) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730848.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(177101..178354) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104541.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(178932..179129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS 179424..180047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 sequence0488 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0489 source 1..535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0490 source 1..401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0491 source 1..441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0492 source 1..309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 sequence0493 source 1..844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(593..778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 sequence0494 source 1..698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0495 source 1..440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0496 source 1..386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0497 source 1..478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0498 source 1..835 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0499 source 1..697 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0500 source 1..573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0501 source 1..935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0502 source 1..809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..605 product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730545.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 sequence0503 source 1..728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0504 source 1..576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0505 source 1..487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0506 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0507 source 1..724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730383.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 sequence0508 source 1..524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0509 source 1..430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0510 source 1..330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0511 source 1..355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0512 source 1..506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0513 source 1..552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0514 source 1..502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 sequence0515 source 1..838 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 372..677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 note possible pseudo, frameshifted sequence0516 source 1..16181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 259..873 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727382.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(912..1922) product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729799.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(1898..2092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 2139..3500 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727347.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS 3693..4970 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911099.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS 4972..5493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401230.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 5474..5797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS 5794..6276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(6298..6927) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(6929..7594) product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727343.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 CDS complement(7591..8247) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727342.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 8357..9046 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727341.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 9036..10061 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727340.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 10234..10626 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078828.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 10697..11083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS complement(11147..12274) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892418.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(12288..13100) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(13101..14132) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727339.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(14129..14905) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727338.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(14909..15133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727337.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 15205..16080 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727336.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 sequence0517 source 1..455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0518 source 1..311 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0519 source 1..364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0520 source 1..453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0521 source 1..704 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0522 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0523 source 1..552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0524 source 1..346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0525 source 1..379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0526 source 1..379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0527 source 1..312 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0528 source 1..523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0529 source 1..921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..801 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005085246.1:bifunctional RNase H/acid phosphatase locus_tag LOCUS_25930 sequence0530 source 1..819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 sequence0531 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0532 source 1..555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0533 source 1..356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0534 source 1..754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 sequence0535 source 1..802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(182..514) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877443.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 sequence0536 source 1..583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0537 source 1..299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0538 source 1..979 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0539 source 1..350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0540 source 1..792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0541 source 1..418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0542 source 1..444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0543 source 1..357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 sequence0544 source 1..498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0545 source 1..585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 30..455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 sequence0546 source 1..526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0547 source 1..443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 sequence0548 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0549 source 1..323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0550 source 1..417 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0551 source 1..532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0552 source 1..694 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0553 source 1..547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0554 source 1..441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0555 source 1..816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(226..>816) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728476.1:cobyrinate a,c-diamide synthase locus_tag LOCUS_26000 sequence0556 source 1..443 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0557 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 sequence0558 source 1..501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0559 source 1..525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0560 source 1..345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0561 source 1..546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0562 source 1..384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0563 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0564 source 1..729 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0565 source 1..455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0566 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0567 source 1..572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0568 source 1..341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0569 source 1..692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 sequence0570 source 1..525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 sequence0571 source 1..314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0572 source 1..872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0573 source 1..317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0574 source 1..713 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0575 source 1..339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0576 source 1..707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0577 source 1..573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0578 source 1..439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0579 source 1..582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0580 source 1..525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0581 source 1..396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0582 source 1..632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0583 source 1..314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0584 source 1..477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0585 source 1..784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0586 source 1..352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0587 source 1..686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 sequence0588 source 1..582 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0589 source 1..1036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0590 source 1..908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 353..598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 sequence0591 source 1..630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0592 source 1..598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0593 source 1..751 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 59..400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 sequence0594 source 1..437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0595 source 1..785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0596 source 1..524 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0597 source 1..555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0598 source 1..476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0599 source 1..320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0600 source 1..687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0601 source 1..750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(69..290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 sequence0602 source 1..437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0603 source 1..304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0604 source 1..562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0605 source 1..656 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 166..369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 note possible pseudo, frameshifted sequence0606 source 1..634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0607 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(307..519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 sequence0608 source 1..806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(96..>806) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727694.1:zf-HC2 domain-containing protein locus_tag LOCUS_26100 sequence0609 source 1..790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0610 source 1..423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0611 source 1..416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0612 source 1..718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0613 source 1..520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0614 source 1..447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0615 source 1..566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0616 source 1..448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0617 source 1..346160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 983..1759 product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896743.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 1776..2456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(2435..3208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 3207..4037 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877271.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS complement(4050..4850) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731440.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 5002..5283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS complement(5288..6007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731398.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS complement(6004..6936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731399.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(6933..7898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898031.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(7889..8362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898032.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(8352..9224) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898033.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(9229..10230) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898034.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(10294..10635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS complement(10690..11400) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729344.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS 11353..11616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 11710..12135 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224742.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(12137..12736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(12736..14205) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 14241..15014 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726855.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(15041..16363) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893847.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(16523..18103) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912272.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(18218..19372) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091317270.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 19611..20465 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS 20462..20917 product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082956.1 transl_table 11 codon_start 1 locus_tag LOCUS_26340 gene cynS CDS complement(20914..22152) product NADPH-dependent stearoyl-CoA 9-desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416919.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 gene desA3 CDS complement(22170..23300) product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727980.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(23411..23899) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907789.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 24130..24621 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728059.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 24816..25040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(25056..26321) product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730485.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 26476..27033 product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723124.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 27030..27644 product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256691.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 gene tenA CDS complement(27654..28883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 28995..29999 product (R)-hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082714.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(30007..30693) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730731.1 transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 30847..32067 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135359221.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 32179..32484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 32962..33666 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730734.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 33653..34243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 34134..35393 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877706.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 35429..36382 product DUF5996 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929027.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(36576..37523) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225335.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS complement(37644..38024) product DUF4267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726623.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(38021..38497) product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726625.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 38597..39172 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726626.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 39231..39716 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(39713..40870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899909.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(40974..42137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(42148..42723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 42813..43703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 43771..44475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(44491..45084) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030868049.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(45095..46363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 46530..47153 product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 47188..48774 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 48851..49525 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS complement(49558..49899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(50042..50428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(50447..50866) product molecular chaperone Hsp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908539.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 gene hsp18 CDS 50975..51319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS complement(51326..51646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS complement(51643..52794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(52886..53761) product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102119.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(53776..54621) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(54903..55985) product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731559.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 56350..57537 product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892417.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(57584..57790) product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731507.1 transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(57826..59226) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726815.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS complement(59262..60125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 60331..61062 product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 61285..62538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(62551..64017) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS complement(64185..64811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 65101..65529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 65649..66203 product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404018.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(66312..67277) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031713.1 transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 67458..68450 product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119496.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 68988..70367 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411663.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 70468..71391 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 71372..72271 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900831.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(72445..75525) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878795.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(76017..76475) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898318.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 gene rplI CDS complement(76492..76755) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898319.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 gene rpsR CDS complement(76794..77330) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898320.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(77410..77709) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 gene rpsF CDS complement(77822..78550) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 78636..80549 product RpoH suppressor SuhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976126.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene suhR CDS complement(80522..82147) product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731615.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(82195..84669) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731616.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(84728..85144) product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296823.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS 85266..86129 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907183.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 86248..86793 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898328.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 86838..87914 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 88009..88908 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS 89031..91103 product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 91123..91914 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878800.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 91974..92651 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899786.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 92724..94469 product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731623.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 94469..95209 product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 95268..95714 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898335.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(95719..97086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898336.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 97113..97808 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731625.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(97756..98268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(98755..101604) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731626.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 gene leuS CDS 101789..102754 product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900793.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 102837..103181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731628.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS complement(103190..103795) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898342.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 103933..105219 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898343.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 105229..106005 product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400427.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(106006..106494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898345.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(106500..107960) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 108237..108815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 note possible pseudo, frameshifted CDS 108908..111256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878804.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS 111430..115095 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene murJ CDS complement(115079..115261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 115202..115762 product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400144.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 gene sigM CDS 115790..116398 product anti-sigma-M factor RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400148.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene rsmA CDS 116489..117463 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 gene trxB CDS 117475..117816 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731639.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 gene trxA CDS 118005..119201 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898354.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(119215..120003) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731640.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS complement(120185..121147) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400175.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS complement(121201..122190) product chromosome partitioning ATPase ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731642.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 gene parA CDS complement(122187..122867) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036454143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene rsmG CDS complement(122938..123483) product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898359.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(123585..124697) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731644.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 gene yidC CDS complement(124690..125031) product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899766.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 gene yidD CDS complement(125028..125363) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731646.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 gene rnpA CDS complement(125417..125560) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898363.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 gene rpmH CDS 126128..127624 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898364.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 gene dnaA CDS 128182..129381 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726602.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene dnaN CDS 129410..130303 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891330.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene gnd CDS 130304..131485 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726603.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene recF CDS 131482..132030 product DNA replication protein DciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726604.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 132250..134277 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891333.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene gyrB CDS 134312..137314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 137356..138378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 tRNA 138456..138530 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 138672..138745 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(138778..139209) product cell wall synthesis protein CwsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400307.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene cwsA CDS 139299..139844 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891350.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(139848..140264) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726616.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(140420..140683) product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891352.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 gene crgA CDS 140802..141515 product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891353.1 transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 141587..142261 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891354.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(142239..144113) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400356.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene pknB CDS complement(144110..145459) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726617.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(145456..146931) product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891359.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene pbpA CDS complement(146928..148340) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726618.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(148337..149920) product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726619.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(149917..150384) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726620.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(150539..151975) product DUF3662 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876644.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 tRNA 152235..152318 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(152334..152921) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728111.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS 153075..155327 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS 155340..156038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 155929..156330 product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS 156442..157416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729051.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS 157523..159331 product serine/threonine protein kinase PknJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410735.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene pknJ CDS complement(159335..160186) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894901.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(160215..160511) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 160547..161602 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021942.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(161599..162582) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(162934..163362) product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188679977.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(163489..163899) product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891959.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(163896..164393) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727022.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS 164511..166040 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091631.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(166084..166377) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726633.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS 166736..167455 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726634.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(167463..168938) product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726635.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS 169415..170038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS 170025..170345 product ESX-1 secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891383.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS 170342..171202 product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891384.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS 171215..171646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726637.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS 171639..173360 product type VII secretion system ESX-1 AAA family ATPase EccA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891386.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene eccA1 CDS 173363..174844 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726638.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 gene eccB CDS 174841..177072 product type VII secretion protein EccCa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891388.1 transl_table 11 codon_start 1 locus_tag LOCUS_27840 gene eccCa CDS 177069..178829 product type VII secretion protein EccCb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726639.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 gene eccCb CDS 178975..179289 product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891390.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 179325..180596 product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036463052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 180676..180987 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891393.1 transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 181018..181314 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891394.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS 181404..182786 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726641.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS 182783..184306 product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726642.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 gene eccD CDS 184325..184633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(184635..185564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(185561..186076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 186094..186381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(186378..188600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(188604..189737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077741794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(189734..190504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 190926..192704 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897929.1 transl_table 11 codon_start 1 locus_tag LOCUS_27990 gene treS CDS 192701..194044 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731333.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 194097..194477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 194752..195480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 195500..196798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 196893..198884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(198890..199831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 199960..200376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896741.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(200377..202536) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene glgX CDS 202613..203419 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112858.1 transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(203412..203963) product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731327.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS complement(203973..205265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731325.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS complement(205262..205678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731324.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(205675..205854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(205851..207698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731322.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(207804..208982) product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731403.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(209043..210437) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977622.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(210559..210858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895135.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS 211079..211609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731319.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS 211617..211925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(212038..212247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(212301..212783) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093354.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS 212885..213274 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731312.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(213278..213409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS 213633..214868 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731311.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS 214862..215578 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 215581..216648 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731309.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS 216786..217952 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(217949..218644) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731308.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS 218698..219267 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897891.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(219264..219905) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731307.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 219998..221371 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731306.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 221381..222739 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731306.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 222763..223209 product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114565.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(223219..223728) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897888.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 gene msrA CDS complement(223725..224186) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729815.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 gene msrB CDS 224237..224635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 224676..225194 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897886.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS 225191..226213 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731304.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 226251..229028 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234708047.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 229096..229818 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727829.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS 229847..230464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS complement(230461..231399) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296290.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 231486..232304 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(232311..232523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(232642..233298) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS 233373..234503 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS 234631..236376 product serine/threonine protein kinase PknJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410735.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 gene pknJ CDS 236425..236895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 236862..238106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(238114..238848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 239019..240392 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878659.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS complement(240418..240987) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899475.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 CDS 240949..241323 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400949.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 241384..242247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104236.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 242326..242883 product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897878.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(242925..243539) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532373.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS complement(243542..244432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(244574..245623) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728257.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(245700..246668) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731296.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS 246579..248654 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 249070..253665 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878656.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 gene gltB CDS 253658..255124 product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897870.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(255523..256332) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078606.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(256446..257942) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082592.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 CDS 258098..258775 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095681.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 258806..259378 product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028034.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 CDS complement(259391..261034) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878652.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS complement(261031..261408) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897863.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS 261524..262528 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731286.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 262895..265330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS complement(265343..265633) product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897856.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(265690..266919) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731284.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene dinB CDS complement(266940..267584) product HTH-type transcriptional regulator EthR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399797.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene ethR CDS 267664..269139 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897853.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS complement(269144..269626) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene rraA CDS complement(269623..270378) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975420.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(270427..270888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(270980..271924) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878646.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(271900..272442) product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897849.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(272458..273111) product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897846.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 273139..274242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 274310..274801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878644.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 274798..275970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104341.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS complement(276008..276406) product secretion protein EspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897840.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(276786..277493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(277733..278266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897837.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(278367..278651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 278737..279159 product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene sodN CDS complement(279240..279401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS 279794..280135 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897834.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 CDS 280341..281183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS 281190..282014 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897832.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(282101..283027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(283344..284111) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731271.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(284140..284937) product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897828.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 285049..285933 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897827.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 gene pheA CDS 285930..286616 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897826.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(286849..287202) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878637.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS complement(287207..288616) product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731269.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 288732..289991 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897822.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 gene serS CDS complement(289996..290628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(290638..291711) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(291731..292594) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 292679..293800 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(293797..294132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897820.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(294129..295703) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731268.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS 295814..296599 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731267.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 296604..297356 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897817.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 297353..298177 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897816.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(298179..299807) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731266.1 transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(299946..300851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897814.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS 301058..302305 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420798.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 gene glf CDS 302302..304263 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731265.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 304256..304777 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897811.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 304777..305739 product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897810.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 305777..307813 product flagellar motor control protein ZomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496045.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene zomB CDS 307896..308879 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897808.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 309009..310094 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731262.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 310270..311124 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731260.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 311297..311698 product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731259.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 311753..312763 product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731258.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 312938..314827 product long-chain-fatty-acid--AMP ligase FadD32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731257.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene fadD32 CDS 314845..320238 product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878634.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 gene pks13 CDS 320243..321793 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897801.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS 321810..322820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS 322849..324285 product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729255.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(324292..325983) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410095.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS complement(326036..326947) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894822.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(326944..330186) product arabinosyltransferase EmbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950939.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene embB CDS complement(330150..333425) product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731254.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS complement(333514..336732) product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731253.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(336744..338600) product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878631.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 CDS complement(338603..339385) product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731251.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(339386..340786) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112896.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(340834..341247) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897783.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(341257..342675) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731240.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 342803..343195 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731239.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS 343208..343966 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027843.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(343963..344313) product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109033875.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 misc_feature complement(344310..>346160) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003912345.1:HNH endonuclease signature motif containing protein locus_tag LOCUS_29390 sequence0618 source 1..655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0619 source 1..527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0620 source 1..905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(284..>905) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259351.1:sensor domain-containing diguanylate cyclase locus_tag LOCUS_29400 sequence0621 source 1..385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0622 source 1..847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0623 source 1..386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0624 source 1..359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0625 source 1..446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0626 source 1..566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0627 source 1..499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0628 source 1..426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0629 source 1..527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(192..344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 sequence0630 source 1..628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0631 source 1..388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0632 source 1..522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0633 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0634 source 1..363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0635 source 1..324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0636 source 1..691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0637 source 1..401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0638 source 1..359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0639 source 1..547 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 76..387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 note possible pseudo, frameshifted sequence0640 source 1..866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0641 source 1..712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0642 source 1..715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..684 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897870.1:glutamate synthase subunit beta locus_tag LOCUS_29430 sequence0643 source 1..445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0644 source 1..709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0645 source 1..449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0646 source 1..790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0647 source 1..526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0648 source 1..402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0649 source 1..956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0650 source 1..517 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0651 source 1..863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0652 source 1..358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0653 source 1..691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0654 source 1..354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0655 source 1..708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0656 source 1..501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0657 source 1..228856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..790) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726687.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS 952..2586 product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726688.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene fadD5 CDS 2799..3599 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726689.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 3601..4470 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891465.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 4474..5691 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726690.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS 5688..6719 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726691.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 6716..8287 product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726692.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 8300..9946 product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726693.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS 9946..11106 product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891470.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS 11110..12675 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726695.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 12645..13268 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891472.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 13265..14248 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726696.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 14245..14796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726697.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 14763..15620 product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726698.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS 15639..16331 product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891476.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS 16324..16908 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037896947.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS 16985..17263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS 17303..18133 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 18707..18907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 note possible pseudo, frameshifted CDS complement(18904..19983) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899845.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS 20155..20604 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 20601..20888 product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230904.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(20885..22189) product gluconolaconase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726747.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(22167..22928) product pirin-like bicupin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089568.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 22997..23461 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878772.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS complement(23436..24560) product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891558.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 24736..25140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 note possible pseudo, frameshifted CDS 25118..25627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 note possible pseudo, frameshifted CDS complement(25698..26702) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726750.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 26754..27593 product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726751.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 27590..28582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104120.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 28598..29350 product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 29441..29842 product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 29844..30527 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726755.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(30520..31137) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408754.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS 31263..32603 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899017.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS 32603..33382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408760.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS 33523..33936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 34004..34372 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942959.