>Feature sequence01 112 939 gene locus_tag LOCUS_00010 112 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4497 985 gene locus_tag LOCUS_00020 gene mmpL12 4497 985 CDS product RND transporter MmpL12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901188.1 protein_id gnl|my_center|LOCUS_00020 4782 5567 gene locus_tag LOCUS_00030 4782 5567 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407670.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00030 6845 5604 gene locus_tag LOCUS_00040 6845 5604 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407676.1 protein_id gnl|my_center|LOCUS_00040 >Feature sequence02 <1 1294 gene locus_tag LOCUS_00050 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886110.1:serine/threonine protein kinase PknH 1415 3805 gene locus_tag LOCUS_00060 1415 3805 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030872986.1 protein_id gnl|my_center|LOCUS_00060 3998 4735 gene locus_tag LOCUS_00070 gene lprA 3998 4735 CDS product TLR2 agonist LprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406562.1 protein_id gnl|my_center|LOCUS_00070 4807 5178 gene locus_tag LOCUS_00080 4807 5178 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406558.1 protein_id gnl|my_center|LOCUS_00080 5587 5306 gene locus_tag LOCUS_00090 5587 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 >Feature sequence03 354 2753 gene locus_tag LOCUS_00100 354 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00100 2810 6082 gene locus_tag LOCUS_00110 2810 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6448 7275 gene locus_tag LOCUS_00120 6448 7275 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414900.1 protein_id gnl|my_center|LOCUS_00120 7912 7421 gene locus_tag LOCUS_00130 7912 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9613 8168 gene locus_tag LOCUS_00140 gene papA3 9613 8168 CDS product acyltransferase PapA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898759.1 protein_id gnl|my_center|LOCUS_00140 11042 9873 gene locus_tag LOCUS_00150 11042 9873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11959 11009 gene locus_tag LOCUS_00160 11959 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 11049 11055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <12569 11886 gene locus_tag LOCUS_00170 <12569 11886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003913253.1:type I polyketide synthase note possible pseudo, frameshifted >Feature sequence04 513 304 gene locus_tag LOCUS_00180 513 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 <1779 536 gene locus_tag LOCUS_00190 <1779 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027312.1:glycoside hydrolase family 64 protein >Feature sequence05 296 135 gene locus_tag LOCUS_00200 296 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 1928 765 gene locus_tag LOCUS_00210 1928 765 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229317.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00210 2790 2326 gene locus_tag LOCUS_00220 2790 2326 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407340.1 protein_id gnl|my_center|LOCUS_00220 3269 2787 gene locus_tag LOCUS_00230 gene ribH 3269 2787 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898872.1 protein_id gnl|my_center|LOCUS_00230 4611 3325 gene locus_tag LOCUS_00240 4611 3325 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407334.1 protein_id gnl|my_center|LOCUS_00240 5315 4692 gene locus_tag LOCUS_00250 5315 4692 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407318.1 protein_id gnl|my_center|LOCUS_00250 5205 6101 gene locus_tag LOCUS_00260 gene lprG 5205 6101 CDS product lipoarabinomannan carrier protein LprG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407315.1 protein_id gnl|my_center|LOCUS_00260 6059 7678 gene locus_tag LOCUS_00270 6059 7678 CDS product aminoglycoside/tetracycline transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407310.1 protein_id gnl|my_center|LOCUS_00270 8705 7659 gene locus_tag LOCUS_00280 gene ribD 8705 7659 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407308.1 protein_id gnl|my_center|LOCUS_00280 9402 8713 gene locus_tag LOCUS_00290 gene rpe 9402 8713 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898866.1 protein_id gnl|my_center|LOCUS_00290 10798 9413 gene locus_tag LOCUS_00300 10798 9413 CDS product 16S rRNA m5C967 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898865.1 protein_id gnl|my_center|LOCUS_00300 11730 10795 gene locus_tag LOCUS_00310 gene fmt 11730 10795 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900336.1 protein_id gnl|my_center|LOCUS_00310 11916 12740 gene locus_tag LOCUS_00320 11916 12740 CDS product virulence-associated methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407297.1 protein_id gnl|my_center|LOCUS_00320 13241 12759 gene locus_tag LOCUS_00330 13241 12759 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407295.1 protein_id gnl|my_center|LOCUS_00330 13379 14203 gene locus_tag LOCUS_00340 13379 14203 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407292.1 protein_id gnl|my_center|LOCUS_00340 16179 14212 gene locus_tag LOCUS_00350 16179 14212 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407285.1 protein_id gnl|my_center|LOCUS_00350 16963 16199 gene locus_tag LOCUS_00360 16963 16199 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898862.1 protein_id gnl|my_center|LOCUS_00360 16944 17903 gene locus_tag LOCUS_00370 16944 17903 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407279.1 protein_id gnl|my_center|LOCUS_00370 18036 18245 gene locus_tag LOCUS_00380 18036 18245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00380 18223 18747 gene locus_tag LOCUS_00390 18223 18747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00390 18956 18699 gene locus_tag LOCUS_00400 18956 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 >Feature sequence06 >Feature sequence07 >Feature sequence08 454 858 gene locus_tag LOCUS_00410 454 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 1466 1092 gene locus_tag LOCUS_00420 1466 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400629.1 protein_id gnl|my_center|LOCUS_00420 1632 2684 gene locus_tag LOCUS_00430 1632 2684 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400616.1 protein_id gnl|my_center|LOCUS_00430 2688 3680 gene locus_tag LOCUS_00440 2688 3680 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899801.1 protein_id gnl|my_center|LOCUS_00440 4538 3696 gene locus_tag LOCUS_00450 4538 3696 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900801.1 protein_id gnl|my_center|LOCUS_00450 4595 5200 gene locus_tag LOCUS_00460 4595 5200 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899803.1 protein_id gnl|my_center|LOCUS_00460 5740 5534 gene locus_tag LOCUS_00470 5740 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400649.1 protein_id gnl|my_center|LOCUS_00470 6869 5934 gene locus_tag LOCUS_00480 6869 5934 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143349.1 protein_id gnl|my_center|LOCUS_00480 6935 8041 gene locus_tag LOCUS_00490 6935 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877149.1 protein_id gnl|my_center|LOCUS_00490 8555 8472 gene locus_tag LOCUS_t00010 8555 8472 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8652 9842 gene locus_tag LOCUS_00500 8652 9842 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113287.1 protein_id gnl|my_center|LOCUS_00500 9957 11186 gene locus_tag LOCUS_00510 9957 11186 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727437.1 protein_id gnl|my_center|LOCUS_00510 11317 12111 gene locus_tag LOCUS_00520 11317 12111 CDS product dormancy-associated translation inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400655.1 protein_id gnl|my_center|LOCUS_00520 12108 12560 gene locus_tag LOCUS_00530 12108 12560 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400656.1 protein_id gnl|my_center|LOCUS_00530 12669 13019 gene locus_tag LOCUS_00540 12669 13019 CDS product lsr2/espR transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400657.1 protein_id gnl|my_center|LOCUS_00540 13449 13808 gene locus_tag LOCUS_00550 13449 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 13808 13993 gene locus_tag LOCUS_00560 13808 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 14857 14069 gene locus_tag LOCUS_00570 14857 14069 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668803.1 protein_id gnl|my_center|LOCUS_00570 14909 16114 gene locus_tag LOCUS_00580 14909 16114 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_00580 16848 16183 gene locus_tag LOCUS_00590 16848 16183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 17701 16892 gene locus_tag LOCUS_00600 17701 16892 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769928.1 protein_id gnl|my_center|LOCUS_00600 18913 17906 gene locus_tag LOCUS_00610 18913 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 19226 18921 gene locus_tag LOCUS_00620 19226 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 19725 20012 gene locus_tag LOCUS_00630 19725 20012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 20016 20531 gene locus_tag LOCUS_00640 20016 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 21028 20609 gene locus_tag LOCUS_00650 21028 20609 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730501.1 protein_id gnl|my_center|LOCUS_00650 21313 21047 gene locus_tag LOCUS_00660 21313 21047 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064709.1 protein_id gnl|my_center|LOCUS_00660 21405 21779 gene locus_tag LOCUS_00670 21405 21779 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408743.1 protein_id gnl|my_center|LOCUS_00670 21859 22659 gene locus_tag LOCUS_00680 21859 22659 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899807.1 protein_id gnl|my_center|LOCUS_00680 23321 22878 gene locus_tag LOCUS_00690 23321 22878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 24106 23261 gene locus_tag LOCUS_00700 24106 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 25305 24106 gene locus_tag LOCUS_00710 25305 24106 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112565.1 protein_id gnl|my_center|LOCUS_00710 25699 25298 gene locus_tag LOCUS_00720 25699 25298 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079675.1 protein_id gnl|my_center|LOCUS_00720 26848 25703 gene locus_tag LOCUS_00730 26848 25703 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112567.1 protein_id gnl|my_center|LOCUS_00730 27548 26895 gene locus_tag LOCUS_00740 27548 26895 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088064.1 protein_id gnl|my_center|LOCUS_00740 28309 27602 gene locus_tag LOCUS_00750 28309 27602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095617.1 protein_id gnl|my_center|LOCUS_00750 29233 28325 gene locus_tag LOCUS_00760 29233 28325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 28446 28450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29733 30572 gene locus_tag LOCUS_00770 29733 30572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 30582 32516 gene locus_tag LOCUS_00780 30582 32516 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900808.1 protein_id gnl|my_center|LOCUS_00780 32731 32513 gene locus_tag LOCUS_00790 32731 32513 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085579.1 protein_id gnl|my_center|LOCUS_00790 34978 32741 gene locus_tag LOCUS_00800 34978 32741 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400797.1 protein_id gnl|my_center|LOCUS_00800 36423 35047 gene locus_tag LOCUS_00810 36423 35047 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950630.1 protein_id gnl|my_center|LOCUS_00810 36603 36439 gene locus_tag LOCUS_00820 gene rpmG 36603 36439 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063154.1 protein_id gnl|my_center|LOCUS_00820 36851 36603 gene locus_tag LOCUS_00830 gene rpmB 36851 36603 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083638.1 protein_id gnl|my_center|LOCUS_00830 36958 38157 gene locus_tag LOCUS_00840 36958 38157 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400804.1 protein_id gnl|my_center|LOCUS_00840 38154 38411 gene locus_tag LOCUS_00850 38154 38411 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897470.1 protein_id gnl|my_center|LOCUS_00850 38731 39600 gene locus_tag LOCUS_00860 38731 39600 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111061.1 protein_id gnl|my_center|LOCUS_00860 39603 41177 gene locus_tag LOCUS_00870 gene fadD12 39603 41177 CDS product acyl-CoA ligase FadD12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898876.1 protein_id gnl|my_center|LOCUS_00870 46009 41168 gene locus_tag LOCUS_00880 46009 41168 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886065.1 protein_id gnl|my_center|LOCUS_00880 46225 46407 gene locus_tag LOCUS_00890 46225 46407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 46787 46554 gene locus_tag LOCUS_00900 46787 46554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400812.1 protein_id gnl|my_center|LOCUS_00900 47303 49315 gene locus_tag LOCUS_00910 47303 49315 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900811.1 protein_id gnl|my_center|LOCUS_00910 49767 49976 gene locus_tag LOCUS_00920 49767 49976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400850.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence09 <1 627 gene locus_tag LOCUS_00930 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402147.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase 627 1001 gene locus_tag LOCUS_00940 627 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 1040 1354 gene locus_tag LOCUS_00950 1040 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 2462 1257 gene locus_tag LOCUS_00960 2462 1257 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876881.1 protein_id gnl|my_center|LOCUS_00960 2699 2998 gene locus_tag LOCUS_00970 2699 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 3475 3071 gene locus_tag LOCUS_00980 3475 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3715 3488 gene locus_tag LOCUS_00990 3715 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 3626 3907 gene locus_tag LOCUS_01000 3626 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3907 4200 gene locus_tag LOCUS_01010 3907 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 6068 4602 gene locus_tag LOCUS_01020 6068 4602 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402135.1 protein_id gnl|my_center|LOCUS_01020 7660 6191 gene locus_tag LOCUS_01030 7660 6191 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727204.1 protein_id gnl|my_center|LOCUS_01030 9150 7669 gene locus_tag LOCUS_01040 9150 7669 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402133.1 protein_id gnl|my_center|LOCUS_01040 9428 9255 gene locus_tag LOCUS_01050 9428 9255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01050 9681 9448 gene locus_tag LOCUS_01060 9681 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01060 9955 9713 gene locus_tag LOCUS_01070 9955 9713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01070 10345 10866 gene locus_tag LOCUS_01080 10345 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 11757 10960 gene locus_tag LOCUS_01090 gene thiG 11757 10960 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402126.1 protein_id gnl|my_center|LOCUS_01090 11947 11750 gene locus_tag LOCUS_01100 gene thiS 11947 11750 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402121.1 protein_id gnl|my_center|LOCUS_01100 12951 11944 gene locus_tag LOCUS_01110 gene thiO 12951 11944 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402118.1 protein_id gnl|my_center|LOCUS_01110 13081 13752 gene locus_tag LOCUS_01120 gene thiE 13081 13752 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402115.1 protein_id gnl|my_center|LOCUS_01120 14356 13724 gene locus_tag LOCUS_01130 14356 13724 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402111.1 protein_id gnl|my_center|LOCUS_01130 14482 15801 gene locus_tag LOCUS_01140 gene glnX 14482 15801 CDS product protein kinase G-activating protein GlnX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402108.1 protein_id gnl|my_center|LOCUS_01140 15801 16772 gene locus_tag LOCUS_01150 15801 16772 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900142.1 protein_id gnl|my_center|LOCUS_01150 16772 19060 gene locus_tag LOCUS_01160 gene pknG 16772 19060 CDS product serine/threonine protein kinase PknG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402100.1 protein_id gnl|my_center|LOCUS_01160 20287 19115 gene locus_tag LOCUS_01170 20287 19115 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402097.1 protein_id gnl|my_center|LOCUS_01170 22355 20280 gene locus_tag LOCUS_01180 gene pta 22355 20280 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402089.1 protein_id gnl|my_center|LOCUS_01180 23367 22357 gene locus_tag LOCUS_01190 gene fgd 23367 22357 CDS product glucose-6-phosphate dehydrogenase (coenzyme-F420) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898438.1 protein_id gnl|my_center|LOCUS_01190 23506 24246 gene locus_tag LOCUS_01200 23506 24246 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898437.1 protein_id gnl|my_center|LOCUS_01200 25267 24248 gene locus_tag LOCUS_01210 25267 24248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 27063 25213 gene locus_tag LOCUS_01220 27063 25213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01220 27821 27147 gene locus_tag LOCUS_01230 27821 27147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 28428 28664 gene locus_tag LOCUS_01240 28428 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 29221 28787 gene locus_tag LOCUS_01250 29221 28787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 30901 30719 gene locus_tag LOCUS_01260 30901 30719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 31359 31787 gene locus_tag LOCUS_01270 31359 31787 CDS product MmpS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402074.1 protein_id gnl|my_center|LOCUS_01270 31841 34660 gene locus_tag LOCUS_01280 gene mmpL1 31841 34660 CDS product RND transporter MmpL1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898435.1 protein_id gnl|my_center|LOCUS_01280 35226 34855 gene locus_tag LOCUS_01290 35226 34855 CDS product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401978.1 protein_id gnl|my_center|LOCUS_01290 35259 36449 gene locus_tag LOCUS_01300 35259 36449 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401972.1 protein_id gnl|my_center|LOCUS_01300 36459 37688 gene locus_tag LOCUS_01310 36459 37688 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898432.1 protein_id gnl|my_center|LOCUS_01310 37695 38336 gene locus_tag LOCUS_01320 37695 38336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401963.1 protein_id gnl|my_center|LOCUS_01320 39208 38840 gene locus_tag LOCUS_01330 39208 38840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401960.1 protein_id gnl|my_center|LOCUS_01330 40115 39135 gene locus_tag LOCUS_01340 40115 39135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01340 40261 40112 gene locus_tag LOCUS_01350 40261 40112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 40808 42220 gene locus_tag LOCUS_01360 40808 42220 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898428.1 protein_id gnl|my_center|LOCUS_01360 43440 42217 gene locus_tag LOCUS_01370 43440 42217 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401927.1 protein_id gnl|my_center|LOCUS_01370 43862 43437 gene locus_tag LOCUS_01380 43862 43437 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401921.1 protein_id gnl|my_center|LOCUS_01380 45034 43859 gene locus_tag LOCUS_01390 gene purT 45034 43859 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898427.1 protein_id gnl|my_center|LOCUS_01390 45324 45635 gene locus_tag LOCUS_01400 45324 45635 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406222.1 protein_id gnl|my_center|LOCUS_01400 45638 46978 gene locus_tag LOCUS_01410 45638 46978 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950393.1 protein_id gnl|my_center|LOCUS_01410 47639 46992 gene locus_tag LOCUS_01420 47639 46992 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401827.1 protein_id gnl|my_center|LOCUS_01420 48934 47636 gene locus_tag LOCUS_01430 48934 47636 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_01430 49025 49681 gene locus_tag LOCUS_01440 49025 49681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401831.1 protein_id gnl|my_center|LOCUS_01440 49701 50471 gene locus_tag LOCUS_01450 49701 50471 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401851.1 protein_id gnl|my_center|LOCUS_01450 52031 50496 gene locus_tag LOCUS_01460 gene espB 52031 50496 CDS product type VII secretion system ESX-1 target EspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399995.1 protein_id gnl|my_center|LOCUS_01460 54039 52762 gene locus_tag LOCUS_01470 54039 52762 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125720.1 protein_id gnl|my_center|LOCUS_01470 55824 54130 gene locus_tag LOCUS_01480 55824 54130 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950839.1 protein_id gnl|my_center|LOCUS_01480 55706 56059 gene locus_tag LOCUS_01490 55706 56059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 57866 56778 gene locus_tag LOCUS_01500 57866 56778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence10 >Feature sequence11 >Feature sequence12 606 253 gene locus_tag LOCUS_01510 606 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412119.1 protein_id gnl|my_center|LOCUS_01510 2349 823 gene locus_tag LOCUS_01520 2349 823 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899284.1 protein_id gnl|my_center|LOCUS_01520 3893 2493 gene locus_tag LOCUS_01530 3893 2493 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899285.1 protein_id gnl|my_center|LOCUS_01530 5827 4265 gene locus_tag LOCUS_01540 5827 4265 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911847.1 protein_id gnl|my_center|LOCUS_01540 6245 7018 gene locus_tag LOCUS_01550 6245 7018 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906617.1 protein_id gnl|my_center|LOCUS_01550 7458 7156 gene locus_tag LOCUS_01560 7458 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 7552 7848 gene locus_tag LOCUS_01570 7552 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8142 8609 gene locus_tag LOCUS_01580 8142 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9216 8932 gene locus_tag LOCUS_01590 gene esxN 9216 8932 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015293199.1 protein_id gnl|my_center|LOCUS_01590 9526 9227 gene locus_tag LOCUS_01600 gene esxJ 9526 9227 CDS product type VII secretion system ESX-5 protein EsxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900502.1 protein_id gnl|my_center|LOCUS_01600 9889 9626 gene locus_tag LOCUS_01610 9889 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 10019 10423 gene locus_tag LOCUS_01620 10019 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12313 10955 gene locus_tag LOCUS_01630 12313 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence13 >Feature sequence14 >Feature sequence15 262 1176 gene locus_tag LOCUS_01640 262 1176 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405888.1 protein_id gnl|my_center|LOCUS_01640 1197 2423 gene locus_tag LOCUS_01650 1197 2423 CDS product WS/DGAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900276.1 protein_id gnl|my_center|LOCUS_01650 2828 2598 gene locus_tag LOCUS_01660 2828 2598 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417286.1 protein_id gnl|my_center|LOCUS_01660 3473 2868 gene locus_tag LOCUS_01670 3473 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405892.1 protein_id gnl|my_center|LOCUS_01670 5119 3470 gene locus_tag LOCUS_01680 5119 3470 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903329.1 protein_id gnl|my_center|LOCUS_01680 5215 5721 gene locus_tag LOCUS_01690 5215 5721 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908043.1 protein_id gnl|my_center|LOCUS_01690 6119 6664 gene locus_tag LOCUS_01700 6119 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 7259 7897 gene locus_tag LOCUS_01710 7259 7897 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006996462.1 protein_id gnl|my_center|LOCUS_01710 7878 8549 gene locus_tag LOCUS_01720 7878 8549 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967222.1 protein_id gnl|my_center|LOCUS_01720 9057 8647 gene locus_tag LOCUS_01730 9057 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 10587 9160 gene locus_tag LOCUS_01740 10587 9160 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405904.1 protein_id gnl|my_center|LOCUS_01740 10689 12203 gene locus_tag LOCUS_01750 10689 12203 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898738.1 protein_id gnl|my_center|LOCUS_01750 12200 13096 gene locus_tag LOCUS_01760 gene prpB 12200 13096 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112517.1 protein_id gnl|my_center|LOCUS_01760 13077 14201 gene locus_tag LOCUS_01770 13077 14201 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405909.1 protein_id gnl|my_center|LOCUS_01770 14278 15999 gene locus_tag LOCUS_01780 14278 15999 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405912.1 protein_id gnl|my_center|LOCUS_01780 18349 16079 gene locus_tag LOCUS_01790 gene metE 18349 16079 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405914.1 protein_id gnl|my_center|LOCUS_01790 18883 19230 gene locus_tag LOCUS_01800 18883 19230 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230891.1 protein_id gnl|my_center|LOCUS_01800 19227 20447 gene locus_tag LOCUS_01810 19227 20447 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230890.1 protein_id gnl|my_center|LOCUS_01810 20455 20901 gene locus_tag LOCUS_01820 20455 20901 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225379.1 protein_id gnl|my_center|LOCUS_01820 24064 20909 gene locus_tag LOCUS_01830 24064 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 24328 25584 gene locus_tag LOCUS_01840 24328 25584 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896601.1 protein_id gnl|my_center|LOCUS_01840 25581 26381 gene locus_tag LOCUS_01850 25581 26381 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730375.1 protein_id gnl|my_center|LOCUS_01850 27404 26391 gene locus_tag LOCUS_01860 27404 26391 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405932.1 protein_id gnl|my_center|LOCUS_01860 27955 27455 gene locus_tag LOCUS_01870 27955 27455 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 protein_id gnl|my_center|LOCUS_01870 28964 27960 gene locus_tag LOCUS_01880 28964 27960 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727205.1 protein_id gnl|my_center|LOCUS_01880 29098 30183 gene locus_tag LOCUS_01890 gene mcr 29098 30183 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898740.1 protein_id gnl|my_center|LOCUS_01890 30216 30968 gene locus_tag LOCUS_01900 30216 30968 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405961.1 protein_id gnl|my_center|LOCUS_01900 31240 31085 gene locus_tag LOCUS_01910 31240 31085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730366.1 protein_id gnl|my_center|LOCUS_01910 31474 33834 gene locus_tag LOCUS_01920 31474 33834 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405970.1 protein_id gnl|my_center|LOCUS_01920 33827 34573 gene locus_tag LOCUS_01930 33827 34573 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730363.1 protein_id gnl|my_center|LOCUS_01930 34570 35217 gene locus_tag LOCUS_01940 34570 35217 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405982.1 protein_id gnl|my_center|LOCUS_01940 35955 35242 gene locus_tag LOCUS_01950 gene cobB 35955 35242 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406044.1 protein_id gnl|my_center|LOCUS_01950 35993 36358 gene locus_tag LOCUS_01960 35993 36358 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406047.1 protein_id gnl|my_center|LOCUS_01960 36916 36395 gene locus_tag LOCUS_01970 36916 36395 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936776.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 36963 37406 gene locus_tag LOCUS_01980 36963 37406 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406060.1 protein_id gnl|my_center|LOCUS_01980 37426 37599 gene locus_tag LOCUS_01990 37426 37599 CDS product DUF5302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406063.1 protein_id gnl|my_center|LOCUS_01990 37713 38306 gene locus_tag LOCUS_02000 37713 38306 CDS product HhH-GPD-type base excision DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406064.1 protein_id gnl|my_center|LOCUS_02000 38303 38449 gene locus_tag LOCUS_02010 38303 38449 CDS product DUF1059 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896554.1 protein_id gnl|my_center|LOCUS_02010 39308 38454 gene locus_tag LOCUS_02020 39308 38454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591911.1 protein_id gnl|my_center|LOCUS_02020 40128 39424 gene locus_tag LOCUS_02030 40128 39424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406075.1 protein_id gnl|my_center|LOCUS_02030 40303 41514 gene locus_tag LOCUS_02040 40303 41514 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900282.1 protein_id gnl|my_center|LOCUS_02040 41752 41492 gene locus_tag LOCUS_02050 41752 41492 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_02050 41804 42199 gene locus_tag LOCUS_02060 gene mutT 41804 42199 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406084.1 protein_id gnl|my_center|LOCUS_02060 >Feature sequence16 >Feature sequence17 120 368 gene locus_tag LOCUS_02070 120 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 365 781 gene locus_tag LOCUS_02080 365 781 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 protein_id gnl|my_center|LOCUS_02080 1747 974 gene locus_tag LOCUS_02090 1747 974 CDS product TIGR03084 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400427.1 protein_id gnl|my_center|LOCUS_02090 3096 1795 gene locus_tag LOCUS_02100 3096 1795 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400431.1 protein_id gnl|my_center|LOCUS_02100 3244 3849 gene locus_tag LOCUS_02110 3244 3849 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400460.1 protein_id gnl|my_center|LOCUS_02110 4890 3856 gene locus_tag LOCUS_02120 4890 3856 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095694.1 protein_id gnl|my_center|LOCUS_02120 5260 4910 gene locus_tag LOCUS_02130 5260 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907179.1 protein_id gnl|my_center|LOCUS_02130 6372 5341 gene locus_tag LOCUS_02140 6372 5341 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900793.1 protein_id gnl|my_center|LOCUS_02140 6575 9487 gene locus_tag LOCUS_02150 gene leuS 6575 9487 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900794.1 protein_id gnl|my_center|LOCUS_02150 10050 9547 gene locus_tag LOCUS_02160 10050 9547 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400476.1 protein_id gnl|my_center|LOCUS_02160 11092 10400 gene locus_tag LOCUS_02170 11092 10400 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899786.1 protein_id gnl|my_center|LOCUS_02170 11960 11175 gene locus_tag LOCUS_02180 11960 11175 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400486.1 protein_id gnl|my_center|LOCUS_02180 13169 12066 gene locus_tag LOCUS_02190 13169 12066 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400492.1 protein_id gnl|my_center|LOCUS_02190 13775 13233 gene locus_tag LOCUS_02200 13775 13233 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899787.1 protein_id gnl|my_center|LOCUS_02200 14879 13935 gene locus_tag LOCUS_02210 14879 13935 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907183.1 protein_id gnl|my_center|LOCUS_02210 14931 15374 gene locus_tag LOCUS_02220 14931 15374 CDS product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296823.1 protein_id gnl|my_center|LOCUS_02220 15274 17874 gene locus_tag LOCUS_02230 gene ponA1 15274 17874 CDS product transglycosylase/D,D-transpeptidase PonA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031651598.1 protein_id gnl|my_center|LOCUS_02230 17871 19493 gene locus_tag LOCUS_02240 17871 19493 CDS product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400514.1 protein_id gnl|my_center|LOCUS_02240 19493 20131 gene locus_tag LOCUS_02250 19493 20131 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400517.1 protein_id gnl|my_center|LOCUS_02250 20255 20545 gene locus_tag LOCUS_02260 gene rpsF 20255 20545 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400520.1 protein_id gnl|my_center|LOCUS_02260 20694 21194 gene locus_tag LOCUS_02270 20694 21194 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 protein_id gnl|my_center|LOCUS_02270 21244 21498 gene locus_tag LOCUS_02280 gene rpsR 21244 21498 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400540.1 protein_id gnl|my_center|LOCUS_02280 21531 21992 gene locus_tag LOCUS_02290 gene rplI 21531 21992 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400543.1 protein_id gnl|my_center|LOCUS_02290 22328 22119 gene locus_tag LOCUS_02300 22328 22119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 22549 25500 gene locus_tag LOCUS_02310 22549 25500 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878795.1 protein_id gnl|my_center|LOCUS_02310 26020 25676 gene locus_tag LOCUS_02320 26020 25676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899794.1 protein_id gnl|my_center|LOCUS_02320 26539 27483 gene locus_tag LOCUS_02330 26539 27483 CDS product glycoside hydrolase family 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400562.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02330 27732 28679 gene locus_tag LOCUS_02340 27732 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 28625 28885 gene locus_tag LOCUS_02350 28625 28885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 29130 28945 gene locus_tag LOCUS_02360 29130 28945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 30398 29187 gene locus_tag LOCUS_02370 30398 29187 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727016.1 protein_id gnl|my_center|LOCUS_02370 32736 30505 gene locus_tag LOCUS_02380 32736 30505 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899797.1 protein_id gnl|my_center|LOCUS_02380 33421 32858 gene locus_tag LOCUS_02390 33421 32858 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400591.1 protein_id gnl|my_center|LOCUS_02390 33535 34446 gene locus_tag LOCUS_02400 33535 34446 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899798.1 protein_id gnl|my_center|LOCUS_02400 35850 34465 gene locus_tag LOCUS_02410 35850 34465 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400600.1 protein_id gnl|my_center|LOCUS_02410 37172 35847 gene locus_tag LOCUS_02420 37172 35847 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899799.1 protein_id gnl|my_center|LOCUS_02420 40119 37207 gene locus_tag LOCUS_02430 gene gcvP 40119 37207 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226813.1 protein_id gnl|my_center|LOCUS_02430 40625 40365 gene locus_tag LOCUS_02440 40625 40365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 41042 41599 gene locus_tag LOCUS_02450 41042 41599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02450 >Feature sequence18 1160 168 gene locus_tag LOCUS_02460 1160 168 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419778.1 protein_id gnl|my_center|LOCUS_02460 1291 2301 gene locus_tag LOCUS_02470 1291 2301 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419780.1 protein_id gnl|my_center|LOCUS_02470 2455 3150 gene locus_tag LOCUS_02480 2455 3150 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050039320.1 protein_id gnl|my_center|LOCUS_02480 4711 3185 gene locus_tag LOCUS_02490 gene glpK 4711 3185 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899643.1 protein_id gnl|my_center|LOCUS_02490 5187 4687 gene locus_tag LOCUS_02500 5187 4687 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899644.1 protein_id gnl|my_center|LOCUS_02500 5408 5184 gene locus_tag LOCUS_02510 5408 5184 CDS product antitoxin VapB48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419787.1 protein_id gnl|my_center|LOCUS_02510 5491 6963 gene locus_tag LOCUS_02520 5491 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899645.1 protein_id gnl|my_center|LOCUS_02520 6974 7663 gene locus_tag LOCUS_02530 6974 7663 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419793.1 protein_id gnl|my_center|LOCUS_02530 8805 7669 gene locus_tag LOCUS_02540 gene egtE 8805 7669 CDS product ergothioneine biosynthesis PLP-dependent enzyme EgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901701.1 protein_id gnl|my_center|LOCUS_02540 9767 8802 gene locus_tag LOCUS_02550 gene egtD 9767 8802 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419799.1 protein_id gnl|my_center|LOCUS_02550 10463 9780 gene locus_tag LOCUS_02560 gene egtC 10463 9780 CDS product ergothioneine biosynthesis protein EgtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419806.1 protein_id gnl|my_center|LOCUS_02560 11740 10463 gene locus_tag LOCUS_02570 gene egtB 11740 10463 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419808.1 protein_id gnl|my_center|LOCUS_02570 13020 11737 gene locus_tag LOCUS_02580 gene egtA 13020 11737 CDS product ergothioneine biosynthesis glutamate--cysteine ligase EgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419809.1 protein_id gnl|my_center|LOCUS_02580 13802 13161 gene locus_tag LOCUS_02590 13802 13161 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419812.1 protein_id gnl|my_center|LOCUS_02590 15290 13842 gene locus_tag LOCUS_02600 15290 13842 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729105.1 protein_id gnl|my_center|LOCUS_02600 15918 15484 gene locus_tag LOCUS_02610 15918 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 16333 15995 gene locus_tag LOCUS_02620 16333 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 17585 16437 gene locus_tag LOCUS_02630 17585 16437 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419818.1 protein_id gnl|my_center|LOCUS_02630 18627 17593 gene locus_tag LOCUS_02640 gene asd 18627 17593 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419825.1 protein_id gnl|my_center|LOCUS_02640 19893 18628 gene locus_tag LOCUS_02650 19893 18628 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419828.