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(34397..36133) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene ilvD CDS 36212..36829 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225371.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 36822..37121 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726761.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 37271..38302 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(38355..40358) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726765.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS 40433..41014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726766.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 41011..41700 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726767.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(41697..42092) product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891579.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(42099..42467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(42485..43006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(43003..45897) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726771.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 CDS 46251..46823 product hemophore inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726772.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 46994..47392 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891584.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 47405..48121 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891585.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 48212..49471 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726775.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS complement(49427..49804) product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891587.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(49791..51062) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726776.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(51081..52142) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726777.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 52220..53368 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891590.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 53448..54350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730680.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(54362..57679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(57724..58407) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104288.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(58404..59159) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104289.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 gene trmB CDS 59507..60343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS 60340..61800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726782.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 62011..63840 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726783.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 63951..65471 product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 gene fadD4 CDS 65468..66352 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726786.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(66404..67132) product GntR family transcriptional regulator, LSA1692 subfamily inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(67132..68256) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902894.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 68301..69302 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726789.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 69343..70431 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726790.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 70425..71726 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726791.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS complement(71723..72637) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726805.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS complement(72648..73352) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726811.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(73709..75910) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 76065..77288 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876726.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 77313..78728 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726815.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(78718..79986) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726828.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(80028..80831) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726830.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS 80948..82189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 82245..83018 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899864.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS 83063..83887 product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876731.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(83865..84878) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728648.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(84875..86032) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728649.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 86073..87047 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726832.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 87053..87574 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726833.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS complement(87571..88191) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS complement(88565..90049) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891663.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(90055..90846) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401240.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 90906..92042 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726835.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS complement(92039..93811) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726840.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS complement(93823..95019) product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891671.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 95087..96373 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070945485.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(96339..97805) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891673.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(97805..98776) product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900835.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(98787..103028) product alpha-(1->3)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726878.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(103006..103179) product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891682.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS 103203..103340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 103352..104524 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726879.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 104584..105207 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876752.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(105226..106041) product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510610.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS complement(106056..107411) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726889.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 107450..108757 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726890.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(108943..110064) product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027886.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 110095..111036 product TIGR03564 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205660833.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS complement(111261..113096) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726920.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS 113335..114417 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726921.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 114429..114923 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726929.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS complement(114937..115098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726930.1 transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(115162..115914) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS complement(115914..117860) product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726932.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(117893..118732) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891739.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS complement(118774..119070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891740.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 119180..119938 product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079937.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 120046..120249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 120337..120837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(120890..121333) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876771.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS 121502..124048 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726939.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 gene nirB CDS 124045..124389 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401341.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene nirD CDS complement(124399..125160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(125208..125891) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891750.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(125888..127033) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891751.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(127213..127812) product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene aac(2')-Ic CDS complement(127840..128739) product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891754.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(128751..129434) product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104243.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(129509..130213) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070188143.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(130226..131089) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726944.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(131184..131477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(131477..132280) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208394.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS complement(132277..132879) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487124.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(132892..133491) product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726966.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene lysE CDS 133618..134952 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978280.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS 135288..135614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS 135654..136412 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 136409..137650 product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727698.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS complement(137654..138442) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 gene hypB CDS complement(138472..138807) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 139063..139320 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(139362..141425) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944033.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene tkt CDS 141620..141760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(141772..142782) product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 143007..144395 product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085371.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS 144418..144843 product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532057.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS 144848..145849 product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532058.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene cbbX CDS 145875..146780 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS complement(146785..147846) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728263.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 148066..148614 product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 148749..149672 product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893633.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 149729..151336 product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728265.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(151279..151671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 151552..152175 product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893635.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 152172..152423 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877348.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 CDS 152469..153743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728267.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 CDS 153753..154667 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728268.1 transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 154664..155857 product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 155854..158256 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 gene hypF CDS 158243..158956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894092.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 158953..159627 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894091.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 159627..160739 product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728538.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene hypE CDS 160756..161028 product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene hypC CDS 161045..162184 product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene hypD CDS 162232..162945 product DUF6390 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894094.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 162942..163784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104265.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 163936..164295 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728125.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 164286..164840 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893431.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS 164876..165502 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728124.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 165499..166797 product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728123.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene nuoD CDS 166826..167572 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene nuoE CDS 167572..168906 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893427.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene nuoF CDS 168903..171287 product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728121.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 171284..172600 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728120.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene nuoH CDS 172593..173135 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086544.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene nuoI CDS 173132..173941 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 173938..174237 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893422.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene nuoK CDS 174239..176155 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893421.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 gene nuoL CDS 176152..177750 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728119.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 177747..179282 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728118.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene nuoN CDS complement(179298..180182) product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(180196..181269) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095990.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 181429..181842 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893433.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 181953..182654 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene rpe CDS 182665..183357 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(183323..184381) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227824.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(184436..185032) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081670.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 185474..186787 product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928604.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 186830..187702 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727029.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(187775..188227) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(188258..189931) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895658.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(190098..191123) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 191093..191998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086484.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(191981..193396) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891985.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS complement(193406..193840) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115912.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(193893..194687) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(194754..194984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 194901..195665 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727008.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(195649..196023) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899113.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(196128..196538) product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876808.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(196661..197908) product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876812.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 197964..199664 product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876813.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 gene fadD2 CDS 199694..200473 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727057.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(200470..200781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104250.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(200821..201099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743357.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS complement(201157..203349) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727059.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS complement(203362..204372) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519563.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(204348..205433) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876815.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS complement(205490..206125) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727062.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 206247..206822 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401399.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(206819..207436) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899886.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 207518..208414 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104249.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 208669..210399 product type VII secretion system ESX-3 AAA family ATPase EccA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876817.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene eccA3 CDS 210396..211970 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892036.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene eccB CDS 211967..215944 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727068.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 215944..216264 product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727069.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 216267..217811 product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727070.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 217862..218155 product type VII secretion system protein EsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727071.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene esxG CDS 218192..218482 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS 218489..219370 product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727072.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 219394..220788 product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727073.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 gene eccD CDS 220788..222179 product type VII secretion system ESX-3 serine protease mycosin MycP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727074.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene mycP3 CDS 222176..223120 product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892045.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene eccE CDS complement(223076..224272) product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727075.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS 224308..225069 product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727078.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(225072..225815) product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093093.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(225944..227317) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093094.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 sequence0658 source 1..712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0659 source 1..624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(102..>624) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729873.1:decaprenyl diphosphate synthase locus_tag LOCUS_31680 sequence0660 source 1..786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0661 source 1..728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0662 source 1..878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0663 source 1..400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0664 source 1..1401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0665 source 1..480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0666 source 1..385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0667 source 1..649 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 219..524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 sequence0668 source 1..748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..661) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401666.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 sequence0669 source 1..725 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0670 source 1..400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0671 source 1..390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0672 source 1..578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0673 source 1..942 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0674 source 1..344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0675 source 1..508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0676 source 1..1275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(496..>1275) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005066067.1:MlaD family protein locus_tag LOCUS_31710 sequence0677 source 1..429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0678 source 1..423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0679 source 1..551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0680 source 1..439 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0681 source 1..644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0682 source 1..337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0683 source 1..657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0684 source 1..399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0685 source 1..897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0686 source 1..506 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0687 source 1..477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0688 source 1..849 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0689 source 1..415048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1866..2312) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(2351..2794) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730752.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 2826..3269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS 3294..3647 product UBP-type zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730753.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 CDS 3666..3842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS complement(3843..4895) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(4960..6522) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899716.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(6572..7165) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899717.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 7236..7730 product DUF2834 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420879.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 7759..8220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS 8217..9002 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899260.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 9005..10009 product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(10006..10851) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226335.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(10835..11746) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226336.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(11743..13101) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 tRNA complement(13243..13317) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA complement(13362..13438) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA complement(13481..13554) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 13676..13751 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(13803..15779) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922110.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(15919..16773) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730776.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS 17001..17585 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897189.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(17589..18008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048400.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(18096..18533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048400.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 18720..19733 product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897193.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 19787..20884 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104395.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 gene dusB CDS 21091..23214 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049744866.1 transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 23317..23982 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene phoU CDS complement(24050..24826) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730783.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 gene pstB CDS complement(24834..25736) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112722.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 gene pstA CDS complement(25733..26671) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112723.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene pstC CDS complement(26792..27922) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112724.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 gene pstS CDS 28147..28824 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112715.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 28838..29506 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087078053.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(29587..30372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(30806..31924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32030 note possible pseudo, internal stop codon, frameshifted CDS complement(31921..32202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(32357..32833) product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 32929..33288 product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727473.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 33306..33929 product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120749.1 transl_table 11 codon_start 1 locus_tag LOCUS_32070 gene sigZ CDS complement(33933..34394) product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727472.1 transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 34535..35833 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS complement(35830..36735) product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404307.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 gene mshD CDS complement(36732..37505) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897204.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 37666..38481 product mannan chain length control protein LmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 gene lmeA CDS 38540..38932 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730788.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 39151..39618 product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085648.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 40086..40433 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 note possible pseudo, frameshifted CDS 40435..40737 product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878457.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 40911..41540 product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898596.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 41540..41800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730794.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(41797..42093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS complement(42057..42638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(42930..43847) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404139.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 43880..44953 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730797.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS 45116..45292 product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404135.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(45296..46366) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897216.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 gene purM CDS 46475..46909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 46944..47912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS complement(47935..49467) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730800.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 gene purF CDS complement(49686..50048) product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730817.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 50095..51300 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726690.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 51341..51763 product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730819.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS complement(51768..52553) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(52582..53079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(53089..53727) product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404117.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(53727..55451) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730823.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(55448..57757) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730824.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene purL CDS complement(57794..58141) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730827.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 58267..58617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS complement(58727..59983) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 60036..61058 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 61058..61855 product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897233.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS complement(61856..62584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726651.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(62584..63930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(63934..64242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727232.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS complement(64276..64950) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113206.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 gene purQ CDS complement(64947..65174) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403993.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 gene purS CDS complement(65235..65897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 note possible pseudo, internal stop codon, frameshifted CDS 65942..66595 product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897237.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 66622..67233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(67230..68873) product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730832.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS complement(68897..69601) product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730833.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 CDS complement(69676..70167) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730834.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(70178..70744) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730835.1 transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(70782..72917) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730837.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(72914..73807) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897243.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 73778..74458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730838.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 74483..75418 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730839.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(75342..76268) product tellurite resistance/C4-dicarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730841.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS complement(76265..77491) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730842.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS complement(77497..78915) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878470.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 gene purB CDS 78956..79810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(79807..81234) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897250.1 transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS complement(81254..82219) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027013.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(82261..82890) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878471.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 83014..83835 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730845.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(83837..85105) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878472.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 gene purD CDS 85188..86411 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878473.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 86432..87100 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730848.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS complement(87039..88265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730849.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS complement(88255..88698) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897257.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(88704..89555) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730850.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(89552..90313) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897259.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(90324..91793) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897260.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 91936..92544 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897261.1 transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 92541..93770 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730851.1 transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 93782..94609 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730852.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 94606..95958 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897264.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 95967..96176 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897265.1 transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 96179..96718 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897266.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 96810..97940 product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897267.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 97946..98389 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730853.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 98451..99245 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897269.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(99321..100697) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 100844..101260 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897271.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(101264..102697) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878477.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS complement(102709..103368) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730856.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 103526..104356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730857.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(104359..104688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 tRNA 104739..104813 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 104862..105266 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878479.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(105263..105952) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098590.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS 106129..106566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 106880..107224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 107485..109215 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893092.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 109285..109704 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727828.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 109723..110673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462273.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(110562..111446) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173543.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS 111540..112214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 112211..113473 product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230416.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 113591..114298 product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093934.1 transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS complement(114295..114924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 115091..116233 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228973.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 116227..117201 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS complement(117185..117967) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730861.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 CDS complement(118000..119028) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 119169..120053 product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969667.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 120050..121729 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338607.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(121697..123007) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729275.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(123010..123879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS complement(123896..124552) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060503.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 124667..125887 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104541.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 125908..127029 product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727161.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 127107..127961 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730867.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(127974..128810) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(128856..129779) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104400.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 130024..130383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730871.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 CDS 130452..130808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730871.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 130909..131280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730871.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 131333..131497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897289.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS 131498..132958 product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(132945..133421) product Mce associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418958.1 transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(133421..134116) product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418960.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(134116..135936) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730875.1 transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS complement(135936..137132) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878485.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS complement(137129..138556) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730877.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(138553..139599) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730878.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(139592..140620) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730879.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(140620..141810) product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897298.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS complement(141826..142668) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418983.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(142668..143429) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730881.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(143696..144616) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730882.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(144629..144820) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897302.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 144982..146163 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897303.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS 146177..147274 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730884.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS 147271..148791 product long-chain-fatty-acid--CoA ligase FadD17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901655.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 gene fadD17 CDS 148839..149483 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727949.1 transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS 149771..150487 product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730547.1 transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(150647..151768) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(151799..153451) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 153522..154328 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897311.1 transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(154380..155594) product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 gene cyp142 CDS complement(155598..156311) product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730893.1 transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS complement(156390..157421) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730894.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 157504..158484 product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730895.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 158495..159553 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878491.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS 159555..160736 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897320.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS 160733..161620 product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 CDS 161624..162040 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062283.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS 162106..162693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897321.1 transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(162690..163670) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726700.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(163687..164217) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS 164348..165514 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897322.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 165586..166014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730897.1 transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 166023..166673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(166677..167819) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878493.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(167819..168604) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897328.1 transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(168606..169733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730900.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS 169870..170745 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730901.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(170767..171180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(171278..173212) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897332.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(173359..174414) product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897334.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 gene dmpG CDS complement(174411..175337) product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878495.1 transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS complement(175351..176136) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897336.1 transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 176135..177892 product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730906.1 transl_table 11 codon_start 1 locus_tag LOCUS_33620 gene kstD CDS 177892..178752 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730907.1 transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(178749..180011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(180011..180991) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(180998..181717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS complement(181819..182010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(182007..184250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(184257..185435) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937386.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(185435..186205) product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 gene rfbF CDS complement(186202..187248) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613588.1 transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(187236..188339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS complement(188336..189178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(189848..191014) product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(191014..191460) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730956.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(191442..192404) product bifunctional MaoC family dehydratase N-terminal/OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730957.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS complement(192401..193564) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419296.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(193549..194562) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730959.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS complement(194587..195840) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730960.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS 195971..197146 product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419307.1 transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS 197146..197535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730962.1 transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS 197545..198003 product deazaflavin-dependent nitroreductase Ddn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419309.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene ddn CDS complement(198039..200039) product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892409.1 transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(200096..201118) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727331.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(201192..202097) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730964.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(202131..202904) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 202969..203724 product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897402.1 transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS 203721..204596 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730966.1 transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 204596..205339 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730967.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 205339..206400 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730968.1 transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 206452..207105 product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730969.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 207102..207839 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730970.1 transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 207913..209010 product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110593.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(209007..210155) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419328.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(210155..210760) product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 gene kstR2 CDS complement(210757..211545) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730972.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(211542..212690) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897413.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 212738..214276 product 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl)propanoate--CoA ligase FadD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900098.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 gene fadD3 CDS 214286..215410 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730973.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 215415..216380 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730974.1 transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS 216377..217318 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730975.1 transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 217329..218069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 CDS 218066..219220 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419356.1 transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(219217..220365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS 221243..222877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS 222877..223653 product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 transl_table 11 codon_start 1 locus_tag LOCUS_34060 gene istB CDS complement(223792..225192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(225484..225666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 227453..227866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS 228141..228662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296240.1 transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 229916..231076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(232252..232488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(232720..238572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(238753..239307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(239307..239708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(239791..241065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(241227..241544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(241549..242670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 243064..243537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS 244079..244291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(244943..245365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 note possible pseudo, internal stop codon, frameshifted CDS complement(245601..245894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(246223..247242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(247865..248011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(248352..248600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS complement(248619..249467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS complement(249558..250778) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 252262..253287 product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729681.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 gene ripC CDS complement(253299..254093) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014152.1 transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 254570..254758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 254955..255614 product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730262.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(255758..256933) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091654.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(256933..257715) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111761.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS 257793..258035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 257965..259545 product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene mmcO CDS complement(259659..261071) product NlpC/P60 family peptidoglycan endopeptidase RipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728845.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 gene ripA CDS complement(261564..261929) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727828.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS 262217..262714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS 262780..263337 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230549.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS 263337..263762 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225370.1 transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 263765..264664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34410 CDS 265351..265524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34420 CDS 265761..266516 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729134.1 transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 266899..267249 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 267246..268187 product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112734.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 269349..269774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS 269889..270998 product S-sulfocysteine synthase CysK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935595.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 gene cysK2 CDS 270995..272053 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404402.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 note possible pseudo, internal stop codon CDS 272063..272263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34490 CDS 272691..272990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727440.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 273814..274116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 274442..274822 product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112732.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(275123..276568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 276571..277212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS 277487..278206 product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063881.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS 278597..279163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS 279567..280280 product DUF1775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821402.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS 280611..280832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS 280829..282199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084962.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(283480..284271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS 284430..284642 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775998.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 284639..285610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225367.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 285651..287933 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS 287960..288238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 288309..288638 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 288868..290838 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS complement(291012..291851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS complement(292104..294680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS complement(294677..295639) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(295750..296292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 CDS complement(296420..296905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 297423..297605 product antitoxin VbhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419627.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 297934..298248 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34730 note possible pseudo, frameshifted CDS complement(298442..299071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS 299220..299555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34750 CDS 299552..299863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 300370..300999 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080706.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 301010..302080 product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640655.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(302073..302468) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 CDS 302607..303521 product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729726.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS complement(303475..304302) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729725.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS complement(304302..304808) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729724.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(304801..305454) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 305552..306514 product Rv2231c family pyridoxal phosphate-dependent protein CobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411503.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 gene cobC CDS 306511..307683 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729722.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS 307673..308410 product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 308407..309495 product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729720.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 309556..310041 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729049.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS complement(310038..310640) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519605.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS 310661..311617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 note possible pseudo, frameshifted CDS 311604..312239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 note possible pseudo, frameshifted CDS complement(312289..312993) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411499.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS complement(312993..313505) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285387.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(313584..314102) product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530080.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(314103..314540) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(314551..315006) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 315812..316189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS 316383..317054 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235666617.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS 317051..317257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS complement(317268..318737) product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911786.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 318823..319602 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS complement(319599..320435) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729713.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 gene panB CDS 320548..321984 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS 322012..323544 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104378.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 323532..323981 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970772.1 transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 324082..325422 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729709.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 gene glnA CDS 325600..328431 product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729708.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS 328444..329079 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729168.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS 329076..329933 product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(329942..330388) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225379.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS complement(330390..331631) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230890.1 transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(331650..331997) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230891.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(332134..332670) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895688.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(332766..334202) product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 gene glnA CDS 334369..334851 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS complement(334941..335693) product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895683.1 transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(335698..336699) product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729704.1 transl_table 11 codon_start 1 locus_tag LOCUS_35170 gene lipA CDS complement(336696..337364) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 gene lipB CDS complement(337406..338314) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729703.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(338339..340165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS 340302..340667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729701.1 transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 340780..342456 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411445.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(342555..344081) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877992.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(344100..345185) product adenylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411442.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS 345315..346328 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729697.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 gene gcvT CDS 346351..347457 product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729696.1 transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(347509..347847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS complement(347955..348686) product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729695.1 transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS complement(348683..349735) product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729694.1 transl_table 11 codon_start 1 locus_tag LOCUS_35290 gene cobT CDS complement(349732..350298) product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163803955.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 gene cobU CDS complement(350295..350984) product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729692.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS 351113..351475 product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895666.1 transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(351477..352151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104376.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 352298..353281 product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(353299..355242) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729689.1 transl_table 11 codon_start 1 locus_tag LOCUS_35350 gene asnB CDS 355348..356382 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895662.1 transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS 356398..356817 product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895661.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS 357024..357851 product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411405.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 357851..358552 product DUF2561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899213.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(358560..360245) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899212.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(360272..361480) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104375.1 transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(361477..362313) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729686.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(362361..362903) product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729685.1 transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS complement(363418..363966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS complement(363973..365919) product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712239.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 365988..366218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104374.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 366442..367524 product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729681.1 transl_table 11 codon_start 1 locus_tag LOCUS_35470 gene ripC CDS 367668..368393 product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729680.1 transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 368414..369541 product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877983.1 transl_table 11 codon_start 1 locus_tag LOCUS_35490 gene pimB CDS complement(369538..371346) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729678.1 transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS 371434..371823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729677.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 CDS 371892..372332 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729676.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 372355..373614 product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729675.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 373611..374012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729674.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 374119..374844 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411341.1 transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(374841..376091) product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877982.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS 376218..377090 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729672.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS 377087..377584 product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729671.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS 377618..379006 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895637.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS complement(379007..380188) product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877981.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 380225..380629 product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729669.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(380618..382150) product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729668.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS complement(382153..383241) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729667.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 CDS complement(383336..383923) product DUF3153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877979.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(384075..384755) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895631.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 384914..385324 product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411231.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 385629..386060 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729664.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 gene mraZ CDS 386206..387210 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729663.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 gene rsmH CDS 387207..388256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 388253..390181 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729661.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 390247..391767 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729660.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 391764..393263 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729659.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 393260..394339 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895621.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 gene mraY CDS 394332..395759 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729658.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene murD CDS 395765..397318 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746059.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene ftsW CDS 397315..398427 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729656.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 gene murG CDS 398424..399869 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411159.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 gene murC CDS 399866..400798 product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729654.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS 400930..402108 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895613.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 gene ftsZ CDS 402131..402838 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729652.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 gene pgeF CDS 402835..403656 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877975.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 403653..404306 product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895610.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 CDS 404466..404756 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895609.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 405019..405834 product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729650.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 gene wag31 CDS 405881..406189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(406217..406888) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729648.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS 406972..408318 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462762.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(408297..409022) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729647.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS complement(409031..410269) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898432.1 transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 410330..411877 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS 411874..413415 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104297.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(413515..414855) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730979.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 sequence0690 source 1..508 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0691 source 1..364 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0692 source 1..567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 73..531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 note possible pseudo, frameshifted sequence0693 source 1..461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0694 source 1..739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3..626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 sequence0695 source 1..399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0696 source 1..606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0697 source 1..553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0698 source 1..853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0699 source 1..361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0700 source 1..509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0701 source 1..900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0702 source 1..875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0703 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0704 source 1..578 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0705 source 1..800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0706 source 1..643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 sequence0707 source 1..545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0708 source 1..514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0709 source 1..424 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0710 source 1..558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0711 source 1..348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0712 source 1..1256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0713 source 1..669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0714 source 1..521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0715 source 1..469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0716 source 1..383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0717 source 1..542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0718 source 1..796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0719 source 1..367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0720 source 1..425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0721 source 1..560 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0722 source 1..470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0723 source 1..546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0724 source 1..412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0725 source 1..521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0726 source 1..347 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0727 source 1..637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0728 source 1..1033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0729 source 1..482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0730 source 1..402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0731 source 1..1168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(454..>1168) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729371.1:ABC transporter substrate-binding protein locus_tag LOCUS_35960 sequence0732 source 1..360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0733 source 1..490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0734 source 1..579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0735 source 1..425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0736 source 1..744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0737 source 1..403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(114..314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35970 note possible pseudo, internal stop codon sequence0738 source 1..504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0739 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0740 source 1..522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(48..452) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224026.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 sequence0741 source 1..933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0742 source 1..334 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0743 source 1..509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0744 source 1..513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0745 source 1..342 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0746 source 1..814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0747 source 1..367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0748 source 1..1532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(252..>1532) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727977.1:wax ester/triacylglycerol synthase family O-acyltransferase locus_tag LOCUS_35990 sequence0749 source 1..586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0750 source 1..748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0751 source 1..469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0752 source 1..410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0753 source 1..430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0754 source 1..548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0755 source 1..648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0756 source 1..465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0757 source 1..714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0758 source 1..380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0759 source 1..28178 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1997..3136) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 3020..3232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 3253..3714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS 3801..4382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728163.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 4379..4906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728164.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(4968..5141) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226939.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS complement(5262..6422) product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029167.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(6419..7219) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091316930.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(7329..7610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(7741..8022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(8032..9225) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS complement(9259..11478) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731362.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(11482..12348) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411868.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS 12548..13171 product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878540.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene kstR CDS 13290..14024 product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730633.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS complement(14039..14629) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404314.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene phoU CDS 14537..14788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 14791..15468 product PAS and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088224.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 15535..15888 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227684.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 CDS 15890..20038 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227688.1 transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 20038..20343 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227689.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(20414..20680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 20954..23809 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729110.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(23819..24757) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418777.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 24695..24955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36240 CDS 25024..25944 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS 26039..27817 product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268668.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 sequence0760 source 1..484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0761 source 1..563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36270 sequence0762 source 1..580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0763 source 1..664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0764 source 1..1049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(85..>1049) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727994.1:LuxR family transcriptional regulator locus_tag LOCUS_36280 sequence0765 source 1..393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0766 source 1..545 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0767 source 1..537 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0768 source 1..485 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0769 source 1..782 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 190..615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36290 sequence0770 source 1..447 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0771 source 1..586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0772 source 1..427 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0773 source 1..459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0774 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0775 source 1..396 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0776 source 1..952 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0777 source 1..543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 73..414 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896750.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 sequence0778 source 1..512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0779 source 1..372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0780 source 1..500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0781 source 1..667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0782 source 1..395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0783 source 1..469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 36..344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 sequence0784 source 1..375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0785 source 1..486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0786 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0787 source 1..381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0788 source 1..464 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0789 source 1..429 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0790 source 1..333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0791 source 1..432 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0792 source 1..528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0793 source 1..669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0794 source 1..395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0795 source 1..514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0796 source 1..753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0797 source 1..397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0798 source 1..585 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0799 source 1..492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0800 source 1..382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0801 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0802 source 1..540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0803 source 1..914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0804 source 1..651 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(69..>651) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878169.1:bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase locus_tag LOCUS_36320 sequence0805 source 1..489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0806 source 1..376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0807 source 1..718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0808 source 1..1101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 48..386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 misc_feature complement(388..>1101) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899537.1:amidohydrolase family protein locus_tag LOCUS_36340 sequence0809 source 1..35883 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 40..1056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(1053..4319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(5286..8555) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726759.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 8555..9673 product fatty-acid-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404414.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 gene far CDS 9732..10166 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404418.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS 10222..10941 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730747.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS 10995..12548 product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730746.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS 12545..13261 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730745.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 CDS complement(13243..14151) product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897147.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 gene puuE CDS complement(14148..15110) product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730744.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 gene alc CDS complement(15107..16357) product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730743.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(16338..17516) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730742.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 CDS 17577..18683 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113293.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS 18812..20023 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730738.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 20032..22176 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730737.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS 22263..24092 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS 24147..25628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(25625..26050) product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897128.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(26086..26346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 26490..27893 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 CDS 27905..28894 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(28898..29509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(29567..29851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS 29813..30157 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878426.1 transl_table 11 codon_start 1 locus_tag LOCUS_36580 CDS complement(30154..31812) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897120.1 transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS complement(31841..34090) product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730725.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 CDS 34118..34351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911329.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 34351..34857 product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730724.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 gene moaC CDS 34845..35333 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878425.1 transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS 35330..35755 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730722.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 sequence0810 source 1..680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0811 source 1..483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0812 source 1..319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0813 source 1..366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0814 source 1..920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0815 source 1..383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0816 source 1..859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..704 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727880.1:ATP-dependent helicase locus_tag LOCUS_36650 sequence0817 source 1..493 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0818 source 1..718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0819 source 1..536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0820 source 1..483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..376 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410631.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene rpmB sequence0821 source 1..372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0822 source 1..550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0823 source 1..742 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0824 source 1..593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0825 source 1..1064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(381..917) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731182.1 transl_table 11 codon_start 1 locus_tag LOCUS_36670 sequence0826 source 1..386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0827 source 1..366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0828 source 1..436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0829 source 1..107856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(338..679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(902..2113) product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(2150..2548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 2644..3027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(3058..4032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 4140..4946 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(4963..5685) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730422.1 transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(5828..6883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(6892..7863) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728156.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(7865..8665) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225418.1 transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 8739..9737 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896854.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 9739..10569 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896853.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(10606..11310) product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730547.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 11481..13052 product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115316754.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 CDS complement(13061..13369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896699.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 13471..14121 product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730545.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS 14127..14834 product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730544.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 CDS complement(14831..15457) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896847.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(15470..15904) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878334.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 gene soxR CDS 15939..17165 product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730543.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene arcA CDS complement(17248..18789) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730541.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS 18814..19650 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730540.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 gene rsmI CDS 19663..20121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS complement(20172..21431) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905428.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(21451..22347) product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730538.1 transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(22344..23525) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227969.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(23657..24583) product RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112241.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 gene sigJ CDS complement(24580..25785) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896840.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(25849..27384) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730537.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 gene metG CDS 27404..28264 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180038.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 28399..29475 product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896836.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS 29688..30407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS complement(30417..31199) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730534.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 31283..32239 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS 32526..34160 product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896832.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 34281..35258 product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029976.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 35255..36103 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227726.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS complement(36100..37149) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098538.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS complement(37361..37924) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893908.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 38111..39274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896388.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 CDS 39338..40369 product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730531.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 40417..41148 product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727721.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(41151..41729) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 gene pth CDS complement(41736..42422) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405254.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS complement(42554..43432) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730529.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 CDS complement(43463..44101) product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730528.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS complement(44116..44460) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896825.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 gene arsC CDS complement(44460..45440) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896824.1 transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(45515..46984) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730527.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene glmU CDS 47082..48008 product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37170 tRNA complement(48081..48153) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 48204..48863 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 48906..52541 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730525.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 gene mfd CDS 52784..53236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 53421..54491 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730524.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 54652..55314 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730519.1 transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 55388..56677 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896814.1 transl_table 11 codon_start 1 locus_tag LOCUS_37230 gene eno CDS 56825..57364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 note possible pseudo, internal stop codon CDS 57357..57851 product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907636.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 57848..58786 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896811.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(58902..60764) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015482.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(60843..61124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS complement(61211..61693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(62312..63100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 note possible pseudo, frameshifted CDS complement(63097..64737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 note possible pseudo, frameshifted CDS 64907..65458 product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408271.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 65458..66342 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112261.1 transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS complement(66354..67352) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408279.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS complement(67346..68167) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898971.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(68186..69313) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408274.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(69317..70102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408272.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(70358..71728) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006789594.1 transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(71863..72159) product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230558.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(72565..73254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(73251..73826) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS 73903..74517 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086652.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(74952..75611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 75703..76428 product HTH-type transcriptional regulator Cmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408268.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 gene cmr CDS complement(76445..76852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408263.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(76849..77196) product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408261.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 77478..77792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895135.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 77930..78178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS complement(78195..78734) product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893937.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS complement(79010..80935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225580837.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 81246..81977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(82114..82536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(82533..84668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(84665..86542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(86539..87966) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731434.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(88038..88328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(88400..89563) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920958.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 89685..90686 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528920.1 transl_table 11 codon_start 1 locus_tag LOCUS_37580 gene gnd CDS 90692..92083 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898735.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 92084..92887 product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS complement(92895..93509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS 93546..94016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(94018..95931) product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896800.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS 95930..96796 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899827.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS 96825..97295 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896798.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS 97320..97796 product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730327.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(97797..98486) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730508.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(98483..100969) product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915886.1 transl_table 11 codon_start 1 locus_tag LOCUS_37680 gene kdpD CDS complement(101023..101898) product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(101900..104044) product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 transl_table 11 codon_start 1 locus_tag LOCUS_37700 gene kdpB CDS complement(104046..105716) product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 transl_table 11 codon_start 1 locus_tag LOCUS_37710 gene kdpA CDS 105651..105824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(106087..106785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(106897..107070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37740 tRNA complement(107566..107643) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence0830 source 1..536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37750 sequence0831 source 1..335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0832 source 1..430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0833 source 1..662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0834 source 1..372 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0835 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0836 source 1..481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0837 source 1..371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0838 source 1..105294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892052.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 802..1446 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727080.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(1400..2890) product bifunctional phosphatase PAP2/diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727081.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS 2948..3535 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742088.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 3535..4362 product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226469.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 4372..5016 product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876820.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS complement(5020..5487) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727083.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS 5584..7326 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727085.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(7330..8451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727488.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(8551..10533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 note possible pseudo, internal stop codon, frameshifted CDS complement(10962..12230) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(12265..13038) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931063.1 transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(13035..14624) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088755.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS complement(14655..15440) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036341485.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 15555..16256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401636.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(16281..17054) product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS 17159..19195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(19211..19615) product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228393.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS complement(19636..19968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS 20185..20850 product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900263.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(20861..21316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS complement(21286..22368) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 22498..23493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(23506..23760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 tRNA complement(23906..23979) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 24050..24622 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898399.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene dcd CDS 24737..26053 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831524.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS 26311..27882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 CDS 27972..29321 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876837.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS complement(29299..29952) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091305224.1 transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS 30005..31330 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876838.1 transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS 31332..32081 product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892101.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS 32101..32448 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892102.1 transl_table 11 codon_start 1 locus_tag LOCUS_38070 CDS 32448..33311 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 transl_table 11 codon_start 1 locus_tag LOCUS_38080 gene rfbA CDS complement(33265..34530) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727121.1 transl_table 11 codon_start 1 locus_tag LOCUS_38090 CDS complement(34556..35821) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892107.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS complement(35869..38877) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510614.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 CDS complement(39093..41630) product isoniazid response ATPase/transcriptional regulator IniR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727123.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene iniR CDS complement(41634..43445) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727124.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 CDS 43677..44222 product IniB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876842.1 transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 44480..45400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 45502..47343 product isoniazid-induced dynamin-like GTPase IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876844.1 transl_table 11 codon_start 1 locus_tag LOCUS_38160 gene iniA CDS 47366..48859 product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892122.1 transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(48856..49329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(49349..49786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38190 CDS complement(49826..50770) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727131.1 transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(50795..51103) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(51114..51389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38220 CDS complement(51343..51963) product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727132.1 transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS complement(52025..52387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 CDS complement(52581..52856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 53035..53529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 53526..54227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38270 CDS complement(54173..55627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(55593..56480) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38290 note possible pseudo, frameshifted CDS complement(56438..58075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 note possible pseudo, frameshifted CDS 58216..60081 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892134.1 transl_table 11 codon_start 1 locus_tag LOCUS_38310 gene dnaK CDS 60078..60692 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892135.1 transl_table 11 codon_start 1 locus_tag LOCUS_38320 gene grpE CDS 60716..61897 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892137.1 transl_table 11 codon_start 1 locus_tag LOCUS_38330 gene dnaJ CDS 61897..62262 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892138.1 transl_table 11 codon_start 1 locus_tag LOCUS_38340 CDS complement(62259..63161) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727141.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 CDS complement(63277..64443) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876850.1 transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(64424..65437) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727143.1 transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS 65591..66169 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975488.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS complement(66173..66829) product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727149.1 transl_table 11 codon_start 1 locus_tag LOCUS_38390 CDS 67004..70126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(70123..71094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(71105..73822) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088902.1 transl_table 11 codon_start 1 locus_tag LOCUS_38420 CDS complement(73819..74637) product FAD binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088901.1 transl_table 11 codon_start 1 locus_tag LOCUS_38430 CDS 74856..77402 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727152.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 gene clpB CDS 77421..78752 product alpha/beta hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742093.1 transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 78802..79632 product trehalose monomycolate transport factor TtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892156.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene ttfA CDS 79658..80434 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727156.1 transl_table 11 codon_start 1 locus_tag LOCUS_38470 CDS 80445..81344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727157.1 transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(81787..83448) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977257.1 transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(83445..84092) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325826.1 transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS 84091..85191 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727158.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 85257..87035 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484240.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 CDS complement(87040..87732) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727167.1 transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS 87852..88892 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892176.1 transl_table 11 codon_start 1 locus_tag LOCUS_38540 gene fbaA CDS complement(88889..89677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892177.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 CDS 89761..90186 product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892178.1 transl_table 11 codon_start 1 locus_tag LOCUS_38560 CDS complement(90193..91086) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727169.1 transl_table 11 codon_start 1 locus_tag LOCUS_38570 CDS complement(91132..91920) product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727171.1 transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(91930..92475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727172.1 transl_table 11 codon_start 1 locus_tag LOCUS_38590 CDS 92603..93898 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727173.1 transl_table 11 codon_start 1 locus_tag LOCUS_38600 CDS 93895..94530 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727174.1 transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 94549..95205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(95202..95393) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892186.1 transl_table 11 codon_start 1 locus_tag LOCUS_38630 CDS complement(95390..96619) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS complement(96629..97444) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113846.1 transl_table 11 codon_start 1 locus_tag LOCUS_38650 CDS complement(97383..99428) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876865.1 transl_table 11 codon_start 1 locus_tag LOCUS_38660 CDS 99492..99971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 100017..101285 product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892190.1 transl_table 11 codon_start 1 locus_tag LOCUS_38680 gene purT CDS 101288..101749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892191.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 101769..102182 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 CDS 102179..103393 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727178.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 CDS 103402..103815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892194.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 CDS complement(103812..104675) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 sequence0839 source 1..465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0840 source 1..589 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0841 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0842 source 1..869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0843 source 1..661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0844 source 1..629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0845 source 1..481 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0846 source 1..598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0847 source 1..845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0848 source 1..644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0849 source 1..368 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0850 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0851 source 1..586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 231..422 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896221.1 transl_table 11 codon_start 1 locus_tag LOCUS_38740 sequence0852 source 1..892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0853 source 1..350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0854 source 1..397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0855 source 1..352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0856 source 1..392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0857 source 1..634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0858 source 1..8395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(96..893) product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 982..2697 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139618.