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence19 2618 2328 gene locus_tag LOCUS_02660 2618 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 3590 3231 gene locus_tag LOCUS_02670 3590 3231 CDS product Rv2640c family ArsR-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413665.1 protein_id gnl|my_center|LOCUS_02670 3691 4149 gene locus_tag LOCUS_02680 gene cadI 3691 4149 CDS product cadmium-induced metalloenzyme CadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413675.1 protein_id gnl|my_center|LOCUS_02680 4273 4653 gene locus_tag LOCUS_02690 4273 4653 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899407.1 protein_id gnl|my_center|LOCUS_02690 4650 5750 gene locus_tag LOCUS_02700 4650 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02700 5743 6177 gene locus_tag LOCUS_02710 5743 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02710 6607 6864 gene locus_tag LOCUS_02720 6607 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 6861 7205 gene locus_tag LOCUS_02730 6861 7205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 7348 7276 gene locus_tag LOCUS_t00020 7348 7276 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7520 7593 gene locus_tag LOCUS_t00030 7520 7593 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 7621 7693 gene locus_tag LOCUS_t00040 7621 7693 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7708 7782 gene locus_tag LOCUS_t00050 7708 7782 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7888 8307 gene locus_tag LOCUS_02740 7888 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 8905 9513 gene locus_tag LOCUS_02750 8905 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 11031 10645 gene locus_tag LOCUS_02760 11031 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 11231 11031 gene locus_tag LOCUS_02770 11231 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 13214 11541 gene locus_tag LOCUS_02780 13214 11541 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104548.1 protein_id gnl|my_center|LOCUS_02780 13337 13570 gene locus_tag LOCUS_02790 13337 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 13920 13585 gene locus_tag LOCUS_02800 13920 13585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 14334 14023 gene locus_tag LOCUS_02810 14334 14023 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409065.1 protein_id gnl|my_center|LOCUS_02810 14496 15008 gene locus_tag LOCUS_02820 14496 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950757.1 protein_id gnl|my_center|LOCUS_02820 15055 15513 gene locus_tag LOCUS_02830 15055 15513 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413852.1 protein_id gnl|my_center|LOCUS_02830 16621 15491 gene locus_tag LOCUS_02840 gene zapE 16621 15491 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899426.1 protein_id gnl|my_center|LOCUS_02840 16643 17425 gene locus_tag LOCUS_02850 gene ribD 16643 17425 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413854.1 protein_id gnl|my_center|LOCUS_02850 17428 19017 gene locus_tag LOCUS_02860 17428 19017 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413857.1 protein_id gnl|my_center|LOCUS_02860 19031 20344 gene locus_tag LOCUS_02870 gene aftC 19031 20344 CDS product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413860.1 protein_id gnl|my_center|LOCUS_02870 20341 20748 gene locus_tag LOCUS_02880 gene msrB 20341 20748 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413865.1 protein_id gnl|my_center|LOCUS_02880 21525 20830 gene locus_tag LOCUS_02890 21525 20830 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413869.1 protein_id gnl|my_center|LOCUS_02890 22892 21531 gene locus_tag LOCUS_02900 22892 21531 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413871.1 protein_id gnl|my_center|LOCUS_02900 23962 22889 gene locus_tag LOCUS_02910 gene hemE 23962 22889 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413873.1 protein_id gnl|my_center|LOCUS_02910 24067 24873 gene locus_tag LOCUS_02920 24067 24873 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413876.1 protein_id gnl|my_center|LOCUS_02920 24983 25678 gene locus_tag LOCUS_02930 24983 25678 CDS product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413879.1 protein_id gnl|my_center|LOCUS_02930 25770 26951 gene locus_tag LOCUS_02940 25770 26951 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413889.1 protein_id gnl|my_center|LOCUS_02940 28879 26948 gene locus_tag LOCUS_02950 gene dxs 28879 26948 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413891.1 protein_id gnl|my_center|LOCUS_02950 28963 29508 gene locus_tag LOCUS_02960 28963 29508 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899429.1 protein_id gnl|my_center|LOCUS_02960 29513 30799 gene locus_tag LOCUS_02970 29513 30799 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413894.1 protein_id gnl|my_center|LOCUS_02970 31577 30810 gene locus_tag LOCUS_02980 31577 30810 CDS product fluoroquinolones efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413897.1 protein_id gnl|my_center|LOCUS_02980 31933 31577 gene locus_tag LOCUS_02990 31933 31577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 33325 32132 gene locus_tag LOCUS_03000 33325 32132 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900550.1 protein_id gnl|my_center|LOCUS_03000 35319 33322 gene locus_tag LOCUS_03010 35319 33322 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413917.1 protein_id gnl|my_center|LOCUS_03010 35454 36137 gene locus_tag LOCUS_03020 35454 36137 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413919.1 protein_id gnl|my_center|LOCUS_03020 36200 36859 gene locus_tag LOCUS_03030 36200 36859 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413921.1 protein_id gnl|my_center|LOCUS_03030 37547 36753 gene locus_tag LOCUS_03040 37547 36753 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413925.1 protein_id gnl|my_center|LOCUS_03040 37912 37544 gene locus_tag LOCUS_03050 37912 37544 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901453.1 protein_id gnl|my_center|LOCUS_03050 38072 38776 gene locus_tag LOCUS_03060 38072 38776 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413927.1 protein_id gnl|my_center|LOCUS_03060 39590 38850 gene locus_tag LOCUS_03070 39590 38850 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413928.1 protein_id gnl|my_center|LOCUS_03070 40094 39642 gene locus_tag LOCUS_03080 gene dut 40094 39642 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413930.1 protein_id gnl|my_center|LOCUS_03080 40132 40608 gene locus_tag LOCUS_03090 40132 40608 CDS product DUF3093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413931.1 protein_id gnl|my_center|LOCUS_03090 40978 40676 gene locus_tag LOCUS_03100 40978 40676 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899437.1 protein_id gnl|my_center|LOCUS_03100 41213 41863 gene locus_tag LOCUS_03110 gene cei 41213 41863 CDS product envelope integrity protein Cei inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413937.1 protein_id gnl|my_center|LOCUS_03110 42742 41867 gene locus_tag LOCUS_03120 gene suhB 42742 41867 CDS product inositol-1-monophosphatase SuhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413939.1 protein_id gnl|my_center|LOCUS_03120 42892 43695 gene locus_tag LOCUS_03130 42892 43695 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413941.1 protein_id gnl|my_center|LOCUS_03130 43872 45422 gene locus_tag LOCUS_03140 43872 45422 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413944.1 protein_id gnl|my_center|LOCUS_03140 45951 45328 gene locus_tag LOCUS_03150 45951 45328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 46361 45963 gene locus_tag LOCUS_03160 46361 45963 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413947.1 protein_id gnl|my_center|LOCUS_03160 46489 46674 gene locus_tag LOCUS_03170 46489 46674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894140.1 protein_id gnl|my_center|LOCUS_03170 46740 47717 gene locus_tag LOCUS_03180 46740 47717 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413953.1 protein_id gnl|my_center|LOCUS_03180 47966 47718 gene locus_tag LOCUS_03190 47966 47718 CDS product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899441.1 protein_id gnl|my_center|LOCUS_03190 48003 48455 gene locus_tag LOCUS_03200 48003 48455 CDS product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899442.1 protein_id gnl|my_center|LOCUS_03200 48604 49575 gene locus_tag LOCUS_03210 gene sigB 48604 49575 CDS product sigma-70 family RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413958.1 protein_id gnl|my_center|LOCUS_03210 49723 50415 gene locus_tag LOCUS_03220 gene ideR 49723 50415 CDS product iron-dependent transcriptional regulator IdeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413962.1 protein_id gnl|my_center|LOCUS_03220 51500 50442 gene locus_tag LOCUS_03230 51500 50442 CDS product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413965.1 protein_id gnl|my_center|LOCUS_03230 51584 53020 gene locus_tag LOCUS_03240 gene sthA 51584 53020 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900556.1 protein_id gnl|my_center|LOCUS_03240 53219 54196 gene locus_tag LOCUS_03250 53219 54196 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413968.1 protein_id gnl|my_center|LOCUS_03250 54241 55266 gene locus_tag LOCUS_03260 54241 55266 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900558.1 protein_id gnl|my_center|LOCUS_03260 55315 56013 gene locus_tag LOCUS_03270 55315 56013 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413971.1 protein_id gnl|my_center|LOCUS_03270 56511 56026 gene locus_tag LOCUS_03280 56511 56026 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908069.1 protein_id gnl|my_center|LOCUS_03280 56988 56524 gene locus_tag LOCUS_03290 gene nrdR 56988 56524 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413973.1 protein_id gnl|my_center|LOCUS_03290 57634 57152 gene locus_tag LOCUS_03300 57634 57152 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908067.1 protein_id gnl|my_center|LOCUS_03300 57681 58556 gene locus_tag LOCUS_03310 gene lexA 57681 58556 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899448.1 protein_id gnl|my_center|LOCUS_03310 60776 58575 gene locus_tag LOCUS_03320 60776 58575 CDS product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900560.1 protein_id gnl|my_center|LOCUS_03320 61114 62307 gene locus_tag LOCUS_03330 61114 62307 CDS product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413979.1 protein_id gnl|my_center|LOCUS_03330 63464 62304 gene locus_tag LOCUS_03340 63464 62304 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413981.1 protein_id gnl|my_center|LOCUS_03340 65018 63573 gene locus_tag LOCUS_03350 gene hflX 65018 63573 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413984.1 protein_id gnl|my_center|LOCUS_03350 65565 65659 gene locus_tag LOCUS_t00060 65565 65659 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66948 66022 gene locus_tag LOCUS_03360 gene miaA 66948 66022 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413989.1 protein_id gnl|my_center|LOCUS_03360 67640 66945 gene locus_tag LOCUS_03370 67640 66945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899452.1 protein_id gnl|my_center|LOCUS_03370 68671 67682 gene locus_tag LOCUS_03380 68671 67682 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728549.1 protein_id gnl|my_center|LOCUS_03380 69892 68987 gene locus_tag LOCUS_03390 69892 68987 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911951.1 protein_id gnl|my_center|LOCUS_03390 70361 71587 gene locus_tag LOCUS_03400 70361 71587 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413997.1 protein_id gnl|my_center|LOCUS_03400 72189 71584 gene locus_tag LOCUS_03410 72189 71584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413999.1 protein_id gnl|my_center|LOCUS_03410 73940 72204 gene locus_tag LOCUS_03420 gene miaB 73940 72204 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414001.1 protein_id gnl|my_center|LOCUS_03420 74152 75006 gene locus_tag LOCUS_03430 74152 75006 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_03430 75883 74891 gene locus_tag LOCUS_03440 75883 74891 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899456.1 protein_id gnl|my_center|LOCUS_03440 76417 75893 gene locus_tag LOCUS_03450 gene recX 76417 75893 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900562.1 protein_id gnl|my_center|LOCUS_03450 78539 76383 gene locus_tag LOCUS_03460 gene recA 78539 76383 CDS product intein-containing recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908056.1 protein_id gnl|my_center|LOCUS_03460 79005 78697 gene locus_tag LOCUS_03470 79005 78697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 79144 78938 gene locus_tag LOCUS_03480 79144 78938 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414010.1 protein_id gnl|my_center|LOCUS_03480 80321 79155 gene locus_tag LOCUS_03490 80321 79155 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901461.1 protein_id gnl|my_center|LOCUS_03490 80364 80816 gene locus_tag LOCUS_03500 gene ephG 80364 80816 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414015.1 protein_id gnl|my_center|LOCUS_03500 80813 81208 gene locus_tag LOCUS_03510 80813 81208 CDS product DUF5313 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728533.1 protein_id gnl|my_center|LOCUS_03510 82011 81205 gene locus_tag LOCUS_03520 82011 81205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414026.1 protein_id gnl|my_center|LOCUS_03520 82840 82022 gene locus_tag LOCUS_03530 gene pspA 82840 82022 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414030.1 protein_id gnl|my_center|LOCUS_03530 83301 82984 gene locus_tag LOCUS_03540 gene clgR 83301 82984 CDS product transcriptional regulator ClgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414032.1 protein_id gnl|my_center|LOCUS_03540 83990 83409 gene locus_tag LOCUS_03550 gene pgsA 83990 83409 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414035.1 protein_id gnl|my_center|LOCUS_03550 84108 84593 gene locus_tag LOCUS_03560 84108 84593 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414037.1 protein_id gnl|my_center|LOCUS_03560 87009 84661 gene locus_tag LOCUS_03570 87009 84661 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414040.1 protein_id gnl|my_center|LOCUS_03570 87337 87648 gene locus_tag LOCUS_03580 87337 87648 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414042.1 protein_id gnl|my_center|LOCUS_03580 87648 88481 gene locus_tag LOCUS_03590 87648 88481 CDS product Rv2750 family mycofactocin-dependent SDR oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414045.1 protein_id gnl|my_center|LOCUS_03590 88485 89357 gene locus_tag LOCUS_03600 88485 89357 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899463.1 protein_id gnl|my_center|LOCUS_03600 91043 89367 gene locus_tag LOCUS_03610 gene rnj 91043 89367 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414049.1 protein_id gnl|my_center|LOCUS_03610 91962 91060 gene locus_tag LOCUS_03620 gene dapA 91962 91060 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900564.1 protein_id gnl|my_center|LOCUS_03620 92830 92078 gene locus_tag LOCUS_03630 gene thyX 92830 92078 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899465.1 protein_id gnl|my_center|LOCUS_03630 93119 92841 gene locus_tag LOCUS_03640 93119 92841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03640 93296 93538 gene locus_tag LOCUS_03650 93296 93538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 93535 93972 gene locus_tag LOCUS_03660 93535 93972 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_03660 95754 94066 gene locus_tag LOCUS_03670 95754 94066 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 protein_id gnl|my_center|LOCUS_03670 96347 96012 gene locus_tag LOCUS_03680 gene vapC21 96347 96012 CDS product type II toxin-antitoxin system toxin ribonuclease C21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414059.1 protein_id gnl|my_center|LOCUS_03680 96640 96425 gene locus_tag LOCUS_03690 96640 96425 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414061.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03690 97110 96715 gene locus_tag LOCUS_03700 97110 96715 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414064.1 protein_id gnl|my_center|LOCUS_03700 97259 97107 gene locus_tag LOCUS_03710 97259 97107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03710 98375 97368 gene locus_tag LOCUS_03720 98375 97368 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414068.1 protein_id gnl|my_center|LOCUS_03720 98599 98450 gene locus_tag LOCUS_03730 98599 98450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 99275 98790 gene locus_tag LOCUS_03740 gene dfrA 99275 98790 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414073.1 protein_id gnl|my_center|LOCUS_03740 100137 99337 gene locus_tag LOCUS_03750 100137 99337 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414075.1 protein_id gnl|my_center|LOCUS_03750 100353 101093 gene locus_tag LOCUS_03760 100353 101093 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414079.1 protein_id gnl|my_center|LOCUS_03760 101100 101285 gene locus_tag LOCUS_03770 101100 101285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 101269 101523 gene locus_tag LOCUS_03780 101269 101523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03780 101577 101747 gene locus_tag LOCUS_03790 101577 101747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 102711 101929 gene locus_tag LOCUS_03800 102711 101929 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414081.1 protein_id gnl|my_center|LOCUS_03800 104145 102967 gene locus_tag LOCUS_03810 104145 102967 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414085.1 protein_id gnl|my_center|LOCUS_03810 104984 104181 gene locus_tag LOCUS_03820 104984 104181 CDS product PE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414086.1 protein_id gnl|my_center|LOCUS_03820 105979 105362 gene locus_tag LOCUS_03830 105979 105362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 106376 106681 gene locus_tag LOCUS_03840 106376 106681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 107147 106695 gene locus_tag LOCUS_03850 107147 106695 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414091.1 protein_id gnl|my_center|LOCUS_03850 107593 107144 gene locus_tag LOCUS_03860 107593 107144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414097.1 protein_id gnl|my_center|LOCUS_03860 108327 107590 gene locus_tag LOCUS_03870 gene dapB 108327 107590 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414099.1 protein_id gnl|my_center|LOCUS_03870 108707 110080 gene locus_tag LOCUS_03880 108707 110080 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 protein_id gnl|my_center|LOCUS_03880 110115 110660 gene locus_tag LOCUS_03890 110115 110660 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414102.1 protein_id gnl|my_center|LOCUS_03890 112262 110799 gene locus_tag LOCUS_03900 112262 110799 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404651.1 protein_id gnl|my_center|LOCUS_03900 112744 112283 gene locus_tag LOCUS_03910 112744 112283 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899475.1 protein_id gnl|my_center|LOCUS_03910 113289 112774 gene locus_tag LOCUS_03920 113289 112774 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899476.1 protein_id gnl|my_center|LOCUS_03920 113337 114473 gene locus_tag LOCUS_03930 gene ald 113337 114473 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899477.1 protein_id gnl|my_center|LOCUS_03930 115510 114476 gene locus_tag LOCUS_03940 115510 114476 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899478.1 protein_id gnl|my_center|LOCUS_03940 116789 115515 gene locus_tag LOCUS_03950 116789 115515 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414119.1 protein_id gnl|my_center|LOCUS_03950 119076 116809 gene locus_tag LOCUS_03960 119076 116809 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907967.1 protein_id gnl|my_center|LOCUS_03960 120010 119486 gene locus_tag LOCUS_03970 120010 119486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899480.1 protein_id gnl|my_center|LOCUS_03970 120291 120022 gene locus_tag LOCUS_03980 gene rpsO 120291 120022 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414128.1 protein_id gnl|my_center|LOCUS_03980 121336 120413 gene locus_tag LOCUS_03990 121336 120413 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414131.1 protein_id gnl|my_center|LOCUS_03990 121805 121467 gene locus_tag LOCUS_04000 121805 121467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 122133 121984 gene locus_tag LOCUS_04010 122133 121984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04010 123360 122158 gene locus_tag LOCUS_04020 123360 122158 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414142.1 protein_id gnl|my_center|LOCUS_04020 124598 123705 gene locus_tag LOCUS_04030 gene truB 124598 123705 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414147.1 protein_id gnl|my_center|LOCUS_04030 125266 124595 gene locus_tag LOCUS_04040 gene pptT 125266 124595 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414149.1 protein_id gnl|my_center|LOCUS_04040 126237 125275 gene locus_tag LOCUS_04050 126237 125275 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414151.1 protein_id gnl|my_center|LOCUS_04050 126933 126382 gene locus_tag LOCUS_04060 126933 126382 CDS product LppA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414153.1 protein_id gnl|my_center|LOCUS_04060 128633 126945 gene locus_tag LOCUS_04070 128633 126945 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414155.1 protein_id gnl|my_center|LOCUS_04070 128963 128637 gene locus_tag LOCUS_04080 128963 128637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414157.1 protein_id gnl|my_center|LOCUS_04080 129136 129720 gene locus_tag LOCUS_04090 129136 129720 CDS product DUF3558 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414158.1 protein_id gnl|my_center|LOCUS_04090 129826 131394 gene locus_tag LOCUS_04100 129826 131394 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899485.1 protein_id gnl|my_center|LOCUS_04100 131849 131496 gene locus_tag LOCUS_04110 gene mazF9 131849 131496 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_04110 132054 131836 gene locus_tag LOCUS_04120 132054 131836 CDS product type II toxin-antitoxin system antitoxin MazE9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901465.1 protein_id gnl|my_center|LOCUS_04120 133125 132109 gene locus_tag LOCUS_04130 133125 132109 CDS product DUF2293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414172.1 protein_id gnl|my_center|LOCUS_04130 133566 133297 gene locus_tag LOCUS_04140 133566 133297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 133495 133884 gene locus_tag LOCUS_04150 133495 133884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 133881 134384 gene locus_tag LOCUS_04160 133881 134384 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705365.1 protein_id gnl|my_center|LOCUS_04160 134908 135492 gene locus_tag LOCUS_04170 134908 135492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 135951 138161 gene locus_tag LOCUS_04180 135951 138161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 138158 140293 gene locus_tag LOCUS_04190 138158 140293 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779460.1 protein_id gnl|my_center|LOCUS_04190 140335 140496 gene locus_tag LOCUS_04200 140335 140496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 140493 142550 gene locus_tag LOCUS_04210 140493 142550 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_04210 142547 143020 gene locus_tag LOCUS_04220 142547 143020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 144494 143046 gene locus_tag LOCUS_04230 144494 143046 CDS product DNA phosphorothioation-associated putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109925.1 protein_id gnl|my_center|LOCUS_04230 144883 144491 gene locus_tag LOCUS_04240 gene dndE 144883 144491 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_04240 146856 144886 gene locus_tag LOCUS_04250 gene dndD 146856 144886 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_04250 148388 146853 gene locus_tag LOCUS_04260 gene dndC 148388 146853 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_04260 149539 148385 gene locus_tag LOCUS_04270 gene dndB 149539 148385 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_04270 149633 150850 gene locus_tag LOCUS_04280 gene dndA 149633 150850 CDS product cysteine desulfurase DndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109917.1 protein_id gnl|my_center|LOCUS_04280 151496 153229 gene locus_tag LOCUS_04290 151496 153229 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_04290 153600 153379 gene locus_tag LOCUS_04300 153600 153379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 154040 154267 gene locus_tag LOCUS_04310 154040 154267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 154508 154810 gene locus_tag LOCUS_04320 154508 154810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence20 1069 140 gene locus_tag LOCUS_04330 1069 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1437 1727 gene locus_tag LOCUS_04340 1437 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 2336 2082 gene locus_tag LOCUS_04350 2336 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5613 2734 gene locus_tag LOCUS_04360 5613 2734 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407779.1 protein_id gnl|my_center|LOCUS_04360 6014 5610 gene locus_tag LOCUS_04370 6014 5610 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903500.1 protein_id gnl|my_center|LOCUS_04370 6832 6236 gene locus_tag LOCUS_04380 6832 6236 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407773.1 protein_id gnl|my_center|LOCUS_04380 7097 7522 gene locus_tag LOCUS_04390 7097 7522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7656 8378 gene locus_tag LOCUS_04400 7656 8378 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412957.1 protein_id gnl|my_center|LOCUS_04400 8886 18167 gene locus_tag LOCUS_04410 gene fas 8886 18167 CDS product fatty acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901420.1 protein_id gnl|my_center|LOCUS_04410 18283 18675 gene locus_tag LOCUS_04420 18283 18675 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412952.1 protein_id gnl|my_center|LOCUS_04420 19439 20764 gene locus_tag LOCUS_04430 19439 20764 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_04430 21238 20765 gene locus_tag LOCUS_04440 gene bcp 21238 20765 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412944.1 protein_id gnl|my_center|LOCUS_04440 21352 21579 gene locus_tag LOCUS_04450 21352 21579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 21738 21663 gene locus_tag LOCUS_t00070 21738 21663 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 22023 23180 gene locus_tag LOCUS_04460 gene ldtMt2 22023 23180 CDS product L,D-transpeptidase LdtMt2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412938.1 protein_id gnl|my_center|LOCUS_04460 23287 23724 gene locus_tag LOCUS_04470 23287 23724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 23791 23865 gene locus_tag LOCUS_t00080 23791 23865 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 24238 24474 gene locus_tag LOCUS_04480 24238 24474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence21 <1 1419 gene locus_tag LOCUS_04490 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029104282.1:HNH endonuclease signature motif containing protein 1416 1544 gene locus_tag LOCUS_04500 1416 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1626 2279 gene locus_tag LOCUS_04510 1626 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 2276 5026 gene locus_tag LOCUS_04520 2276 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5023 5844 gene locus_tag LOCUS_04530 5023 5844 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 protein_id gnl|my_center|LOCUS_04530 5841 6143 gene locus_tag LOCUS_04540 5841 6143 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409276.1 protein_id gnl|my_center|LOCUS_04540 6140 6535 gene locus_tag LOCUS_04550 6140 6535 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409273.1 protein_id gnl|my_center|LOCUS_04550 6608 7336 gene locus_tag LOCUS_04560 6608 7336 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_04560 7333 8283 gene locus_tag LOCUS_04570 7333 8283 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411868.1 protein_id gnl|my_center|LOCUS_04570 8315 10261 gene locus_tag LOCUS_04580 gene htpG 8315 10261 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411855.1 protein_id gnl|my_center|LOCUS_04580 11219 10248 gene locus_tag LOCUS_04590 11219 10248 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902161.1 protein_id gnl|my_center|LOCUS_04590 11368 12342 gene locus_tag LOCUS_04600 11368 12342 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416362.1 protein_id gnl|my_center|LOCUS_04600 12339 13454 gene locus_tag LOCUS_04610 12339 13454 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510581.1 protein_id gnl|my_center|LOCUS_04610 13447 14292 gene locus_tag LOCUS_04620 13447 14292 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174519602.1 protein_id gnl|my_center|LOCUS_04620 14293 15051 gene locus_tag LOCUS_04630 14293 15051 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_04630 15048 16340 gene locus_tag LOCUS_04640 15048 16340 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895383.1 protein_id gnl|my_center|LOCUS_04640 16337 16789 gene locus_tag LOCUS_04650 16337 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 17266 16802 gene locus_tag LOCUS_04660 17266 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895392.1 protein_id gnl|my_center|LOCUS_04660 17163 17426 gene locus_tag LOCUS_04670 17163 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 17802 17374 gene locus_tag LOCUS_04680 17802 17374 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896644.1 protein_id gnl|my_center|LOCUS_04680 18057 17818 gene locus_tag LOCUS_04690 18057 17818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 19176 18064 gene locus_tag LOCUS_04700 19176 18064 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040687.1 protein_id gnl|my_center|LOCUS_04700 20150 19176 gene locus_tag LOCUS_04710 20150 19176 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_04710 21112 20147 gene locus_tag LOCUS_04720 gene pdhA 21112 20147 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_04720 22914 21109 gene locus_tag LOCUS_04730 gene acsA 22914 21109 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862095.1 protein_id gnl|my_center|LOCUS_04730 23104 24075 gene locus_tag LOCUS_04740 23104 24075 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877873.1 protein_id gnl|my_center|LOCUS_04740 24102 24464 gene locus_tag LOCUS_04750 24102 24464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 24461 24892 gene locus_tag LOCUS_04760 gene hspX 24461 24892 CDS product alpha-crystallin HspX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410189.1 protein_id gnl|my_center|LOCUS_04760 24918 26954 gene locus_tag LOCUS_04770 24918 26954 CDS product erythromycin esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410178.1 protein_id gnl|my_center|LOCUS_04770 26995 27975 gene locus_tag LOCUS_04780 26995 27975 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899139.1 protein_id gnl|my_center|LOCUS_04780 28044 28826 gene locus_tag LOCUS_04790 28044 28826 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413594.1 protein_id gnl|my_center|LOCUS_04790 28949 30655 gene locus_tag LOCUS_04800 28949 30655 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729418.1 protein_id gnl|my_center|LOCUS_04800 34366 30680 gene locus_tag LOCUS_04810 gene otsB 34366 30680 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410063.1 protein_id gnl|my_center|LOCUS_04810 34520 35395 gene locus_tag LOCUS_04820 34520 35395 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410060.1 protein_id gnl|my_center|LOCUS_04820 35400 36908 gene locus_tag LOCUS_04830 35400 36908 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410057.1 protein_id gnl|my_center|LOCUS_04830 36917 39193 gene locus_tag LOCUS_04840 gene ppsA 36917 39193 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 protein_id gnl|my_center|LOCUS_04840 39777 41252 gene locus_tag LOCUS_04850 gene spmT 39777 41252 CDS product sphingomyelinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901038.1 protein_id gnl|my_center|LOCUS_04850 41661 41212 gene locus_tag LOCUS_04860 41661 41212 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728030.1 protein_id gnl|my_center|LOCUS_04860 42005 41658 gene locus_tag LOCUS_04870 42005 41658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 43334 42108 gene locus_tag LOCUS_04880 43334 42108 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899255.1 protein_id gnl|my_center|LOCUS_04880 44206 43358 gene locus_tag LOCUS_04890 44206 43358 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411722.1 protein_id gnl|my_center|LOCUS_04890 44526 44960 gene locus_tag LOCUS_04900 44526 44960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 45009 45701 gene locus_tag LOCUS_04910 45009 45701 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001204.1 protein_id gnl|my_center|LOCUS_04910 46044 46364 gene locus_tag LOCUS_04920 46044 46364 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408465.1 protein_id gnl|my_center|LOCUS_04920 47748 46369 gene locus_tag LOCUS_04930 47748 46369 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411690.1 protein_id gnl|my_center|LOCUS_04930 48147 47896 gene locus_tag LOCUS_04940 48147 47896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 51291 48229 gene locus_tag LOCUS_04950 51291 48229 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401912.1 protein_id gnl|my_center|LOCUS_04950 51659 51288 gene locus_tag LOCUS_04960 51659 51288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 52056 51898 gene locus_tag LOCUS_04970 52056 51898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 52588 53994 gene locus_tag LOCUS_04980 52588 53994 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411663.1 protein_id gnl|my_center|LOCUS_04980 53994 55133 gene locus_tag LOCUS_04990 53994 55133 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_04990 56455 55151 gene locus_tag LOCUS_05000 gene cyp124 56455 55151 CDS product methyl-branched lipid omega-hydroxylase Cyp124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411654.1 protein_id gnl|my_center|LOCUS_05000 56928 56557 gene locus_tag LOCUS_05010 56928 56557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 57134 57448 gene locus_tag LOCUS_05020 57134 57448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 57541 59445 gene locus_tag LOCUS_05030 57541 59445 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899240.1 protein_id gnl|my_center|LOCUS_05030 60380 59433 gene locus_tag LOCUS_05040 60380 59433 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899238.1 protein_id gnl|my_center|LOCUS_05040 60451 61971 gene locus_tag LOCUS_05050 gene lnt 60451 61971 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901363.1 protein_id gnl|my_center|LOCUS_05050 61964 62662 gene locus_tag LOCUS_05060 61964 62662 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729750.1 protein_id gnl|my_center|LOCUS_05060 63366 62743 gene locus_tag LOCUS_05070 63366 62743 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411632.1 protein_id gnl|my_center|LOCUS_05070 64451 63366 gene locus_tag LOCUS_05080 64451 63366 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899236.1 protein_id gnl|my_center|LOCUS_05080 64548 65708 gene locus_tag LOCUS_05090 64548 65708 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411622.1 protein_id gnl|my_center|LOCUS_05090 65721 66539 gene locus_tag LOCUS_05100 65721 66539 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411619.1 protein_id gnl|my_center|LOCUS_05100 66683 67195 gene locus_tag LOCUS_05110 66683 67195 CDS product DUF3145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908531.1 protein_id gnl|my_center|LOCUS_05110 67720 67202 gene locus_tag LOCUS_05120 67720 67202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411608.1 protein_id gnl|my_center|LOCUS_05120 68690 67776 gene locus_tag LOCUS_05130 68690 67776 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411603.1 protein_id gnl|my_center|LOCUS_05130 70309 68690 gene locus_tag LOCUS_05140 70309 68690 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411596.1 protein_id gnl|my_center|LOCUS_05140 70327 70896 gene locus_tag LOCUS_05150 70327 70896 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411595.1 protein_id gnl|my_center|LOCUS_05150 70896 72434 gene locus_tag LOCUS_05160 70896 72434 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411591.1 protein_id gnl|my_center|LOCUS_05160 73925 72504 gene locus_tag LOCUS_05170 73925 72504 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900487.1 protein_id gnl|my_center|LOCUS_05170 75220 73967 gene locus_tag LOCUS_05180 gene kasB 75220 73967 CDS product 3-oxoacyl-ACP synthase KasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411576.1 protein_id gnl|my_center|LOCUS_05180 76456 75314 gene locus_tag LOCUS_05190 gene kasA 76456 75314 CDS product 3-oxoacyl-ACP synthase KasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411571.1 protein_id gnl|my_center|LOCUS_05190 76908 76561 gene locus_tag LOCUS_05200 gene acpM 76908 76561 CDS product meromycolate extension acyl carrier protein AcpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411565.1 protein_id gnl|my_center|LOCUS_05200 77897 76977 gene locus_tag LOCUS_05210 gene fabD 77897 76977 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411559.1 protein_id gnl|my_center|LOCUS_05210 79373 78057 gene locus_tag LOCUS_05220 79373 78057 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411543.1 protein_id gnl|my_center|LOCUS_05220 82132 79427 gene locus_tag LOCUS_05230 gene aceE 82132 79427 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911788.1 protein_id gnl|my_center|LOCUS_05230 82380 82970 gene locus_tag LOCUS_05240 82380 82970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031652337.1 protein_id gnl|my_center|LOCUS_05240 83052 83474 gene locus_tag LOCUS_05250 83052 83474 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411534.1 protein_id gnl|my_center|LOCUS_05250 83474 83935 gene locus_tag LOCUS_05260 gene ahpE 83474 83935 CDS product peroxiredoxin AhpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411527.1 protein_id gnl|my_center|LOCUS_05260 83988 84061 gene locus_tag LOCUS_t00090 83988 84061 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 84066 84308 gene locus_tag LOCUS_05270 84066 84308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899229.1 protein_id gnl|my_center|LOCUS_05270 85139 84324 gene locus_tag LOCUS_05280 85139 84324 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901356.1 protein_id gnl|my_center|LOCUS_05280 86035 85235 gene locus_tag LOCUS_05290 86035 85235 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411514.1 protein_id gnl|my_center|LOCUS_05290 86532 86035 gene locus_tag LOCUS_05300 gene ptpA 86532 86035 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411510.1 protein_id gnl|my_center|LOCUS_05300 87253 86525 gene locus_tag LOCUS_05310 87253 86525 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411507.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05310 87443 89065 gene locus_tag LOCUS_05320 87443 89065 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400998.1 protein_id gnl|my_center|LOCUS_05320 89096 89341 gene locus_tag LOCUS_05330 89096 89341 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_05330 89338 89730 gene locus_tag LOCUS_05340 89338 89730 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_05340 90037 90228 gene locus_tag LOCUS_05350 90037 90228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 90222 91370 gene locus_tag LOCUS_05360 90222 91370 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411502.1 protein_id gnl|my_center|LOCUS_05360 91367 92104 gene locus_tag LOCUS_05370 91367 92104 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411501.1 protein_id gnl|my_center|LOCUS_05370 92101 93210 gene locus_tag LOCUS_05380 92101 93210 CDS product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899226.1 protein_id gnl|my_center|LOCUS_05380 94061 93351 gene locus_tag LOCUS_05390 94061 93351 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411499.1 protein_id gnl|my_center|LOCUS_05390 96129 94600 gene locus_tag LOCUS_05400 96129 94600 CDS product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911786.1 protein_id gnl|my_center|LOCUS_05400 97254 96409 gene locus_tag LOCUS_05410 gene panB 97254 96409 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411489.1 protein_id gnl|my_center|LOCUS_05410 97387 98778 gene locus_tag LOCUS_05420 97387 98778 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729712.1 protein_id gnl|my_center|LOCUS_05420 99844 98786 gene locus_tag LOCUS_05430 99844 98786 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225527.1 protein_id gnl|my_center|LOCUS_05430 99973 100608 gene locus_tag LOCUS_05440 99973 100608 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111103.1 protein_id gnl|my_center|LOCUS_05440 100646 102202 gene locus_tag LOCUS_05450 gene caeA 100646 102202 CDS product carboxylesterase CaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411486.1 protein_id gnl|my_center|LOCUS_05450 102442 104133 gene locus_tag LOCUS_05460 gene ctaD 102442 104133 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 protein_id gnl|my_center|LOCUS_05460 104223 105755 gene locus_tag LOCUS_05470 gene caeB 104223 105755 CDS product carboxylesterase CaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411484.1 protein_id gnl|my_center|LOCUS_05470 105894 107234 gene locus_tag LOCUS_05480 105894 107234 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411482.1 protein_id gnl|my_center|LOCUS_05480 107270 110254 gene locus_tag LOCUS_05490 107270 110254 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411478.1 protein_id gnl|my_center|LOCUS_05490 110319 111176 gene locus_tag LOCUS_05500 110319 111176 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_05500 112685 111249 gene locus_tag LOCUS_05510 gene glnA 112685 111249 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411475.1 protein_id gnl|my_center|LOCUS_05510 112913 113335 gene locus_tag LOCUS_05520 112913 113335 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411466.1 protein_id gnl|my_center|LOCUS_05520 114106 113348 gene locus_tag LOCUS_05530 114106 113348 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411463.1 protein_id gnl|my_center|LOCUS_05530 115063 114128 gene locus_tag LOCUS_05540 gene lipA 115063 114128 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411460.1 protein_id gnl|my_center|LOCUS_05540 115812 115060 gene locus_tag LOCUS_05550 gene lipB 115812 115060 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411458.1 protein_id gnl|my_center|LOCUS_05550 116805 115894 gene locus_tag LOCUS_05560 116805 115894 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411454.1 protein_id gnl|my_center|LOCUS_05560 118540 116810 gene locus_tag LOCUS_05570 gene sucB 118540 116810 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411450.1 protein_id gnl|my_center|LOCUS_05570 118695 120476 gene locus_tag LOCUS_05580 118695 120476 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411445.1 protein_id gnl|my_center|LOCUS_05580 122027 120480 gene locus_tag LOCUS_05590 122027 120480 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899220.1 protein_id gnl|my_center|LOCUS_05590 123139 122039 gene locus_tag LOCUS_05600 123139 122039 CDS product adenylyl cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411442.1 protein_id gnl|my_center|LOCUS_05600 123184 124287 gene locus_tag LOCUS_05610 gene gcvT 123184 124287 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899219.