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 CDS 2694..3188 product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730716.1 transl_table 11 codon_start 1 locus_tag LOCUS_38770 CDS complement(3173..4177) product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878423.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(4214..4624) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897108.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 4770..5186 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897109.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 5183..6232 product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730719.1 transl_table 11 codon_start 1 locus_tag LOCUS_38810 gene moaA CDS 6235..6519 product molybdopterin synthase subunit MoaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404559.1 transl_table 11 codon_start 1 locus_tag LOCUS_38820 gene moaD2 CDS 6964..8289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 sequence0859 source 1..686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0860 source 1..739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0861 source 1..588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0862 source 1..889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0863 source 1..379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0864 source 1..530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0865 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0866 source 1..504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0867 source 1..83498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(362..3406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38850 CDS complement(3399..3806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(3799..4821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38870 CDS complement(4818..5096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38880 CDS complement(5093..5551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS complement(5548..6756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 CDS complement(6722..7498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 CDS complement(7593..11639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38920 CDS 11757..11960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 CDS 12219..13478 product type VII secretion system ESX-4 subunit EccB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418333.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene eccB4 CDS complement(13443..14801) product type VII secretion system ESX-4 serine protease mycosin MycP4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418331.1 transl_table 11 codon_start 1 locus_tag LOCUS_38950 gene mycP4 CDS complement(14798..16099) product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624000.1 transl_table 11 codon_start 1 locus_tag LOCUS_38960 gene eccD CDS 16215..19880 product type VII secretion protein EccC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727726.1 transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS 19877..21040 product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418324.1 transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS 21117..21440 product type VII secretion system ESX-4 protein EsxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900060.1 transl_table 11 codon_start 1 locus_tag LOCUS_38990 gene esxU CDS 21451..21747 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892927.1 transl_table 11 codon_start 1 locus_tag LOCUS_39000 CDS complement(21872..22066) product excalibur calcium-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895789.1 transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS 22421..22864 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892944.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene rplM CDS 22861..23364 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892945.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene rpsI CDS complement(23422..24171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 CDS 24545..24913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 25005..26423 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892947.1 transl_table 11 codon_start 1 locus_tag LOCUS_39060 gene glmM CDS 26468..26773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 CDS 26775..28118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 CDS complement(28121..29575) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912345.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 CDS complement(29640..30944) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727728.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 CDS complement(31093..32133) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877116.1 transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS complement(32177..33064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892955.1 transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 33079..34947 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892956.1 transl_table 11 codon_start 1 locus_tag LOCUS_39130 gene glmS CDS 34947..35837 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727741.1 transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 35995..36234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 note possible pseudo, frameshifted CDS 36424..36594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 note possible pseudo, frameshifted CDS 37008..38408 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 38423..39805 product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727746.1 transl_table 11 codon_start 1 locus_tag LOCUS_39180 CDS 39940..41091 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023637501.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 gene alr CDS 41088..42179 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250368.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 42172..42639 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727749.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene tsaE CDS 42636..43232 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727750.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 gene tsaB CDS 43229..43705 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727751.1 transl_table 11 codon_start 1 locus_tag LOCUS_39230 gene rimI CDS 43702..44727 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727752.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 gene tsaD CDS 44724..45167 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892969.1 transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 45188..46186 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089703.1 transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 46234..46671 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 CDS 46773..48398 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727753.1 transl_table 11 codon_start 1 locus_tag LOCUS_39280 gene groL CDS 48453..49976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS 50233..50574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 51127..51486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104557.1 transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS 51526..51828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 51858..52778 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730772.1 transl_table 11 codon_start 1 locus_tag LOCUS_39330 CDS 52882..53802 product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077222.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 CDS complement(53834..55915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 CDS complement(56010..56300) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893002.1 transl_table 11 codon_start 1 locus_tag LOCUS_39360 CDS 56653..57528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727764.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS 57800..58198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39380 CDS 58191..59429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39390 CDS complement(59445..59849) product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 CDS 59990..61531 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727766.1 transl_table 11 codon_start 1 locus_tag LOCUS_39410 gene guaB CDS 61559..62704 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727767.1 transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS 62766..64511 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS 64549..65232 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727768.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 gene phoU CDS complement(65238..67592) product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893013.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS complement(67589..68329) product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 transl_table 11 codon_start 1 locus_tag LOCUS_39460 CDS 68540..70075 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893015.1 transl_table 11 codon_start 1 locus_tag LOCUS_39470 gene guaA CDS complement(70076..70999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(70996..72492) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095417.1 transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS complement(72495..73415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094778.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 CDS complement(73425..74267) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095420.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 CDS complement(74264..75253) product acetyl hydrolase/esterase MbtJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412284.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 gene mbtJ CDS 75675..76115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 CDS 76165..77763 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727778.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(77778..78812) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727779.1 transl_table 11 codon_start 1 locus_tag LOCUS_39550 CDS complement(78838..80868) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727780.1 transl_table 11 codon_start 1 locus_tag LOCUS_39560 CDS 80988..81857 product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 transl_table 11 codon_start 1 locus_tag LOCUS_39570 gene htdY CDS 81970..82857 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 transl_table 11 codon_start 1 locus_tag LOCUS_39580 sequence0868 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2..415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39590 sequence0869 source 1..386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0870 source 1..379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 21..350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39600 sequence0871 source 1..741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..580 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728400.1:amidase locus_tag LOCUS_39610 sequence0872 source 1..370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0873 source 1..393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0874 source 1..411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0875 source 1..16662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(101..556) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS complement(584..823) product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897101.1 transl_table 11 codon_start 1 locus_tag LOCUS_39630 CDS 905..1315 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897100.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 1351..2166 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730712.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 CDS 2163..2435 product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730711.1 transl_table 11 codon_start 1 locus_tag LOCUS_39660 CDS complement(2499..3314) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730710.1 transl_table 11 codon_start 1 locus_tag LOCUS_39670 gene sepH CDS complement(3400..4512) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897096.1 transl_table 11 codon_start 1 locus_tag LOCUS_39680 gene serC CDS 4693..5148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39690 CDS complement(5155..5919) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897095.1 transl_table 11 codon_start 1 locus_tag LOCUS_39700 gene map CDS 6053..7081 product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897094.1 transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 7089..7583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39720 note possible pseudo, frameshifted CDS 7550..8767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39730 note possible pseudo, frameshifted CDS complement(8773..9225) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730707.1 transl_table 11 codon_start 1 locus_tag LOCUS_39740 CDS 9310..10887 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408080.1 transl_table 11 codon_start 1 locus_tag LOCUS_39750 CDS complement(10889..11707) product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074730.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS complement(11820..12431) product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730704.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 CDS complement(12428..13555) product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898633.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 13673..14332 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730702.1 transl_table 11 codon_start 1 locus_tag LOCUS_39790 gene pdxH CDS 14467..15117 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730700.1 transl_table 11 codon_start 1 locus_tag LOCUS_39800 CDS 15223..16518 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897085.1 transl_table 11 codon_start 1 locus_tag LOCUS_39810 sequence0876 source 1..473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0877 source 1..586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0878 source 1..391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0879 source 1..650 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0880 source 1..528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0881 source 1..397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0882 source 1..769 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0883 source 1..623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0884 source 1..405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0885 source 1..489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0886 source 1..655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0887 source 1..1085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..616 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225865.1:alpha/beta fold hydrolase locus_tag LOCUS_39820 sequence0888 source 1..361168 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 182..1700 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 assembly_gap 1716..1783 estimated_length known gap_type within scaffold linkage_evidence paired-ends rRNA 2008..5138 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 5258..5330 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 61 percent of the 5S ribosomal RNA locus_tag LOCUS_r00030 CDS complement(5470..6030) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730198.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 CDS complement(6030..7514) product DNA-3-methyladenine glycosylase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878186.1 transl_table 11 codon_start 1 locus_tag LOCUS_39840 CDS 7662..8165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731393.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 CDS complement(8174..9988) product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894908.1 transl_table 11 codon_start 1 locus_tag LOCUS_39860 CDS complement(10059..11663) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406864.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS 11710..12381 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886111.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 gene nucS CDS complement(12705..13175) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730193.1 transl_table 11 codon_start 1 locus_tag LOCUS_39890 gene mce CDS 13310..14440 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878184.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 14469..14867 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730191.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 CDS 14911..15768 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730190.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 CDS complement(15790..18000) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730189.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene glgB CDS complement(18005..20092) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896313.1 transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS 20254..22866 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730188.1 transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 22863..23708 product virginiamycin B lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496018.1 transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 23818..24573 product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005076063.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 CDS complement(24570..25982) product zinc metallopeptidase LpqM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730186.1 transl_table 11 codon_start 1 locus_tag LOCUS_39980 gene lpqM CDS 25873..26124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(26084..27775) product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730185.1 transl_table 11 codon_start 1 locus_tag LOCUS_40000 CDS 27695..28078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS complement(28066..29373) product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730184.1 transl_table 11 codon_start 1 locus_tag LOCUS_40020 CDS 29507..29809 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896307.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 gene clpS CDS 29817..30398 product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730183.1 transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 30401..31420 product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730182.1 transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 31467..31880 product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896304.1 transl_table 11 codon_start 1 locus_tag LOCUS_40060 CDS 31905..32186 product sulfur carrier protein CysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406910.1 transl_table 11 codon_start 1 locus_tag LOCUS_40070 gene cysO CDS 32187..33158 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896302.1 transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS 33149..33838 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730180.1 transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS 33835..34668 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730179.1 transl_table 11 codon_start 1 locus_tag LOCUS_40100 gene murI CDS 34733..35500 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730178.1 transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS 35560..36342 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730177.1 transl_table 11 codon_start 1 locus_tag LOCUS_40120 gene rph CDS complement(36406..36651) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058264.1 transl_table 11 codon_start 1 locus_tag LOCUS_40130 CDS 36799..37401 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730176.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 gene rdgB CDS 37542..38900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40150 CDS complement(38858..39478) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388643.1 transl_table 11 codon_start 1 locus_tag LOCUS_40160 CDS 39532..40413 product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 transl_table 11 codon_start 1 locus_tag LOCUS_40170 CDS complement(40417..40749) product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730175.1 transl_table 11 codon_start 1 locus_tag LOCUS_40180 CDS complement(40746..41078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898833.1 transl_table 11 codon_start 1 locus_tag LOCUS_40190 CDS complement(41098..41868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40200 tRNA 41956..42040 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(42049..43485) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618874.1 transl_table 11 codon_start 1 locus_tag LOCUS_40210 CDS complement(43493..43987) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731118.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS complement(44014..44325) product transcriptional regulator WhiB6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899734.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 gene whiB6 CDS 44434..45072 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093224.1 transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS complement(45085..45768) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731349.1 transl_table 11 codon_start 1 locus_tag LOCUS_40250 CDS 45658..45888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS 45943..47205 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731350.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(47202..48500) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730163.1 transl_table 11 codon_start 1 locus_tag LOCUS_40280 CDS complement(48561..49877) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS complement(49874..50674) product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027775.1 transl_table 11 codon_start 1 locus_tag LOCUS_40300 CDS complement(50704..52179) product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064937.1 transl_table 11 codon_start 1 locus_tag LOCUS_40310 CDS complement(52193..52495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS complement(52509..54023) product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 CDS complement(54020..54853) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730161.1 transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 55056..56645 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730160.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS 56645..57073 product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896278.1 transl_table 11 codon_start 1 locus_tag LOCUS_40360 CDS 57070..58026 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 CDS 58023..59081 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730158.1 transl_table 11 codon_start 1 locus_tag LOCUS_40380 CDS complement(59069..59377) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104195.1 transl_table 11 codon_start 1 locus_tag LOCUS_40390 CDS 59486..60886 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104196.1 transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS 60871..61683 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730155.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 61670..62770 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730154.1 transl_table 11 codon_start 1 locus_tag LOCUS_40420 CDS 62772..63539 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878171.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 CDS complement(63625..64458) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878170.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 CDS 64451..65326 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730150.1 transl_table 11 codon_start 1 locus_tag LOCUS_40450 gene meaB CDS complement(65323..65787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 CDS complement(65784..66368) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726758.1 transl_table 11 codon_start 1 locus_tag LOCUS_40470 CDS complement(66395..67057) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228236.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 67109..68428 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228237.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 CDS complement(68396..68674) product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS complement(68676..69287) product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731337.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 CDS complement(69284..70090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897943.1 transl_table 11 codon_start 1 locus_tag LOCUS_40520 CDS complement(70087..70881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897942.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS complement(71058..72665) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730149.1 transl_table 11 codon_start 1 locus_tag LOCUS_40540 CDS complement(72689..73417) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730148.1 transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS 73556..74440 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730147.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 74437..76125 product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878169.1 transl_table 11 codon_start 1 locus_tag LOCUS_40570 CDS 76049..76993 product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712479.1 transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 76990..78753 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730144.1 transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 78755..80086 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 transl_table 11 codon_start 1 locus_tag LOCUS_40600 CDS 80090..80902 product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS 80913..81902 product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878166.1 transl_table 11 codon_start 1 locus_tag LOCUS_40620 CDS 81912..82502 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395908.1 transl_table 11 codon_start 1 locus_tag LOCUS_40630 CDS 82538..83407 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730140.1 transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS 83404..84216 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730139.1 transl_table 11 codon_start 1 locus_tag LOCUS_40650 CDS complement(84213..84986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 85052..85726 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896256.1 transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 85723..85917 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730138.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 CDS 85928..87163 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730137.1 transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 87206..88375 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730136.1 transl_table 11 codon_start 1 locus_tag LOCUS_40700 CDS 88372..89622 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730135.1 transl_table 11 codon_start 1 locus_tag LOCUS_40710 CDS 89626..90762 product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730134.1 transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS 90773..91741 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730133.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 CDS 91747..94152 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 CDS 94162..94968 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 CDS complement(94969..95802) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950459.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 CDS complement(95820..96896) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730401.1 transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 96995..97795 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 transl_table 11 codon_start 1 locus_tag LOCUS_40780 CDS 97883..99403 product acyl-CoA ligase FadD12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898876.1 transl_table 11 codon_start 1 locus_tag LOCUS_40790 gene fadD12 CDS complement(99400..100833) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726815.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 CDS complement(100904..101974) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730164.1 transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(101988..102827) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730987.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS complement(102858..104057) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730119.1 transl_table 11 codon_start 1 locus_tag LOCUS_40830 CDS complement(104199..105017) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225695.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 CDS complement(105076..105732) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036453560.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 CDS 105921..107096 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730097.1 transl_table 11 codon_start 1 locus_tag LOCUS_40860 CDS 107104..107886 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS complement(107900..109078) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 CDS complement(109071..110093) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977632.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 CDS complement(110135..110770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 tRNA complement(111143..111226) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(111621..112760) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896242.1 transl_table 11 codon_start 1 locus_tag LOCUS_40910 CDS complement(112757..113203) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896241.1 transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(113187..114416) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730128.1 transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS complement(114419..114748) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896239.1 transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS complement(114741..116078) product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896238.1 transl_table 11 codon_start 1 locus_tag LOCUS_40950 CDS complement(116086..116742) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 transl_table 11 codon_start 1 locus_tag LOCUS_40960 CDS 116891..118228 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 CDS 118213..119391 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878160.1 transl_table 11 codon_start 1 locus_tag LOCUS_40980 CDS 119391..120152 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730124.1 transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 120157..121374 product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730123.1 transl_table 11 codon_start 1 locus_tag LOCUS_41000 CDS 121371..122168 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 CDS 122173..123318 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730122.1 transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 123329..124477 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896231.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 CDS 124600..125208 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730121.1 transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS 125223..125708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730120.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS complement(125751..126746) product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730118.1 transl_table 11 codon_start 1 locus_tag LOCUS_41060 CDS complement(126743..127768) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730117.1 transl_table 11 codon_start 1 locus_tag LOCUS_41070 CDS complement(127765..129066) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS complement(129091..130095) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228993.1 transl_table 11 codon_start 1 locus_tag LOCUS_41090 CDS complement(130092..130643) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730115.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 CDS 130845..131567 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283886.1 transl_table 11 codon_start 1 locus_tag LOCUS_41110 CDS 131580..132029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41120 CDS complement(131981..132949) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730159.1 transl_table 11 codon_start 1 locus_tag LOCUS_41130 CDS complement(132959..133702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(133712..134644) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939109.1 transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS 134689..135867 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730097.1 transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(136142..137320) product spirocyclase AveC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731549.1 transl_table 11 codon_start 1 locus_tag LOCUS_41170 CDS 137419..138021 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731548.1 transl_table 11 codon_start 1 locus_tag LOCUS_41180 CDS complement(138008..138817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730114.1 transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS 138951..140216 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726824.1 transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 140218..140583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139576.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 CDS 140580..141827 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726822.1 transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 141850..142302 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726821.1 transl_table 11 codon_start 1 locus_tag LOCUS_41230 CDS 142355..143380 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876727.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS 143400..144143 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726819.1 transl_table 11 codon_start 1 locus_tag LOCUS_41250 CDS 144162..145433 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726818.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 CDS 145430..145771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726817.1 transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 145790..146635 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726816.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 CDS 146754..148028 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896222.1 transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 148025..148219 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896221.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 CDS 148233..148517 product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896220.1 transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(148635..149600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041179691.1 transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(149655..150857) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730110.1 transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(150854..151054) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730111.1 transl_table 11 codon_start 1 locus_tag LOCUS_41340 CDS complement(151051..152253) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730110.1 transl_table 11 codon_start 1 locus_tag LOCUS_41350 CDS complement(152366..153157) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730109.1 transl_table 11 codon_start 1 locus_tag LOCUS_41360 CDS complement(153154..153972) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730108.1 transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS complement(153972..154862) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730107.1 transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS complement(154859..156502) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730106.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 CDS complement(156499..156810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41400 CDS complement(156803..158104) product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730104.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 CDS 158135..158608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878154.1 transl_table 11 codon_start 1 locus_tag LOCUS_41420 CDS complement(158646..159554) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730102.1 transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(159551..159940) product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730101.1 transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(159942..161084) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878153.1 transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(161110..162204) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878152.1 transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS 162483..163475 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730098.1 transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS 163475..164650 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730097.1 transl_table 11 codon_start 1 locus_tag LOCUS_41480 CDS 164654..165451 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727864.1 transl_table 11 codon_start 1 locus_tag LOCUS_41490 CDS 165480..166775 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730116.1 transl_table 11 codon_start 1 locus_tag LOCUS_41500 CDS 166785..167561 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 CDS 167656..168783 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907550.1 transl_table 11 codon_start 1 locus_tag LOCUS_41520 CDS 168780..169949 product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 transl_table 11 codon_start 1 locus_tag LOCUS_41530 CDS 169952..170716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 170726..171934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730900.1 transl_table 11 codon_start 1 locus_tag LOCUS_41550 CDS complement(171983..172426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS complement(172491..173858) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730096.1 transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS complement(173899..174093) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896201.1 transl_table 11 codon_start 1 locus_tag LOCUS_41580 CDS complement(174106..174966) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896200.1 transl_table 11 codon_start 1 locus_tag LOCUS_41590 CDS complement(174997..175680) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730095.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 CDS 175951..177447 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730094.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 CDS 177500..178708 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730093.1 transl_table 11 codon_start 1 locus_tag LOCUS_41620 CDS 179040..179813 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878149.1 transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS 179817..180674 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878148.1 transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS 180688..181887 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730089.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS 181893..182909 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730088.1 transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS 182906..184009 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085143857.1 transl_table 11 codon_start 1 locus_tag LOCUS_41670 CDS 183993..185489 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730085.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS 185486..186874 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730084.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 CDS 186874..188583 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730083.1 transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS complement(188598..189122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730082.1 transl_table 11 codon_start 1 locus_tag LOCUS_41710 CDS 189202..189609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510592.1 transl_table 11 codon_start 1 locus_tag LOCUS_41720 CDS complement(189606..190886) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730081.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 CDS 191084..191695 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896181.1 transl_table 11 codon_start 1 locus_tag LOCUS_41740 CDS complement(191704..192147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728635.1 transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(192202..193347) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123024664.1 transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(193364..193837) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730079.1 transl_table 11 codon_start 1 locus_tag LOCUS_41770 CDS complement(193837..194343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41780 CDS 194456..194881 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS 194878..195396 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730078.1 transl_table 11 codon_start 1 locus_tag LOCUS_41800 CDS complement(195480..196196) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896177.1 transl_table 11 codon_start 1 locus_tag LOCUS_41810 CDS 196278..197807 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896176.1 transl_table 11 codon_start 1 locus_tag LOCUS_41820 CDS 197910..199100 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896175.1 transl_table 11 codon_start 1 locus_tag LOCUS_41830 CDS 199097..200557 product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083087609.1 transl_table 11 codon_start 1 locus_tag LOCUS_41840 CDS 200702..201538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 CDS 201535..202173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730074.1 transl_table 11 codon_start 1 locus_tag LOCUS_41860 CDS 202205..202882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(202869..203582) product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224063.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 CDS complement(203636..204079) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027616.1 transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(204098..204238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(204211..204696) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730072.1 transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS 204818..205210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 note possible pseudo, frameshifted CDS 205144..206082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 note possible pseudo, frameshifted CDS complement(206083..207378) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104427.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 CDS 207712..208506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS complement(208493..209293) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896166.1 transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(209293..210165) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896165.1 transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(210175..211365) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878137.1 transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(211369..212421) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730066.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 CDS 212614..213348 product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412957.1 transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 213840..223094 product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730064.1 transl_table 11 codon_start 1 locus_tag LOCUS_42010 CDS 223110..223505 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412952.1 transl_table 11 codon_start 1 locus_tag LOCUS_42020 CDS 223559..224905 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878135.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS complement(224882..225355) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730061.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 gene bcp CDS 225469..225693 product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412942.1 transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(225705..225875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42060 CDS 226237..227634 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42070 tRNA complement(227677..227752) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS 227917..229119 product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496011.1 transl_table 11 codon_start 1 locus_tag LOCUS_42080 tRNA complement(229164..229237) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(229269..229916) product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878121.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 gene orn CDS 229943..231538 product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730039.1 transl_table 11 codon_start 1 locus_tag LOCUS_42100 CDS complement(231535..232341) product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730038.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene cmrA CDS 232367..233686 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730037.1 transl_table 11 codon_start 1 locus_tag LOCUS_42120 CDS complement(233683..234477) product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907725.1 transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS 234641..236482 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS 236829..236984 product DUF6131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893185.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 CDS complement(236981..237616) product TetR family transcriptional regulator BkaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730035.1 transl_table 11 codon_start 1 locus_tag LOCUS_42160 gene bkaR CDS 237713..239263 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730034.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 239269..241266 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878115.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS 241263..242423 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896109.1 transl_table 11 codon_start 1 locus_tag LOCUS_42190 CDS 242420..242920 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036448818.1 transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 242920..243738 product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112336.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 CDS 243974..245083 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730030.1 transl_table 11 codon_start 1 locus_tag LOCUS_42220 gene pdhA CDS 245085..246173 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730029.1 transl_table 11 codon_start 1 locus_tag LOCUS_42230 CDS 246170..247354 product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730028.1 transl_table 11 codon_start 1 locus_tag LOCUS_42240 CDS complement(247356..248108) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730027.1 transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(248147..248515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42260 CDS complement(248576..250018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(250127..251092) product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_42280 CDS 251153..252256 product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 CDS complement(252262..253074) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030616714.1 transl_table 11 codon_start 1 locus_tag LOCUS_42300 CDS complement(253208..254605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 tRNA complement(254823..254900) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 255267..256751 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730024.1 transl_table 11 codon_start 1 locus_tag LOCUS_42320 CDS 256748..258418 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730023.1 transl_table 11 codon_start 1 locus_tag LOCUS_42330 CDS 258415..260754 product glycerol-3-phosphate 1-O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730022.1 transl_table 11 codon_start 1 locus_tag LOCUS_42340 CDS 260824..262830 product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878112.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 CDS complement(262837..263235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42360 CDS 263333..264457 product phenazine antibiotic biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082414.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 CDS 264460..265818 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082413.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 CDS 265968..266426 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878111.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 CDS 266532..268205 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896081.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene ettA CDS 268299..273188 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730019.1 transl_table 11 codon_start 1 locus_tag LOCUS_42410 CDS 273185..273598 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896079.1 transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS 273586..274254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412698.1 transl_table 11 codon_start 1 locus_tag LOCUS_42430 CDS complement(274273..275856) product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730017.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 CDS complement(275931..276326) product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878109.1 transl_table 11 codon_start 1 locus_tag LOCUS_42450 CDS complement(276513..276791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 CDS 276697..277134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 277221..277406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 277393..277875 product DUF5130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896073.1 transl_table 11 codon_start 1 locus_tag LOCUS_42490 CDS complement(277872..278222) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730014.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS complement(278305..280890) product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730013.1 transl_table 11 codon_start 1 locus_tag LOCUS_42510 gene pepN CDS complement(280928..281314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42520 CDS 281502..282113 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730011.1 transl_table 11 codon_start 1 locus_tag LOCUS_42530 CDS complement(282148..283752) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742208.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 CDS 283859..284338 product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899332.1 transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS 284342..285136 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730006.1 transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(285156..285911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730005.1 transl_table 11 codon_start 1 locus_tag LOCUS_42570 CDS complement(285986..287116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528200.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 CDS 287237..288505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42590 CDS complement(288561..288929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS complement(290023..290325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS 290273..290608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 CDS 290719..291099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS 291183..292631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 tRNA complement(292975..293048) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 293168..293242 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 293285..294691 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730000.1 transl_table 11 codon_start 1 locus_tag LOCUS_42650 gene tig CDS 294790..295401 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878099.1 transl_table 11 codon_start 1 locus_tag LOCUS_42660 CDS 295398..296045 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896046.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 CDS 296167..296493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 CDS 296402..296704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS 296784..298064 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896045.1 transl_table 11 codon_start 1 locus_tag LOCUS_42700 gene clpX CDS complement(298270..299574) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729999.1 transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 299728..300231 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005060706.1 transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS 300300..301379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 CDS complement(301417..302043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42740 CDS complement(302130..302954) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896043.1 transl_table 11 codon_start 1 locus_tag LOCUS_42750 gene fdhD CDS complement(302954..305317) product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899532.1 transl_table 11 codon_start 1 locus_tag LOCUS_42760 CDS complement(305399..306763) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731372.1 transl_table 11 codon_start 1 locus_tag LOCUS_42770 CDS 307017..309191 product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS complement(309308..309577) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878317.1 transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS complement(309652..310527) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(310533..311120) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 transl_table 11 codon_start 1 locus_tag LOCUS_42810 CDS 311327..312706 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896784.1 transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS 312728..313930 product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 transl_table 11 codon_start 1 locus_tag LOCUS_42830 CDS 313979..314341 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894525.1 transl_table 11 codon_start 1 locus_tag LOCUS_42840 gene trxA CDS 314558..315283 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 transl_table 11 codon_start 1 locus_tag LOCUS_42850 CDS 315347..315760 product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 transl_table 11 codon_start 1 locus_tag LOCUS_42860 CDS 315797..316570 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 transl_table 11 codon_start 1 locus_tag LOCUS_42870 CDS 316591..317937 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027250.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS complement(317951..319336) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893816.1 transl_table 11 codon_start 1 locus_tag LOCUS_42890 CDS complement(319348..320859) product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893815.1 transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(320869..321759) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013437.1 transl_table 11 codon_start 1 locus_tag LOCUS_42910 CDS complement(321761..322771) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729996.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 CDS complement(322789..323694) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729995.1 transl_table 11 codon_start 1 locus_tag LOCUS_42930 CDS complement(323707..325656) product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729994.1 transl_table 11 codon_start 1 locus_tag LOCUS_42940 gene iolD CDS complement(325660..326553) product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729993.1 transl_table 11 codon_start 1 locus_tag LOCUS_42950 gene iolB CDS complement(326556..327449) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896035.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 CDS complement(327442..328413) product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729991.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene iolC CDS 328567..329298 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896033.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 CDS complement(329387..330175) product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896029.1 transl_table 11 codon_start 1 locus_tag LOCUS_42990 CDS 330332..331318 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729990.1 transl_table 11 codon_start 1 locus_tag LOCUS_43000 CDS 331318..332376 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896031.1 transl_table 11 codon_start 1 locus_tag LOCUS_43010 CDS 332380..333000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 note possible pseudo, frameshifted CDS 332958..333146 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 note possible pseudo, frameshifted CDS complement(333421..336591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 CDS complement(336613..337725) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900437.1 transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(337700..338941) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(338945..339841) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409707.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 CDS 340091..341200 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS 341231..343759 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409714.1 transl_table 11 codon_start 1 locus_tag LOCUS_43090 CDS 343806..344861 product epoxide hydrolase EphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899091.1 transl_table 11 codon_start 1 locus_tag LOCUS_43100 gene ephB CDS 344886..345404 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409718.1 transl_table 11 codon_start 1 locus_tag LOCUS_43110 CDS 345422..346489 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899092.1 transl_table 11 codon_start 1 locus_tag LOCUS_43120 CDS 346527..347297 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409775.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 CDS complement(347258..348487) product TetR family transcriptional regulator Mce3R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409919.1 transl_table 11 codon_start 1 locus_tag LOCUS_43140 gene mce3R CDS complement(348612..349004) product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS 349551..350324 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899101.1 transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS 350391..351188 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899102.1 transl_table 11 codon_start 1 locus_tag LOCUS_43170 CDS 351353..352555 product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900443.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 CDS 352607..353266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 note possible pseudo, frameshifted CDS 353263..353631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43200 note possible pseudo, frameshifted CDS 353628..354944 product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904746.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 CDS 355001..356269 product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899106.1 transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS 356266..357423 product Mce family lipoprotein LprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899107.1 transl_table 11 codon_start 1 locus_tag LOCUS_43230 gene lprM CDS 357425..358459 product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911732.1 transl_table 11 codon_start 1 locus_tag LOCUS_43240 CDS 358759..360255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 CDS 360252..361067 product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene istB sequence0889 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0890 source 1..848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..701 product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897410.