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence22 <1 2187 gene locus_tag LOCUS_05620 <1 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950590.1:PPE family protein 2706 2263 gene locus_tag LOCUS_05630 2706 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 2782 4080 gene locus_tag LOCUS_05640 2782 4080 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898649.1 protein_id gnl|my_center|LOCUS_05640 4280 5650 gene locus_tag LOCUS_05650 4280 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5694 5933 gene locus_tag LOCUS_05660 5694 5933 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190259411.1 protein_id gnl|my_center|LOCUS_05660 5936 6346 gene locus_tag LOCUS_05670 5936 6346 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_05670 6713 6363 gene locus_tag LOCUS_05680 6713 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6842 7414 gene locus_tag LOCUS_05690 6842 7414 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230158.1 protein_id gnl|my_center|LOCUS_05690 7631 7704 gene locus_tag LOCUS_t00100 7631 7704 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7800 8036 gene locus_tag LOCUS_05700 7800 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8965 8669 gene locus_tag LOCUS_05710 8965 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9444 9106 gene locus_tag LOCUS_05720 9444 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9715 9897 gene locus_tag LOCUS_05730 9715 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 10603 10902 gene locus_tag LOCUS_05740 10603 10902 CDS product type VII secretion system ESX-5 target PE19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408807.1 protein_id gnl|my_center|LOCUS_05740 10916 12178 gene locus_tag LOCUS_05750 10916 12178 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404747.1 protein_id gnl|my_center|LOCUS_05750 12213 13439 gene locus_tag LOCUS_05760 12213 13439 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404744.1 protein_id gnl|my_center|LOCUS_05760 13441 14949 gene locus_tag LOCUS_05770 13441 14949 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404742.1 protein_id gnl|my_center|LOCUS_05770 15054 15434 gene locus_tag LOCUS_05780 15054 15434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 15874 15440 gene locus_tag LOCUS_05790 15874 15440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404738.1 protein_id gnl|my_center|LOCUS_05790 16755 15979 gene locus_tag LOCUS_05800 16755 15979 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404735.1 protein_id gnl|my_center|LOCUS_05800 17268 16822 gene locus_tag LOCUS_05810 17268 16822 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404726.1 protein_id gnl|my_center|LOCUS_05810 17440 17273 gene locus_tag LOCUS_05820 17440 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 19961 17583 gene locus_tag LOCUS_05830 19961 17583 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898639.1 protein_id gnl|my_center|LOCUS_05830 21544 19961 gene locus_tag LOCUS_05840 21544 19961 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287949.1 protein_id gnl|my_center|LOCUS_05840 22741 21620 gene locus_tag LOCUS_05850 22741 21620 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404705.1 protein_id gnl|my_center|LOCUS_05850 23479 22748 gene locus_tag LOCUS_05860 23479 22748 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404702.1 protein_id gnl|my_center|LOCUS_05860 23507 24988 gene locus_tag LOCUS_05870 23507 24988 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404691.1 protein_id gnl|my_center|LOCUS_05870 26003 25389 gene locus_tag LOCUS_05880 26003 25389 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047314267.1 protein_id gnl|my_center|LOCUS_05880 26095 27765 gene locus_tag LOCUS_05890 26095 27765 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031577.1 protein_id gnl|my_center|LOCUS_05890 29918 27792 gene locus_tag LOCUS_05900 29918 27792 CDS product glycogen debranching N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730677.1 protein_id gnl|my_center|LOCUS_05900 31099 29915 gene locus_tag LOCUS_05910 31099 29915 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730678.1 protein_id gnl|my_center|LOCUS_05910 31232 32494 gene locus_tag LOCUS_05920 31232 32494 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096774.1 protein_id gnl|my_center|LOCUS_05920 32559 33269 gene locus_tag LOCUS_05930 gene prrA 32559 33269 CDS product two-component system response regulator PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935658.1 protein_id gnl|my_center|LOCUS_05930 33281 34621 gene locus_tag LOCUS_05940 gene prrB 33281 34621 CDS product two-component system sensor histidine kinase PrrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404689.1 protein_id gnl|my_center|LOCUS_05940 35210 34644 gene locus_tag LOCUS_05950 35210 34644 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404688.1 protein_id gnl|my_center|LOCUS_05950 35350 35210 gene locus_tag LOCUS_05960 35350 35210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 36383 35364 gene locus_tag LOCUS_05970 gene arfA 36383 35364 CDS product peptidoglycan-binding protein ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404684.1 protein_id gnl|my_center|LOCUS_05970 36500 36676 gene locus_tag LOCUS_05980 36500 36676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 36679 38271 gene locus_tag LOCUS_05990 36679 38271 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900230.1 protein_id gnl|my_center|LOCUS_05990 39623 38328 gene locus_tag LOCUS_06000 39623 38328 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908725.1 protein_id gnl|my_center|LOCUS_06000 40261 50280 gene locus_tag LOCUS_06010 40261 50280 CDS product PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122524938.1 protein_id gnl|my_center|LOCUS_06010 50918 52139 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggcggcgccggcggcgccggcggc 56172 55513 gene locus_tag LOCUS_06020 gene pdxH 56172 55513 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045843615.1 protein_id gnl|my_center|LOCUS_06020 56244 57398 gene locus_tag LOCUS_06030 56244 57398 CDS product citrate synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898633.1 protein_id gnl|my_center|LOCUS_06030 57597 58055 gene locus_tag LOCUS_06040 57597 58055 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404633.1 protein_id gnl|my_center|LOCUS_06040 59722 58052 gene locus_tag LOCUS_06050 59722 58052 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404631.1 protein_id gnl|my_center|LOCUS_06050 60782 59799 gene locus_tag LOCUS_06060 60782 59799 CDS product diiron oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404627.1 protein_id gnl|my_center|LOCUS_06060 61000 62130 gene locus_tag LOCUS_06070 gene serC 61000 62130 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404623.1 protein_id gnl|my_center|LOCUS_06070 62250 63014 gene locus_tag LOCUS_06080 gene sepH 62250 63014 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404617.1 protein_id gnl|my_center|LOCUS_06080 63366 63085 gene locus_tag LOCUS_06090 63366 63085 CDS product DUF2537 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404614.1 protein_id gnl|my_center|LOCUS_06090 64211 63363 gene locus_tag LOCUS_06100 64211 63363 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404610.1 protein_id gnl|my_center|LOCUS_06100 64639 64208 gene locus_tag LOCUS_06110 64639 64208 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404606.1 protein_id gnl|my_center|LOCUS_06110 64778 65119 gene locus_tag LOCUS_06120 64778 65119 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404603.1 protein_id gnl|my_center|LOCUS_06120 65088 65543 gene locus_tag LOCUS_06130 65088 65543 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897102.1 protein_id gnl|my_center|LOCUS_06130 66349 65540 gene locus_tag LOCUS_06140 66349 65540 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404596.1 protein_id gnl|my_center|LOCUS_06140 66545 68140 gene locus_tag LOCUS_06150 66545 68140 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900225.1 protein_id gnl|my_center|LOCUS_06150 68137 68619 gene locus_tag LOCUS_06160 68137 68619 CDS product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404591.1 protein_id gnl|my_center|LOCUS_06160 68708 71281 gene locus_tag LOCUS_06170 68708 71281 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900188.1 protein_id gnl|my_center|LOCUS_06170 71842 71387 gene locus_tag LOCUS_06180 71842 71387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06180 74069 72117 gene locus_tag LOCUS_06190 74069 72117 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898626.1 protein_id gnl|my_center|LOCUS_06190 74433 76283 gene locus_tag LOCUS_06200 74433 76283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06200 76898 76491 gene locus_tag LOCUS_06210 76898 76491 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908736.1 protein_id gnl|my_center|LOCUS_06210 77061 77450 gene locus_tag LOCUS_06220 77061 77450 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404566.1 protein_id gnl|my_center|LOCUS_06220 77447 78529 gene locus_tag LOCUS_06230 gene moaA 77447 78529 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404564.1 protein_id gnl|my_center|LOCUS_06230 78522 78812 gene locus_tag LOCUS_06240 gene moaD2 78522 78812 CDS product molybdopterin synthase subunit MoaD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404559.1 protein_id gnl|my_center|LOCUS_06240 79253 80320 gene locus_tag LOCUS_06250 79253 80320 CDS product transglycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950462.1 protein_id gnl|my_center|LOCUS_06250 81132 80707 gene locus_tag LOCUS_06260 gene moaE2 81132 80707 CDS product molybdopterin synthase subunit MoaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404552.1 protein_id gnl|my_center|LOCUS_06260 81614 81129 gene locus_tag LOCUS_06270 81614 81129 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404549.1 protein_id gnl|my_center|LOCUS_06270 82111 81611 gene locus_tag LOCUS_06280 gene moaC 82111 81611 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404544.1 protein_id gnl|my_center|LOCUS_06280 82330 82121 gene locus_tag LOCUS_06290 82330 82121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911329.1 protein_id gnl|my_center|LOCUS_06290 82393 84666 gene locus_tag LOCUS_06300 82393 84666 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404512.1 protein_id gnl|my_center|LOCUS_06300 84775 86424 gene locus_tag LOCUS_06310 84775 86424 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404428.1 protein_id gnl|my_center|LOCUS_06310 86740 88389 gene locus_tag LOCUS_06320 86740 88389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06320 88871 88545 gene locus_tag LOCUS_06330 88871 88545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 89510 89172 gene locus_tag LOCUS_06340 89510 89172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 90569 89616 gene locus_tag LOCUS_06350 90569 89616 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897127.1 protein_id gnl|my_center|LOCUS_06350 91263 94571 gene locus_tag LOCUS_06360 91263 94571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 94585 97962 gene locus_tag LOCUS_06370 94585 97962 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900743.1 protein_id gnl|my_center|LOCUS_06370 99735 98110 gene locus_tag LOCUS_06380 99735 98110 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419334.1 protein_id gnl|my_center|LOCUS_06380 101667 100261 gene locus_tag LOCUS_06390 101667 100261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 103343 102006 gene locus_tag LOCUS_06400 103343 102006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 103888 105993 gene locus_tag LOCUS_06410 103888 105993 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886120.1 protein_id gnl|my_center|LOCUS_06410 106452 106168 gene locus_tag LOCUS_06420 gene esxN 106452 106168 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015293199.1 protein_id gnl|my_center|LOCUS_06420 106633 106466 gene locus_tag LOCUS_06430 106633 106466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 106972 106721 gene locus_tag LOCUS_06440 gene esxW 106972 106721 CDS product type VII secretion system protein EsxW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899603.1 protein_id gnl|my_center|LOCUS_06440 107256 107672 gene locus_tag LOCUS_06450 107256 107672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 107874 108263 gene locus_tag LOCUS_06460 107874 108263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 108878 112909 gene locus_tag LOCUS_06470 108878 112909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 113252 113037 gene locus_tag LOCUS_06480 113252 113037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 115137 113530 gene locus_tag LOCUS_06490 115137 113530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06490 115500 115781 gene locus_tag LOCUS_06500 115500 115781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 116946 115951 gene locus_tag LOCUS_06510 116946 115951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 118835 116928 gene locus_tag LOCUS_06520 118835 116928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 118872 119039 gene locus_tag LOCUS_06530 118872 119039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 120266 119352 gene locus_tag LOCUS_06540 120266 119352 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722212.1 protein_id gnl|my_center|LOCUS_06540 120837 121055 gene locus_tag LOCUS_06550 120837 121055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 121052 122749 gene locus_tag LOCUS_06560 121052 122749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 124778 122634 gene locus_tag LOCUS_06570 gene fadB 124778 122634 CDS product fatty oxidation protein FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404426.1 protein_id gnl|my_center|LOCUS_06570 125994 124783 gene locus_tag LOCUS_06580 125994 124783 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404423.1 protein_id gnl|my_center|LOCUS_06580 126223 127422 gene locus_tag LOCUS_06590 126223 127422 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404420.1 protein_id gnl|my_center|LOCUS_06590 127864 127415 gene locus_tag LOCUS_06600 127864 127415 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404418.1 protein_id gnl|my_center|LOCUS_06600 128373 127918 gene locus_tag LOCUS_06610 128373 127918 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903201.1 protein_id gnl|my_center|LOCUS_06610 129564 128431 gene locus_tag LOCUS_06620 gene far 129564 128431 CDS product fatty-acid-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404414.1 protein_id gnl|my_center|LOCUS_06620 130022 129570 gene locus_tag LOCUS_06630 130022 129570 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404412.1 protein_id gnl|my_center|LOCUS_06630 130049 131746 gene locus_tag LOCUS_06640 gene pdc 130049 131746 CDS product alpha-keto-acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900222.1 protein_id gnl|my_center|LOCUS_06640 132513 131863 gene locus_tag LOCUS_06650 132513 131863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003913008.1 protein_id gnl|my_center|LOCUS_06650 135874 132659 gene locus_tag LOCUS_06660 135874 132659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900661.1 protein_id gnl|my_center|LOCUS_06660 136620 136198 gene locus_tag LOCUS_06670 136620 136198 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085647.1 protein_id gnl|my_center|LOCUS_06670 138051 136753 gene locus_tag LOCUS_06680 138051 136753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 139100 138078 gene locus_tag LOCUS_06690 139100 138078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 139315 140835 gene locus_tag LOCUS_06700 139315 140835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 140961 141983 gene locus_tag LOCUS_06710 140961 141983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 142243 142503 gene locus_tag LOCUS_06720 142243 142503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 142723 143199 gene locus_tag LOCUS_06730 142723 143199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06730 143218 144060 gene locus_tag LOCUS_06740 143218 144060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06740 144123 147056 gene locus_tag LOCUS_06750 gene mmpL8 144123 147056 CDS product sulfolipid-1 RND transporter MmpL8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908351.1 protein_id gnl|my_center|LOCUS_06750 148494 147346 gene locus_tag LOCUS_06760 148494 147346 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730122.1 protein_id gnl|my_center|LOCUS_06760 148811 149644 gene locus_tag LOCUS_06770 148811 149644 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898616.1 protein_id gnl|my_center|LOCUS_06770 150006 151643 gene locus_tag LOCUS_06780 gene mmcO 150006 151643 CDS product multicopper oxidase MmcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404392.1 protein_id gnl|my_center|LOCUS_06780 152893 151673 gene locus_tag LOCUS_06790 152893 151673 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898611.1 protein_id gnl|my_center|LOCUS_06790 153141 153791 gene locus_tag LOCUS_06800 gene narL 153141 153791 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404388.1 protein_id gnl|my_center|LOCUS_06800 155033 153717 gene locus_tag LOCUS_06810 155033 153717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 156344 155061 gene locus_tag LOCUS_06820 156344 155061 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084878.1 protein_id gnl|my_center|LOCUS_06820 157105 156341 gene locus_tag LOCUS_06830 157105 156341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_06830 158154 157102 gene locus_tag LOCUS_06840 158154 157102 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257218.1 protein_id gnl|my_center|LOCUS_06840 159122 158115 gene locus_tag LOCUS_06850 159122 158115 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404384.1 protein_id gnl|my_center|LOCUS_06850 160186 159284 gene locus_tag LOCUS_06860 160186 159284 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404384.1 protein_id gnl|my_center|LOCUS_06860 161481 160183 gene locus_tag LOCUS_06870 161481 160183 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404382.1 protein_id gnl|my_center|LOCUS_06870 163134 161638 gene locus_tag LOCUS_06880 163134 161638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 164513 163131 gene locus_tag LOCUS_06890 164513 163131 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404382.1 protein_id gnl|my_center|LOCUS_06890 165763 164627 gene locus_tag LOCUS_06900 165763 164627 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901258.1 protein_id gnl|my_center|LOCUS_06900 166914 166174 gene locus_tag LOCUS_06910 166914 166174 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898609.1 protein_id gnl|my_center|LOCUS_06910 167630 167025 gene locus_tag LOCUS_06920 167630 167025 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730440.1 protein_id gnl|my_center|LOCUS_06920 167687 169426 gene locus_tag LOCUS_06930 167687 169426 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_06930 170114 169500 gene locus_tag LOCUS_06940 170114 169500 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404362.1 protein_id gnl|my_center|LOCUS_06940 170587 170192 gene locus_tag LOCUS_06950 170587 170192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 170655 171035 gene locus_tag LOCUS_06960 170655 171035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06960 172024 171707 gene locus_tag LOCUS_06970 gene pemK 172024 171707 CDS product type II toxin-antitoxin system toxin endoribonuclease PemK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416110.1 protein_id gnl|my_center|LOCUS_06970 172244 172014 gene locus_tag LOCUS_06980 172244 