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 gene kstR2 sequence0891 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 23..265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43280 sequence0892 source 1..491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0893 source 1..601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0894 source 1..775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0895 source 1..600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0896 source 1..383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0897 source 1..640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0898 source 1..378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0899 source 1..595 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0900 source 1..454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0901 source 1..457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43290 sequence0902 source 1..491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0903 source 1..358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0904 source 1..465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0905 source 1..639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0906 source 1..617 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 218..595 product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891587.1 transl_table 11 codon_start 1 locus_tag LOCUS_43300 sequence0907 source 1..151811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 179..790 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895960.1 transl_table 11 codon_start 1 locus_tag LOCUS_43310 gene nadD CDS 787..1188 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729939.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 gene rsfS CDS 1203..1853 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895958.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 CDS 1840..2571 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729938.1 transl_table 11 codon_start 1 locus_tag LOCUS_43340 CDS 2562..3398 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729937.1 transl_table 11 codon_start 1 locus_tag LOCUS_43350 CDS complement(3395..4447) product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 transl_table 11 codon_start 1 locus_tag LOCUS_43360 CDS complement(4458..5261) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036463150.1 transl_table 11 codon_start 1 locus_tag LOCUS_43370 CDS complement(5322..5903) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728638.1 transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS 6025..6696 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087452.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 CDS complement(6697..8367) product 3-ketosteroid-delta-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112843.1 transl_table 11 codon_start 1 locus_tag LOCUS_43400 CDS 8504..9658 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086140.1 transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS 9658..9948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086139.1 transl_table 11 codon_start 1 locus_tag LOCUS_43420 CDS 9959..10765 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728691.1 transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS complement(10920..11996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728645.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 CDS complement(12090..13031) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728646.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 CDS complement(13028..13846) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894238.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS complement(13873..14358) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728647.1 transl_table 11 codon_start 1 locus_tag LOCUS_43470 CDS complement(14408..15964) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877518.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 CDS complement(15976..17127) product long-chain specific acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031182.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 CDS 17229..19148 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728654.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 CDS 19145..20032 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728655.1 transl_table 11 codon_start 1 locus_tag LOCUS_43510 CDS complement(20029..20661) product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728656.1 transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS complement(20654..21001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104574.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 CDS complement(20994..21929) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728659.1 transl_table 11 codon_start 1 locus_tag LOCUS_43540 CDS complement(21926..22753) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894251.1 transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS complement(22920..24383) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 CDS complement(24387..25295) product biphenyl-2,3-diol 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894252.1 transl_table 11 codon_start 1 locus_tag LOCUS_43570 gene bphC CDS complement(25299..26477) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728661.1 transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(26567..26836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 26914..28572 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 CDS 28572..29372 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086134.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 29375..30202 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112839.1 transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS complement(30207..31094) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728670.1 transl_table 11 codon_start 1 locus_tag LOCUS_43630 CDS complement(31199..31921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS 32080..32904 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878069.1 transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS 32901..34445 product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729933.1 transl_table 11 codon_start 1 locus_tag LOCUS_43660 CDS 34463..35404 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729932.1 transl_table 11 codon_start 1 locus_tag LOCUS_43670 gene holA CDS complement(35439..35699) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 gene rpsT CDS 35988..37568 product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104123.1 transl_table 11 codon_start 1 locus_tag LOCUS_43690 CDS 37568..38545 product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895947.1 transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS 38545..39384 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729930.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS complement(39387..40298) product diacylglycerol acyltransferase/mycolyltransferase Ag85C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400908.1 transl_table 11 codon_start 1 locus_tag LOCUS_43720 gene ag85C CDS complement(40561..41424) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729929.1 transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS complement(41462..42481) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729928.1 transl_table 11 codon_start 1 locus_tag LOCUS_43740 CDS 42644..43072 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224278.1 transl_table 11 codon_start 1 locus_tag LOCUS_43750 CDS 43065..43673 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 transl_table 11 codon_start 1 locus_tag LOCUS_43760 CDS complement(43760..44350) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729921.1 transl_table 11 codon_start 1 locus_tag LOCUS_43770 CDS 44461..46293 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900516.1 transl_table 11 codon_start 1 locus_tag LOCUS_43780 gene lepA CDS 46307..47023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 CDS 47080..47793 product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729918.1 transl_table 11 codon_start 1 locus_tag LOCUS_43800 CDS complement(47828..49837) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729900.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS complement(49905..51068) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110188.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 CDS 51161..51361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729899.1 transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 51708..52739 product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895899.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 CDS 52736..53614 product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895898.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 gene cysT CDS 53611..54423 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895897.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 gene cysW CDS 54442..55503 product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729898.1 transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS 55645..57051 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967349.1 transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(57052..58053) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730166.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 CDS complement(58123..59589) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920973.1 transl_table 11 codon_start 1 locus_tag LOCUS_43900 CDS 59592..59810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43910 CDS complement(59708..60454) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878057.1 transl_table 11 codon_start 1 locus_tag LOCUS_43920 CDS complement(60433..61137) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729897.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 CDS complement(61134..62813) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729896.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 63109..64287 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729894.1 transl_table 11 codon_start 1 locus_tag LOCUS_43950 gene hemW CDS 64317..64880 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061267.1 transl_table 11 codon_start 1 locus_tag LOCUS_43960 CDS 64873..65571 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727694.1 transl_table 11 codon_start 1 locus_tag LOCUS_43970 CDS 65747..70927 product phthiocerol type I polyketide synthase PpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886158.1 transl_table 11 codon_start 1 locus_tag LOCUS_43980 gene ppsA CDS complement(70939..72591) product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104139.1 transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS 72686..76165 product phenyloxazoline synthase MbtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899299.1 transl_table 11 codon_start 1 locus_tag LOCUS_44000 gene mbtB CDS 76292..77830 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906521.1 transl_table 11 codon_start 1 locus_tag LOCUS_44010 CDS complement(77846..78706) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975951.1 transl_table 11 codon_start 1 locus_tag LOCUS_44020 CDS 78961..79758 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895881.1 transl_table 11 codon_start 1 locus_tag LOCUS_44030 CDS 79748..81052 product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729888.1 transl_table 11 codon_start 1 locus_tag LOCUS_44040 CDS 81052..84027 product mycobactin polyketide synthase MbtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412277.1 transl_table 11 codon_start 1 locus_tag LOCUS_44050 gene mbtD CDS 84020..89197 product mycobactin non-ribosomal peptide synthetase MbtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901387.1 transl_table 11 codon_start 1 locus_tag LOCUS_44060 gene mbtE CDS 89245..93546 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729885.1 transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS 93543..94892 product NADPH-dependent L-lysine N(6)-monooxygenase MbtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729884.1 transl_table 11 codon_start 1 locus_tag LOCUS_44080 gene mbtG CDS complement(94894..96642) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115909.1 transl_table 11 codon_start 1 locus_tag LOCUS_44090 CDS complement(96639..99239) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086041.1 transl_table 11 codon_start 1 locus_tag LOCUS_44100 CDS 99416..100093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44110 CDS 100093..100749 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727332.1 transl_table 11 codon_start 1 locus_tag LOCUS_44120 CDS complement(100746..101066) product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895874.1 transl_table 11 codon_start 1 locus_tag LOCUS_44130 CDS 101253..102284 product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729881.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140 gene hrcA CDS 102336..103478 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729880.1 transl_table 11 codon_start 1 locus_tag LOCUS_44150 gene dnaJ CDS 103484..104254 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729879.1 transl_table 11 codon_start 1 locus_tag LOCUS_44160 CDS 104360..105394 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895868.1 transl_table 11 codon_start 1 locus_tag LOCUS_44170 CDS 105407..105943 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895867.1 transl_table 11 codon_start 1 locus_tag LOCUS_44180 gene ybeY CDS 105958..107229 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895866.1 transl_table 11 codon_start 1 locus_tag LOCUS_44190 CDS 107222..107539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895865.1 transl_table 11 codon_start 1 locus_tag LOCUS_44200 CDS 107536..108435 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895864.1 transl_table 11 codon_start 1 locus_tag LOCUS_44210 gene era CDS complement(108464..108805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44220 CDS complement(108839..109387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44230 CDS complement(109399..110889) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745905.1 transl_table 11 codon_start 1 locus_tag LOCUS_44240 CDS 110950..111795 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895862.1 transl_table 11 codon_start 1 locus_tag LOCUS_44250 gene recO CDS 111743..112627 product decaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729873.1 transl_table 11 codon_start 1 locus_tag LOCUS_44260 CDS 112651..113073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412208.1 transl_table 11 codon_start 1 locus_tag LOCUS_44270 CDS complement(113065..113487) product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895858.1 transl_table 11 codon_start 1 locus_tag LOCUS_44280 CDS complement(113484..113852) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895857.1 transl_table 11 codon_start 1 locus_tag LOCUS_44290 CDS 113924..115324 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729870.1 transl_table 11 codon_start 1 locus_tag LOCUS_44300 CDS complement(115321..117309) product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729869.1 transl_table 11 codon_start 1 locus_tag LOCUS_44310 CDS 117345..118625 product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899281.1 transl_table 11 codon_start 1 locus_tag LOCUS_44320 CDS 118666..120588 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729868.1 transl_table 11 codon_start 1 locus_tag LOCUS_44330 gene dnaG CDS 120655..120969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510586.1 transl_table 11 codon_start 1 locus_tag LOCUS_44340 CDS complement(120970..121224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895835.1 transl_table 11 codon_start 1 locus_tag LOCUS_44350 tRNA 121376..121449 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(121766..122605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44360 CDS complement(122738..124660) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729863.1 transl_table 11 codon_start 1 locus_tag LOCUS_44370 CDS 124813..125475 product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729862.1 transl_table 11 codon_start 1 locus_tag LOCUS_44380 CDS 125475..126581 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235632064.1 transl_table 11 codon_start 1 locus_tag LOCUS_44390 CDS complement(126576..127781) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729861.1 transl_table 11 codon_start 1 locus_tag LOCUS_44400 CDS complement(127850..128287) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878047.1 transl_table 11 codon_start 1 locus_tag LOCUS_44410 CDS 128397..130445 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729859.1 transl_table 11 codon_start 1 locus_tag LOCUS_44420 CDS 130481..131290 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729858.1 transl_table 11 codon_start 1 locus_tag LOCUS_44430 CDS 131316..132833 product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729853.1 transl_table 11 codon_start 1 locus_tag LOCUS_44440 CDS 132837..134213 product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729852.1 transl_table 11 codon_start 1 locus_tag LOCUS_44450 CDS 134221..135066 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411924.1 transl_table 11 codon_start 1 locus_tag LOCUS_44460 tRNA 135093..135167 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(135210..136373) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110336.1 transl_table 11 codon_start 1 locus_tag LOCUS_44470 CDS complement(136385..137020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44480 CDS 137389..137799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44490 CDS 137992..138213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44500 CDS 138210..138599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44510 CDS 138678..140147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44520 CDS complement(140829..141620) product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 transl_table 11 codon_start 1 locus_tag LOCUS_44530 gene istB CDS complement(141645..143249) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189327688.1 transl_table 11 codon_start 1 locus_tag LOCUS_44540 gene istA CDS complement(143227..143694) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246360.1 transl_table 11 codon_start 1 locus_tag LOCUS_44550 CDS 143765..144943 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223404.1 transl_table 11 codon_start 1 locus_tag LOCUS_44560 CDS complement(145531..146844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44570 CDS 146951..147214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44580 CDS complement(147443..147742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44590 CDS complement(147732..149141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44600 CDS 149360..149959 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100847.1 transl_table 11 codon_start 1 locus_tag LOCUS_44610 CDS complement(150021..150734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44620 CDS complement(150905..151156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44630 CDS 151365..151718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44640 sequence0908 source 1..779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0909 source 1..603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0910 source 1..96036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44650 CDS 598..990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44660 CDS 1178..1756 product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 transl_table 11 codon_start 1 locus_tag LOCUS_44670 CDS complement(1753..2967) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730299.1 transl_table 11 codon_start 1 locus_tag LOCUS_44680 gene glgC CDS 3119..4267 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730300.1 transl_table 11 codon_start 1 locus_tag LOCUS_44690 gene glgA CDS complement(4295..4462) product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 transl_table 11 codon_start 1 locus_tag LOCUS_44700 CDS complement(4587..5168) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896489.1 transl_table 11 codon_start 1 locus_tag LOCUS_44710 gene tag CDS complement(5165..5539) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730301.1 transl_table 11 codon_start 1 locus_tag LOCUS_44720 CDS complement(5587..6549) product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896491.1 transl_table 11 codon_start 1 locus_tag LOCUS_44730 CDS complement(6546..7421) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730302.1 transl_table 11 codon_start 1 locus_tag LOCUS_44740 gene folP CDS complement(7454..9352) product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730303.1 transl_table 11 codon_start 1 locus_tag LOCUS_44750 gene fadD6 CDS complement(9327..9887) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730304.1 transl_table 11 codon_start 1 locus_tag LOCUS_44760 CDS 9917..12013 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104277.1 transl_table 11 codon_start 1 locus_tag LOCUS_44770 CDS complement(12010..12747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730953.1 transl_table 11 codon_start 1 locus_tag LOCUS_44780 CDS complement(12760..13881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730954.1 transl_table 11 codon_start 1 locus_tag LOCUS_44790 CDS complement(13958..15595) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730315.1 transl_table 11 codon_start 1 locus_tag LOCUS_44800 CDS complement(15704..16771) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730316.1 transl_table 11 codon_start 1 locus_tag LOCUS_44810 gene dapE CDS 16754..17740 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 transl_table 11 codon_start 1 locus_tag LOCUS_44820 gene dapD CDS complement(17743..18315) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727993.1 transl_table 11 codon_start 1 locus_tag LOCUS_44830 CDS complement(18318..18674) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081659.1 transl_table 11 codon_start 1 locus_tag LOCUS_44840 CDS complement(18665..20071) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730326.1 transl_table 11 codon_start 1 locus_tag LOCUS_44850 CDS 20093..20641 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730328.1 transl_table 11 codon_start 1 locus_tag LOCUS_44860 CDS 20638..21066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44870 CDS 21117..21614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411608.1 transl_table 11 codon_start 1 locus_tag LOCUS_44880 CDS complement(21608..22570) product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896514.1 transl_table 11 codon_start 1 locus_tag LOCUS_44890 CDS complement(22572..24200) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730329.1 transl_table 11 codon_start 1 locus_tag LOCUS_44900 gene pruA CDS 24294..25877 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730330.1 transl_table 11 codon_start 1 locus_tag LOCUS_44910 CDS 25916..26464 product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804097.1 transl_table 11 codon_start 1 locus_tag LOCUS_44920 gene idi CDS complement(26465..27469) product DUF5914 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728280.1 transl_table 11 codon_start 1 locus_tag LOCUS_44930 CDS complement(27466..28761) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877361.1 transl_table 11 codon_start 1 locus_tag LOCUS_44940 CDS 28744..28929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44950 CDS complement(28989..29699) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225920.1 transl_table 11 codon_start 1 locus_tag LOCUS_44960 CDS complement(29696..30025) product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742202.1 transl_table 11 codon_start 1 locus_tag LOCUS_44970 CDS complement(30022..30366) product lycopene cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225087.1 transl_table 11 codon_start 1 locus_tag LOCUS_44980 CDS complement(30369..31316) product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728282.1 transl_table 11 codon_start 1 locus_tag LOCUS_44990 CDS complement(31313..32845) product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728283.1 transl_table 11 codon_start 1 locus_tag LOCUS_45000 gene crtI CDS complement(32824..33957) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225925.1 transl_table 11 codon_start 1 locus_tag LOCUS_45010 CDS 34165..35676 product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228506.1 transl_table 11 codon_start 1 locus_tag LOCUS_45020 CDS 35713..36882 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230183.1 transl_table 11 codon_start 1 locus_tag LOCUS_45030 CDS 36879..37511 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 transl_table 11 codon_start 1 locus_tag LOCUS_45040 CDS complement(37515..38612) product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730331.1 transl_table 11 codon_start 1 locus_tag LOCUS_45050 gene dapC CDS complement(38624..38947) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896518.1 transl_table 11 codon_start 1 locus_tag LOCUS_45060 CDS 39293..40327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45070 note possible pseudo, internal stop codon, frameshifted CDS complement(40396..40956) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 transl_table 11 codon_start 1 locus_tag LOCUS_45080 CDS complement(41068..41529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45090 CDS complement(41661..44240) product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104130.1 transl_table 11 codon_start 1 locus_tag LOCUS_45100 CDS complement(44423..44620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45110 CDS 44529..45554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45120 CDS complement(45558..45785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45130 CDS complement(45938..46066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45140 CDS complement(46100..46975) product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730335.1 transl_table 11 codon_start 1 locus_tag LOCUS_45150 gene mshB CDS 47016..48254 product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444392.1 transl_table 11 codon_start 1 locus_tag LOCUS_45160 CDS complement(48248..49999) product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730336.1 transl_table 11 codon_start 1 locus_tag LOCUS_45170 CDS complement(50189..51955) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066672.1 transl_table 11 codon_start 1 locus_tag LOCUS_45180 gene typA CDS 52157..52324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134055442.1 transl_table 11 codon_start 1 locus_tag LOCUS_45190 CDS 52388..52654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896533.1 transl_table 11 codon_start 1 locus_tag LOCUS_45200 CDS complement(52606..53649) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407264.1 transl_table 11 codon_start 1 locus_tag LOCUS_45210 CDS 53790..55043 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411663.1 transl_table 11 codon_start 1 locus_tag LOCUS_45220 CDS complement(55072..55473) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896546.1 transl_table 11 codon_start 1 locus_tag LOCUS_45230 CDS 55500..55784 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 transl_table 11 codon_start 1 locus_tag LOCUS_45240 CDS complement(55762..56922) product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217160422.1 transl_table 11 codon_start 1 locus_tag LOCUS_45250 CDS complement(57028..57366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45260 CDS 57281..57655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45270 CDS 57725..58690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730350.1 transl_table 11 codon_start 1 locus_tag LOCUS_45280 CDS complement(58701..59018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45290 CDS 58899..59540 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896555.1 transl_table 11 codon_start 1 locus_tag LOCUS_45300 CDS 59650..60036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45310 CDS complement(60033..60611) product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896556.1 transl_table 11 codon_start 1 locus_tag LOCUS_45320 CDS 60650..61888 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896558.1 transl_table 11 codon_start 1 locus_tag LOCUS_45330 CDS 61885..62649 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896559.1 transl_table 11 codon_start 1 locus_tag LOCUS_45340 CDS 62642..63016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104514.1 transl_table 11 codon_start 1 locus_tag LOCUS_45350 CDS 63013..64752 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730352.1 transl_table 11 codon_start 1 locus_tag LOCUS_45360 CDS 64900..65235 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049745379.1 transl_table 11 codon_start 1 locus_tag LOCUS_45370 CDS 65232..66878 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730355.1 transl_table 11 codon_start 1 locus_tag LOCUS_45380 CDS 66984..68180 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896567.1 transl_table 11 codon_start 1 locus_tag LOCUS_45390 CDS complement(68177..68344) product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896571.1 transl_table 11 codon_start 1 locus_tag LOCUS_45400 CDS complement(68385..68828) product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730357.1 transl_table 11 codon_start 1 locus_tag LOCUS_45410 CDS 68877..69704 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092959.1 transl_table 11 codon_start 1 locus_tag LOCUS_45420 CDS 69714..70235 product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730359.1 transl_table 11 codon_start 1 locus_tag LOCUS_45430 CDS 70250..71092 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896576.1 transl_table 11 codon_start 1 locus_tag LOCUS_45440 CDS complement(71103..72632) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 transl_table 11 codon_start 1 locus_tag LOCUS_45450 CDS 72728..73984 product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406219.1 transl_table 11 codon_start 1 locus_tag LOCUS_45460 CDS complement(73981..74346) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730360.1 transl_table 11 codon_start 1 locus_tag LOCUS_45470 CDS 74382..75098 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730361.1 transl_table 11 codon_start 1 locus_tag LOCUS_45480 gene cobB CDS complement(75095..75733) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730362.1 transl_table 11 codon_start 1 locus_tag LOCUS_45490 CDS complement(75714..76394) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730363.1 transl_table 11 codon_start 1 locus_tag LOCUS_45500 CDS complement(76391..78661) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730364.1 transl_table 11 codon_start 1 locus_tag LOCUS_45510 CDS 78859..79356 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730365.1 transl_table 11 codon_start 1 locus_tag LOCUS_45520 CDS 79445..79594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730366.1 transl_table 11 codon_start 1 locus_tag LOCUS_45530 CDS complement(79689..80687) product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730367.1 transl_table 11 codon_start 1 locus_tag LOCUS_45540 CDS complement(80684..81436) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896585.1 transl_table 11 codon_start 1 locus_tag LOCUS_45550 CDS complement(81472..82575) product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730368.1 transl_table 11 codon_start 1 locus_tag LOCUS_45560 CDS 82665..83486 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896587.1 transl_table 11 codon_start 1 locus_tag LOCUS_45570 CDS 83588..84820 product tetracycline efflux MFS transporter Tet(V) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896589.1 transl_table 11 codon_start 1 locus_tag LOCUS_45580 gene tet(V) CDS complement(84817..85506) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730369.1 transl_table 11 codon_start 1 locus_tag LOCUS_45590 CDS complement(85536..86681) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730370.1 transl_table 11 codon_start 1 locus_tag LOCUS_45600 CDS complement(86727..87254) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730372.1 transl_table 11 codon_start 1 locus_tag LOCUS_45610 CDS 87295..88224 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618895.1 transl_table 11 codon_start 1 locus_tag LOCUS_45620 CDS 88378..89145 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896598.1 transl_table 11 codon_start 1 locus_tag LOCUS_45630 CDS complement(89166..90308) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896599.1 transl_table 11 codon_start 1 locus_tag LOCUS_45640 CDS complement(90328..91125) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 transl_table 11 codon_start 1 locus_tag LOCUS_45650 CDS complement(91122..92267) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896601.1 transl_table 11 codon_start 1 locus_tag LOCUS_45660 CDS 92480..93244 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730376.1 transl_table 11 codon_start 1 locus_tag LOCUS_45670 CDS complement(93225..94979) product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730378.1 transl_table 11 codon_start 1 locus_tag LOCUS_45680 CDS complement(95039..95572) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896605.1 transl_table 11 codon_start 1 locus_tag LOCUS_45690 sequence0911 source 1..615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0912 source 1..744 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0913 source 1..502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0914 source 1..755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0915 source 1..373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0916 source 1..379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0917 source 1..91827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..603) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728005.1 transl_table 11 codon_start 1 locus_tag LOCUS_45700 gene ybaK CDS 805..1500 product sigma-70 family RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893296.1 transl_table 11 codon_start 1 locus_tag LOCUS_45710 gene sigH CDS 1497..1802 product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728007.1 transl_table 11 codon_start 1 locus_tag LOCUS_45720 gene rsrA CDS 2068..2283 product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 transl_table 11 codon_start 1 locus_tag LOCUS_45730 CDS 2316..3824 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728009.1 transl_table 11 codon_start 1 locus_tag LOCUS_45740 CDS complement(3949..4203) product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893300.1 transl_table 11 codon_start 1 locus_tag LOCUS_45750 gene whiB1 CDS complement(4455..5405) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728010.1 transl_table 11 codon_start 1 locus_tag LOCUS_45760 CDS 5456..5896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416881.1 transl_table 11 codon_start 1 locus_tag LOCUS_45770 CDS complement(5833..6330) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728014.1 transl_table 11 codon_start 1 locus_tag LOCUS_45780 CDS complement(6327..7436) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323726.1 transl_table 11 codon_start 1 locus_tag LOCUS_45790 CDS complement(7421..8053) product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728016.1 transl_table 11 codon_start 1 locus_tag LOCUS_45800 CDS 8112..8906 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728017.1 transl_table 11 codon_start 1 locus_tag LOCUS_45810 CDS complement(8961..10175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728019.1 transl_table 11 codon_start 1 locus_tag LOCUS_45820 CDS complement(10217..11665) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728020.1 transl_table 11 codon_start 1 locus_tag LOCUS_45830 CDS 11909..12625 product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728021.1 transl_table 11 codon_start 1 locus_tag LOCUS_45840 CDS complement(12629..13387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45850 CDS 13610..13888 product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893314.1 transl_table 11 codon_start 1 locus_tag LOCUS_45860 CDS complement(13875..14540) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893315.1 transl_table 11 codon_start 1 locus_tag LOCUS_45870 CDS 14714..15745 product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728024.1 transl_table 11 codon_start 1 locus_tag LOCUS_45880 CDS 15782..17023 product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085976174.1 transl_table 11 codon_start 1 locus_tag LOCUS_45890 gene moeZ CDS 17060..17914 product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893318.1 transl_table 11 codon_start 1 locus_tag LOCUS_45900 CDS complement(18005..18301) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728026.1 transl_table 11 codon_start 1 locus_tag LOCUS_45910 CDS complement(18302..19063) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877251.1 transl_table 11 codon_start 1 locus_tag LOCUS_45920 CDS 19043..22264 product ATP-dependent DNA helicase AdnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728028.1 transl_table 11 codon_start 1 locus_tag LOCUS_45930 gene adnA CDS 22261..25521 product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728029.1 transl_table 11 codon_start 1 locus_tag LOCUS_45940 gene adnB CDS complement(25508..25921) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728030.1 transl_table 11 codon_start 1 locus_tag LOCUS_45950 CDS 25967..27046 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893325.1 transl_table 11 codon_start 1 locus_tag LOCUS_45960 CDS 27043..27972 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728031.1 transl_table 11 codon_start 1 locus_tag LOCUS_45970 gene nudC CDS complement(27969..28325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_45980 CDS 28294..30408 product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462428.1 transl_table 11 codon_start 1 locus_tag LOCUS_45990 CDS 30527..30715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46000 CDS 30832..31188 product transcriptional regulator WhiB7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893333.1 transl_table 11 codon_start 1 locus_tag LOCUS_46010 gene whiB7 CDS complement(31219..32538) product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877256.1 transl_table 11 codon_start 1 locus_tag LOCUS_46020 CDS complement(32596..33423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416809.1 transl_table 11 codon_start 1 locus_tag LOCUS_46030 CDS complement(33481..34857) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728041.1 transl_table 11 codon_start 1 locus_tag LOCUS_46040 CDS complement(34850..35065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46050 CDS 34962..35969 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893338.1 transl_table 11 codon_start 1 locus_tag LOCUS_46060 CDS 36133..39063 product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728043.1 transl_table 11 codon_start 1 locus_tag LOCUS_46070 tRNA 39116..39190 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 CDS complement(39315..39518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46080 CDS 39777..40559 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402925.1 transl_table 11 codon_start 1 locus_tag LOCUS_46090 CDS 40710..40958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46100 note possible pseudo, internal stop codon CDS 41658..42050 product MmpS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726897.1 transl_table 11 codon_start 1 locus_tag LOCUS_46110 CDS 42047..44929 product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726898.1 transl_table 11 codon_start 1 locus_tag LOCUS_46120 CDS 44940..47885 product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726899.1 transl_table 11 codon_start 1 locus_tag LOCUS_46130 CDS 48016..48429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46140 CDS complement(48556..54897) product phthioceranic/hydroxyphthioceranic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900763.1 transl_table 11 codon_start 1 locus_tag LOCUS_46150 gene pks2 CDS 55177..56910 product fatty-acid--AMP ligase FAAL28/FadD28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950803.1 transl_table 11 codon_start 1 locus_tag LOCUS_46160 gene fadD28 CDS complement(56947..58296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112610.1 transl_table 11 codon_start 1 locus_tag LOCUS_46170 CDS 58658..59629 product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296788.1 transl_table 11 codon_start 1 locus_tag LOCUS_46180 CDS complement(59788..60825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46190 CDS 60824..61090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46200 CDS 61399..62796 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728477.1 transl_table 11 codon_start 1 locus_tag LOCUS_46210 CDS 62957..64120 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089126.1 transl_table 11 codon_start 1 locus_tag LOCUS_46220 CDS 64385..65650 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112593.1 transl_table 11 codon_start 1 locus_tag LOCUS_46230 CDS 66010..66237 product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726914.1 transl_table 11 codon_start 1 locus_tag LOCUS_46240 CDS 66273..81008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46250 CDS 81005..88750 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083452801.1 transl_table 11 codon_start 1 locus_tag LOCUS_46260 note possible pseudo, frameshifted CDS 88737..90068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46270 note possible pseudo, frameshifted sequence0918 source 1..593 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0919 source 1..383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0920 source 1..878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 244..381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46280 CDS complement(395..631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46290 sequence0921 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(42..>599) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224757.1:TetR family transcriptional regulator locus_tag LOCUS_46300 sequence0922 source 1..467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0923 source 1..820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(45..818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46310 sequence0924 source 1..428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0925 source 1..672 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0926 source 1..619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0927 source 1..749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0928 source 1..653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0929 source 1..609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0930 source 1..346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0931 source 1..497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0932 source 1..409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0933 source 1..532 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0934 source 1..497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0935 source 1..780 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0936 source 1..762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(57..>762) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727236.1:Na+/H+ antiporter subunit A locus_tag LOCUS_46320 sequence0937 source 1..661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0938 source 1..629 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(229..627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46330 sequence0939 source 1..50640 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..404) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895305.1 transl_table 11 codon_start 1 locus_tag LOCUS_46340 gene rbpA CDS 744..911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46350 CDS 1050..2228 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729373.1 transl_table 11 codon_start 1 locus_tag LOCUS_46360 CDS 2308..3021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104430.1 transl_table 11 codon_start 1 locus_tag LOCUS_46370 CDS 3150..3962 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895300.1 transl_table 11 codon_start 1 locus_tag LOCUS_46380 CDS 3959..4681 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729372.1 transl_table 11 codon_start 1 locus_tag LOCUS_46390 CDS 4699..5712 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729371.1 transl_table 11 codon_start 1 locus_tag LOCUS_46400 CDS 5720..6883 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729370.1 transl_table 11 codon_start 1 locus_tag LOCUS_46410 CDS 6941..7516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46420 CDS 7539..7925 product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 transl_table 11 codon_start 1 locus_tag LOCUS_46430 gene kmtR CDS 7925..8851 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410146.1 transl_table 11 codon_start 1 locus_tag LOCUS_46440 CDS complement(8841..9347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899146.1 transl_table 11 codon_start 1 locus_tag LOCUS_46450 CDS 9286..9594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46460 CDS 9594..11102 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729367.1 transl_table 11 codon_start 1 locus_tag LOCUS_46470 CDS 11154..13127 product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729366.1 transl_table 11 codon_start 1 locus_tag LOCUS_46480 CDS 13132..15087 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729365.1 transl_table 11 codon_start 1 locus_tag LOCUS_46490 CDS complement(15173..15499) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728925.1 transl_table 11 codon_start 1 locus_tag LOCUS_46500 CDS complement(15587..16483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728926.1 transl_table 11 codon_start 1 locus_tag LOCUS_46510 CDS complement(16493..17221) product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891775.1 transl_table 11 codon_start 1 locus_tag LOCUS_46520 CDS 17346..17861 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891774.1 transl_table 11 codon_start 1 locus_tag LOCUS_46530 CDS 17861..19321 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726955.1 transl_table 11 codon_start 1 locus_tag LOCUS_46540 CDS complement(19331..19837) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728927.1 transl_table 11 codon_start 1 locus_tag LOCUS_46550 CDS complement(19944..20873) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728928.1 transl_table 11 codon_start 1 locus_tag LOCUS_46560 CDS complement(20937..21527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46570 CDS 21557..22951 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877620.1 transl_table 11 codon_start 1 locus_tag LOCUS_46580 gene xylB CDS 22948..23664 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409574.1 transl_table 11 codon_start 1 locus_tag LOCUS_46590 CDS 23740..23973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46600 CDS 23960..24190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46610 CDS complement(24194..25114) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728933.1 transl_table 11 codon_start 1 locus_tag LOCUS_46620 CDS 25174..26070 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728945.1 transl_table 11 codon_start 1 locus_tag LOCUS_46630 CDS 26084..26431 product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894681.1 transl_table 11 codon_start 1 locus_tag LOCUS_46640 CDS complement(26432..27277) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894682.1 transl_table 11 codon_start 1 locus_tag LOCUS_46650 CDS complement(27274..28149) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894683.1 transl_table 11 codon_start 1 locus_tag LOCUS_46660 CDS complement(28154..29341) product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894684.1 transl_table 11 codon_start 1 locus_tag LOCUS_46670 CDS complement(29398..30396) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728946.1 transl_table 11 codon_start 1 locus_tag LOCUS_46680 note possible pseudo, internal stop codon, frameshifted CDS 30289..30597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46690 CDS 30925..31353 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729050.1 transl_table 11 codon_start 1 locus_tag LOCUS_46700 CDS complement(31357..32826) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728948.1 transl_table 11 codon_start 1 locus_tag LOCUS_46710 CDS 32920..34317 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223436.1 transl_table 11 codon_start 1 locus_tag LOCUS_46720 CDS complement(34278..35156) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 transl_table 11 codon_start 1 locus_tag LOCUS_46730 CDS 35210..35953 product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729851.1 transl_table 11 codon_start 1 locus_tag LOCUS_46740 CDS complement(35917..36351) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388135.1 transl_table 11 codon_start 1 locus_tag LOCUS_46750 CDS 36399..37013 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894014.1 transl_table 11 codon_start 1 locus_tag LOCUS_46760 CDS 37084..37611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46770 CDS 37644..38465 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104317.1 transl_table 11 codon_start 1 locus_tag LOCUS_46780 CDS complement(38480..39193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46790 CDS 39312..39782 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 transl_table 11 codon_start 1 locus_tag LOCUS_46800 CDS 39788..40198 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891553.1 transl_table 11 codon_start 1 locus_tag LOCUS_46810 CDS 40199..42553 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726746.1 transl_table 11 codon_start 1 locus_tag LOCUS_46820 CDS 42571..44358 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 transl_table 11 codon_start 1 locus_tag LOCUS_46830 CDS 44418..45848 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728442.1 transl_table 11 codon_start 1 locus_tag LOCUS_46840 CDS complement(45854..46288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46850 CDS 46469..48124 product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 transl_table 11 codon_start 1 locus_tag LOCUS_46860 CDS complement(48937..50355) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_46870 sequence0940 source 1..733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 82..480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46880 sequence0941 source 1..531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0942 source 1..825 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 374..526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46890 sequence0943 source 1..366 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0944 source 1..604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0945 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0946 source 1..622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0947 source 1..768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 248..697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892191.1 transl_table 11 codon_start 1 locus_tag LOCUS_46900 sequence0948 source 1..666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(69..