172014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 172643 173320 gene locus_tag LOCUS_06990 172643 173320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 173533 173829 gene locus_tag LOCUS_07000 173533 173829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 174019 174363 gene locus_tag LOCUS_07010 174019 174363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 174513 174710 gene locus_tag LOCUS_07020 174513 174710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 174819 174744 gene locus_tag LOCUS_t00110 174819 174744 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 174922 174846 gene locus_tag LOCUS_t00120 174922 174846 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 175033 174958 gene locus_tag LOCUS_t00130 175033 174958 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 175154 175228 gene locus_tag LOCUS_t00140 175154 175228 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 175330 176145 gene locus_tag LOCUS_07030 175330 176145 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404352.1 protein_id gnl|my_center|LOCUS_07030 177093 176188 gene locus_tag LOCUS_07040 177093 176188 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404349.1 protein_id gnl|my_center|LOCUS_07040 177253 177597 gene locus_tag LOCUS_07050 gene kmtR 177253 177597 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404335.1 protein_id gnl|my_center|LOCUS_07050 177642 177845 gene locus_tag LOCUS_07060 177642 177845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 178360 178049 gene locus_tag LOCUS_07070 178360 178049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07070 178403 179044 gene locus_tag LOCUS_07080 178403 179044 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404326.1 protein_id gnl|my_center|LOCUS_07080 179191 180207 gene locus_tag LOCUS_07090 179191 180207 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908751.1 protein_id gnl|my_center|LOCUS_07090 180214 181398 gene locus_tag LOCUS_07100 gene dusB 180214 181398 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898601.1 protein_id gnl|my_center|LOCUS_07100 181563 183623 gene locus_tag LOCUS_07110 181563 183623 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404316.1 protein_id gnl|my_center|LOCUS_07110 183680 184351 gene locus_tag LOCUS_07120 gene phoU 183680 184351 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404314.1 protein_id gnl|my_center|LOCUS_07120 185140 184364 gene locus_tag LOCUS_07130 gene pstB 185140 184364 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404312.1 protein_id gnl|my_center|LOCUS_07130 185777 185154 gene locus_tag LOCUS_07140 185777 185154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 186843 185887 gene locus_tag LOCUS_07150 gene mshD 186843 185887 CDS product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404307.1 protein_id gnl|my_center|LOCUS_07150 187604 186840 gene locus_tag LOCUS_07160 187604 186840 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903189.1 protein_id gnl|my_center|LOCUS_07160 187825 188637 gene locus_tag LOCUS_07170 gene lmeA 187825 188637 CDS product mannan chain length control protein LmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404298.1 protein_id gnl|my_center|LOCUS_07170 189051 189884 gene locus_tag LOCUS_07180 189051 189884 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404293.1 protein_id gnl|my_center|LOCUS_07180 189886 190188 gene locus_tag LOCUS_07190 189886 190188 CDS product DUF1416 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404278.1 protein_id gnl|my_center|LOCUS_07190 190223 190342 gene locus_tag LOCUS_07200 190223 190342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 190339 191007 gene locus_tag LOCUS_07210 190339 191007 CDS product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898596.1 protein_id gnl|my_center|LOCUS_07210 191135 193504 gene locus_tag LOCUS_07220 191135 193504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 193742 195247 gene locus_tag LOCUS_07230 193742 195247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 196394 195507 gene locus_tag LOCUS_07240 196394 195507 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404139.1 protein_id gnl|my_center|LOCUS_07240 196590 197693 gene locus_tag LOCUS_07250 196590 197693 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404137.1 protein_id gnl|my_center|LOCUS_07250 197851 198039 gene locus_tag LOCUS_07260 197851 198039 CDS product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404135.1 protein_id gnl|my_center|LOCUS_07260 199233 198088 gene locus_tag LOCUS_07270 gene purM 199233 198088 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404132.1 protein_id gnl|my_center|LOCUS_07270 200856 199273 gene locus_tag LOCUS_07280 gene purF 200856 199273 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404129.1 protein_id gnl|my_center|LOCUS_07280 201338 200949 gene locus_tag LOCUS_07290 201338 200949 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404127.1 protein_id gnl|my_center|LOCUS_07290 201358 202563 gene locus_tag LOCUS_07300 201358 202563 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915845.1 protein_id gnl|my_center|LOCUS_07300 202827 204425 gene locus_tag LOCUS_07310 202827 204425 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898594.1 protein_id gnl|my_center|LOCUS_07310 205326 204370 gene locus_tag LOCUS_07320 gene cpdA 205326 204370 CDS product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404120.1 protein_id gnl|my_center|LOCUS_07320 206029 205313 gene locus_tag LOCUS_07330 206029 205313 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404117.1 protein_id gnl|my_center|LOCUS_07330 208323 206026 gene locus_tag LOCUS_07340 gene purL 208323 206026 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916276.1 protein_id gnl|my_center|LOCUS_07340 208393 209037 gene locus_tag LOCUS_07350 208393 209037 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404111.1 protein_id gnl|my_center|LOCUS_07350 209458 209111 gene locus_tag LOCUS_07360 209458 209111 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898592.1 protein_id gnl|my_center|LOCUS_07360 210741 209470 gene locus_tag LOCUS_07370 210741 209470 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404103.1 protein_id gnl|my_center|LOCUS_07370 210790 211806 gene locus_tag LOCUS_07380 210790 211806 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404098.1 protein_id gnl|my_center|LOCUS_07380 211803 212600 gene locus_tag LOCUS_07390 211803 212600 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404092.1 protein_id gnl|my_center|LOCUS_07390 214510 212630 gene locus_tag LOCUS_07400 214510 212630 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015288299.1 protein_id gnl|my_center|LOCUS_07400 214703 216166 gene locus_tag LOCUS_07410 214703 216166 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404013.1 protein_id gnl|my_center|LOCUS_07410 216335 216775 gene locus_tag LOCUS_07420 216335 216775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403998.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07420 217540 216866 gene locus_tag LOCUS_07430 gene purQ 217540 216866 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403995.1 protein_id gnl|my_center|LOCUS_07430 217776 217537 gene locus_tag LOCUS_07440 gene purS 217776 217537 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403993.1 protein_id gnl|my_center|LOCUS_07440 218716 217988 gene locus_tag LOCUS_07450 218716 217988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886087.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07450 218693 219331 gene locus_tag LOCUS_07460 218693 219331 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403989.1 protein_id gnl|my_center|LOCUS_07460 220114 219410 gene locus_tag LOCUS_07470 220114 219410 CDS product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898589.1 protein_id gnl|my_center|LOCUS_07470 222450 220267 gene locus_tag LOCUS_07480 222450 220267 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898586.1 protein_id gnl|my_center|LOCUS_07480 223343 222447 gene locus_tag LOCUS_07490 223343 222447 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403962.1 protein_id gnl|my_center|LOCUS_07490 224625 223375 gene locus_tag LOCUS_07500 224625 223375 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898584.1 protein_id gnl|my_center|LOCUS_07500 226047 224629 gene locus_tag LOCUS_07510 gene purB 226047 224629 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403952.1 protein_id gnl|my_center|LOCUS_07510 226271 227203 gene locus_tag LOCUS_07520 226271 227203 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403949.1 protein_id gnl|my_center|LOCUS_07520 227712 228623 gene locus_tag LOCUS_07530 227712 228623 CDS product iron-stress inducible esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403938.1 protein_id gnl|my_center|LOCUS_07530 228712 230259 gene locus_tag LOCUS_07540 gene ggtA 228712 230259 CDS product gamma-glutamyltranspeptidase GgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403933.1 protein_id gnl|my_center|LOCUS_07540 230527 232128 gene locus_tag LOCUS_07550 230527 232128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 233434 232166 gene locus_tag LOCUS_07560 gene purD 233434 232166 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898580.1 protein_id gnl|my_center|LOCUS_07560 233877 233446 gene locus_tag LOCUS_07570 233877 233446 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403928.1 protein_id gnl|my_center|LOCUS_07570 234773 233895 gene locus_tag LOCUS_07580 234773 233895 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403924.1 protein_id gnl|my_center|LOCUS_07580 235516 234770 gene locus_tag LOCUS_07590 235516 234770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898579.1 protein_id gnl|my_center|LOCUS_07590 237009 235540 gene locus_tag LOCUS_07600 237009 235540 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403919.1 protein_id gnl|my_center|LOCUS_07600 237219 237797 gene locus_tag LOCUS_07610 237219 237797 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403915.1 protein_id gnl|my_center|LOCUS_07610 237794 239011 gene locus_tag LOCUS_07620 237794 239011 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403911.1 protein_id gnl|my_center|LOCUS_07620 239012 239899 gene locus_tag LOCUS_07630 239012 239899 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898578.1 protein_id gnl|my_center|LOCUS_07630 239896 241257 gene locus_tag LOCUS_07640 gene cyp51 239896 241257 CDS product lanosterol 14-alpha demethylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898577.1 protein_id gnl|my_center|LOCUS_07640 241260 241466 gene locus_tag LOCUS_07650 241260 241466 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403890.1 protein_id gnl|my_center|LOCUS_07650 241468 242025 gene locus_tag LOCUS_07660 241468 242025 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403887.1 protein_id gnl|my_center|LOCUS_07660 242175 243302 gene locus_tag LOCUS_07670 242175 243302 CDS product NDMA-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403885.1 protein_id gnl|my_center|LOCUS_07670 243373 245376 gene locus_tag LOCUS_07680 243373 245376 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135545767.1 protein_id gnl|my_center|LOCUS_07680 245394 245813 gene locus_tag LOCUS_07690 245394 245813 CDS product ketosteroid isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403880.1 protein_id gnl|my_center|LOCUS_07690 245883 246287 gene locus_tag LOCUS_07700 245883 246287 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403876.1 protein_id gnl|my_center|LOCUS_07700 247725 246295 gene locus_tag LOCUS_07710 gene phoR 247725 246295 CDS product sensory box histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916717.1 protein_id gnl|my_center|LOCUS_07710 248474 247752 gene locus_tag LOCUS_07720 gene phoP 248474 247752 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403867.1 protein_id gnl|my_center|LOCUS_07720 248588 249373 gene locus_tag LOCUS_07730 248588 249373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403862.1 protein_id gnl|my_center|LOCUS_07730 249454 249528 gene locus_tag LOCUS_t00150 249454 249528 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 250411 249947 gene locus_tag LOCUS_07740 250411 249947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 251123 250665 gene locus_tag LOCUS_07750 251123 250665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 251467 252027 gene locus_tag LOCUS_07760 251467 252027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence23 <4312 1453 gene locus_tag LOCUS_07770 <4312 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886158.1:phthiocerol type I polyketide synthase PpsA >Feature sequence24 333 151 gene locus_tag LOCUS_07780 333 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 689 273 gene locus_tag LOCUS_07790 689 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 900 2048 gene locus_tag LOCUS_07800 900 2048 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416576.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence25 237 1139 gene locus_tag LOCUS_07810 237 1139 CDS product ESX secretion-associated protein EspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408846.1 protein_id gnl|my_center|LOCUS_07810 1388 2899 gene locus_tag LOCUS_07820 gene eccD5 1388 2899 CDS product type VII secretion system ESX-5 subunit EccD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950604.1 protein_id gnl|my_center|LOCUS_07820 2877 4655 gene locus_tag LOCUS_07830 gene mycP5 2877 4655 CDS product type VII secretion system ESX-5 serine protease mycosin MycP5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408854.1 protein_id gnl|my_center|LOCUS_07830 4652 5872 gene locus_tag LOCUS_07840 gene eccE5 4652 5872 CDS product type VII secretion system ESX-5 subunit EccE5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408859.1 protein_id gnl|my_center|LOCUS_07840 5869 7701 gene locus_tag LOCUS_07850 gene eccA5 5869 7701 CDS product type VII secretion system ESX-5 AAA family ATPase EccA5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408868.1 protein_id gnl|my_center|LOCUS_07850 8391 9692 gene locus_tag LOCUS_07860 8391 9692 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_07860 9756 10982 gene locus_tag LOCUS_07870 9756 10982 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_07870 11330 11082 gene locus_tag LOCUS_07880 11330 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 11752 12042 gene locus_tag LOCUS_07890 11752 12042 CDS product type VII secretion system ESX-5 target PE19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408807.1 protein_id gnl|my_center|LOCUS_07890 12058 13263 gene locus_tag LOCUS_07900 12058 13263 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_07900 14039 15262 gene locus_tag LOCUS_07910 14039 15262 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901258.1 protein_id gnl|my_center|LOCUS_07910 15309 15542 gene locus_tag LOCUS_07920 15309 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 15556 16953 gene locus_tag LOCUS_07930 15556 16953 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911666.1 protein_id gnl|my_center|LOCUS_07930 17075 17392 gene locus_tag LOCUS_07940 17075 17392 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409188.1 protein_id gnl|my_center|LOCUS_07940 17553 18350 gene locus_tag LOCUS_07950 17553 18350 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899032.1 protein_id gnl|my_center|LOCUS_07950 19449 18262 gene locus_tag LOCUS_07960 19449 18262 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409193.1 protein_id gnl|my_center|LOCUS_07960 20141 19740 gene locus_tag LOCUS_07970 20141 19740 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409199.1 protein_id gnl|my_center|LOCUS_07970 20363 21307 gene locus_tag LOCUS_07980 20363 21307 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901259.1 protein_id gnl|my_center|LOCUS_07980 21592 21380 gene locus_tag LOCUS_07990 21592 21380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 21510 22091 gene locus_tag LOCUS_08000 21510 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409204.1 protein_id gnl|my_center|LOCUS_08000 22138 22815 gene locus_tag LOCUS_08010 22138 22815 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409205.1 protein_id gnl|my_center|LOCUS_08010 23154 24617 gene locus_tag LOCUS_08020 23154 24617 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409207.1 protein_id gnl|my_center|LOCUS_08020 26241 24736 gene locus_tag LOCUS_08030 26241 24736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 28295 26376 gene locus_tag LOCUS_08040 gene bacA 28295 26376 CDS product vitamin B12 ABC transporter ATP-binding protein BacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900416.1 protein_id gnl|my_center|LOCUS_08040 28389 30035 gene locus_tag LOCUS_08050 28389 30035 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409218.1 protein_id gnl|my_center|LOCUS_08050 30099 32435 gene locus_tag LOCUS_08060 gene secA2 30099 32435 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409221.1 protein_id gnl|my_center|LOCUS_08060 32518 33156 gene locus_tag LOCUS_08070 32518 33156 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409227.1 protein_id gnl|my_center|LOCUS_08070 33149 34069 gene locus_tag LOCUS_08080 33149 34069 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901262.1 protein_id gnl|my_center|LOCUS_08080 34101 34433 gene locus_tag LOCUS_08090 34101 34433 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899037.1 protein_id gnl|my_center|LOCUS_08090 34510 35358 gene locus_tag LOCUS_08100 34510 35358 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899038.1 protein_id gnl|my_center|LOCUS_08100 35385 35789 gene locus_tag LOCUS_08110 gene gcvH 35385 35789 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409234.1 protein_id gnl|my_center|LOCUS_08110 36029 36517 gene locus_tag LOCUS_08120 gene garA 36029 36517 CDS product glycogen accumulation regulator GarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899041.1 protein_id gnl|my_center|LOCUS_08120 36514 37254 gene locus_tag LOCUS_08130 36514 37254 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409239.1 protein_id gnl|my_center|LOCUS_08130 37372 37866 gene locus_tag LOCUS_08140 37372 37866 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908703.1 protein_id gnl|my_center|LOCUS_08140 38163 38813 gene locus_tag LOCUS_08150 38163 38813 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409244.1 protein_id gnl|my_center|LOCUS_08150 39158 41968 gene locus_tag LOCUS_08160 gene gcvP 39158 41968 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900418.1 protein_id gnl|my_center|LOCUS_08160 42840 41980 gene locus_tag LOCUS_08170 42840 41980 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_08170 42926 43747 gene locus_tag LOCUS_08180 42926 43747 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409255.1 protein_id gnl|my_center|LOCUS_08180 44781 43840 gene locus_tag LOCUS_08190 44781 43840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08190 46973 44874 gene locus_tag LOCUS_08200 46973 44874 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901265.1 protein_id gnl|my_center|LOCUS_08200 49398 47203 gene locus_tag LOCUS_08210 49398 47203 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409271.1 protein_id gnl|my_center|LOCUS_08210 50010 49609 gene locus_tag LOCUS_08220 50010 49609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 51098 50049 gene locus_tag LOCUS_08230 51098 50049 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409281.1 protein_id gnl|my_center|LOCUS_08230 52477 51098 gene locus_tag LOCUS_08240 52477 51098 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899046.1 protein_id gnl|my_center|LOCUS_08240 54091 52655 gene locus_tag LOCUS_08250 54091 52655 CDS product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902189.1 protein_id gnl|my_center|LOCUS_08250 55559 54108 gene locus_tag LOCUS_08260 gene gndA 55559 54108 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911671.1 protein_id gnl|my_center|LOCUS_08260 56614 55673 gene locus_tag LOCUS_08270 56614 55673 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409298.1 protein_id gnl|my_center|LOCUS_08270 57063 56629 gene locus_tag LOCUS_08280 gene blaI 57063 56629 CDS product transcriptional repressor BlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409301.1 protein_id gnl|my_center|LOCUS_08280 57333 57770 gene locus_tag