>666) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729301.1:SMC-Scp complex subunit ScpB locus_tag LOCUS_46910 sequence0949 source 1..467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0950 source 1..15274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 285..533 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406668.1 transl_table 11 codon_start 1 locus_tag LOCUS_46920 gene rpmE CDS complement(530..718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_46930 CDS 635..1708 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730207.1 transl_table 11 codon_start 1 locus_tag LOCUS_46940 gene prfA CDS 1705..2568 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730206.1 transl_table 11 codon_start 1 locus_tag LOCUS_46950 gene prmC CDS 2582..3235 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406678.1 transl_table 11 codon_start 1 locus_tag LOCUS_46960 CDS 3257..4456 product UDP-N-acetylglucosamine--decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730204.1 transl_table 11 codon_start 1 locus_tag LOCUS_46970 gene rfe CDS 4752..5138 product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896335.1 transl_table 11 codon_start 1 locus_tag LOCUS_46980 CDS 5131..5886 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406681.1 transl_table 11 codon_start 1 locus_tag LOCUS_46990 gene atpB CDS 5953..6201 product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059842.1 transl_table 11 codon_start 1 locus_tag LOCUS_47000 CDS 6222..6761 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896332.1 transl_table 11 codon_start 1 locus_tag LOCUS_47010 CDS 6766..8097 product F0F1 ATP synthase subunit B/delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896331.1 transl_table 11 codon_start 1 locus_tag LOCUS_47020 CDS 8145..9791 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406699.1 transl_table 11 codon_start 1 locus_tag LOCUS_47030 gene atpA CDS 9803..10726 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896329.1 transl_table 11 codon_start 1 locus_tag LOCUS_47040 CDS 10750..12294 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 transl_table 11 codon_start 1 locus_tag LOCUS_47050 gene atpD CDS 12297..12668 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406708.1 transl_table 11 codon_start 1 locus_tag LOCUS_47060 CDS 12688..13122 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878187.1 transl_table 11 codon_start 1 locus_tag LOCUS_47070 CDS complement(13119..13697) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 transl_table 11 codon_start 1 locus_tag LOCUS_47080 CDS 13793..15031 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 transl_table 11 codon_start 1 locus_tag LOCUS_47090 gene murA sequence0951 source 1..328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0952 source 1..66504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..1259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47100 CDS 1256..3004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47110 CDS 3001..5124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47120 CDS 5121..5543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47130 CDS complement(5839..6159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403164.1 transl_table 11 codon_start 1 locus_tag LOCUS_47140 CDS complement(6444..7514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47150 CDS complement(7498..8193) product two-component system response regulator TcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403148.1 transl_table 11 codon_start 1 locus_tag LOCUS_47160 gene tcrA CDS 8319..9293 product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900184.1 transl_table 11 codon_start 1 locus_tag LOCUS_47170 CDS 9308..10096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47180 CDS 10093..11019 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 transl_table 11 codon_start 1 locus_tag LOCUS_47190 CDS 11016..11786 product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 transl_table 11 codon_start 1 locus_tag LOCUS_47200 gene gldF CDS 11792..12337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47210 CDS complement(12334..13179) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082087.1 transl_table 11 codon_start 1 locus_tag LOCUS_47220 CDS complement(13644..13856) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47230 CDS complement(13853..14134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47240 CDS complement(14164..14370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47250 CDS complement(14696..14980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47260 CDS 15897..16880 product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110351.1 transl_table 11 codon_start 1 locus_tag LOCUS_47270 CDS 18014..18673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47280 CDS 19160..19780 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899374.1 transl_table 11 codon_start 1 locus_tag LOCUS_47290 CDS 20041..20508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730634.1 transl_table 11 codon_start 1 locus_tag LOCUS_47300 CDS complement(20543..22690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47310 CDS complement(22832..23047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47320 CDS complement(23208..23876) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727699.1 transl_table 11 codon_start 1 locus_tag LOCUS_47330 CDS 24010..24291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47340 CDS 24386..24832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47350 CDS complement(25281..26243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47360 CDS 26748..27440 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703909.1 transl_table 11 codon_start 1 locus_tag LOCUS_47370 gene yieH CDS complement(27441..28346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47380 CDS 28513..28863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47390 CDS 28884..30056 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214468507.1 transl_table 11 codon_start 1 locus_tag LOCUS_47400 CDS 30072..30392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47410 CDS 30389..30964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838026.1 transl_table 11 codon_start 1 locus_tag LOCUS_47420 CDS complement(30988..31143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894882.1 transl_table 11 codon_start 1 locus_tag LOCUS_47430 CDS 31334..32614 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082804.1 transl_table 11 codon_start 1 locus_tag LOCUS_47440 CDS 32686..32877 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892088.1 transl_table 11 codon_start 1 locus_tag LOCUS_47450 CDS 32997..34661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47460 CDS complement(34691..35431) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729763.1 transl_table 11 codon_start 1 locus_tag LOCUS_47470 CDS complement(35456..37063) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729762.1 transl_table 11 codon_start 1 locus_tag LOCUS_47480 CDS complement(37060..37935) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729761.1 transl_table 11 codon_start 1 locus_tag LOCUS_47490 CDS complement(37932..38900) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729760.1 transl_table 11 codon_start 1 locus_tag LOCUS_47500 CDS complement(38897..40348) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 transl_table 11 codon_start 1 locus_tag LOCUS_47510 CDS 40274..40549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47520 CDS 40562..41098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087517.1 transl_table 11 codon_start 1 locus_tag LOCUS_47530 CDS 41067..42233 product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729758.1 transl_table 11 codon_start 1 locus_tag LOCUS_47540 CDS 42353..43096 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 transl_table 11 codon_start 1 locus_tag LOCUS_47550 CDS complement(43086..43847) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729757.1 transl_table 11 codon_start 1 locus_tag LOCUS_47560 CDS 43959..45047 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250320.1 transl_table 11 codon_start 1 locus_tag LOCUS_47570 CDS 45114..46880 product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729755.1 transl_table 11 codon_start 1 locus_tag LOCUS_47580 CDS 46909..48663 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223446.1 transl_table 11 codon_start 1 locus_tag LOCUS_47590 CDS complement(48645..48968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47600 CDS complement(48956..49585) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228294.1 transl_table 11 codon_start 1 locus_tag LOCUS_47610 CDS 49678..50640 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731576.1 transl_table 11 codon_start 1 locus_tag LOCUS_47620 CDS complement(50644..51732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729753.1 transl_table 11 codon_start 1 locus_tag LOCUS_47630 CDS complement(51793..52740) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 transl_table 11 codon_start 1 locus_tag LOCUS_47640 CDS 52884..53504 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223207.1 transl_table 11 codon_start 1 locus_tag LOCUS_47650 CDS 53541..54272 product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729750.1 transl_table 11 codon_start 1 locus_tag LOCUS_47660 CDS complement(54288..54914) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089210.1 transl_table 11 codon_start 1 locus_tag LOCUS_47670 CDS complement(54911..55996) product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729747.1 transl_table 11 codon_start 1 locus_tag LOCUS_47680 CDS 56042..57694 product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729746.1 transl_table 11 codon_start 1 locus_tag LOCUS_47690 CDS 57812..58891 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495700.1 transl_table 11 codon_start 1 locus_tag LOCUS_47700 CDS 58927..59829 product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 transl_table 11 codon_start 1 locus_tag LOCUS_47710 CDS 59839..60663 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878005.1 transl_table 11 codon_start 1 locus_tag LOCUS_47720 CDS 60780..61292 product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729743.1 transl_table 11 codon_start 1 locus_tag LOCUS_47730 CDS 61406..61702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47740 CDS complement(61706..62608) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 transl_table 11 codon_start 1 locus_tag LOCUS_47750 CDS complement(62605..64227) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729741.1 transl_table 11 codon_start 1 locus_tag LOCUS_47760 CDS 64245..64826 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895728.1 transl_table 11 codon_start 1 locus_tag LOCUS_47770 CDS 64823..66379 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729740.1 transl_table 11 codon_start 1 locus_tag LOCUS_47780 sequence0953 source 1..451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0954 source 1..623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0955 source 1..530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0956 source 1..459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0957 source 1..317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0958 source 1..415 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0959 source 1..392 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0960 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0961 source 1..66977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 321..1088 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891419.1 transl_table 11 codon_start 1 locus_tag LOCUS_47790 CDS 1085..2071 product hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891418.1 transl_table 11 codon_start 1 locus_tag LOCUS_47800 CDS 2068..4092 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726656.1 transl_table 11 codon_start 1 locus_tag LOCUS_47810 CDS 4119..4376 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726655.1 transl_table 11 codon_start 1 locus_tag LOCUS_47820 CDS 4578..5924 product type VII secretion system ESX-1 serine protease mycosin MycP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726654.1 transl_table 11 codon_start 1 locus_tag LOCUS_47830 gene mycP1 CDS 5921..7318 product type VII secretion protein EccE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726653.1 transl_table 11 codon_start 1 locus_tag LOCUS_47840 gene eccE CDS 7322..8842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_47850 CDS 8839..9174 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891413.1 transl_table 11 codon_start 1 locus_tag LOCUS_47860 CDS 9194..9994 product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 transl_table 11 codon_start 1 locus_tag LOCUS_47870 CDS 10009..10587 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731335.1 transl_table 11 codon_start 1 locus_tag LOCUS_47880 CDS complement(10574..11611) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897935.1 transl_table 11 codon_start 1 locus_tag LOCUS_47890 CDS complement(11641..12414) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897936.1 transl_table 11 codon_start 1 locus_tag LOCUS_47900 CDS complement(12411..13274) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897937.1 transl_table 11 codon_start 1 locus_tag LOCUS_47910 CDS complement(13276..14406) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731336.1 transl_table 11 codon_start 1 locus_tag LOCUS_47920 CDS 14588..15160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897939.1 transl_table 11 codon_start 1 locus_tag LOCUS_47930 CDS complement(15221..15832) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227659.1 transl_table 11 codon_start 1 locus_tag LOCUS_47940 CDS 15901..16359 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086841425.1 transl_table 11 codon_start 1 locus_tag LOCUS_47950 CDS 16370..16789 product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897940.1 transl_table 11 codon_start 1 locus_tag LOCUS_47960 CDS 16899..19112 product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731342.1 transl_table 11 codon_start 1 locus_tag LOCUS_47970 CDS complement(19114..19725) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035634.1 transl_table 11 codon_start 1 locus_tag LOCUS_47980 CDS 19676..20416 product sigma-70 family RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416897.1 transl_table 11 codon_start 1 locus_tag LOCUS_47990 gene sigH CDS complement(20637..21368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48000 CDS complement(21365..22561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48010 CDS complement(22558..24156) product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727775.1 transl_table 11 codon_start 1 locus_tag LOCUS_48020 CDS complement(24196..24474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48030 CDS complement(24591..24944) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419762.1 transl_table 11 codon_start 1 locus_tag LOCUS_48040 CDS 25179..25589 product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392983.1 transl_table 11 codon_start 1 locus_tag LOCUS_48050 CDS 25582..27852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48060 CDS complement(27830..28723) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731346.1 transl_table 11 codon_start 1 locus_tag LOCUS_48070 CDS 28892..29215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48080 CDS complement(29212..29529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48090 CDS 29701..29961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48100 CDS 30028..30291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48110 CDS complement(30325..30876) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978722.1 transl_table 11 codon_start 1 locus_tag LOCUS_48120 CDS complement(30974..32275) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730167.1 transl_table 11 codon_start 1 locus_tag LOCUS_48130 CDS complement(32357..32776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48140 CDS complement(32773..34032) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416584.1 transl_table 11 codon_start 1 locus_tag LOCUS_48150 CDS complement(34039..34935) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950843.1 transl_table 11 codon_start 1 locus_tag LOCUS_48160 CDS complement(34998..35483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416593.1 transl_table 11 codon_start 1 locus_tag LOCUS_48170 CDS complement(35480..36442) product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900649.1 transl_table 11 codon_start 1 locus_tag LOCUS_48180 CDS 36495..37172 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085254309.1 transl_table 11 codon_start 1 locus_tag LOCUS_48190 CDS complement(37156..37977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467667.1 transl_table 11 codon_start 1 locus_tag LOCUS_48200 CDS 38005..39915 product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 transl_table 11 codon_start 1 locus_tag LOCUS_48210 CDS complement(40030..40437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48220 CDS complement(40580..41413) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495744.1 transl_table 11 codon_start 1 locus_tag LOCUS_48230 CDS complement(41416..41892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48240 CDS 42293..42751 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897999.1 transl_table 11 codon_start 1 locus_tag LOCUS_48250 CDS 42855..43463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48260 CDS 43598..44695 product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086125.1 transl_table 11 codon_start 1 locus_tag LOCUS_48270 gene lipE CDS complement(44696..45814) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104228.1 transl_table 11 codon_start 1 locus_tag LOCUS_48280 CDS complement(45863..46657) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858314.1 transl_table 11 codon_start 1 locus_tag LOCUS_48290 CDS complement(46676..50596) product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731383.1 transl_table 11 codon_start 1 locus_tag LOCUS_48300 gene hrpA CDS complement(50600..51490) product 5,10-methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731390.1 transl_table 11 codon_start 1 locus_tag LOCUS_48310 CDS 51612..53087 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728345.1 transl_table 11 codon_start 1 locus_tag LOCUS_48320 CDS complement(53089..53697) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727830.1 transl_table 11 codon_start 1 locus_tag LOCUS_48330 CDS complement(53811..54221) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086201.1 transl_table 11 codon_start 1 locus_tag LOCUS_48340 CDS complement(54350..55015) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729087.1 transl_table 11 codon_start 1 locus_tag LOCUS_48350 CDS complement(55018..55773) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327981.1 transl_table 11 codon_start 1 locus_tag LOCUS_48360 CDS complement(55847..56428) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079706.1 transl_table 11 codon_start 1 locus_tag LOCUS_48370 CDS complement(56438..57424) product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083133052.1 transl_table 11 codon_start 1 locus_tag LOCUS_48380 CDS complement(57464..58648) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898036.1 transl_table 11 codon_start 1 locus_tag LOCUS_48390 CDS 58724..60016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48400 note possible pseudo, internal stop codon CDS 60074..60892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48410 note possible pseudo, internal stop codon CDS complement(60895..61614) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731404.1 transl_table 11 codon_start 1 locus_tag LOCUS_48420 CDS 61767..62108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48430 CDS 62105..63361 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727607.1 transl_table 11 codon_start 1 locus_tag LOCUS_48440 CDS 63368..64207 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731439.1 transl_table 11 codon_start 1 locus_tag LOCUS_48450 CDS 64240..66741 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 transl_table 11 codon_start 1 locus_tag LOCUS_48460 sequence0962 source 1..771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0963 source 1..468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0964 source 1..671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0965 source 1..458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0966 source 1..1588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 408..1202 product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730710.1 transl_table 11 codon_start 1 locus_tag LOCUS_48470 gene sepH CDS complement(1207..1479) product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730711.1 transl_table 11 codon_start 1 locus_tag LOCUS_48480 sequence0967 source 1..606 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0968 source 1..451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0969 source 1..621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0970 source 1..732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 324..566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727503.1 transl_table 11 codon_start 1 locus_tag LOCUS_48490 sequence0971 source 1..374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0972 source 1..479 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0973 source 1..612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0974 source 1..144233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(100..1371) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894552.1 transl_table 11 codon_start 1 locus_tag LOCUS_48500 CDS complement(1431..2408) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728859.1 transl_table 11 codon_start 1 locus_tag LOCUS_48510 gene meaB CDS complement(2419..4719) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728858.1 transl_table 11 codon_start 1 locus_tag LOCUS_48520 gene scpA CDS complement(4716..6566) product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519593.1 transl_table 11 codon_start 1 locus_tag LOCUS_48530 gene mutA CDS 6710..7462 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728856.1 transl_table 11 codon_start 1 locus_tag LOCUS_48540 CDS complement(7450..8667) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728854.1 transl_table 11 codon_start 1 locus_tag LOCUS_48550 CDS complement(8700..9131) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 transl_table 11 codon_start 1 locus_tag LOCUS_48560 CDS 9218..10051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728852.1 transl_table 11 codon_start 1 locus_tag LOCUS_48570 CDS complement(10063..10323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48580 CDS complement(10423..11424) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728851.1 transl_table 11 codon_start 1 locus_tag LOCUS_48590 CDS complement(11428..12234) product NADH-dependent enoyl-ACP reductase InhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894540.1 transl_table 11 codon_start 1 locus_tag LOCUS_48600 gene inhA CDS complement(12253..13020) product 3-oxoacyl-ACP reductase FabG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728850.1 transl_table 11 codon_start 1 locus_tag LOCUS_48610 gene fabG1 CDS complement(13064..14074) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407530.1 transl_table 11 codon_start 1 locus_tag LOCUS_48620 CDS complement(14090..15097) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877593.1 transl_table 11 codon_start 1 locus_tag LOCUS_48630 CDS complement(15120..16076) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728848.1 transl_table 11 codon_start 1 locus_tag LOCUS_48640 CDS complement(16073..17236) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877592.1 transl_table 11 codon_start 1 locus_tag LOCUS_48650 CDS complement(17412..18071) product NlpC/P60 family peptidoglycan endopeptidase RipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728846.1 transl_table 11 codon_start 1 locus_tag LOCUS_48660 gene ripB CDS complement(18128..19480) product NlpC/P60 family peptidoglycan endopeptidase RipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728845.1 transl_table 11 codon_start 1 locus_tag LOCUS_48670 gene ripA CDS 19392..19607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48680 CDS complement(19795..20322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728844.1 transl_table 11 codon_start 1 locus_tag LOCUS_48690 CDS 20519..23323 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728843.1 transl_table 11 codon_start 1 locus_tag LOCUS_48700 CDS 23326..23907 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728842.1 transl_table 11 codon_start 1 locus_tag LOCUS_48710 CDS complement(23898..24095) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407511.1 transl_table 11 codon_start 1 locus_tag LOCUS_48720 CDS complement(24193..25821) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894527.1 transl_table 11 codon_start 1 locus_tag LOCUS_48730 CDS complement(25841..26677) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877590.1 transl_table 11 codon_start 1 locus_tag LOCUS_48740 CDS complement(26695..27060) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894525.1 transl_table 11 codon_start 1 locus_tag LOCUS_48750 gene trxA CDS complement(27128..27844) product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225375.1 transl_table 11 codon_start 1 locus_tag LOCUS_48760 CDS complement(27841..28482) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226912.1 transl_table 11 codon_start 1 locus_tag LOCUS_48770 CDS complement(28540..30027) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328003.1 transl_table 11 codon_start 1 locus_tag LOCUS_48780 CDS complement(30080..30652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877588.1 transl_table 11 codon_start 1 locus_tag LOCUS_48790 CDS complement(30683..32398) product MOSC and FAD-binding oxidoreductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225744.1 transl_table 11 codon_start 1 locus_tag LOCUS_48800 CDS complement(32395..32907) product CGNR zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891451.1 transl_table 11 codon_start 1 locus_tag LOCUS_48810 CDS 32994..33863 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726677.1 transl_table 11 codon_start 1 locus_tag LOCUS_48820 CDS 33894..34607 product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891449.1 transl_table 11 codon_start 1 locus_tag LOCUS_48830 CDS complement(34614..34961) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407492.1 transl_table 11 codon_start 1 locus_tag LOCUS_48840 CDS complement(34939..35409) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894513.1 transl_table 11 codon_start 1 locus_tag LOCUS_48850 CDS complement(35406..36677) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894512.1 transl_table 11 codon_start 1 locus_tag LOCUS_48860 CDS complement(36679..37446) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894511.1 transl_table 11 codon_start 1 locus_tag LOCUS_48870 gene sufC CDS complement(37443..38621) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728831.1 transl_table 11 codon_start 1 locus_tag LOCUS_48880 gene sufD CDS complement(38622..40049) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894509.1 transl_table 11 codon_start 1 locus_tag LOCUS_48890 gene sufB CDS complement(40046..40804) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877586.1 transl_table 11 codon_start 1 locus_tag LOCUS_48900 CDS 40914..41849 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 transl_table 11 codon_start 1 locus_tag LOCUS_48910 CDS 41866..43578 product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877585.1 transl_table 11 codon_start 1 locus_tag LOCUS_48920 gene mptB CDS 43611..44516 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728828.1 transl_table 11 codon_start 1 locus_tag LOCUS_48930 CDS 44513..45286 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728827.1 transl_table 11 codon_start 1 locus_tag LOCUS_48940 CDS complement(45200..45883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_48950 CDS 45972..46544 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225203.1 transl_table 11 codon_start 1 locus_tag LOCUS_48960 CDS 46592..47602 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728826.1 transl_table 11 codon_start 1 locus_tag LOCUS_48970 CDS complement(47498..48436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877581.1 transl_table 11 codon_start 1 locus_tag LOCUS_48980 CDS 48456..49427 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877580.1 transl_table 11 codon_start 1 locus_tag LOCUS_48990 CDS complement(49438..50370) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894492.1 transl_table 11 codon_start 1 locus_tag LOCUS_49000 CDS 50549..52642 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728815.1 transl_table 11 codon_start 1 locus_tag LOCUS_49010 gene tkt CDS 52666..53784 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728814.1 transl_table 11 codon_start 1 locus_tag LOCUS_49020 gene tal CDS 53781..55307 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728813.1 transl_table 11 codon_start 1 locus_tag LOCUS_49030 gene zwf CDS 55307..56218 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894487.1 transl_table 11 codon_start 1 locus_tag LOCUS_49040 gene opcA CDS 56215..56952 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894486.1 transl_table 11 codon_start 1 locus_tag LOCUS_49050 gene pgl CDS complement(56994..58373) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113389.1 transl_table 11 codon_start 1 locus_tag LOCUS_49060 CDS 58700..59086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728812.1 transl_table 11 codon_start 1 locus_tag LOCUS_49070 CDS 59086..60369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49080 CDS 60459..60752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49090 CDS complement(60749..63538) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728811.1 transl_table 11 codon_start 1 locus_tag LOCUS_49100 gene ppc CDS complement(63598..63831) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894475.1 transl_table 11 codon_start 1 locus_tag LOCUS_49110 gene secG CDS complement(63862..64647) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728805.1 transl_table 11 codon_start 1 locus_tag LOCUS_49120 gene tpiA CDS complement(64660..65886) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894473.1 transl_table 11 codon_start 1 locus_tag LOCUS_49130 CDS complement(65891..66913) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894472.1 transl_table 11 codon_start 1 locus_tag LOCUS_49140 gene gap CDS 67110..67346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49150 CDS complement(67363..68073) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444615.1 transl_table 11 codon_start 1 locus_tag LOCUS_49160 CDS complement(68139..69122) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877572.1 transl_table 11 codon_start 1 locus_tag LOCUS_49170 gene whiA CDS complement(69113..70135) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728801.1 transl_table 11 codon_start 1 locus_tag LOCUS_49180 gene yvcK CDS complement(70132..71058) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894466.1 transl_table 11 codon_start 1 locus_tag LOCUS_49190 gene rapZ CDS complement(71055..73067) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728800.1 transl_table 11 codon_start 1 locus_tag LOCUS_49200 gene uvrC CDS 73103..75070 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728799.1 transl_table 11 codon_start 1 locus_tag LOCUS_49210 gene ggt CDS 75067..75537 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728798.1 transl_table 11 codon_start 1 locus_tag LOCUS_49220 CDS complement(75524..75973) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139538.1 transl_table 11 codon_start 1 locus_tag LOCUS_49230 CDS complement(75970..76455) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898872.1 transl_table 11 codon_start 1 locus_tag LOCUS_49240 gene ribH CDS complement(76478..77791) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894459.1 transl_table 11 codon_start 1 locus_tag LOCUS_49250 CDS complement(77872..78492) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894458.1 transl_table 11 codon_start 1 locus_tag LOCUS_49260 CDS 78603..79295 product LppX_LprAFG lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894457.1 transl_table 11 codon_start 1 locus_tag LOCUS_49270 CDS 79295..80998 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462758.1 transl_table 11 codon_start 1 locus_tag LOCUS_49280 CDS complement(81006..81158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49290 CDS 81341..81904 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030978.1 transl_table 11 codon_start 1 locus_tag LOCUS_49300 CDS 81950..82999 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413230.1 transl_table 11 codon_start 1 locus_tag LOCUS_49310 CDS 83003..84019 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899801.1 transl_table 11 codon_start 1 locus_tag LOCUS_49320 CDS complement(84016..85017) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104448.1 transl_table 11 codon_start 1 locus_tag LOCUS_49330 gene ribD CDS complement(85014..85691) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894453.1 transl_table 11 codon_start 1 locus_tag LOCUS_49340 gene rpe CDS complement(85696..87069) product 16S rRNA m5C967 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728793.1 transl_table 11 codon_start 1 locus_tag LOCUS_49350 CDS complement(87066..87995) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728792.1 transl_table 11 codon_start 1 locus_tag LOCUS_49360 gene fmt CDS complement(88030..88566) product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728791.1 transl_table 11 codon_start 1 locus_tag LOCUS_49370 CDS complement(88560..90377) product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728790.1 transl_table 11 codon_start 1 locus_tag LOCUS_49380 CDS complement(90415..92442) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234904336.1 transl_table 11 codon_start 1 locus_tag LOCUS_49390 CDS complement(92443..93102) product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728788.1 transl_table 11 codon_start 1 locus_tag LOCUS_49400 CDS 93176..94126 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877566.1 transl_table 11 codon_start 1 locus_tag LOCUS_49410 CDS 94260..95741 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407257.1 transl_table 11 codon_start 1 locus_tag LOCUS_49420 CDS 95842..96198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49430 CDS complement(96195..97403) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894439.1 transl_table 11 codon_start 1 locus_tag LOCUS_49440 gene metK CDS complement(97532..98785) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728784.1 transl_table 11 codon_start 1 locus_tag LOCUS_49450 gene coaBC CDS complement(98826..99185) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728783.1 transl_table 11 codon_start 1 locus_tag LOCUS_49460 gene rpoZ CDS complement(99160..99756) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728781.1 transl_table 11 codon_start 1 locus_tag LOCUS_49470 gene gmk CDS complement(99772..100086) product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894434.1 transl_table 11 codon_start 1 locus_tag LOCUS_49480 gene mihF CDS 100636..101700 product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420436.1 transl_table 11 codon_start 1 locus_tag LOCUS_49490 CDS complement(101741..102559) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894432.1 transl_table 11 codon_start 1 locus_tag LOCUS_49500 gene pyrF CDS complement(102556..105894) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728779.1 transl_table 11 codon_start 1 locus_tag LOCUS_49510 gene carB CDS complement(105894..107018) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728778.1 transl_table 11 codon_start 1 locus_tag LOCUS_49520 gene carA CDS complement(107015..107551) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728777.1 transl_table 11 codon_start 1 locus_tag LOCUS_49530 CDS complement(107548..108840) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407204.1 transl_table 11 codon_start 1 locus_tag LOCUS_49540 CDS complement(108837..109784) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894427.1 transl_table 11 codon_start 1 locus_tag LOCUS_49550 CDS complement(109781..110353) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894426.1 transl_table 11 codon_start 1 locus_tag LOCUS_49560 gene pyrR CDS 110490..111695 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728774.1 transl_table 11 codon_start 1 locus_tag LOCUS_49570 CDS 111711..112934 product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728773.1 transl_table 11 codon_start 1 locus_tag LOCUS_49580 CDS complement(112940..113494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49590 CDS complement(113495..113983) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728771.1 transl_table 11 codon_start 1 locus_tag LOCUS_49600 gene nusB CDS complement(113976..114539) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894417.1 transl_table 11 codon_start 1 locus_tag LOCUS_49610 gene efp CDS complement(114558..115652) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728770.1 transl_table 11 codon_start 1 locus_tag LOCUS_49620 CDS 115686..116234 product B-4DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728769.1 transl_table 11 codon_start 1 locus_tag LOCUS_49630 CDS 116275..117174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49640 CDS complement(117171..117857) product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807676.1 transl_table 11 codon_start 1 locus_tag LOCUS_49650 CDS complement(117854..118549) product 3-oxoacid CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705261.1 transl_table 11 codon_start 1 locus_tag LOCUS_49660 CDS complement(118546..119727) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189284957.1 transl_table 11 codon_start 1 locus_tag LOCUS_49670 gene pcaD CDS complement(119724..120923) product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728464.1 transl_table 11 codon_start 1 locus_tag LOCUS_49680 gene pcaB CDS complement(120920..121483) product protocatechuate 3,4-dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728463.1 transl_table 11 codon_start 1 locus_tag LOCUS_49690 gene pcaG CDS complement(121483..122280) product protocatechuate 3,4-dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728462.1 transl_table 11 codon_start 1 locus_tag LOCUS_49700 gene pcaH CDS 122343..123092 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893955.1 transl_table 11 codon_start 1 locus_tag LOCUS_49710 CDS complement(123121..124479) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226203.1 transl_table 11 codon_start 1 locus_tag LOCUS_49720 CDS complement(124489..125382) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198727.1 transl_table 11 codon_start 1 locus_tag LOCUS_49730 CDS complement(125481..126122) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226204.1 transl_table 11 codon_start 1 locus_tag LOCUS_49740 CDS 126215..128038 product dehydroshikimate dehydratase QsuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013639.1 transl_table 11 codon_start 1 locus_tag LOCUS_49750 gene qsuB CDS complement(128025..128486) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413001.1 transl_table 11 codon_start 1 locus_tag LOCUS_49760 gene aroQ CDS complement(128483..129571) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894414.1 transl_table 11 codon_start 1 locus_tag LOCUS_49770 gene aroB CDS complement(129564..130211) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728767.1 transl_table 11 codon_start 1 locus_tag LOCUS_49780 CDS complement(130211..131362) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894412.1 transl_table 11 codon_start 1 locus_tag LOCUS_49790 gene aroC CDS 131556..132068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49800 CDS 132065..132802 product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726894.1 transl_table 11 codon_start 1 locus_tag LOCUS_49810 gene nthB CDS 132799..133419 product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726895.1 transl_table 11 codon_start 1 locus_tag LOCUS_49820 gene nthA CDS 133416..133703 product nitrile hydratase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726896.1 transl_table 11 codon_start 1 locus_tag LOCUS_49830 CDS complement(133700..134323) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085162530.1 transl_table 11 codon_start 1 locus_tag LOCUS_49840 CDS complement(134333..134824) product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896441.1 transl_table 11 codon_start 1 locus_tag LOCUS_49850 CDS complement(134821..135198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49860 CDS complement(135254..135685) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728766.1 transl_table 11 codon_start 1 locus_tag LOCUS_49870 CDS complement(135701..136474) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413193.1 transl_table 11 codon_start 1 locus_tag LOCUS_49880 CDS complement(136517..137788) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894408.1 transl_table 11 codon_start 1 locus_tag LOCUS_49890 CDS complement(137781..138320) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894407.1 transl_table 11 codon_start 1 locus_tag LOCUS_49900 gene ruvX CDS complement(138325..141015) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728764.1 transl_table 11 codon_start 1 locus_tag LOCUS_49910 gene alaS CDS complement(141154..141555) product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104445.1 transl_table 11 codon_start 1 locus_tag LOCUS_49920 CDS 141653..141961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49930 CDS complement(142019..142492) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225944.1 transl_table 11 codon_start 1 locus_tag LOCUS_49940 CDS complement(142489..142851) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225945.1 transl_table 11 codon_start 1 locus_tag LOCUS_49950 sequence0975 source 1..336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0976 source 1..767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 33..755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49960 sequence0977 source 1..682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0978 source 1..421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0979 source 1..128164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49970 CDS 300..857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_49980 note possible pseudo, frameshifted CDS 906..4226 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727789.1 transl_table 11 codon_start 1 locus_tag LOCUS_49990 CDS 4243..5385 product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091313186.1 transl_table 11 codon_start 1 locus_tag LOCUS_50000 CDS complement(5382..5828) product TIGR03667 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417882.1 transl_table 11 codon_start 1 locus_tag LOCUS_50010 CDS 5822..6460 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727791.1 transl_table 11 codon_start 1 locus_tag LOCUS_50020 CDS complement(6464..6928) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727792.1 transl_table 11 codon_start 1 locus_tag LOCUS_50030 CDS 7347..10007 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104606.1 transl_table 11 codon_start 1 locus_tag LOCUS_50040 CDS 10004..10432 product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893045.1 transl_table 11 codon_start 1 locus_tag LOCUS_50050 CDS 10440..10811 product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893046.1 transl_table 11 codon_start 1 locus_tag LOCUS_50060 CDS 10792..11403 product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893047.1 transl_table 11 codon_start 1 locus_tag LOCUS_50070 CDS 11408..11971 product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893048.1 transl_table 11 codon_start 1 locus_tag LOCUS_50080 CDS 11999..12847 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111553.1 transl_table 11 codon_start 1 locus_tag LOCUS_50090 CDS 12926..14200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50100 CDS complement(14172..15008) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495342.1 transl_table 11 codon_start 1 locus_tag LOCUS_50110 CDS complement(15013..17556) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893049.1 transl_table 11 codon_start 1 locus_tag LOCUS_50120 CDS complement(17743..18150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50130 CDS 18200..18763 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079730.1 transl_table 11 codon_start 1 locus_tag LOCUS_50140 CDS 18815..19312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50150 CDS complement(19309..20505) product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727796.1 transl_table 11 codon_start 1 locus_tag LOCUS_50160 CDS 20564..21421 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417751.1 transl_table 11 codon_start 1 locus_tag LOCUS_50170 CDS 21418..21711 product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417749.1 transl_table 11 codon_start 1 locus_tag LOCUS_50180 CDS 21852..23231 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727218.1 transl_table 11 codon_start 1 locus_tag LOCUS_50190 CDS complement(23167..23928) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727800.1 transl_table 11 codon_start 1 locus_tag LOCUS_50200 CDS complement(23925..25058) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417458.1 transl_table 11 codon_start 1 locus_tag LOCUS_50210 CDS complement(25058..26398) product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893059.1 transl_table 11 codon_start 1 locus_tag LOCUS_50220 CDS 26763..29000 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727802.1 transl_table 11 codon_start 1 locus_tag LOCUS_50230 CDS complement(28997..29830) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727803.1 transl_table 11 codon_start 1 locus_tag LOCUS_50240 CDS 29956..31308 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898428.1 transl_table 11 codon_start 1 locus_tag LOCUS_50250 CDS 31330..32337 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727804.1 transl_table 11 codon_start 1 locus_tag LOCUS_50260 gene trpS CDS 32371..33420 product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727805.1 transl_table 11 codon_start 1 locus_tag LOCUS_50270 gene yhjD CDS complement(33433..34968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50280 CDS 35192..36490 product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 transl_table 11 codon_start 1 locus_tag LOCUS_50290 CDS complement(36509..37690) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893068.1 transl_table 11 codon_start 1 locus_tag LOCUS_50300 CDS complement(37840..38856) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080724.1 transl_table 11 codon_start 1 locus_tag LOCUS_50310 CDS complement(38880..40259) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893069.1 transl_table 11 codon_start 1 locus_tag LOCUS_50320 CDS complement(40256..40741) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877152.1 transl_table 11 codon_start 1 locus_tag LOCUS_50330 CDS 40888..42393 product gamma-aminobutyraldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877153.1 transl_table 11 codon_start 1 locus_tag LOCUS_50340 CDS complement(42416..43276) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727781.1 transl_table 11 codon_start 1 locus_tag LOCUS_50350 CDS complement(43292..44800) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081393.1 transl_table 11 codon_start 1 locus_tag LOCUS_50360 CDS 44914..45867 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727809.1 transl_table 11 codon_start 1 locus_tag LOCUS_50370 CDS complement(45815..46405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50380 CDS 46576..47598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50390 CDS complement(47595..48386) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417279.1 transl_table 11 codon_start 1 locus_tag LOCUS_50400 CDS complement(48388..50142) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727811.1 transl_table 11 codon_start 1 locus_tag LOCUS_50410 gene sdhA CDS complement(50165..50656) product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893078.1 transl_table 11 codon_start 1 locus_tag LOCUS_50420 CDS complement(50653..50979) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727812.1 transl_table 11 codon_start 1 locus_tag LOCUS_50430 gene sdhC CDS 51326..51748 product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877157.1 transl_table 11 codon_start 1 locus_tag LOCUS_50440 CDS 51756..53072 product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727815.1 transl_table 11 codon_start 1 locus_tag LOCUS_50450 CDS 53074..54159 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877158.1 transl_table 11 codon_start 1 locus_tag LOCUS_50460 CDS complement(54169..55443) product protein export chaperone SatS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727824.1 transl_table 11 codon_start 1 locus_tag LOCUS_50470 gene satS CDS 55540..55989 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443174.1 transl_table 11 codon_start 1 locus_tag LOCUS_50480 CDS complement(55990..57072) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727826.1 transl_table 11 codon_start 1 locus_tag LOCUS_50490 CDS complement(57075..57371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50500 CDS 57420..58043 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893093.1 transl_table 11 codon_start 1 locus_tag LOCUS_50510 gene upp CDS 58717..59595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50520 CDS complement(59609..61249) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727833.1 transl_table 11 codon_start 1 locus_tag LOCUS_50530 CDS complement(61246..61710) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893095.1 transl_table 11 codon_start 1 locus_tag LOCUS_50540 CDS 61799..62917 product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893096.1 transl_table 11 codon_start 1 locus_tag LOCUS_50550 CDS complement(62863..63690) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727836.1 transl_table 11 codon_start 1 locus_tag LOCUS_50560 CDS 63714..64895 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727837.1 transl_table 11 codon_start 1 locus_tag LOCUS_50570 CDS 64892..66061 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_50580 CDS 66248..67135 product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727857.1 transl_table 11 codon_start 1 locus_tag LOCUS_50590 CDS complement(67206..67682) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727858.1 transl_table 11 codon_start 1 locus_tag LOCUS_50600 CDS 67762..69177 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727859.1 transl_table 11 codon_start 1 locus_tag LOCUS_50610 CDS 69234..70973 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727860.1 transl_table 11 codon_start 1 locus_tag LOCUS_50620 CDS 70988..71830 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727861.1 transl_table 11 codon_start 1 locus_tag LOCUS_50630 CDS complement(71822..73678) product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223544.1 transl_table 11 codon_start 1 locus_tag LOCUS_50640 CDS complement(74379..74513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50650 CDS 74611..75381 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727863.1 transl_table 11 codon_start 1 locus_tag LOCUS_50660 CDS complement(75350..76135) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727864.1 transl_table 11 codon_start 1 locus_tag LOCUS_50670 CDS complement(76167..76850) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727865.1 transl_table 11 codon_start 1 locus_tag LOCUS_50680 CDS 76920..77969 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727866.1 transl_table 11 codon_start 1 locus_tag LOCUS_50690 CDS 77998..79101 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727867.1 transl_table 11 codon_start 1 locus_tag LOCUS_50700 CDS complement(79106..79864) product endonuclease VIII Nei2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893139.1 transl_table 11 codon_start 1 locus_tag LOCUS_50710 gene nei2 CDS complement(79871..84427) product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727880.1 transl_table 11 codon_start 1 locus_tag LOCUS_50720 CDS complement(84460..85101) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417200.1 transl_table 11 codon_start 1 locus_tag LOCUS_50730 CDS complement(85231..86775) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727883.1 transl_table 11 codon_start 1 locus_tag LOCUS_50740 CDS complement(86772..87974) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417184.1 transl_table 11 codon_start 1 locus_tag LOCUS_50750 CDS 88005..88457 product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417179.1 transl_table 11 codon_start 1 locus_tag LOCUS_50760 gene lrpA CDS 88510..89850 product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893146.1 transl_table 11 codon_start 1 locus_tag LOCUS_50770 gene lat CDS complement(89847..90437) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049747928.1 transl_table 11 codon_start 1 locus_tag LOCUS_50780 CDS 90529..91209 product PAS and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088224.1 transl_table 11 codon_start 1 locus_tag LOCUS_50790 CDS 91279..91650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50800 CDS 91647..92264 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727887.1 transl_table 11 codon_start 1 locus_tag LOCUS_50810 CDS 92355..92663 product protein UsfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727908.1 transl_table 11 codon_start 1 locus_tag LOCUS_50820 gene usfY CDS complement(92727..92963) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727888.1 transl_table 11 codon_start 1 locus_tag LOCUS_50830 CDS complement(93067..93264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235623983.1 transl_table 11 codon_start 1 locus_tag LOCUS_50840 CDS complement(93340..94356) product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727903.1 transl_table 11 codon_start 1 locus_tag LOCUS_50850 CDS complement(94438..94605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50860 CDS 94727..95161 product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893193.1 transl_table 11 codon_start 1 locus_tag LOCUS_50870 gene rsbW CDS 95224..95946 product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624325.1 transl_table 11 codon_start 1 locus_tag LOCUS_50880 CDS complement(95917..96360) product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727905.1 transl_table 11 codon_start 1 locus_tag LOCUS_50890 CDS 96760..97161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50900 CDS complement(97162..97572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727922.1 transl_table 11 codon_start 1 locus_tag LOCUS_50910 CDS 97529..98227 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093980.1 transl_table 11 codon_start 1 locus_tag LOCUS_50920 CDS complement(98247..100046) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893197.1 transl_table 11 codon_start 1 locus_tag LOCUS_50930 CDS complement(100184..100963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_50940 CDS complement(101050..101454) product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727923.1 transl_table 11 codon_start 1 locus_tag LOCUS_50950 CDS complement(101481..102368) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893199.1 transl_table 11 codon_start 1 locus_tag LOCUS_50960 CDS complement(102395..103036) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417146.1 transl_table 11 codon_start 1 locus_tag LOCUS_50970 CDS complement(103033..103323) product acyl-CoA carboxylase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727925.1 transl_table 11 codon_start 1 locus_tag LOCUS_50980 CDS complement(103320..104960) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893203.1 transl_table 11 codon_start 1 locus_tag LOCUS_50990 CDS 105056..105862 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899999.1 transl_table 11 codon_start 1 locus_tag LOCUS_51000 CDS 105884..106402 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727928.1 transl_table 11 codon_start 1 locus_tag LOCUS_51010 CDS complement(106357..107040) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899998.1 transl_table 11 codon_start 1 locus_tag LOCUS_51020 CDS 107170..108354 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083453060.1 transl_table 11 codon_start 1 locus_tag LOCUS_51030 CDS 108347..108880 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877211.1 transl_table 11 codon_start 1 locus_tag LOCUS_51040 gene purE CDS 108837..110057 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417122.1 transl_table 11 codon_start 1 locus_tag LOCUS_51050 CDS complement(110146..111531) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110043.1 transl_table 11 codon_start 1 locus_tag LOCUS_51060 CDS complement(111582..112286) product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727932.1 transl_table 11 codon_start 1 locus_tag LOCUS_51070 CDS complement(112289..113755) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727933.1 transl_table 11 codon_start 1 locus_tag LOCUS_51080 CDS 113871..114704 product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893216.1 transl_table 11 codon_start 1 locus_tag LOCUS_51090 gene rfbD CDS 114727..115635 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 transl_table 11 codon_start 1 locus_tag LOCUS_51100 CDS 115662..116708 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080830.1 transl_table 11 codon_start 1 locus_tag LOCUS_51110 CDS complement(116757..117293) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 transl_table 11 codon_start 1 locus_tag LOCUS_51120 CDS complement(117290..118630) product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727937.1 transl_table 11 codon_start 1 locus_tag LOCUS_51130 CDS complement(118627..119664) product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727938.1 transl_table 11 codon_start 1 locus_tag LOCUS_51140 gene cofD CDS 119920..120336 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020102910.1 transl_table 11 codon_start 1 locus_tag LOCUS_51150 CDS complement(120346..120882) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417076.1 transl_table 11 codon_start 1 locus_tag LOCUS_51160 CDS 120897..121316 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727939.1 transl_table 11 codon_start 1 locus_tag LOCUS_51170 CDS 121402..122802 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727940.1 transl_table 11 codon_start 1 locus_tag LOCUS_51180 CDS 122799..123905 product TobH protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727941.1 transl_table 11 codon_start 1 locus_tag LOCUS_51190 CDS 123910..125136 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877219.1 transl_table 11 codon_start 1 locus_tag LOCUS_51200 gene manA CDS complement(125152..126468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899988.1 transl_table 11 codon_start 1 locus_tag LOCUS_51210 CDS 126373..126612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51220 CDS 126587..128056 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727944.1 transl_table 11 codon_start 1 locus_tag LOCUS_51230 sequence0980 source 1..736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(168..>736) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896836.1:resuscitation-promoting factor locus_tag LOCUS_51240 sequence0981 source 1..601 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0982 source 1..730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0983 source 1..681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0984 source 1..533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0985 source 1..715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0986 source 1..736 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0987 source 1..416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(264..338) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 sequence0988 source 1..260555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(321..1151) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 transl_table 11 codon_start 1 locus_tag LOCUS_51250 CDS complement(1148..2050) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091105.1 transl_table 11 codon_start 1 locus_tag LOCUS_51260 CDS complement(2043..2858) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731235.1 transl_table 11 codon_start 1 locus_tag LOCUS_51270 CDS complement(2870..3415) product bacterial proteasome activator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731234.1 transl_table 11 codon_start 1 locus_tag LOCUS_51280 CDS 3685..4881 product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731233.1 transl_table 11 codon_start 1 locus_tag LOCUS_51290 CDS complement(4894..5877) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731232.1 transl_table 11 codon_start 1 locus_tag LOCUS_51300 CDS 5993..6469 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897770.1 transl_table 11 codon_start 1 locus_tag LOCUS_51310 tRNA 6501..6590 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 6617..7183 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224991.1 transl_table 11 codon_start 1 locus_tag LOCUS_51320 CDS 7241..7573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51330 CDS complement(7570..8967) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027697.1 transl_table 11 codon_start 1 locus_tag LOCUS_51340 CDS 8999..9412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51350 CDS 9412..10320 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 transl_table 11 codon_start 1 locus_tag LOCUS_51360 CDS complement(10307..11131) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420587.1 transl_table 11 codon_start 1 locus_tag LOCUS_51370 CDS complement(11152..11625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51380 CDS 11628..12209 product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420580.1 transl_table 11 codon_start 1 locus_tag LOCUS_51390 CDS complement(12206..12706) product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897767.1 transl_table 11 codon_start 1 locus_tag LOCUS_51400 CDS complement(12666..13130) product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897767.1 transl_table 11 codon_start 1 locus_tag LOCUS_51410 CDS complement(13127..14182) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731224.1 transl_table 11 codon_start 1 locus_tag LOCUS_51420 gene hisC tRNA 14277..14368 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 14385..14458 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 15256..15639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51430 CDS 15701..15988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51440 note possible pseudo, frameshifted CDS 16039..16839 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112560.1 transl_table 11 codon_start 1 locus_tag LOCUS_51450 CDS complement(17339..17758) product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878533.1 transl_table 11 codon_start 1 locus_tag LOCUS_51460 CDS 18318..19088 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027504.1 transl_table 11 codon_start 1 locus_tag LOCUS_51470 CDS complement(19394..19807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51480 CDS complement(19891..20163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51490 CDS complement(20156..20839) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 transl_table 11 codon_start 1 locus_tag LOCUS_51500 CDS 20952..21488 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922248.1 transl_table 11 codon_start 1 locus_tag LOCUS_51510 CDS 21812..22375 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51520 CDS 22478..23038 product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228370.1 transl_table 11 codon_start 1 locus_tag LOCUS_51530 CDS 23048..23551 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897761.1 transl_table 11 codon_start 1 locus_tag LOCUS_51540 CDS 23544..23957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51550 CDS complement(23959..24297) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878621.1 transl_table 11 codon_start 1 locus_tag LOCUS_51560 CDS 24387..25253 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731219.1 transl_table 11 codon_start 1 locus_tag LOCUS_51570 CDS 25250..26107 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731218.1 transl_table 11 codon_start 1 locus_tag LOCUS_51580 CDS 26145..26978 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409355.1 transl_table 11 codon_start 1 locus_tag LOCUS_51590 CDS 26999..28876 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731217.1 transl_table 11 codon_start 1 locus_tag LOCUS_51600 CDS complement(28902..29675) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731216.1 transl_table 11 codon_start 1 locus_tag LOCUS_51610 CDS 29693..30295 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 transl_table 11 codon_start 1 locus_tag LOCUS_51620 CDS 30305..31333 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731214.1 transl_table 11 codon_start 1 locus_tag LOCUS_51630 CDS complement(31335..31712) product DUF1049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897753.1 transl_table 11 codon_start 1 locus_tag LOCUS_51640 CDS 31813..32805 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743594.1 transl_table 11 codon_start 1 locus_tag LOCUS_51650 CDS 32802..33908 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731211.1 transl_table 11 codon_start 1 locus_tag LOCUS_51660 CDS 33909..34574 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731210.1 transl_table 11 codon_start 1 locus_tag LOCUS_51670 CDS 34571..35332 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731209.1 transl_table 11 codon_start 1 locus_tag LOCUS_51680 CDS 35434..35955 product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878619.1 transl_table 11 codon_start 1 locus_tag LOCUS_51690 CDS complement(35918..36823) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731208.1 transl_table 11 codon_start 1 locus_tag LOCUS_51700 CDS 36971..37492 product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731207.1 transl_table 11 codon_start 1 locus_tag LOCUS_51710 CDS 37541..37990 product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420508.1 transl_table 11 codon_start 1 locus_tag LOCUS_51720 CDS complement(37992..38285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51730 tRNA 38418..38508 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 39101..41752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51740 CDS complement(41780..42124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51750 CDS 42008..44164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51760 CDS 44182..45258 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_51770 CDS 45359..46546 product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731062.1 transl_table 11 codon_start 1 locus_tag LOCUS_51780 CDS 46543..48114 product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731061.1 transl_table 11 codon_start 1 locus_tag LOCUS_51790 CDS 48111..48551 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 transl_table 11 codon_start 1 locus_tag LOCUS_51800 CDS complement(48558..48968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51810 CDS complement(49038..49358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51820 CDS 49458..49808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51830 CDS complement(49878..50345) product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420544.1 transl_table 11 codon_start 1 locus_tag LOCUS_51840 gene lpqH CDS complement(50464..50901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51850 CDS 50958..52172 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897733.1 transl_table 11 codon_start 1 locus_tag LOCUS_51860 gene tgt CDS complement(52229..53599) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 transl_table 11 codon_start 1 locus_tag LOCUS_51870 CDS 53918..54097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51880 CDS complement(54094..54849) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731193.1 transl_table 11 codon_start 1 locus_tag LOCUS_51890 CDS complement(54846..56180) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897727.1 transl_table 11 codon_start 1 locus_tag LOCUS_51900 CDS 56359..57699 product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109985.1 transl_table 11 codon_start 1 locus_tag LOCUS_51910 CDS complement(57733..58602) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897726.1 transl_table 11 codon_start 1 locus_tag LOCUS_51920 gene gluQRS CDS complement(58616..58984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897725.1 transl_table 11 codon_start 1 locus_tag LOCUS_51930 CDS complement(58975..60150) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027795.1 transl_table 11 codon_start 1 locus_tag LOCUS_51940 CDS 60222..60956 product DUF899 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776254.1 transl_table 11 codon_start 1 locus_tag LOCUS_51950 CDS complement(60937..61347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_51960 CDS complement(61392..62606) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463816.1 transl_table 11 codon_start 1 locus_tag LOCUS_51970 CDS complement(62619..63683) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420435.1 transl_table 11 codon_start 1 locus_tag LOCUS_51980 CDS complement(63711..65825) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 transl_table 11 codon_start 1 locus_tag LOCUS_51990 CDS complement(65822..66889) product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027566.1 transl_table 11 codon_start 1 locus_tag LOCUS_52000 CDS 66942..67694 product DUF899 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398004.1 transl_table 11 codon_start 1 locus_tag LOCUS_52010 CDS complement(67908..68471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52020 CDS complement(68678..69034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52030 CDS complement(69125..69406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52040 CDS complement(69832..71790) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112725.1 transl_table 11 codon_start 1 locus_tag LOCUS_52050 CDS complement(71787..72170) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112726.1 transl_table 11 codon_start 1 locus_tag LOCUS_52060 CDS complement(72282..73355) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420435.1 transl_table 11 codon_start 1 locus_tag LOCUS_52070 CDS complement(73360..75813) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211934313.1 transl_table 11 codon_start 1 locus_tag LOCUS_52080 CDS complement(75870..77069) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189955127.1 transl_table 11 codon_start 1 locus_tag LOCUS_52090 CDS 77319..78032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52100 note possible pseudo, frameshifted CDS 78032..79090 product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878612.1 transl_table 11 codon_start 1 locus_tag LOCUS_52110 gene ligD CDS 79249..79905 product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727721.1 transl_table 11 codon_start 1 locus_tag LOCUS_52120 CDS complement(79902..82118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52130 CDS 82646..84535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52140 CDS 84612..85049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52150 CDS 85053..86381 product lipase LipD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900433.1 transl_table 11 codon_start 1 locus_tag LOCUS_52160 gene lipD CDS complement(86378..87445) product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 transl_table 11 codon_start 1 locus_tag LOCUS_52170 CDS 87614..88192 product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727035.1 transl_table 11 codon_start 1 locus_tag LOCUS_52180 CDS complement(88202..89227) product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731179.1 transl_table 11 codon_start 1 locus_tag LOCUS_52190 CDS complement(89256..90050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897708.1 transl_table 11 codon_start 1 locus_tag LOCUS_52200 tRNA complement(90123..90209) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 90412..91689 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 transl_table 11 codon_start 1 locus_tag LOCUS_52210 CDS 91741..93648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52220 CDS complement(93652..94965) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897704.1 transl_table 11 codon_start 1 locus_tag LOCUS_52230 CDS complement(94962..96353) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731176.1 transl_table 11 codon_start 1 locus_tag LOCUS_52240 CDS 96429..96866 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897702.1 transl_table 11 codon_start 1 locus_tag LOCUS_52250 CDS complement(96872..97636) product Rv3717 family N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731175.1 transl_table 11 codon_start 1 locus_tag LOCUS_52260 CDS 97725..98063 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104589.1 transl_table 11 codon_start 1 locus_tag LOCUS_52270 CDS 98065..98676 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897699.1 transl_table 11 codon_start 1 locus_tag LOCUS_52280 gene recR CDS 98789..99655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110712.1 transl_table 11 codon_start 1 locus_tag LOCUS_52290 CDS complement(99652..100368) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731174.1 transl_table 11 codon_start 1 locus_tag LOCUS_52300 CDS complement(100361..101641) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900738.1 transl_table 11 codon_start 1 locus_tag LOCUS_52310 CDS complement(101638..101865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52320 CDS 101881..102654 product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731172.1 transl_table 11 codon_start 1 locus_tag LOCUS_52330 CDS complement(102658..104373) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731169.1 transl_table 11 codon_start 1 locus_tag LOCUS_52340 gene leuA CDS complement(104669..105316) product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897687.1 transl_table 11 codon_start 1 locus_tag LOCUS_52350 CDS complement(105331..106515) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 transl_table 11 codon_start 1 locus_tag LOCUS_52360 CDS complement(106512..107840) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897685.1 transl_table 11 codon_start 1 locus_tag LOCUS_52370 CDS complement(107840..108523) product protein glxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731166.1 transl_table 11 codon_start 1 locus_tag LOCUS_52380 CDS complement(108511..109389) product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897683.1 transl_table 11 codon_start 1 locus_tag LOCUS_52390 CDS complement(109405..110718) product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897682.1 transl_table 11 codon_start 1 locus_tag LOCUS_52400 gene glnT CDS complement(110808..112067) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897681.1 transl_table 11 codon_start 1 locus_tag LOCUS_52410 CDS 112238..112651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52420 CDS 112726..113991 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897679.1 transl_table 11 codon_start 1 locus_tag LOCUS_52430 CDS 113992..115050 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419825.1 transl_table 11 codon_start 1 locus_tag LOCUS_52440 gene asd CDS 115149..116180 product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731164.1 transl_table 11 codon_start 1 locus_tag LOCUS_52450 CDS complement(116177..116878) product GAF and ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079514.1 transl_table 11 codon_start 1 locus_tag LOCUS_52460 CDS complement(116944..118452) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104247.1 transl_table 11 codon_start 1 locus_tag LOCUS_52470 CDS 118632..119012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52480 CDS 119125..119535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52490 CDS 119635..121095 product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971553.1 transl_table 11 codon_start 1 locus_tag LOCUS_52500 CDS 121210..121575 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 transl_table 11 codon_start 1 locus_tag LOCUS_52510 CDS 121579..122238 product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104592.1 transl_table 11 codon_start 1 locus_tag LOCUS_52520 CDS 122363..123649 product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731159.1 transl_table 11 codon_start 1 locus_tag LOCUS_52530 gene egtA CDS 123646..124959 product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731158.1 transl_table 11 codon_start 1 locus_tag LOCUS_52540 gene egtB CDS 124992..125648 product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419806.1 transl_table 11 codon_start 1 locus_tag LOCUS_52550 gene egtC CDS 125648..126613 product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731156.1 transl_table 11 codon_start 1 locus_tag LOCUS_52560 gene egtD CDS 126613..127734 product ergothioneine biosynthesis PLP-dependent enzyme EgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731155.1 transl_table 11 codon_start 1 locus_tag LOCUS_52570 gene egtE CDS complement(127731..128306) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419793.1 transl_table 11 codon_start 1 locus_tag LOCUS_52580 note possible pseudo, frameshifted CDS complement(128476..129951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731144.1 transl_table 11 codon_start 1 locus_tag LOCUS_52590 CDS complement(129961..130722) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731140.1 transl_table 11 codon_start 1 locus_tag LOCUS_52600 CDS 130762..132279 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731139.1 transl_table 11 codon_start 1 locus_tag LOCUS_52610 gene glpK CDS complement(132334..133206) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728366.1 transl_table 11 codon_start 1 locus_tag LOCUS_52620 CDS complement(133277..133987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52630 CDS complement(134080..134298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52640 CDS complement(134372..135007) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940085.1 transl_table 11 codon_start 1 locus_tag LOCUS_52650 CDS 135093..135752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52660 CDS complement(135877..136764) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731133.1 transl_table 11 codon_start 1 locus_tag LOCUS_52670 CDS 136792..137784 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731132.1 transl_table 11 codon_start 1 locus_tag LOCUS_52680 CDS complement(137781..138692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52690 CDS 138801..139013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52700 CDS complement(139103..140086) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731130.1 transl_table 11 codon_start 1 locus_tag LOCUS_52710 CDS complement(140083..141222) product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139569.1 transl_table 11 codon_start 1 locus_tag LOCUS_52720 CDS complement(141219..141872) product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419770.1 transl_table 11 codon_start 1 locus_tag LOCUS_52730 CDS complement(141874..143031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223495859.1 transl_table 11 codon_start 1 locus_tag LOCUS_52740 CDS 143092..143556 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731125.1 transl_table 11 codon_start 1 locus_tag LOCUS_52750 CDS 143593..144579 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877201.1 transl_table 11 codon_start 1 locus_tag LOCUS_52760 CDS 144589..144747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52770 CDS complement(144751..145422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104597.1 transl_table 11 codon_start 1 locus_tag LOCUS_52780 CDS 145549..146244 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727889.1 transl_table 11 codon_start 1 locus_tag LOCUS_52790 CDS complement(146436..147380) product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727891.1 transl_table 11 codon_start 1 locus_tag LOCUS_52800 CDS 147580..147966 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730495.1 transl_table 11 codon_start 1 locus_tag LOCUS_52810 tRNA complement(148024..148098) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 148253..148450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_52820 CDS complement(148354..149394) product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901694.1 transl_table 11 codon_start 1 locus_tag LOCUS_52830 CDS complement(149463..150419) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731114.1 transl_table 11 codon_start 1 locus_tag LOCUS_52840 CDS complement(150494..152968) product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878583.1 transl_table 11 codon_start 1 locus_tag LOCUS_52850 gene ponA2 CDS 153303..153623 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731112.1 transl_table 11 codon_start 1 locus_tag LOCUS_52860 CDS complement(153620..154750) product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731107.1 transl_table 11 codon_start 1 locus_tag LOCUS_52870 CDS complement(154747..155766) product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897588.1 transl_table 11 codon_start 1 locus_tag LOCUS_52880 CDS 155773..155976 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897587.1 transl_table 11 codon_start 1 locus_tag LOCUS_52890 CDS 155973..156428 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 transl_table 11 codon_start 1 locus_tag LOCUS_52900 CDS 156433..157209 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731106.1 transl_table 11 codon_start 1 locus_tag LOCUS_52910 CDS complement(157267..157881) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063269.1 transl_table 11 codon_start 1 locus_tag LOCUS_52920 gene crp CDS complement(158007..158339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899635.1 transl_table 11 codon_start 1 locus_tag LOCUS_52930 CDS 158445..159197 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731104.1 transl_table 11 codon_start 1 locus_tag LOCUS_52940 gene nth CDS 159217..159864 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731103.1 transl_table 11 codon_start 1 locus_tag LOCUS_52950 CDS 159861..160643 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731102.1 transl_table 11 codon_start 1 locus_tag LOCUS_52960 CDS 160640..161827 product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731101.1 transl_table 11 codon_start 1 locus_tag LOCUS_52970 gene marP CDS complement(161828..162778) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731100.1 transl_table 11 codon_start 1 locus_tag LOCUS_52980 CDS complement(162778..163305) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897577.1 transl_table 11 codon_start 1 locus_tag LOCUS_52990 CDS 163400..164152 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139568.1 transl_table 11 codon_start 1 locus_tag LOCUS_53000 CDS complement(164175..165125) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 transl_table 11 codon_start 1 locus_tag LOCUS_53010 gene adhP CDS complement(165046..166941) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556617.1 transl_table 11 codon_start 1 locus_tag LOCUS_53020 assembly_gap 165788..165819 estimated_length known gap_type within scaffold linkage_evidence paired-ends CDS 167015..169012 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048382.1 transl_table 11 codon_start 1 locus_tag LOCUS_53030 CDS complement(169005..170276) product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704997.1 transl_table 11 codon_start 1 locus_tag LOCUS_53040 gene efeB CDS complement(170273..171199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53050 CDS 171303..172205 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 transl_table 11 codon_start 1 locus_tag LOCUS_53060 CDS complement(172202..173176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53070 CDS complement(173209..174063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727270.1 transl_table 11 codon_start 1 locus_tag LOCUS_53080 CDS complement(174093..174956) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727269.1 transl_table 11 codon_start 1 locus_tag LOCUS_53090 gene ppk2 CDS complement(175027..176553) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892316.1 transl_table 11 codon_start 1 locus_tag LOCUS_53100 CDS complement(176563..177093) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727268.1 transl_table 11 codon_start 1 locus_tag LOCUS_53110 CDS complement(177132..177647) product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892314.1 transl_table 11 codon_start 1 locus_tag LOCUS_53120 CDS complement(177666..178094) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727266.1 transl_table 11 codon_start 1 locus_tag LOCUS_53130 CDS 178102..179829 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727265.1 transl_table 11 codon_start 1 locus_tag LOCUS_53140 CDS complement(179819..180820) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 transl_table 11 codon_start 1 locus_tag LOCUS_53150 CDS 180881..181255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727264.1 transl_table 11 codon_start 1 locus_tag LOCUS_53160 CDS 181629..182120 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53170 CDS complement(182235..183860) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892307.1 transl_table 11 codon_start 1 locus_tag LOCUS_53180 gene groL CDS complement(184041..184583) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085561.1 transl_table 11 codon_start 1 locus_tag LOCUS_53190 tRNA complement(185311..185407) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 185615..186142 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743071.1 transl_table 11 codon_start 1 locus_tag LOCUS_53200 CDS 186237..187952 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727251.1 transl_table 11 codon_start 1 locus_tag LOCUS_53210 CDS complement(187953..189047) product response regulator transcription factor EmbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406553.1 transl_table 11 codon_start 1 locus_tag LOCUS_53220 gene embR CDS complement(189118..189621) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729049.1 transl_table 11 codon_start 1 locus_tag LOCUS_53230 CDS complement(189658..189939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53240 CDS complement(189942..190757) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892291.1 transl_table 11 codon_start 1 locus_tag LOCUS_53250 CDS 190850..191518 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401632.1 transl_table 11 codon_start 1 locus_tag LOCUS_53260 gene pcp CDS 191634..192302 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243178.1 transl_table 11 codon_start 1 locus_tag LOCUS_53270 CDS 192338..193267 product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938457.1 transl_table 11 codon_start 1 locus_tag LOCUS_53280 CDS 193282..193650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53290 CDS complement(193634..195112) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727250.1 transl_table 11 codon_start 1 locus_tag LOCUS_53300 CDS complement(195109..195585) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727249.1 transl_table 11 codon_start 1 locus_tag LOCUS_53310 CDS complement(195597..196079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53320 CDS 196133..197044 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402219.1 transl_table 11 codon_start 1 locus_tag LOCUS_53330 CDS 197044..198267 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876895.1 transl_table 11 codon_start 1 locus_tag LOCUS_53340 CDS 198308..199045 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727246.1 transl_table 11 codon_start 1 locus_tag LOCUS_53350 CDS 199042..199893 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892285.1 transl_table 11 codon_start 1 locus_tag LOCUS_53360 gene pssA CDS 199895..202114 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727245.1 transl_table 11 codon_start 1 locus_tag LOCUS_53370 CDS complement(202116..203168) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_53380 CDS 203356..203763 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892281.1 transl_table 11 codon_start 1 locus_tag LOCUS_53390 CDS complement(203788..205311) product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227506.1 transl_table 11 codon_start 1 locus_tag LOCUS_53400 CDS 205301..208180 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727236.1 transl_table 11 codon_start 1 locus_tag LOCUS_53410 CDS 208177..208647 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892273.1 transl_table 11 codon_start 1 locus_tag LOCUS_53420 CDS 208644..210236 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892272.1 transl_table 11 codon_start 1 locus_tag LOCUS_53430 CDS 210233..210766 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727234.1 transl_table 11 codon_start 1 locus_tag LOCUS_53440 CDS 210763..211050 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892270.1 transl_table 11 codon_start 1 locus_tag LOCUS_53450 CDS 211047..211406 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727233.1 transl_table 11 codon_start 1 locus_tag LOCUS_53460 gene mnhG CDS 211393..212148 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112081.1 transl_table 11 codon_start 1 locus_tag LOCUS_53470 CDS complement(212156..212788) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727230.1 transl_table 11 codon_start 1 locus_tag LOCUS_53480 CDS complement(212791..213861) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900145.1 transl_table 11 codon_start 1 locus_tag LOCUS_53490 CDS complement(213905..214615) product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727227.1 transl_table 11 codon_start 1 locus_tag LOCUS_53500 CDS complement(214626..215087) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104367.1 transl_table 11 codon_start 1 locus_tag LOCUS_53510 CDS complement(215140..215448) product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892262.1 transl_table 11 codon_start 1 locus_tag LOCUS_53520 CDS 215585..216178 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402185.1 transl_table 11 codon_start 1 locus_tag LOCUS_53530 CDS 216178..217068 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892260.1 transl_table 11 codon_start 1 locus_tag LOCUS_53540 CDS 217184..217744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53550 CDS 217749..218267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53560 note possible pseudo, internal stop codon, frameshifted CDS 218530..218850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53570 note possible pseudo, internal stop codon, frameshifted CDS 218884..219717 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727225.1 transl_table 11 codon_start 1 locus_tag LOCUS_53580 CDS complement(219654..221405) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049748434.1 transl_table 11 codon_start 1 locus_tag LOCUS_53590 CDS 221615..223201 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900143.1 transl_table 11 codon_start 1 locus_tag LOCUS_53600 gene thiC CDS 223216..224067 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727221.1 transl_table 11 codon_start 1 locus_tag LOCUS_53610 gene thiD CDS 224064..224696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402145.1 transl_table 11 codon_start 1 locus_tag LOCUS_53620 CDS 224736..225374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53630 CDS 225418..226905 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727213.1 transl_table 11 codon_start 1 locus_tag LOCUS_53640 CDS 226925..227197 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727212.1 transl_table 11 codon_start 1 locus_tag LOCUS_53650 CDS complement(227164..228417) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876881.1 transl_table 11 codon_start 1 locus_tag LOCUS_53660 CDS 228530..228871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53670 CDS 228886..230145 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727209.1 transl_table 11 codon_start 1 locus_tag LOCUS_53680 CDS 230133..231422 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727208.1 transl_table 11 codon_start 1 locus_tag LOCUS_53690 CDS complement(231376..232839) product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727204.1 transl_table 11 codon_start 1 locus_tag LOCUS_53700 CDS complement(232836..234326) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876880.1 transl_table 11 codon_start 1 locus_tag LOCUS_53710 CDS complement(234361..235110) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510615.1 transl_table 11 codon_start 1 locus_tag LOCUS_53720 CDS complement(235107..235865) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727197.1 transl_table 11 codon_start 1 locus_tag LOCUS_53730 CDS complement(235858..236055) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727196.1 transl_table 11 codon_start 1 locus_tag LOCUS_53740 gene thiS CDS complement(236052..237092) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727195.1 transl_table 11 codon_start 1 locus_tag LOCUS_53750 gene thiO CDS complement(237201..238574) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729120.1 transl_table 11 codon_start 1 locus_tag LOCUS_53760 CDS 238657..239328 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727194.1 transl_table 11 codon_start 1 locus_tag LOCUS_53770 gene thiE CDS complement(239312..239818) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876872.1 transl_table 11 codon_start 1 locus_tag LOCUS_53780 CDS 239918..241237 product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876871.1 transl_table 11 codon_start 1 locus_tag LOCUS_53790 gene glnX CDS 241234..242199 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727191.1 transl_table 11 codon_start 1 locus_tag LOCUS_53800 CDS 242199..244463 product serine/threonine-protein kinase PknG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727190.1 transl_table 11 codon_start 1 locus_tag LOCUS_53810 CDS 244672..245073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53820 CDS complement(245057..246136) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727188.1 transl_table 11 codon_start 1 locus_tag LOCUS_53830 CDS complement(246187..248259) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727187.1 transl_table 11 codon_start 1 locus_tag LOCUS_53840 gene pta CDS 248577..250040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53850 CDS 250061..251461 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543833.1 transl_table 11 codon_start 1 locus_tag LOCUS_53860 CDS 251461..253398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53870 CDS 253406..255121 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013414.1 transl_table 11 codon_start 1 locus_tag LOCUS_53880 CDS complement(255118..256092) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085283.1 transl_table 11 codon_start 1 locus_tag LOCUS_53890 CDS complement(256116..257126) product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892203.1 transl_table 11 codon_start 1 locus_tag LOCUS_53900 gene fgd CDS 257161..257901 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727181.1 transl_table 11 codon_start 1 locus_tag LOCUS_53910 CDS complement(257910..258206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892201.1 transl_table 11 codon_start 1 locus_tag LOCUS_53920 CDS complement(258342..258839) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727180.1 transl_table 11 codon_start 1 locus_tag LOCUS_53930 CDS 258895..259743 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730403.1 transl_table 11 codon_start 1 locus_tag LOCUS_53940 CDS complement(259740..260285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53950 CDS 260167..260445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53960 sequence0989 source 1..382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0990 source 1..749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_53970 sequence0991 source 1..603 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0992 source 1..626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 208..603 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893728.1 transl_table 11 codon_start 1 locus_tag LOCUS_53980 sequence0993 source 1..607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..601 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003415944.1:ABC transporter ATP-binding protein locus_tag LOCUS_53990 sequence0994 source 1..705 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0995 source 1..387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0996 source 1..410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0997 source 1..766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0998 source 1..663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence0999 source 1..378 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1000 source 1..320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1001 source 1..604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..545 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891673.1:AMP-binding protein locus_tag LOCUS_54000 sequence1002 source 1..472 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1003 source 1..400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1004 source 1..374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1005 source 1..41525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..1419) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894402.1 transl_table 11 codon_start 1 locus_tag LOCUS_54010 CDS complement(1456..2208) product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728763.1 transl_table 11 codon_start 1 locus_tag LOCUS_54020 CDS 2319..2894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54030 CDS 2905..3696 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728664.1 transl_table 11 codon_start 1 locus_tag LOCUS_54040 CDS 3712..4191 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728669.1 transl_table 11 codon_start 1 locus_tag LOCUS_54050 CDS 4188..4964 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 transl_table 11 codon_start 1 locus_tag LOCUS_54060 CDS complement(4961..6046) product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894400.1 transl_table 11 codon_start 1 locus_tag LOCUS_54070 CDS complement(6039..6938) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728762.1 transl_table 11 codon_start 1 locus_tag LOCUS_54080 CDS complement(6935..9598) product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728761.1 transl_table 11 codon_start 1 locus_tag LOCUS_54090 CDS complement(9598..12915) product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728760.1 transl_table 11 codon_start 1 locus_tag LOCUS_54100 CDS complement(13274..13744) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728757.1 transl_table 11 codon_start 1 locus_tag LOCUS_54110 CDS 13840..15021 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894393.1 transl_table 11 codon_start 1 locus_tag LOCUS_54120 CDS complement(15077..15499) product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894385.1 transl_table 11 codon_start 1 locus_tag LOCUS_54130 CDS 15557..16348 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730529.1 transl_table 11 codon_start 1 locus_tag LOCUS_54140 CDS complement(16345..18123) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894384.1 transl_table 11 codon_start 1 locus_tag LOCUS_54150 gene aspS CDS 18199..19095 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015385292.1 transl_table 11 codon_start 1 locus_tag LOCUS_54160 CDS 19375..19884 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728751.1 transl_table 11 codon_start 1 locus_tag LOCUS_54170 CDS complement(19903..21471) product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728750.1 transl_table 11 codon_start 1 locus_tag LOCUS_54180 CDS 21493..22380 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728749.1 transl_table 11 codon_start 1 locus_tag LOCUS_54190 CDS 22439..22924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54200 CDS 22924..23457 product maleylpyruvate isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728747.1 transl_table 11 codon_start 1 locus_tag LOCUS_54210 CDS 23450..24274 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112856.1 transl_table 11 codon_start 1 locus_tag LOCUS_54220 CDS complement(24352..25248) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728746.1 transl_table 11 codon_start 1 locus_tag LOCUS_54230 CDS 25315..25980 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728744.1 transl_table 11 codon_start 1 locus_tag LOCUS_54240 CDS 26104..27324 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728743.1 transl_table 11 codon_start 1 locus_tag LOCUS_54250 CDS 27404..28540 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894374.1 transl_table 11 codon_start 1 locus_tag LOCUS_54260 CDS 28537..29793 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894373.1 transl_table 11 codon_start 1 locus_tag LOCUS_54270 CDS complement(29806..30822) product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728742.1 transl_table 11 codon_start 1 locus_tag LOCUS_54280 CDS complement(30889..31287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894363.1 transl_table 11 codon_start 1 locus_tag LOCUS_54290 CDS 31613..32815 product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728738.1 transl_table 11 codon_start 1 locus_tag LOCUS_54300 gene urtA CDS 32851..33735 product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 transl_table 11 codon_start 1 locus_tag LOCUS_54310 gene urtB CDS 33732..34841 product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728737.1 transl_table 11 codon_start 1 locus_tag LOCUS_54320 gene urtC CDS 34838..35671 product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894359.1 transl_table 11 codon_start 1 locus_tag LOCUS_54330 gene urtD CDS 35671..36363 product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894358.1 transl_table 11 codon_start 1 locus_tag LOCUS_54340 gene urtE CDS 36660..37961 product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065084.1 transl_table 11 codon_start 1 locus_tag LOCUS_54350 CDS complement(37937..39196) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141757.1 transl_table 11 codon_start 1 locus_tag LOCUS_54360 CDS 39285..39965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728720.1 transl_table 11 codon_start 1 locus_tag LOCUS_54370 CDS 40021..41421 product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197085735.1 transl_table 11 codon_start 1 locus_tag LOCUS_54380 sequence1006 source 1..306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1007 source 1..622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1008 source 1..519 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1009 source 1..686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54390 sequence1010 source 1..977 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1011 source 1..375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1012 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1013 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1014 source 1..461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1015 source 1..684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730159.1:LLM class F420-dependent oxidoreductase locus_tag LOCUS_54400 sequence1016 source 1..610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 165..503 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895305.1 transl_table 11 codon_start 1 locus_tag LOCUS_54410 gene rbpA sequence1017 source 1..594 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1018 source 1..495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1019 source 1..384 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1020 source 1..497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1021 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1022 source 1..349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1023 source 1..487 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1024 source 1..357 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1025 source 1..652 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1026 source 1..612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1027 source 1..1264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1028 source 1..612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1029 source 1..421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1030 source 1..541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1031 source 1..678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1032 source 1..455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1033 source 1..480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1034 source 1..336335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(8..1099) product IS30-like element ISBlo4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783747.1 transl_table 11 codon_start 1 locus_tag LOCUS_54420 CDS complement(1543..4740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54430 CDS complement(4809..5615) product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417158.1 transl_table 11 codon_start 1 locus_tag LOCUS_54440 gene sigF CDS 5774..6217 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895709.1 transl_table 11 codon_start 1 locus_tag LOCUS_54450 CDS 6335..7189 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 transl_table 11 codon_start 1 locus_tag LOCUS_54460 CDS complement(7196..7351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54470 CDS complement(7391..7930) product nitroreductase/quinone reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729404.1 transl_table 11 codon_start 1 locus_tag LOCUS_54480 CDS 7970..8479 product F420H(2)-dependent quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407780.1 transl_table 11 codon_start 1 locus_tag LOCUS_54490 CDS complement(8564..9481) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071129.1 transl_table 11 codon_start 1 locus_tag LOCUS_54500 CDS 9574..10851 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726824.1 transl_table 11 codon_start 1 locus_tag LOCUS_54510 CDS 10848..11171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139576.1 transl_table 11 codon_start 1 locus_tag LOCUS_54520 CDS 11177..12007 product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245963.1 transl_table 11 codon_start 1 locus_tag LOCUS_54530 CDS 12004..12870 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877522.1 transl_table 11 codon_start 1 locus_tag LOCUS_54540 CDS 12867..13448 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730127.1 transl_table 11 codon_start 1 locus_tag LOCUS_54550 CDS complement(13471..14664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54560 CDS 14722..15153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54570 CDS complement(15346..16284) product R2-like ligand-binding oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401270.1 transl_table 11 codon_start 1 locus_tag LOCUS_54580 CDS complement(16315..17007) product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894208.1 transl_table 11 codon_start 1 locus_tag LOCUS_54590 CDS complement(17036..18007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54600 CDS complement(18021..18761) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084311.1 transl_table 11 codon_start 1 locus_tag LOCUS_54610 CDS complement(18758..20005) product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123295.1 transl_table 11 codon_start 1 locus_tag LOCUS_54620 CDS complement(20006..21268) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094688.1 transl_table 11 codon_start 1 locus_tag LOCUS_54630 CDS 21360..22220 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112234.1 transl_table 11 codon_start 1 locus_tag LOCUS_54640 CDS 22205..23074 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 transl_table 11 codon_start 1 locus_tag LOCUS_54650 gene fabG CDS 23071..24618 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728639.1 transl_table 11 codon_start 1 locus_tag LOCUS_54660 CDS 24816..26258 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726815.1 transl_table 11 codon_start 1 locus_tag LOCUS_54670 CDS 26280..27086 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726830.1 transl_table 11 codon_start 1 locus_tag LOCUS_54680 CDS complement(27095..28168) product esterase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899863.1 transl_table 11 codon_start 1 locus_tag LOCUS_54690 gene lipC CDS complement(28474..29640) product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416075.1 transl_table 11 codon_start 1 locus_tag LOCUS_54700 CDS complement(29660..31126) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897260.1 transl_table 11 codon_start 1 locus_tag LOCUS_54710 CDS complement(31140..31928) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730054.1 transl_table 11 codon_start 1 locus_tag LOCUS_54720 CDS complement(32048..32680) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899803.1 transl_table 11 codon_start 1 locus_tag LOCUS_54730 CDS complement(32721..33824) product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 transl_table 11 codon_start 1 locus_tag LOCUS_54740 CDS 33909..35069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54750 CDS complement(35152..36219) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_54760 CDS 36358..37605 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 transl_table 11 codon_start 1 locus_tag LOCUS_54770 CDS 37619..38665 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_54780 CDS 38773..39726 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730663.1 transl_table 11 codon_start 1 locus_tag LOCUS_54790 CDS complement(39772..40791) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_54800 CDS 40943..41785 product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 transl_table 11 codon_start 1 locus_tag LOCUS_54810 CDS complement(41795..42598) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728236.1 transl_table 11 codon_start 1 locus_tag LOCUS_54820 CDS complement(42611..43441) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730054.1 transl_table 11 codon_start 1 locus_tag LOCUS_54830 CDS complement(43560..44201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003913008.1 transl_table 11 codon_start 1 locus_tag LOCUS_54840 CDS 44252..45082 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 transl_table 11 codon_start 1 locus_tag LOCUS_54850 gene fabG CDS 45139..46323 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729266.1 transl_table 11 codon_start 1 locus_tag LOCUS_54860 CDS 46409..47380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54870 CDS 47508..48389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54880 CDS 48426..49088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54890 CDS 49448..50122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54900 CDS 50151..50564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54910 CDS 50707..51624 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 transl_table 11 codon_start 1 locus_tag LOCUS_54920 CDS complement(51629..52450) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893578.1 transl_table 11 codon_start 1 locus_tag LOCUS_54930 CDS 52524..53312 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666015.1 transl_table 11 codon_start 1 locus_tag LOCUS_54940 CDS complement(53309..54388) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 transl_table 11 codon_start 1 locus_tag LOCUS_54950 CDS complement(54407..55195) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079722.1 transl_table 11 codon_start 1 locus_tag LOCUS_54960 CDS 55268..55684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_54970 CDS complement(55681..57294) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729090.1 transl_table 11 codon_start 1 locus_tag LOCUS_54980 CDS 57408..57971 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467027.1 transl_table 11 codon_start 1 locus_tag LOCUS_54990 CDS 58083..59276 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730093.1 transl_table 11 codon_start 1 locus_tag LOCUS_55000 CDS 59273..60499 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730110.1 transl_table 11 codon_start 1 locus_tag LOCUS_55010 CDS complement(60505..60906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55020 CDS complement(61112..61735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55030 CDS complement(61753..62922) product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224384.1 transl_table 11 codon_start 1 locus_tag LOCUS_55040 CDS complement(62919..63371) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224383.1 transl_table 11 codon_start 1 locus_tag LOCUS_55050 CDS complement(63368..64477) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 transl_table 11 codon_start 1 locus_tag LOCUS_55060 CDS complement(64496..64909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55070 note possible pseudo, frameshifted CDS complement(64909..65490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55080 CDS complement(65499..66680) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 transl_table 11 codon_start 1 locus_tag LOCUS_55090 CDS complement(66680..67891) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729152.1 transl_table 11 codon_start 1 locus_tag LOCUS_55100 CDS 67840..68130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55110 CDS 68130..69581 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084280.1 transl_table 11 codon_start 1 locus_tag LOCUS_55120 CDS 69578..71938 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 transl_table 11 codon_start 1 locus_tag LOCUS_55130 CDS complement(71944..72420) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 transl_table 11 codon_start 1 locus_tag LOCUS_55140 CDS complement(72417..73613) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728743.1 transl_table 11 codon_start 1 locus_tag LOCUS_55150 CDS complement(73704..74339) product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104261.1 transl_table 11 codon_start 1 locus_tag LOCUS_55160 CDS 74390..74827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55170 CDS complement(74817..75716) product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 transl_table 11 codon_start 1 locus_tag LOCUS_55180 CDS complement(75732..76841) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 transl_table 11 codon_start 1 locus_tag LOCUS_55190 CDS 76946..78142 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225700.1 transl_table 11 codon_start 1 locus_tag LOCUS_55200 CDS 78150..79124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55210 note possible pseudo, frameshifted CDS 79121..80320 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228920.1 transl_table 11 codon_start 1 locus_tag LOCUS_55220 CDS 80320..81855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55230 CDS complement(81852..82709) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112234.1 transl_table 11 codon_start 1 locus_tag LOCUS_55240 CDS 82801..83844 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085596.1 transl_table 11 codon_start 1 locus_tag LOCUS_55250 CDS 83841..84242 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731384.1 transl_table 11 codon_start 1 locus_tag LOCUS_55260 CDS 84239..85075 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 transl_table 11 codon_start 1 locus_tag LOCUS_55270 CDS 85084..86040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55280 CDS 86054..86617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55290 CDS 86621..87733 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112528.1 transl_table 11 codon_start 1 locus_tag LOCUS_55300 CDS complement(87962..89155) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896175.1 transl_table 11 codon_start 1 locus_tag LOCUS_55310 CDS complement(89211..89963) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_55320 CDS complement(89960..90565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55330 CDS 90662..91714 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730401.1 transl_table 11 codon_start 1 locus_tag LOCUS_55340 CDS complement(91717..93168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55350 note possible pseudo, internal stop codon, frameshifted CDS complement(93165..93965) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 transl_table 11 codon_start 1 locus_tag LOCUS_55360 CDS complement(93962..94765) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 transl_table 11 codon_start 1 locus_tag LOCUS_55370 CDS complement(94762..96009) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731379.1 transl_table 11 codon_start 1 locus_tag LOCUS_55380 CDS complement(96006..96812) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728230.1 transl_table 11 codon_start 1 locus_tag LOCUS_55390 CDS complement(96817..98088) product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 transl_table 11 codon_start 1 locus_tag LOCUS_55400 CDS 98286..99008 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728230.1 transl_table 11 codon_start 1 locus_tag LOCUS_55410 CDS complement(99005..99862) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 transl_table 11 codon_start 1 locus_tag LOCUS_55420 CDS 99918..101486 product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729559.1 transl_table 11 codon_start 1 locus_tag LOCUS_55430 CDS complement(101513..101800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55440 note possible pseudo, frameshifted CDS complement(102751..103185) product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 transl_table 11 codon_start 1 locus_tag LOCUS_55450 CDS complement(103185..104330) product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 transl_table 11 codon_start 1 locus_tag LOCUS_55460 CDS 104407..105186 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926031.1 transl_table 11 codon_start 1 locus_tag LOCUS_55470 CDS 105195..106310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55480 CDS 106339..107415 product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966058.1 transl_table 11 codon_start 1 locus_tag LOCUS_55490 CDS 107420..108244 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 transl_table 11 codon_start 1 locus_tag LOCUS_55500 CDS complement(108323..109510) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 transl_table 11 codon_start 1 locus_tag LOCUS_55510 CDS 109685..110473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55520 CDS complement(110462..111622) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 transl_table 11 codon_start 1 locus_tag LOCUS_55530 CDS 111727..112323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55540 CDS 112308..112742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55550 note possible pseudo, frameshifted CDS complement(112721..113152) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893941.1 transl_table 11 codon_start 1 locus_tag LOCUS_55560 CDS complement(113149..114057) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409707.1 transl_table 11 codon_start 1 locus_tag LOCUS_55570 CDS 114154..115266 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229260.1 transl_table 11 codon_start 1 locus_tag LOCUS_55580 CDS 115263..115916 product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731411.1 transl_table 11 codon_start 1 locus_tag LOCUS_55590 CDS 115913..116509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55600 CDS 116506..117264 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 transl_table 11 codon_start 1 locus_tag LOCUS_55610 CDS 117273..118211 product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228570.1 transl_table 11 codon_start 1 locus_tag LOCUS_55620 CDS 118270..119724 product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 transl_table 11 codon_start 1 locus_tag LOCUS_55630 gene fadD4 CDS complement(119721..121295) product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728167.1 transl_table 11 codon_start 1 locus_tag LOCUS_55640 CDS 121430..121900 product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728168.1 transl_table 11 codon_start 1 locus_tag LOCUS_55650 CDS 121901..122686 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728169.1 transl_table 11 codon_start 1 locus_tag LOCUS_55660 gene nagB CDS 122960..123838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55670 CDS 123840..124067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55680 CDS complement(124080..125561) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928898.1 transl_table 11 codon_start 1 locus_tag LOCUS_55690 CDS complement(125578..127263) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 transl_table 11 codon_start 1 locus_tag LOCUS_55700 CDS complement(127273..129537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55710 CDS 129613..130128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55720 CDS 130112..130651 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228137.1 transl_table 11 codon_start 1 locus_tag LOCUS_55730 CDS 130748..131086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55740 CDS complement(131138..131332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55750 CDS 131390..132085 product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 transl_table 11 codon_start 1 locus_tag LOCUS_55760 gene psmB CDS 132114..132995 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728601.1 transl_table 11 codon_start 1 locus_tag LOCUS_55770 CDS 133048..133680 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728178.1 transl_table 11 codon_start 1 locus_tag LOCUS_55780 CDS 133692..134390 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 transl_table 11 codon_start 1 locus_tag LOCUS_55790 CDS complement(134492..135652) product mycobactin biosynthesis acyl-ACP dehydrogenase MbtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104518.1 transl_table 11 codon_start 1 locus_tag LOCUS_55800 gene mbtN CDS complement(135649..137229) product long-chain-fatty acid--ACP ligase MbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893504.1 transl_table 11 codon_start 1 locus_tag LOCUS_55810 gene mbtM CDS complement(137226..137471) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893505.1 transl_table 11 codon_start 1 locus_tag LOCUS_55820 CDS 137699..138250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55830 CDS 138247..138615 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079419.1 transl_table 11 codon_start 1 locus_tag LOCUS_55840 gene crcB CDS 138649..139119 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079420.1 transl_table 11 codon_start 1 locus_tag LOCUS_55850 CDS 139132..140805 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728182.1 transl_table 11 codon_start 1 locus_tag LOCUS_55860 gene pgm CDS 140802..142082 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728183.1 transl_table 11 codon_start 1 locus_tag LOCUS_55870 tRNA 142136..142209 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(142249..143043) product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083453.1 transl_table 11 codon_start 1 locus_tag LOCUS_55880 CDS complement(143123..143560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55890 CDS complement(143990..145945) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922110.1 transl_table 11 codon_start 1 locus_tag LOCUS_55900 CDS complement(146190..146774) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55910 CDS 147000..147557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55920 CDS 147554..148927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55930 CDS 149154..149954 product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730130.1 transl_table 11 codon_start 1 locus_tag LOCUS_55940 CDS complement(150005..150274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55950 CDS complement(150406..150570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55960 CDS 151151..152164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55970 CDS 152157..153119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55980 CDS 153209..153388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_55990 CDS complement(153396..154388) product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400562.1 transl_table 11 codon_start 1 locus_tag LOCUS_56000 CDS complement(154398..154877) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896965.1 transl_table 11 codon_start 1 locus_tag LOCUS_56010 gene rnhA CDS complement(154879..155067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56020 CDS complement(155119..156033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56030 CDS 156196..156432 product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079596.1 transl_table 11 codon_start 1 locus_tag LOCUS_56040 CDS complement(156439..157656) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409193.1 transl_table 11 codon_start 1 locus_tag LOCUS_56050 CDS 158145..159527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56060 CDS complement(159524..160384) product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088843.1 transl_table 11 codon_start 1 locus_tag LOCUS_56070 CDS 160505..161551 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462182.1 transl_table 11 codon_start 1 locus_tag LOCUS_56080 CDS 161548..162636 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727153.1 transl_table 11 codon_start 1 locus_tag LOCUS_56090 CDS complement(162642..163859) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892094.1 transl_table 11 codon_start 1 locus_tag LOCUS_56100 CDS 164022..164594 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876835.1 transl_table 11 codon_start 1 locus_tag LOCUS_56110 CDS 164591..165217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56120 CDS complement(165214..166110) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877324.1 transl_table 11 codon_start 1 locus_tag LOCUS_56130 CDS complement(166182..167303) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728212.1 transl_table 11 codon_start 1 locus_tag LOCUS_56140 CDS complement(167317..168549) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 transl_table 11 codon_start 1 locus_tag LOCUS_56150 CDS complement(168626..170257) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908330.1 transl_table 11 codon_start 1 locus_tag LOCUS_56160 CDS 170428..171588 product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030513.1 transl_table 11 codon_start 1 locus_tag LOCUS_56170 CDS 171836..173245 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222995.1 transl_table 11 codon_start 1 locus_tag LOCUS_56180 CDS 173600..174598 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728573.1 transl_table 11 codon_start 1 locus_tag LOCUS_56190 CDS 174746..175198 product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893575.1 transl_table 11 codon_start 1 locus_tag LOCUS_56200 CDS complement(175235..176062) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893578.1 transl_table 11 codon_start 1 locus_tag LOCUS_56210 CDS complement(176059..177237) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728221.1 transl_table 11 codon_start 1 locus_tag LOCUS_56220 CDS 177421..178161 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051065148.1 transl_table 11 codon_start 1 locus_tag LOCUS_56230 gene fabG CDS 178218..179375 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877333.1 transl_table 11 codon_start 1 locus_tag LOCUS_56240 CDS 179372..180565 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728223.1 transl_table 11 codon_start 1 locus_tag LOCUS_56250 CDS 180569..181246 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893583.1 transl_table 11 codon_start 1 locus_tag LOCUS_56260 CDS complement(181221..182729) product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728227.1 transl_table 11 codon_start 1 locus_tag LOCUS_56270 CDS complement(182722..184233) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728228.1 transl_table 11 codon_start 1 locus_tag LOCUS_56280 CDS complement(184226..185686) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893590.1 transl_table 11 codon_start 1 locus_tag LOCUS_56290 CDS complement(185686..186477) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893591.1 transl_table 11 codon_start 1 locus_tag LOCUS_56300 CDS complement(186474..187310) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 transl_table 11 codon_start 1 locus_tag LOCUS_56310 CDS complement(187307..188101) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728230.1 transl_table 11 codon_start 1 locus_tag LOCUS_56320 CDS 188177..188866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56330 CDS 188866..189633 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036341485.1 