LOCUS_08290 57333 57770 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903650.1 protein_id gnl|my_center|LOCUS_08290 59227 57845 gene locus_tag LOCUS_08300 59227 57845 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409317.1 protein_id gnl|my_center|LOCUS_08300 60081 59404 gene locus_tag LOCUS_08310 60081 59404 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409323.1 protein_id gnl|my_center|LOCUS_08310 60327 61088 gene locus_tag LOCUS_08320 gene modA 60327 61088 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409326.1 protein_id gnl|my_center|LOCUS_08320 61171 61902 gene locus_tag LOCUS_08330 61171 61902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409329.1 protein_id gnl|my_center|LOCUS_08330 61909 63018 gene locus_tag LOCUS_08340 61909 63018 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899051.1 protein_id gnl|my_center|LOCUS_08340 63287 63075 gene locus_tag LOCUS_08350 63287 63075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 63199 64059 gene locus_tag LOCUS_08360 gene apa 63199 64059 CDS product adhesin Apa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409337.1 protein_id gnl|my_center|LOCUS_08360 64166 64465 gene locus_tag LOCUS_08370 64166 64465 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409339.1 protein_id gnl|my_center|LOCUS_08370 64529 65530 gene locus_tag LOCUS_08380 64529 65530 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409345.1 protein_id gnl|my_center|LOCUS_08380 66345 65581 gene locus_tag LOCUS_08390 66345 65581 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899053.1 protein_id gnl|my_center|LOCUS_08390 67113 66433 gene locus_tag LOCUS_08400 67113 66433 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409351.1 protein_id gnl|my_center|LOCUS_08400 67997 67149 gene locus_tag LOCUS_08410 67997 67149 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409355.1 protein_id gnl|my_center|LOCUS_08410 68180 70588 gene locus_tag LOCUS_08420 68180 70588 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900424.1 protein_id gnl|my_center|LOCUS_08420 71139 72596 gene locus_tag LOCUS_08430 71139 72596 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409362.1 protein_id gnl|my_center|LOCUS_08430 72732 74834 gene locus_tag LOCUS_08440 72732 74834 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409374.1 protein_id gnl|my_center|LOCUS_08440 76067 74835 gene locus_tag LOCUS_08450 76067 74835 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899055.1 protein_id gnl|my_center|LOCUS_08450 76858 76133 gene locus_tag LOCUS_08460 76858 76133 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729187.1 protein_id gnl|my_center|LOCUS_08460 77252 76893 gene locus_tag LOCUS_08470 77252 76893 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409380.1 protein_id gnl|my_center|LOCUS_08470 78686 77403 gene locus_tag LOCUS_08480 gene lldD 78686 77403 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409382.1 protein_id gnl|my_center|LOCUS_08480 78681 79115 gene locus_tag LOCUS_08490 78681 79115 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950624.1 protein_id gnl|my_center|LOCUS_08490 79281 80486 gene locus_tag LOCUS_08500 79281 80486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 80431 80979 gene locus_tag LOCUS_08510 80431 80979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 82221 81013 gene locus_tag LOCUS_08520 gene ltrA 82221 81013 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024495.1 protein_id gnl|my_center|LOCUS_08520 83160 83876 gene locus_tag LOCUS_08530 83160 83876 CDS product EthD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904723.1 protein_id gnl|my_center|LOCUS_08530 83873 84316 gene locus_tag LOCUS_08540 83873 84316 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899059.1 protein_id gnl|my_center|LOCUS_08540 84528 84313 gene locus_tag LOCUS_08550 84528 84313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 84837 85316 gene locus_tag LOCUS_08560 gene bfrA 84837 85316 CDS product bacterioferritin BfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409398.1 protein_id gnl|my_center|LOCUS_08560 85740 85943 gene locus_tag LOCUS_08570 85740 85943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08570 85995 86246 gene locus_tag LOCUS_08580 85995 86246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 86256 86786 gene locus_tag LOCUS_08590 86256 86786 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729161.1 protein_id gnl|my_center|LOCUS_08590 86809 88161 gene locus_tag LOCUS_08600 86809 88161 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409401.1 protein_id gnl|my_center|LOCUS_08600 88158 89300 gene locus_tag LOCUS_08610 88158 89300 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899061.1 protein_id gnl|my_center|LOCUS_08610 90832 89297 gene locus_tag LOCUS_08620 90832 89297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 92151 90835 gene locus_tag LOCUS_08630 92151 90835 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409406.1 protein_id gnl|my_center|LOCUS_08630 92637 92227 gene locus_tag LOCUS_08640 92637 92227 CDS product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409409.1 protein_id gnl|my_center|LOCUS_08640 93311 92853 gene locus_tag LOCUS_08650 93311 92853 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409417.1 protein_id gnl|my_center|LOCUS_08650 93782 93366 gene locus_tag LOCUS_08660 93782 93366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08660 94182 93877 gene locus_tag LOCUS_08670 94182 93877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 94288 94812 gene locus_tag LOCUS_08680 94288 94812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410707.1 protein_id gnl|my_center|LOCUS_08680 95810 94854 gene locus_tag LOCUS_08690 gene ag85B 95810 94854 CDS product diacylglycerol acyltransferase/mycolyltransferase Ag85B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409456.1 protein_id gnl|my_center|LOCUS_08690 96338 97480 gene locus_tag LOCUS_08700 96338 97480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899065.1 protein_id gnl|my_center|LOCUS_08700 98046 97498 gene locus_tag LOCUS_08710 98046 97498 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409503.1 protein_id gnl|my_center|LOCUS_08710 98629 99036 gene locus_tag LOCUS_08720 98629 99036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409509.1 protein_id gnl|my_center|LOCUS_08720 99048 99359 gene locus_tag LOCUS_08730 99048 99359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409512.1 protein_id gnl|my_center|LOCUS_08730 99370 99588 gene locus_tag LOCUS_08740 99370 99588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409515.1 protein_id gnl|my_center|LOCUS_08740 100775 99645 gene locus_tag LOCUS_08750 100775 99645 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409518.1 protein_id gnl|my_center|LOCUS_08750 101352 100885 gene locus_tag LOCUS_08760 101352 100885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 101447 103378 gene locus_tag LOCUS_08770 101447 103378 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085964.1 protein_id gnl|my_center|LOCUS_08770 103389 104414 gene locus_tag LOCUS_08780 103389 104414 CDS product alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409522.1 protein_id gnl|my_center|LOCUS_08780 105405 104494 gene locus_tag LOCUS_08790 105405 104494 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409526.1 protein_id gnl|my_center|LOCUS_08790 105853 105422 gene locus_tag LOCUS_08800 gene dtd 105853 105422 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409533.1 protein_id gnl|my_center|LOCUS_08800 105886 106191 gene locus_tag LOCUS_08810 105886 106191 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409536.1 protein_id gnl|my_center|LOCUS_08810 106682 106188 gene locus_tag LOCUS_08820 106682 106188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 107088 106720 gene locus_tag LOCUS_08830 107088 106720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 107423 107085 gene locus_tag LOCUS_08840 107423 107085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 107364 107588 gene locus_tag LOCUS_08850 107364 107588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 107946 107629 gene locus_tag LOCUS_08860 107946 107629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 109382 108000 gene locus_tag LOCUS_08870 109382 108000 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950630.1 protein_id gnl|my_center|LOCUS_08870 109399 110703 gene locus_tag LOCUS_08880 109399 110703 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900426.1 protein_id gnl|my_center|LOCUS_08880 110740 110997 gene locus_tag LOCUS_08890 110740 110997 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414620.1 protein_id gnl|my_center|LOCUS_08890 110984 111421 gene locus_tag LOCUS_08900 110984 111421 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_08900 112713 111451 gene locus_tag LOCUS_08910 112713 111451 CDS product sialate:H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900427.1 protein_id gnl|my_center|LOCUS_08910 112816 113217 gene locus_tag LOCUS_08920 112816 113217 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409542.1 protein_id gnl|my_center|LOCUS_08920 113407 113868 gene locus_tag LOCUS_08930 113407 113868 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409543.1 protein_id gnl|my_center|LOCUS_08930 114865 113903 gene locus_tag LOCUS_08940 114865 113903 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409545.1 protein_id gnl|my_center|LOCUS_08940 115365 114889 gene locus_tag LOCUS_08950 115365 114889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900428.1 protein_id gnl|my_center|LOCUS_08950 118065 115822 gene locus_tag LOCUS_08960 gene katG 118065 115822 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901285.1 protein_id gnl|my_center|LOCUS_08960 118536 118102 gene locus_tag LOCUS_08970 118536 118102 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899076.1 protein_id gnl|my_center|LOCUS_08970 118845 118654 gene locus_tag LOCUS_08980 118845 118654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 119185 118925 gene locus_tag LOCUS_08990 119185 118925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 119394 119762 gene locus_tag LOCUS_09000 119394 119762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 119762 119917 gene locus_tag LOCUS_09010 119762 119917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 120914 119901 gene locus_tag LOCUS_09020 120914 119901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 121080 121262 gene locus_tag LOCUS_09030 121080 121262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 122169 121288 gene locus_tag LOCUS_09040 122169 121288 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896743.1 protein_id gnl|my_center|LOCUS_09040 122880 122275 gene locus_tag LOCUS_09050 122880 122275 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224147.1 protein_id gnl|my_center|LOCUS_09050 122968 124017 gene locus_tag LOCUS_09060 122968 124017 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899114.1 protein_id gnl|my_center|LOCUS_09060 125167 123986 gene locus_tag LOCUS_09070 125167 123986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 126331 125195 gene locus_tag LOCUS_09080 126331 125195 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_09080 126656 126357 gene locus_tag LOCUS_09090 126656 126357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 126547 126777 gene locus_tag LOCUS_09100 126547 126777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 127591 126896 gene locus_tag LOCUS_09110 127591 126896 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411863.1 protein_id gnl|my_center|LOCUS_09110 127818 128360 gene locus_tag LOCUS_09120 127818 128360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09120 128739 128398 gene locus_tag LOCUS_09130 128739 128398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 128769 129008 gene locus_tag LOCUS_09140 128769 129008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 130408 129023 gene locus_tag LOCUS_09150 130408 129023 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899115.1 protein_id gnl|my_center|LOCUS_09150 130628 131431 gene locus_tag LOCUS_09160 130628 131431 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405957.1 protein_id gnl|my_center|LOCUS_09160 132125 131481 gene locus_tag LOCUS_09170 gene cfp21 132125 131481 CDS product cutinase Cfp21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409976.1 protein_id gnl|my_center|LOCUS_09170 132287 133954 gene locus_tag LOCUS_09180 132287 133954 CDS product PecA family PE domain-processing aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899118.1 protein_id gnl|my_center|LOCUS_09180 134067 134315 gene locus_tag LOCUS_09190 134067 134315 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_09190 134319 134714 gene locus_tag LOCUS_09200 134319 134714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 134838 135074 gene locus_tag LOCUS_09210 134838 135074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 135095 135484 gene locus_tag LOCUS_09220 135095 135484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 135785 137224 gene locus_tag LOCUS_09230 135785 137224 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901784.1 protein_id gnl|my_center|LOCUS_09230 138972 137248 gene locus_tag LOCUS_09240 138972 137248 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401347.1 protein_id gnl|my_center|LOCUS_09240 139680 139351 gene locus_tag LOCUS_09250 139680 139351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 139582 140568 gene locus_tag LOCUS_09260 gene dcyD 139582 140568 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096021.1 protein_id gnl|my_center|LOCUS_09260 140597 142432 gene locus_tag LOCUS_09270 140597 142432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 143063 142818 gene locus_tag LOCUS_09280 143063 142818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 143147 143416 gene locus_tag LOCUS_09290 143147 143416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 143413 143796 gene locus_tag LOCUS_09300 143413 143796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 144087 144515 gene locus_tag LOCUS_09310 144087 144515 CDS product cellulose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409992.1 protein_id gnl|my_center|LOCUS_09310 144913 144512 gene locus_tag LOCUS_09320 144913 144512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 145379 145585 gene locus_tag LOCUS_09330 145379 145585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 145576 145998 gene locus_tag LOCUS_09340 145576 145998 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911071.1 protein_id gnl|my_center|LOCUS_09340 146927 146493 gene locus_tag LOCUS_09350 146927 146493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 147144 146911 gene locus_tag LOCUS_09360 147144 146911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 147859 147461 gene locus_tag LOCUS_09370 147859 147461 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898500.1 protein_id gnl|my_center|LOCUS_09370 148091 147846 gene locus_tag LOCUS_09380 148091 147846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 150654 148339 gene locus_tag LOCUS_09390 gene ctpG 150654 148339 CDS product cation transporter ATPase CptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899120.1 protein_id gnl|my_center|LOCUS_09390 150931 150641 gene locus_tag LOCUS_09400 150931 150641 CDS product DUF1490 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410017.1 protein_id gnl|my_center|LOCUS_09400 151302 150934 gene locus_tag LOCUS_09410 gene cmtR 151302 150934 CDS product Cd(II)/Pb(II)-sensing metalloregulatory transcriptional regulator CmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410018.1 protein_id gnl|my_center|LOCUS_09410 151450 152847 gene locus_tag LOCUS_09420 151450 152847 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410042.1 protein_id gnl|my_center|LOCUS_09420 152858 153613 gene locus_tag LOCUS_09430 152858 153613 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900448.1 protein_id gnl|my_center|LOCUS_09430 153613 154947 gene locus_tag LOCUS_09440 153613 154947 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223158.1 protein_id gnl|my_center|LOCUS_09440 155066 156202 gene locus_tag LOCUS_09450 155066 156202 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093421.1 protein_id gnl|my_center|LOCUS_09450 156199 157149 gene locus_tag LOCUS_09460 156199 157149 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227174.1 protein_id gnl|my_center|LOCUS_09460 157146 158729 gene locus_tag LOCUS_09470 157146 158729 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467246.1 protein_id gnl|my_center|LOCUS_09470 159064 158648 gene locus_tag LOCUS_09480 159064 158648 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409913.1 protein_id gnl|my_center|LOCUS_09480 159319 159068 gene locus_tag LOCUS_09490 159319 159068 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899100.1 protein_id gnl|my_center|LOCUS_09490 159731 159366 gene locus_tag LOCUS_09500 159731 159366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 160882 159908 gene locus_tag LOCUS_09510 160882 159908 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410060.1 protein_id gnl|my_center|LOCUS_09510 161795 160911 gene locus_tag LOCUS_09520 161795 160911 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410150.1 protein_id gnl|my_center|LOCUS_09520 162794 161853 gene locus_tag LOCUS_09530 162794 161853 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433833.1 protein_id gnl|my_center|LOCUS_09530 162674 162583 gene locus_tag LOCUS_t00160 162674 162583 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 163380 162835 gene locus_tag LOCUS_09540 163380 162835 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014253.1 protein_id gnl|my_center|LOCUS_09540 163646 163377 gene locus_tag LOCUS_09550 163646 163377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 164266 163643 gene locus_tag LOCUS_09560 164266 163643 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093949117.1 protein_id gnl|my_center|LOCUS_09560 165347 164280 gene locus_tag LOCUS_09570 165347 164280 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115250.1 protein_id gnl|my_center|LOCUS_09570 165814 165344 gene locus_tag LOCUS_09580 gene cynS 165814 165344 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_09580 166349 165825 gene locus_tag LOCUS_09590 166349 165825 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 protein_id gnl|my_center|LOCUS_09590 168025 166520 gene locus_tag LOCUS_09600 168025 166520 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_09600 168182 168352 gene locus_tag LOCUS_09610 168182 168352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 168327 168650 gene locus_tag LOCUS_09620 168327 168650 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410200.1 protein_id gnl|my_center|LOCUS_09620 168647 169759 gene locus_tag LOCUS_09630 168647 169759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 170863 169793 gene locus_tag LOCUS_09640 gene ugpC 170863 169793 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410218.1 protein_id gnl|my_center|LOCUS_09640 171693 170869 gene locus_tag LOCUS_09650 171693 170869 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410221.1 protein_id gnl|my_center|LOCUS_09650 172639 171698 gene locus_tag LOCUS_09660 172639 171698 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410224.1 protein_id gnl|my_center|LOCUS_09660 173952 172636 gene locus_tag LOCUS_09670 173952 172636 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410228.1 protein_id gnl|my_center|LOCUS_09670 175169 174372 gene locus_tag LOCUS_09680 175169 174372 CDS product ketosteroid isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899143.1 protein_id gnl|my_center|LOCUS_09680 175741 175169 gene locus_tag LOCUS_09690 175741 175169 CDS product bifunctional pyrazinamidase/nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410243.1 protein_id gnl|my_center|LOCUS_09690 177379 175781 gene locus_tag LOCUS_09700 177379 175781 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899145.1 protein_id gnl|my_center|LOCUS_09700 180048 177397 gene locus_tag LOCUS_09710 180048 177397 CDS product sugar epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410309.1 protein_id gnl|my_center|LOCUS_09710 185266 180059 gene locus_tag LOCUS_09720 185266 