transl_table 11 codon_start 1 locus_tag LOCUS_56340 CDS 189644..190510 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877338.1 transl_table 11 codon_start 1 locus_tag LOCUS_56350 CDS 190589..191764 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877339.1 transl_table 11 codon_start 1 locus_tag LOCUS_56360 CDS complement(191822..192964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56370 CDS 193121..194128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56380 CDS 194222..195088 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893601.1 transl_table 11 codon_start 1 locus_tag LOCUS_56390 CDS 195102..196313 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728237.1 transl_table 11 codon_start 1 locus_tag LOCUS_56400 CDS 196316..197932 product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728238.1 transl_table 11 codon_start 1 locus_tag LOCUS_56410 CDS 197929..198765 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893604.1 transl_table 11 codon_start 1 locus_tag LOCUS_56420 CDS 198768..199805 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728239.1 transl_table 11 codon_start 1 locus_tag LOCUS_56430 CDS 199815..201008 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728240.1 transl_table 11 codon_start 1 locus_tag LOCUS_56440 CDS 201037..202020 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728252.1 transl_table 11 codon_start 1 locus_tag LOCUS_56450 CDS complement(202057..203286) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728241.1 transl_table 11 codon_start 1 locus_tag LOCUS_56460 CDS complement(203289..204437) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728242.1 transl_table 11 codon_start 1 locus_tag LOCUS_56470 CDS 204468..206744 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039318110.1 transl_table 11 codon_start 1 locus_tag LOCUS_56480 CDS 206896..207540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56490 CDS complement(207550..208794) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104252.1 transl_table 11 codon_start 1 locus_tag LOCUS_56500 CDS 208869..210452 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728244.1 transl_table 11 codon_start 1 locus_tag LOCUS_56510 CDS complement(210467..211105) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728245.1 transl_table 11 codon_start 1 locus_tag LOCUS_56520 CDS complement(211109..212317) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728246.1 transl_table 11 codon_start 1 locus_tag LOCUS_56530 CDS complement(212382..213158) product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035607.1 transl_table 11 codon_start 1 locus_tag LOCUS_56540 CDS 213579..213863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56550 note possible pseudo, frameshifted CDS complement(213984..215642) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728248.1 transl_table 11 codon_start 1 locus_tag LOCUS_56560 CDS complement(215651..216265) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401827.1 transl_table 11 codon_start 1 locus_tag LOCUS_56570 CDS complement(216262..216465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56580 CDS complement(216462..217460) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728250.1 transl_table 11 codon_start 1 locus_tag LOCUS_56590 CDS 217696..218628 product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110688.1 transl_table 11 codon_start 1 locus_tag LOCUS_56600 CDS 218733..220358 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728663.1 transl_table 11 codon_start 1 locus_tag LOCUS_56610 CDS 220355..221476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56620 CDS complement(221448..222074) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265815.1 transl_table 11 codon_start 1 locus_tag LOCUS_56630 CDS 222134..223189 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895326.1 transl_table 11 codon_start 1 locus_tag LOCUS_56640 CDS 223186..223560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56650 CDS 223557..224627 product TIGR03857 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877342.1 transl_table 11 codon_start 1 locus_tag LOCUS_56660 CDS complement(224624..226120) product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104262.1 transl_table 11 codon_start 1 locus_tag LOCUS_56670 CDS complement(226117..226332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56680 CDS 226243..227244 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728259.1 transl_table 11 codon_start 1 locus_tag LOCUS_56690 CDS 227255..228490 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728260.1 transl_table 11 codon_start 1 locus_tag LOCUS_56700 CDS complement(228582..228746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56710 CDS complement(228928..229251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56720 CDS 229360..229950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56730 CDS 230068..231456 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 transl_table 11 codon_start 1 locus_tag LOCUS_56740 CDS 231619..232845 product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730343.1 transl_table 11 codon_start 1 locus_tag LOCUS_56750 CDS 232842..236528 product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878246.1 transl_table 11 codon_start 1 locus_tag LOCUS_56760 CDS 236525..238171 product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 transl_table 11 codon_start 1 locus_tag LOCUS_56770 gene narH CDS 238168..238803 product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730340.1 transl_table 11 codon_start 1 locus_tag LOCUS_56780 gene narJ CDS 238806..239534 product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730339.1 transl_table 11 codon_start 1 locus_tag LOCUS_56790 gene narI CDS complement(239536..239970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56800 CDS 240076..240705 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413588.1 transl_table 11 codon_start 1 locus_tag LOCUS_56810 CDS 240702..241127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077089871.1 transl_table 11 codon_start 1 locus_tag LOCUS_56820 CDS 241168..241569 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896644.1 transl_table 11 codon_start 1 locus_tag LOCUS_56830 CDS 241633..243042 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730410.1 transl_table 11 codon_start 1 locus_tag LOCUS_56840 CDS 243047..243487 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730338.1 transl_table 11 codon_start 1 locus_tag LOCUS_56850 CDS 243512..244165 product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416369.1 transl_table 11 codon_start 1 locus_tag LOCUS_56860 gene devR CDS 244162..245850 product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730409.1 transl_table 11 codon_start 1 locus_tag LOCUS_56870 CDS complement(245843..246832) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729429.1 transl_table 11 codon_start 1 locus_tag LOCUS_56880 CDS complement(246905..248452) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415991.1 transl_table 11 codon_start 1 locus_tag LOCUS_56890 CDS complement(248474..248884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56900 CDS complement(248884..250416) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728275.1 transl_table 11 codon_start 1 locus_tag LOCUS_56910 CDS 250515..251282 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893649.1 transl_table 11 codon_start 1 locus_tag LOCUS_56920 CDS 251345..253090 product ubiquinone-dependent pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728276.1 transl_table 11 codon_start 1 locus_tag LOCUS_56930 gene poxB CDS 253377..254204 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727349.1 transl_table 11 codon_start 1 locus_tag LOCUS_56940 CDS 254217..255284 product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727350.1 transl_table 11 codon_start 1 locus_tag LOCUS_56950 CDS complement(255281..256045) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893654.1 transl_table 11 codon_start 1 locus_tag LOCUS_56960 CDS 256285..256785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013472216.1 transl_table 11 codon_start 1 locus_tag LOCUS_56970 CDS complement(256859..257245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_56980 CDS complement(257248..258732) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415988.1 transl_table 11 codon_start 1 locus_tag LOCUS_56990 CDS 258863..259492 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893657.1 transl_table 11 codon_start 1 locus_tag LOCUS_57000 CDS 259507..260379 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727351.1 transl_table 11 codon_start 1 locus_tag LOCUS_57010 CDS complement(260376..261557) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054879778.1 transl_table 11 codon_start 1 locus_tag LOCUS_57020 CDS complement(261588..262634) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727354.1 transl_table 11 codon_start 1 locus_tag LOCUS_57030 CDS complement(262640..263236) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415984.1 transl_table 11 codon_start 1 locus_tag LOCUS_57040 CDS 263325..263867 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893663.1 transl_table 11 codon_start 1 locus_tag LOCUS_57050 CDS complement(263870..265093) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228182.1 transl_table 11 codon_start 1 locus_tag LOCUS_57060 CDS 265551..267152 product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229262.1 transl_table 11 codon_start 1 locus_tag LOCUS_57070 CDS 267190..267540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57080 CDS 267580..267828 product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893665.1 transl_table 11 codon_start 1 locus_tag LOCUS_57090 CDS 267860..268303 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415981.1 transl_table 11 codon_start 1 locus_tag LOCUS_57100 gene nrdI CDS 268270..270444 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003914457.1 transl_table 11 codon_start 1 locus_tag LOCUS_57110 gene nrdE CDS 270540..270680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57120 CDS 270856..271332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896713.1 transl_table 11 codon_start 1 locus_tag LOCUS_57130 CDS 271329..272033 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730465.1 transl_table 11 codon_start 1 locus_tag LOCUS_57140 CDS 272030..272815 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730464.1 transl_table 11 codon_start 1 locus_tag LOCUS_57150 CDS 272812..273615 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730463.1 transl_table 11 codon_start 1 locus_tag LOCUS_57160 CDS 273634..274302 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730462.1 transl_table 11 codon_start 1 locus_tag LOCUS_57170 CDS 274313..274675 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113787.1 transl_table 11 codon_start 1 locus_tag LOCUS_57180 CDS complement(274665..275852) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893677.1 transl_table 11 codon_start 1 locus_tag LOCUS_57190 CDS 276052..276744 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727362.1 transl_table 11 codon_start 1 locus_tag LOCUS_57200 CDS 276828..277544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57210 CDS 277625..279145 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727363.1 transl_table 11 codon_start 1 locus_tag LOCUS_57220 CDS 279269..280243 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893682.1 transl_table 11 codon_start 1 locus_tag LOCUS_57230 gene nrdF CDS complement(280240..280875) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411863.1 transl_table 11 codon_start 1 locus_tag LOCUS_57240 CDS complement(281005..282054) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727367.1 transl_table 11 codon_start 1 locus_tag LOCUS_57250 CDS complement(282173..282448) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893687.1 transl_table 11 codon_start 1 locus_tag LOCUS_57260 CDS complement(282459..283562) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727368.1 transl_table 11 codon_start 1 locus_tag LOCUS_57270 CDS 283723..285468 product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 transl_table 11 codon_start 1 locus_tag LOCUS_57280 gene ctaD CDS 285545..286756 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893690.1 transl_table 11 codon_start 1 locus_tag LOCUS_57290 gene serB CDS complement(286835..288265) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727370.1 transl_table 11 codon_start 1 locus_tag LOCUS_57300 CDS 288309..288497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57310 CDS 288494..289237 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893694.1 transl_table 11 codon_start 1 locus_tag LOCUS_57320 CDS 289165..290037 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727371.1 transl_table 11 codon_start 1 locus_tag LOCUS_57330 CDS 290034..290879 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727372.1 transl_table 11 codon_start 1 locus_tag LOCUS_57340 CDS 290876..291523 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415942.1 transl_table 11 codon_start 1 locus_tag LOCUS_57350 CDS 291535..292539 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727373.1 transl_table 11 codon_start 1 locus_tag LOCUS_57360 CDS complement(292503..292802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57370 CDS 292689..293699 product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727374.1 transl_table 11 codon_start 1 locus_tag LOCUS_57380 CDS 293794..294492 product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727375.1 transl_table 11 codon_start 1 locus_tag LOCUS_57390 CDS complement(294500..296047) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727376.1 transl_table 11 codon_start 1 locus_tag LOCUS_57400 CDS complement(296183..297481) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727377.1 transl_table 11 codon_start 1 locus_tag LOCUS_57410 CDS 297581..298309 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727378.1 transl_table 11 codon_start 1 locus_tag LOCUS_57420 CDS 298327..299634 product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878613.1 transl_table 11 codon_start 1 locus_tag LOCUS_57430 CDS 299833..302877 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726759.1 transl_table 11 codon_start 1 locus_tag LOCUS_57440 CDS complement(302874..304115) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415928.1 transl_table 11 codon_start 1 locus_tag LOCUS_57450 CDS complement(304112..305635) product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728284.1 transl_table 11 codon_start 1 locus_tag LOCUS_57460 CDS complement(305632..306408) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893717.1 transl_table 11 codon_start 1 locus_tag LOCUS_57470 CDS 306604..307398 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728286.1 transl_table 11 codon_start 1 locus_tag LOCUS_57480 CDS 307452..308408 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877364.1 transl_table 11 codon_start 1 locus_tag LOCUS_57490 CDS 308525..309190 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728289.1 transl_table 11 codon_start 1 locus_tag LOCUS_57500 CDS 309317..310177 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877365.1 transl_table 11 codon_start 1 locus_tag LOCUS_57510 CDS 310174..311013 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728291.1 transl_table 11 codon_start 1 locus_tag LOCUS_57520 CDS 311061..312281 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728292.1 transl_table 11 codon_start 1 locus_tag LOCUS_57530 CDS 312281..313348 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893725.1 transl_table 11 codon_start 1 locus_tag LOCUS_57540 gene mnmA CDS complement(313355..313996) product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415270.1 transl_table 11 codon_start 1 locus_tag LOCUS_57550 CDS 314188..315060 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728293.1 transl_table 11 codon_start 1 locus_tag LOCUS_57560 CDS 315130..315624 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 transl_table 11 codon_start 1 locus_tag LOCUS_57570 CDS 315621..315947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57580 CDS 316142..316843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57590 CDS complement(316829..318436) product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728294.1 transl_table 11 codon_start 1 locus_tag LOCUS_57600 CDS complement(318471..318878) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893728.1 transl_table 11 codon_start 1 locus_tag LOCUS_57610 CDS 318946..321054 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728295.1 transl_table 11 codon_start 1 locus_tag LOCUS_57620 gene ligA CDS 321117..321371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877189.1 transl_table 11 codon_start 1 locus_tag LOCUS_57630 CDS complement(321373..322038) product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519583.1 transl_table 11 codon_start 1 locus_tag LOCUS_57640 CDS 322110..322409 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893732.1 transl_table 11 codon_start 1 locus_tag LOCUS_57650 gene gatC CDS 322406..323899 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893733.1 transl_table 11 codon_start 1 locus_tag LOCUS_57660 gene gatA CDS 323917..324948 product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893734.1 transl_table 11 codon_start 1 locus_tag LOCUS_57670 CDS 324972..326474 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893735.1 transl_table 11 codon_start 1 locus_tag LOCUS_57680 gene gatB CDS complement(326471..327082) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531693.1 transl_table 11 codon_start 1 locus_tag LOCUS_57690 CDS 327183..327917 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926074.1 transl_table 11 codon_start 1 locus_tag LOCUS_57700 CDS 327920..328237 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819574.1 transl_table 11 codon_start 1 locus_tag LOCUS_57710 CDS complement(328293..329396) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877369.1 transl_table 11 codon_start 1 locus_tag LOCUS_57720 CDS 329618..330394 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893738.1 transl_table 11 codon_start 1 locus_tag LOCUS_57730 CDS complement(330399..330740) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415170.1 transl_table 11 codon_start 1 locus_tag LOCUS_57740 CDS 331074..332927 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728299.1 transl_table 11 codon_start 1 locus_tag LOCUS_57750 CDS 332927..333433 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893741.1 transl_table 11 codon_start 1 locus_tag LOCUS_57760 gene ilvN CDS 333473..334486 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893742.1 transl_table 11 codon_start 1 locus_tag LOCUS_57770 gene ilvC CDS complement(334683..336224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57780 sequence1035 source 1..653 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1036 source 1..534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1037 source 1..569 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1038 source 1..340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1039 source 1..455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1040 source 1..455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1041 source 1..561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1042 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1043 source 1..674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1044 source 1..535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1045 source 1..391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1046 source 1..676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1047 source 1..575 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(54..>575) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144241.1:LLM class flavin-dependent oxidoreductase locus_tag LOCUS_57790 sequence1048 source 1..471 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1049 source 1..490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1050 source 1..324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1051 source 1..361 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1052 source 1..609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(78..>609) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891472.1:membrane protein locus_tag LOCUS_57800 sequence1053 source 1..512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1054 source 1..331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1055 source 1..363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1056 source 1..356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1057 source 1..373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1058 source 1..533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1059 source 1..358 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1060 source 1..345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1061 source 1..550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1062 source 1..599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1063 source 1..925 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(20..>925) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893816.1:aspartate aminotransferase family protein locus_tag LOCUS_57810 sequence1064 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1065 source 1..1045 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(384..>1045) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003892514.1:MCE family protein locus_tag LOCUS_57820 sequence1066 source 1..335 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1067 source 1..827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(75..>827) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000037025.1:NAD-dependent epimerase/dehydratase family protein locus_tag LOCUS_57830 sequence1068 source 1..419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1069 source 1..367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1070 source 1..350 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1071 source 1..823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1072 source 1..375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1073 source 1..1626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57840 sequence1074 source 1..410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1075 source 1..540 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1076 source 1..645 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1077 source 1..336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1078 source 1..820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1079 source 1..921 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1080 source 1..456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1081 source 1..571 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1082 source 1..307 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1083 source 1..992 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1084 source 1..531 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1085 source 1..304 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1086 source 1..558 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1087 source 1..235 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1088 source 1..564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1089 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1090 source 1..418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1091 source 1..737 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 87..560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57850 sequence1092 source 1..526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1093 source 1..633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1094 source 1..516 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1095 source 1..299 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1096 source 1..397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1097 source 1..321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1098 source 1..630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1099 source 1..309 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1100 source 1..367 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1101 source 1..818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(26..>818) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003897029.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_57860 sequence1102 source 1..721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1103 source 1..525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1104 source 1..380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1105 source 1..621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1106 source 1..323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1107 source 1..546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1108 source 1..313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1109 source 1..426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1110 source 1..407 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1111 source 1..344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1112 source 1..934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1113 source 1..692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1114 source 1..468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1115 source 1..573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1116 source 1..433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1117 source 1..475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1118 source 1..355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1119 source 1..706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1120 source 1..498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1121 source 1..308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1122 source 1..302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1123 source 1..328 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1124 source 1..383 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1125 source 1..784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1126 source 1..386 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1127 source 1..37318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 562..741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57870 CDS complement(904..1980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57880 CDS complement(2147..2533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57890 CDS complement(2580..3125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57900 note possible pseudo, internal stop codon CDS complement(3127..4533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57910 CDS complement(4552..5637) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086196.1 transl_table 11 codon_start 1 locus_tag LOCUS_57920 CDS complement(6188..7429) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165781113.1 transl_table 11 codon_start 1 locus_tag LOCUS_57930 CDS complement(7426..7626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57940 CDS complement(7655..8458) product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281369.1 transl_table 11 codon_start 1 locus_tag LOCUS_57950 gene hcaB CDS complement(8455..8760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_57960 CDS complement(8757..9353) product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_57970 CDS complement(9350..10804) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665723.1 transl_table 11 codon_start 1 locus_tag LOCUS_57980 CDS 11337..12137 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943730.1 transl_table 11 codon_start 1 locus_tag LOCUS_57990 CDS 12137..12640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58000 CDS complement(12925..13728) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095297.1 transl_table 11 codon_start 1 locus_tag LOCUS_58010 CDS complement(13817..15268) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096457820.1 transl_table 11 codon_start 1 locus_tag LOCUS_58020 CDS complement(15265..16476) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083868.1 transl_table 11 codon_start 1 locus_tag LOCUS_58030 CDS complement(16552..17610) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039103.1 transl_table 11 codon_start 1 locus_tag LOCUS_58040 CDS complement(17607..18299) product 4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969451.1 transl_table 11 codon_start 1 locus_tag LOCUS_58050 CDS complement(18302..19462) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 transl_table 11 codon_start 1 locus_tag LOCUS_58060 CDS 19801..20724 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086624.1 transl_table 11 codon_start 1 locus_tag LOCUS_58070 CDS complement(20699..21823) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013721.1 transl_table 11 codon_start 1 locus_tag LOCUS_58080 CDS complement(21976..22299) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532979.1 transl_table 11 codon_start 1 locus_tag LOCUS_58090 CDS 22834..23532 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728466.1 transl_table 11 codon_start 1 locus_tag LOCUS_58100 CDS complement(23518..24378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58110 CDS complement(24375..25196) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921085.1 transl_table 11 codon_start 1 locus_tag LOCUS_58120 gene panB CDS complement(25208..25657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58130 CDS complement(25717..27003) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083760.1 transl_table 11 codon_start 1 locus_tag LOCUS_58140 CDS complement(27276..28019) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112899.1 transl_table 11 codon_start 1 locus_tag LOCUS_58150 CDS complement(28012..28416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58160 CDS 28647..29837 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 transl_table 11 codon_start 1 locus_tag LOCUS_58170 CDS 29857..30258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58180 tRNA complement(30299..30372) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS complement(30427..31458) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730554.1 transl_table 11 codon_start 1 locus_tag LOCUS_58190 CDS complement(31639..32292) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104413.1 transl_table 11 codon_start 1 locus_tag LOCUS_58200 CDS complement(32313..33587) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730556.1 transl_table 11 codon_start 1 locus_tag LOCUS_58210 CDS complement(33625..34536) product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878343.1 transl_table 11 codon_start 1 locus_tag LOCUS_58220 CDS 34637..35167 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175048375.1 transl_table 11 codon_start 1 locus_tag LOCUS_58230 CDS 35256..35606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58240 CDS 35668..36330 product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896877.1 transl_table 11 codon_start 1 locus_tag LOCUS_58250 CDS complement(36336..36509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58260 CDS 36685..37107 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405128.1 transl_table 11 codon_start 1 locus_tag LOCUS_58270 gene mscL sequence1128 source 1..352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1129 source 1..324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1130 source 1..377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1131 source 1..498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1132 source 1..437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1133 source 1..303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1134 source 1..790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1135 source 1..488 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1136 source 1..555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1137 source 1..572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1138 source 1..565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1139 source 1..490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1140 source 1..686 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1141 source 1..437 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1142 source 1..373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1143 source 1..325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1144 source 1..325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1145 source 1..581 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1146 source 1..790 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 282..428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58280 sequence1147 source 1..689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(49..246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58290 sequence1148 source 1..422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1149 source 1..555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1150 source 1..354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1151 source 1..520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1152 source 1..566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(99..173) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(212..288) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(329..402) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 sequence1153 source 1..436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1154 source 1..702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..665 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225625.1:alpha/beta fold hydrolase locus_tag LOCUS_58300 sequence1155 source 1..528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1156 source 1..533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1157 source 1..848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1158 source 1..353 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1159 source 1..720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1160 source 1..42599 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 159..818 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728707.1 transl_table 11 codon_start 1 locus_tag LOCUS_58310 CDS complement(802..3006) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467867.1 transl_table 11 codon_start 1 locus_tag LOCUS_58320 CDS complement(3060..4121) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730637.1 transl_table 11 codon_start 1 locus_tag LOCUS_58330 CDS complement(4148..4936) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079722.1 transl_table 11 codon_start 1 locus_tag LOCUS_58340 CDS 5038..5637 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731397.1 transl_table 11 codon_start 1 locus_tag LOCUS_58350 CDS 5678..6409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58360 CDS 6467..7069 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731397.1 transl_table 11 codon_start 1 locus_tag LOCUS_58370 CDS 7205..8737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58380 CDS 8734..9519 product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086000.1 transl_table 11 codon_start 1 locus_tag LOCUS_58390 CDS 9521..9652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58400 CDS 9649..10344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58410 CDS 10367..10792 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58420 CDS 10789..12006 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085689.1 transl_table 11 codon_start 1 locus_tag LOCUS_58430 CDS 12003..13052 product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 transl_table 11 codon_start 1 locus_tag LOCUS_58440 CDS 13045..14103 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 transl_table 11 codon_start 1 locus_tag LOCUS_58450 CDS 14100..14513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58460 CDS 14510..15715 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104541.1 transl_table 11 codon_start 1 locus_tag LOCUS_58470 CDS 15715..16281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58480 CDS complement(16478..16924) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730672.1 transl_table 11 codon_start 1 locus_tag LOCUS_58490 CDS complement(16930..17211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58500 CDS complement(17221..19608) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730674.1 transl_table 11 codon_start 1 locus_tag LOCUS_58510 CDS complement(19605..21191) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162139558.1 transl_table 11 codon_start 1 locus_tag LOCUS_58520 CDS complement(21218..22264) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730676.1 transl_table 11 codon_start 1 locus_tag LOCUS_58530 CDS complement(22327..23061) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897046.1 transl_table 11 codon_start 1 locus_tag LOCUS_58540 CDS 23088..24557 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730679.1 transl_table 11 codon_start 1 locus_tag LOCUS_58550 CDS 24657..25349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58560 CDS complement(25356..25802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58570 CDS complement(25812..26327) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727835.1 transl_table 11 codon_start 1 locus_tag LOCUS_58580 CDS 26458..27594 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 transl_table 11 codon_start 1 locus_tag LOCUS_58590 CDS complement(27572..27934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730683.1 transl_table 11 codon_start 1 locus_tag LOCUS_58600 CDS complement(28004..29629) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730684.1 transl_table 11 codon_start 1 locus_tag LOCUS_58610 CDS 29665..30762 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897072.1 transl_table 11 codon_start 1 locus_tag LOCUS_58620 CDS 30771..32162 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410042.1 transl_table 11 codon_start 1 locus_tag LOCUS_58630 CDS complement(32159..33982) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730690.1 transl_table 11 codon_start 1 locus_tag LOCUS_58640 CDS complement(33979..35934) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730691.1 transl_table 11 codon_start 1 locus_tag LOCUS_58650 CDS 36236..36937 product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168189073.1 transl_table 11 codon_start 1 locus_tag LOCUS_58660 gene prrA CDS 36942..38282 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730694.1 transl_table 11 codon_start 1 locus_tag LOCUS_58670 CDS complement(38303..38677) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897079.1 transl_table 11 codon_start 1 locus_tag LOCUS_58680 CDS 38637..38957 product DUF2630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897080.1 transl_table 11 codon_start 1 locus_tag LOCUS_58690 CDS 39029..40516 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730696.1 transl_table 11 codon_start 1 locus_tag LOCUS_58700 CDS complement(40527..40955) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730697.1 transl_table 11 codon_start 1 locus_tag LOCUS_58710 CDS complement(40945..42381) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730698.1 transl_table 11 codon_start 1 locus_tag LOCUS_58720 sequence1161 source 1..553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1162 source 1..566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1163 source 1..441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1164 source 1..527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1165 source 1..654 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1166 source 1..628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1167 source 1..522 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1168 source 1..843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(264..>843) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728337.1:signal recognition particle protein locus_tag LOCUS_58730 sequence1169 source 1..323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1170 source 1..359 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1171 source 1..715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1172 source 1..709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 68..625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728035.1 transl_table 11 codon_start 1 locus_tag LOCUS_58740 sequence1173 source 1..441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1174 source 1..792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1175 source 1..845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1176 source 1..387 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1177 source 1..435 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1178 source 1..352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1179 source 1..109048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 123..623 product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731206.1 transl_table 11 codon_start 1 locus_tag LOCUS_58750 CDS 642..1424 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876968.1 transl_table 11 codon_start 1 locus_tag LOCUS_58760 CDS 1424..3055 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876969.1 transl_table 11 codon_start 1 locus_tag LOCUS_58770 gene menD CDS 3078..3593 product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727417.1 transl_table 11 codon_start 1 locus_tag LOCUS_58780 CDS complement(3597..4271) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036429407.1 transl_table 11 codon_start 1 locus_tag LOCUS_58790 CDS 4405..5532 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727419.1 transl_table 11 codon_start 1 locus_tag LOCUS_58800 CDS complement(5611..6435) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 transl_table 11 codon_start 1 locus_tag LOCUS_58810 CDS 6506..7198 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727422.1 transl_table 11 codon_start 1 locus_tag LOCUS_58820 CDS 7239..8300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58830 CDS complement(8297..8536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58840 CDS complement(8687..9118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58850 CDS 9140..9409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58860 CDS complement(9406..10968) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899716.1 transl_table 11 codon_start 1 locus_tag LOCUS_58870 CDS 11054..11653 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899717.1 transl_table 11 codon_start 1 locus_tag LOCUS_58880 CDS complement(11672..12892) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 transl_table 11 codon_start 1 locus_tag LOCUS_58890 CDS 12932..13921 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519569.1 transl_table 11 codon_start 1 locus_tag LOCUS_58900 CDS 13963..14841 product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727439.1 transl_table 11 codon_start 1 locus_tag LOCUS_58910 gene htpX CDS 14899..15513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727441.1 transl_table 11 codon_start 1 locus_tag LOCUS_58920 CDS complement(15522..16682) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727444.1 transl_table 11 codon_start 1 locus_tag LOCUS_58930 CDS 16681..17484 product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005078164.1 transl_table 11 codon_start 1 locus_tag LOCUS_58940 CDS complement(17488..17979) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727465.1 transl_table 11 codon_start 1 locus_tag LOCUS_58950 tRNA 18082..18166 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(18257..19114) product mycofactocin-coupled SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896200.1 transl_table 11 codon_start 1 locus_tag LOCUS_58960 CDS complement(19199..19897) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731385.1 transl_table 11 codon_start 1 locus_tag LOCUS_58970 note possible pseudo, frameshifted CDS 20090..20896 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730131.1 transl_table 11 codon_start 1 locus_tag LOCUS_58980 CDS complement(21049..21498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_58990 CDS complement(21513..22802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59000 CDS complement(22866..23168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896282.1 transl_table 11 codon_start 1 locus_tag LOCUS_59010 CDS complement(23165..24691) product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730162.1 transl_table 11 codon_start 1 locus_tag LOCUS_59020 CDS complement(24688..25446) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730054.1 transl_table 11 codon_start 1 locus_tag LOCUS_59030 CDS complement(25443..26912) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897260.1 transl_table 11 codon_start 1 locus_tag LOCUS_59040 CDS complement(27019..27630) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112853.1 transl_table 11 codon_start 1 locus_tag LOCUS_59050 CDS 27839..28648 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 transl_table 11 codon_start 1 locus_tag LOCUS_59060 CDS complement(28651..29784) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225715.1 transl_table 11 codon_start 1 locus_tag LOCUS_59070 CDS complement(29786..30454) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467027.1 transl_table 11 codon_start 1 locus_tag LOCUS_59080 CDS complement(30451..32130) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728228.1 transl_table 11 codon_start 1 locus_tag LOCUS_59090 CDS complement(32140..32886) product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 transl_table 11 codon_start 1 locus_tag LOCUS_59100 gene fabG CDS complement(32876..33499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59110 CDS complement(33505..34329) product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 transl_table 11 codon_start 1 locus_tag LOCUS_59120 gene htdY CDS 34428..35501 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222574.1 transl_table 11 codon_start 1 locus_tag LOCUS_59130 CDS 35506..36672 product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112542.1 transl_table 11 codon_start 1 locus_tag LOCUS_59140 CDS 36669..37073 product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929578.1 transl_table 11 codon_start 1 locus_tag LOCUS_59150 CDS 37076..37471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59160 CDS 37533..39554 product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228884.1 transl_table 11 codon_start 1 locus_tag LOCUS_59170 CDS 39551..39778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59180 CDS 39775..40638 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 transl_table 11 codon_start 1 locus_tag LOCUS_59190 CDS 40635..41606 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730367.1 transl_table 11 codon_start 1 locus_tag LOCUS_59200 CDS 41603..42403 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730661.1 transl_table 11 codon_start 1 locus_tag LOCUS_59210 CDS 42400..43170 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899864.1 transl_table 11 codon_start 1 locus_tag LOCUS_59220 CDS complement(43136..44338) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 transl_table 11 codon_start 1 locus_tag LOCUS_59230 CDS complement(44341..45153) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064413.1 transl_table 11 codon_start 1 locus_tag LOCUS_59240 CDS 45251..46447 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730165.1 transl_table 11 codon_start 1 locus_tag LOCUS_59250 CDS 46444..47244 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186957.1 transl_table 11 codon_start 1 locus_tag LOCUS_59260 gene paaG CDS 47273..48211 product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730112.1 transl_table 11 codon_start 1 locus_tag LOCUS_59270 CDS 48208..49029 product coniferyl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730142.1 transl_table 11 codon_start 1 locus_tag LOCUS_59280 CDS 49035..49811 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397283.1 transl_table 11 codon_start 1 locus_tag LOCUS_59290 CDS 49813..50349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59300 CDS 50353..51840 product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208267418.1 transl_table 11 codon_start 1 locus_tag LOCUS_59310 CDS complement(51830..53134) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 transl_table 11 codon_start 1 locus_tag LOCUS_59320 CDS 53231..53425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59330 CDS complement(53430..54779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59340 CDS complement(54792..55931) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730154.1 transl_table 11 codon_start 1 locus_tag LOCUS_59350 CDS complement(55955..57001) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 transl_table 11 codon_start 1 locus_tag LOCUS_59360 CDS complement(57012..57209) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897302.1 transl_table 11 codon_start 1 locus_tag LOCUS_59370 CDS 57306..58100 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043677442.1 transl_table 11 codon_start 1 locus_tag LOCUS_59380 CDS complement(58093..58527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59390 CDS complement(58524..59741) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257259.1 transl_table 11 codon_start 1 locus_tag LOCUS_59400 note possible pseudo, frameshifted CDS complement(59908..60393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59410 CDS complement(60390..61109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59420 note possible pseudo, internal stop codon CDS complement(61173..61625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59430 note possible pseudo, internal stop codon CDS complement(61622..62776) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894374.1 transl_table 11 codon_start 1 locus_tag LOCUS_59440 CDS 62858..63253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59450 CDS 63269..64168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59460 CDS 64171..64602 product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206153.1 transl_table 11 codon_start 1 locus_tag LOCUS_59470 CDS complement(64645..66204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59480 CDS complement(66494..67420) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064437.1 transl_table 11 codon_start 1 locus_tag LOCUS_59490 CDS complement(67417..68973) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893590.1 transl_table 11 codon_start 1 locus_tag LOCUS_59500 CDS 69097..69864 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228963.1 transl_table 11 codon_start 1 locus_tag LOCUS_59510 CDS complement(69869..71062) product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730851.1 transl_table 11 codon_start 1 locus_tag LOCUS_59520 CDS complement(71114..71560) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731409.1 transl_table 11 codon_start 1 locus_tag LOCUS_59530 CDS complement(71557..72495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59540 CDS 72433..72765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59550 CDS complement(72771..73967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59560 CDS 74042..75274 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730119.1 transl_table 11 codon_start 1 locus_tag LOCUS_59570 CDS 75310..76530 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730093.1 transl_table 11 codon_start 1 locus_tag LOCUS_59580 CDS complement(76543..77661) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 transl_table 11 codon_start 1 locus_tag LOCUS_59590 CDS complement(77878..79962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59600 CDS 80091..81305 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728260.1 transl_table 11 codon_start 1 locus_tag LOCUS_59610 CDS 81336..82562 product cytochrome P450 Cyp144 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408772.1 transl_table 11 codon_start 1 locus_tag LOCUS_59620 gene cyp144 CDS 82559..82984 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893617.1 transl_table 11 codon_start 1 locus_tag LOCUS_59630 CDS complement(82968..84044) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228921.1 transl_table 11 codon_start 1 locus_tag LOCUS_59640 CDS complement(84034..85227) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228920.1 transl_table 11 codon_start 1 locus_tag LOCUS_59650 CDS complement(85224..85661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59660 CDS 85746..86636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59670 CDS 86719..87624 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225710.1 transl_table 11 codon_start 1 locus_tag LOCUS_59680 CDS 87641..89065 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730666.1 transl_table 11 codon_start 1 locus_tag LOCUS_59690 CDS 89058..89492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59700 CDS 89492..90670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59710 note possible pseudo, frameshifted CDS complement(90702..92138) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967349.1 transl_table 11 codon_start 1 locus_tag LOCUS_59720 CDS 92420..93739 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896236.1 transl_table 11 codon_start 1 locus_tag LOCUS_59730 CDS 93742..94251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730120.1 transl_table 11 codon_start 1 locus_tag LOCUS_59740 CDS complement(94437..95078) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730848.1 transl_table 11 codon_start 1 locus_tag LOCUS_59750 CDS 96200..96895 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084054.1 transl_table 11 codon_start 1 locus_tag LOCUS_59760 CDS 96990..98417 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211158.1 transl_table 11 codon_start 1 locus_tag LOCUS_59770 CDS 98414..99040 product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095285.1 transl_table 11 codon_start 1 locus_tag LOCUS_59780 CDS 99037..99321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59790 CDS 99318..100130 product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281372.1 transl_table 11 codon_start 1 locus_tag LOCUS_59800 gene hcaB CDS 100127..100909 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355294.1 transl_table 11 codon_start 1 locus_tag LOCUS_59810 CDS complement(100915..101361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59820 CDS 101739..102878 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409667.1 transl_table 11 codon_start 1 locus_tag LOCUS_59830 CDS complement(102892..103815) product DUF4436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898562.1 transl_table 11 codon_start 1 locus_tag LOCUS_59840 CDS complement(103958..104836) product DUF4344 domain-containing metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726965.1 transl_table 11 codon_start 1 locus_tag LOCUS_59850 CDS complement(104948..106051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59860 CDS 105960..106193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59870 CDS complement(106295..106777) product mycobacterial cell wall protein Rv0580c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403017.1 transl_table 11 codon_start 1 locus_tag LOCUS_59880 CDS complement(106824..107210) product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 transl_table 11 codon_start 1 locus_tag LOCUS_59890 CDS 107396..108940 product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 transl_table 11 codon_start 1 locus_tag LOCUS_59900 gene phoD sequence1180 source 1..691 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1181 source 1..698 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1182 source 1..707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1183 source 1..440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1184 source 1..436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1185 source 1..411 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1186 source 1..625 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1187 source 1..332 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1188 source 1..837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence1189 source 1..23440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(374..580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59910 CDS complement(1057..1449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296247.1 transl_table 11 codon_start 1 locus_tag LOCUS_59920 CDS complement(1446..2252) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296248.1 transl_table 11 codon_start 1 locus_tag LOCUS_59930 CDS complement(2374..3144) product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296249.1 transl_table 11 codon_start 1 locus_tag LOCUS_59940 CDS complement(3138..3308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59950 CDS 3588..4409 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296228.1 transl_table 11 codon_start 1 locus_tag LOCUS_59960 CDS 4406..4846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296229.1 transl_table 11 codon_start 1 locus_tag LOCUS_59970 CDS 4935..5168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296230.1 transl_table 11 codon_start 1 locus_tag LOCUS_59980 CDS 5168..5464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_59990 CDS complement(5639..5818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60000 CDS complement(5815..6411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60010 note possible pseudo, internal stop codon, frameshifted CDS complement(6499..6843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60020 note possible pseudo, frameshifted CDS complement(6843..7226) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 transl_table 11 codon_start 1 locus_tag LOCUS_60030 CDS 7365..8783 product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 transl_table 11 codon_start 1 locus_tag LOCUS_60040 gene merA CDS 8812..9327 product Hg(2+) transporter MerH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130983727.1 transl_table 11 codon_start 1 locus_tag LOCUS_60050 gene merH CDS 9374..10030 product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296236.1 transl_table 11 codon_start 1 locus_tag LOCUS_60060 gene merB CDS 10027..11379 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296237.1 transl_table 11 codon_start 1 locus_tag LOCUS_60070 CDS 11578..12162 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296238.1 transl_table 11 codon_start 1 locus_tag LOCUS_60080 CDS 12220..12810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296239.1 transl_table 11 codon_start 1 locus_tag LOCUS_60090 CDS 12977..13504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296240.1 transl_table 11 codon_start 1 locus_tag LOCUS_60100 CDS 13489..15948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60110 CDS 15945..16706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296242.1 transl_table 11 codon_start 1 locus_tag LOCUS_60120 CDS complement(16718..20050) product MobF family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296243.1 transl_table 11 codon_start 1 locus_tag LOCUS_60130 gene mobF CDS complement(20367..20825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60140 CDS complement(21893..22090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60150 CDS 22177..22563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296245.1 transl_table 11 codon_start 1 locus_tag LOCUS_60160 CDS complement(22586..22906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60170 CDS complement(22918..23223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069416905.1 transl_table 11 codon_start 1 locus_tag LOCUS_60180 sequence1190 source 1..4376 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(60..305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60190 CDS complement(514..1974) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030921.1 transl_table 11 codon_start 1 locus_tag LOCUS_60200 CDS complement(2171..2461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_60210 CDS complement(2458..4233) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 transl_table 11 codon_start 1 locus_tag LOCUS_60220 gene frdA