180059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 191283 185299 gene locus_tag LOCUS_09730 191283 185299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 185313 185323 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 191708 191271 gene locus_tag LOCUS_09740 191708 191271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 192166 191678 gene locus_tag LOCUS_09750 192166 191678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09750 192284 192481 gene locus_tag LOCUS_09760 192284 192481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 192487 192762 gene locus_tag LOCUS_09770 192487 192762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 193429 193079 gene locus_tag LOCUS_09780 193429 193079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080063.1 protein_id gnl|my_center|LOCUS_09780 193599 193934 gene locus_tag LOCUS_09790 gene rbpA 193599 193934 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410601.1 protein_id gnl|my_center|LOCUS_09790 194766 193960 gene locus_tag LOCUS_09800 194766 193960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09800 196616 194763 gene locus_tag LOCUS_09810 196616 194763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 198213 196609 gene locus_tag LOCUS_09820 198213 196609 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410605.1 protein_id gnl|my_center|LOCUS_09820 198727 198233 gene locus_tag LOCUS_09830 gene fxsA 198727 198233 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410608.1 protein_id gnl|my_center|LOCUS_09830 198803 199498 gene locus_tag LOCUS_09840 198803 199498 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410610.1 protein_id gnl|my_center|LOCUS_09840 199987 199589 gene locus_tag LOCUS_09850 199987 199589 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546499.1 protein_id gnl|my_center|LOCUS_09850 200181 199984 gene locus_tag LOCUS_09860 200181 199984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 201477 200242 gene locus_tag LOCUS_09870 201477 200242 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901321.1 protein_id gnl|my_center|LOCUS_09870 202506 201592 gene locus_tag LOCUS_09880 gene blaC 202506 201592 CDS product class A beta-lactamase BlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410677.1 protein_id gnl|my_center|LOCUS_09880 202900 202487 gene locus_tag LOCUS_09890 202900 202487 CDS product F420-dependent biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899157.1 protein_id gnl|my_center|LOCUS_09890 202936 203685 gene locus_tag LOCUS_09900 202936 203685 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900457.1 protein_id gnl|my_center|LOCUS_09900 205125 203770 gene locus_tag LOCUS_09910 205125 203770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 205124 205408 gene locus_tag LOCUS_09920 205124 205408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 206911 205433 gene locus_tag LOCUS_09930 206911 205433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899158.1 protein_id gnl|my_center|LOCUS_09930 207757 207359 gene locus_tag LOCUS_09940 207757 207359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09940 208179 207754 gene locus_tag LOCUS_09950 208179 207754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 208578 208300 gene locus_tag LOCUS_09960 208578 208300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 208543 208740 gene locus_tag LOCUS_09970 208543 208740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 208751 209290 gene locus_tag LOCUS_09980 208751 209290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 209280 211406 gene locus_tag LOCUS_09990 209280 211406 CDS product DUF5631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950655.1 protein_id gnl|my_center|LOCUS_09990 211403 212365 gene locus_tag LOCUS_10000 211403 212365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903746.1 protein_id gnl|my_center|LOCUS_10000 212358 213353 gene locus_tag LOCUS_10010 212358 213353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900462.1 protein_id gnl|my_center|LOCUS_10010 213403 213717 gene locus_tag LOCUS_10020 213403 213717 CDS product DUF2563 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410700.1 protein_id gnl|my_center|LOCUS_10020 213699 215666 gene locus_tag LOCUS_10030 213699 215666 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950653.1 protein_id gnl|my_center|LOCUS_10030 215638 216204 gene locus_tag LOCUS_10040 215638 216204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899161.1 protein_id gnl|my_center|LOCUS_10040 217023 216535 gene locus_tag LOCUS_10050 217023 216535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 218322 217198 gene locus_tag LOCUS_10060 218322 217198 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410743.1 protein_id gnl|my_center|LOCUS_10060 218607 218341 gene locus_tag LOCUS_10070 218607 218341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 218631 219554 gene locus_tag LOCUS_10080 218631 219554 CDS product 5'-3' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935270.1 protein_id gnl|my_center|LOCUS_10080 220325 219558 gene locus_tag LOCUS_10090 220325 219558 CDS product DUF4333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410762.1 protein_id gnl|my_center|LOCUS_10090 223088 220377 gene locus_tag LOCUS_10100 223088 220377 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899167.1 protein_id gnl|my_center|LOCUS_10100 224063 223113 gene locus_tag LOCUS_10110 gene tatC 224063 223113 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410764.1 protein_id gnl|my_center|LOCUS_10110 224345 224082 gene locus_tag LOCUS_10120 gene tatA 224345 224082 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410768.1 protein_id gnl|my_center|LOCUS_10120 225381 224413 gene locus_tag LOCUS_10130 225381 224413 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410772.1 protein_id gnl|my_center|LOCUS_10130 226376 225378 gene locus_tag LOCUS_10140 226376 225378 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410775.1 protein_id gnl|my_center|LOCUS_10140 227738 226395 gene locus_tag LOCUS_10150 gene pafA 227738 226395 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410781.1 protein_id gnl|my_center|LOCUS_10150 227793 229424 gene locus_tag LOCUS_10160 227793 229424 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900464.1 protein_id gnl|my_center|LOCUS_10160 229885 229451 gene locus_tag LOCUS_10170 229885 229451 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_10170 230236 229970 gene locus_tag LOCUS_10180 230236 229970 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410814.1 protein_id gnl|my_center|LOCUS_10180 231811 230282 gene locus_tag LOCUS_10190 231811 230282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 232749 231955 gene locus_tag LOCUS_10200 gene prcA 232749 231955 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901330.1 protein_id gnl|my_center|LOCUS_10200 233639 232746 gene locus_tag LOCUS_10210 gene prcB 233639 232746 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411023.1 protein_id gnl|my_center|LOCUS_10210 233872 233636 gene locus_tag LOCUS_10220 233872 233636 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411026.1 protein_id gnl|my_center|LOCUS_10220 235550 233934 gene locus_tag LOCUS_10230 gene dop 235550 233934 CDS product pup deamidase/depupylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899176.1 protein_id gnl|my_center|LOCUS_10230 236084 237277 gene locus_tag LOCUS_10240 236084 237277 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411031.1 protein_id gnl|my_center|LOCUS_10240 237270 237929 gene locus_tag LOCUS_10250 237270 237929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411033.1 protein_id gnl|my_center|LOCUS_10250 239762 237933 gene locus_tag LOCUS_10260 gene arc 239762 237933 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411035.1 protein_id gnl|my_center|LOCUS_10260 239983 240540 gene locus_tag LOCUS_10270 239983 240540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900470.1 protein_id gnl|my_center|LOCUS_10270 240551 240844 gene locus_tag LOCUS_10280 240551 240844 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075541644.1 protein_id gnl|my_center|LOCUS_10280 240955 241266 gene locus_tag LOCUS_10290 240955 241266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10290 241263 242681 gene locus_tag LOCUS_10300 241263 242681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 243595 242699 gene locus_tag LOCUS_10310 gene trmI 243595 242699 CDS product tRNA (adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411041.1 protein_id gnl|my_center|LOCUS_10310 243615 244460 gene locus_tag LOCUS_10320 243615 244460 CDS product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899178.1 protein_id gnl|my_center|LOCUS_10320 245885 244497 gene locus_tag LOCUS_10330 245885 244497 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529943.1 protein_id gnl|my_center|LOCUS_10330 246364 245882 gene locus_tag LOCUS_10340 246364 245882 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900471.1 protein_id gnl|my_center|LOCUS_10340 247295 246441 gene locus_tag LOCUS_10350 gene hisG 247295 246441 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411047.1 protein_id gnl|my_center|LOCUS_10350 247579 247298 gene locus_tag LOCUS_10360 247579 247298 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899180.1 protein_id gnl|my_center|LOCUS_10360 251211 247618 gene locus_tag LOCUS_10370 gene metH 251211 247618 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900472.1 protein_id gnl|my_center|LOCUS_10370 251386 252207 gene locus_tag LOCUS_10380 251386 252207 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411060.1 protein_id gnl|my_center|LOCUS_10380 252266 252544 gene locus_tag LOCUS_10390 252266 252544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10390 254037 252844 gene locus_tag LOCUS_10400 254037 252844 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227533.1 protein_id gnl|my_center|LOCUS_10400 254944 254072 gene locus_tag LOCUS_10410 254944 254072 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411086.1 protein_id gnl|my_center|LOCUS_10410 256309 254978 gene locus_tag LOCUS_10420 gene mshC 256309 254978 CDS product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411091.1 protein_id gnl|my_center|LOCUS_10420 257072 256284 gene locus_tag LOCUS_10430 gene cysQ 257072 256284 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411096.1 protein_id gnl|my_center|LOCUS_10430 257171 257401 gene locus_tag LOCUS_10440 257171 257401 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411099.1 protein_id gnl|my_center|LOCUS_10440 257401 257829 gene locus_tag LOCUS_10450 257401 257829 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_10450 258643 257855 gene locus_tag LOCUS_10460 258643 257855 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411101.1 protein_id gnl|my_center|LOCUS_10460 259241 258654 gene locus_tag LOCUS_10470 259241 258654 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411102.1 protein_id gnl|my_center|LOCUS_10470 260009 259317 gene locus_tag LOCUS_10480 260009 259317 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411103.1 protein_id gnl|my_center|LOCUS_10480 260836 260006 gene locus_tag LOCUS_10490 260836 260006 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411105.1 protein_id gnl|my_center|LOCUS_10490 261290 260988 gene locus_tag LOCUS_10500 261290 260988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 261456 262427 gene locus_tag LOCUS_10510 261456 262427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411110.1 protein_id gnl|my_center|LOCUS_10510 262424 262690 gene locus_tag LOCUS_10520 262424 262690 CDS product DUF5703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895584.1 protein_id gnl|my_center|LOCUS_10520 262711 263784 gene locus_tag LOCUS_10530 262711 263784 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411116.1 protein_id gnl|my_center|LOCUS_10530 264328 263798 gene locus_tag LOCUS_10540 264328 263798 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411119.1 protein_id gnl|my_center|LOCUS_10540 265735 264383 gene locus_tag LOCUS_10550 265735 264383 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411121.1 protein_id gnl|my_center|LOCUS_10550 265853 265939 gene locus_tag LOCUS_t00170 265853 265939 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 266291 265962 gene locus_tag LOCUS_10560 266291 265962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411130.1 protein_id gnl|my_center|LOCUS_10560 267144 266377 gene locus_tag LOCUS_10570 gene wag31 267144 266377 CDS product cell wall synthesis protein Wag31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411131.1 protein_id gnl|my_center|LOCUS_10570 267687 267397 gene locus_tag LOCUS_10580 267687 267397 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900476.1 protein_id gnl|my_center|LOCUS_10580 268476 267820 gene locus_tag LOCUS_10590 gene sepF 268476 267820 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411133.1 protein_id gnl|my_center|LOCUS_10590 269336 268542 gene locus_tag LOCUS_10600 269336 268542 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411137.1 protein_id gnl|my_center|LOCUS_10600 270040 269333 gene locus_tag LOCUS_10610 gene pgeF 270040 269333 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411140.1 protein_id gnl|my_center|LOCUS_10610 271215 270073 gene locus_tag LOCUS_10620 gene ftsZ 271215 270073 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411144.1 protein_id gnl|my_center|LOCUS_10620 272277 271408 gene locus_tag LOCUS_10630 gene ftsQ 272277 271408 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411157.1 protein_id gnl|my_center|LOCUS_10630 273752 272274 gene locus_tag LOCUS_10640 gene murC 273752 272274 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411159.1 protein_id gnl|my_center|LOCUS_10640 274930 273749 gene locus_tag LOCUS_10650 gene murG 274930 273749 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950665.1 protein_id gnl|my_center|LOCUS_10650 276456 274927 gene locus_tag LOCUS_10660 gene ftsW 276456 274927 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411165.1 protein_id gnl|my_center|LOCUS_10660 277905 276463 gene locus_tag LOCUS_10670 gene murD 277905 276463 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001157.1 protein_id gnl|my_center|LOCUS_10670 278986 277907 gene locus_tag LOCUS_10680 gene mraY 278986 277907 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411171.1 protein_id gnl|my_center|LOCUS_10680 280497 278983 gene locus_tag LOCUS_10690 280497 278983 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411187.1 protein_id gnl|my_center|LOCUS_10690 282050 280494 gene locus_tag LOCUS_10700 282050 280494 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411189.1 protein_id gnl|my_center|LOCUS_10700 282453 283541 gene locus_tag LOCUS_10710 282453 283541 CDS product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904572.1 protein_id gnl|my_center|LOCUS_10710 286884 283528 gene locus_tag LOCUS_10720 286884 283528 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401912.1 protein_id gnl|my_center|LOCUS_10720 288947 287013 gene locus_tag LOCUS_10730 gene pbpB 288947 287013 CDS product D,D-transpeptidase PbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411214.1 protein_id gnl|my_center|LOCUS_10730 289948 288944 gene locus_tag LOCUS_10740 289948 288944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899197.1 protein_id gnl|my_center|LOCUS_10740 290949 289948 gene locus_tag LOCUS_10750 gene rsmH 290949 289948 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411221.1 protein_id gnl|my_center|LOCUS_10750 291520 291089 gene locus_tag LOCUS_10760 gene mraZ 291520 291089 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411225.1 protein_id gnl|my_center|LOCUS_10760 292293 291883 gene locus_tag LOCUS_10770 292293 291883 CDS product DUF3040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411231.1 protein_id gnl|my_center|LOCUS_10770 292572 293216 gene locus_tag LOCUS_10780 292572 293216 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411235.1 protein_id gnl|my_center|LOCUS_10780 293170 294021 gene locus_tag LOCUS_10790 gene lppM 293170 294021 CDS product lipoprotein LppM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411238.1 protein_id gnl|my_center|LOCUS_10790 294923 294018 gene locus_tag LOCUS_10800 294923 294018 CDS product mycobacterial-type methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411241.1 protein_id gnl|my_center|LOCUS_10800 295211 296281 gene locus_tag LOCUS_10810 295211 296281 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411245.1 protein_id gnl|my_center|LOCUS_10810 296285 297808 gene locus_tag LOCUS_10820 296285 297808 CDS product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903784.1 protein_id gnl|my_center|LOCUS_10820 298199 297795 gene locus_tag LOCUS_10830 298199 297795 CDS product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900481.1 protein_id gnl|my_center|LOCUS_10830 298300 299523 gene locus_tag LOCUS_10840 298300 299523 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910517.1 protein_id gnl|my_center|LOCUS_10840 299830 299540 gene locus_tag LOCUS_10850 299830 299540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 301270 299882 gene locus_tag LOCUS_10860 301270 299882 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411323.1 protein_id gnl|my_center|LOCUS_10860 301842 301351 gene locus_tag LOCUS_10870 301842 301351 CDS product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411331.1 protein_id gnl|my_center|LOCUS_10870 301928 303208 gene locus_tag LOCUS_10880 301928 303208 CDS product alpha-(1-2)-phosphatidylinositol mannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411339.1 protein_id gnl|my_center|LOCUS_10880 303948 303205 gene locus_tag LOCUS_10890 303948 303205 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411341.1 protein_id gnl|my_center|LOCUS_10890 304429 304034 gene locus_tag LOCUS_10900 304429 304034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411344.1 protein_id gnl|my_center|LOCUS_10900 305538 304426 gene locus_tag LOCUS_10910 305538 304426 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411348.1 protein_id gnl|my_center|LOCUS_10910 306134 305700 gene locus_tag LOCUS_10920 306134 305700 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411354.1 protein_id gnl|my_center|LOCUS_10920 306628 306239 gene locus_tag LOCUS_10930 306628 306239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411357.1 protein_id gnl|my_center|LOCUS_10930 306814 308616 gene locus_tag LOCUS_10940 306814 308616 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014001171.1 protein_id gnl|my_center|LOCUS_10940 309819 308686 gene locus_tag LOCUS_10950 gene pimB 309819 308686 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411369.1 protein_id gnl|my_center|LOCUS_10950 310690 309872 gene locus_tag LOCUS_10960 310690 309872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411371.1 protein_id gnl|my_center|LOCUS_10960 311891 310740 gene locus_tag LOCUS_10970 gene ripC 311891 310740 CDS product peptidoglycan hydrolase RipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907994.1 protein_id gnl|my_center|LOCUS_10970 312307 312053 gene locus_tag LOCUS_10980 312307 312053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 312414 314378 gene locus_tag LOCUS_10990 312414 314378 CDS product DEDD exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901350.1 protein_id gnl|my_center|LOCUS_10990 314554 314811 gene locus_tag LOCUS_11000 314554 314811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 314817 315122 gene locus_tag LOCUS_11010 314817 315122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 315588 316130 gene locus_tag LOCUS_11020 315588 316130 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411389.1 protein_id gnl|my_center|LOCUS_11020 316127 317026 gene locus_tag LOCUS_11030 316127 317026 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411392.1 protein_id gnl|my_center|LOCUS_11030 317023 318222 gene locus_tag LOCUS_11040 317023 318222 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950672.1 protein_id gnl|my_center|LOCUS_11040 318219 319886 gene locus_tag LOCUS_11050 318219 319886 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899212.1 protein_id gnl|my_center|LOCUS_11050 320515 319883 gene locus_tag LOCUS_11060 320515 319883 CDS product DUF2561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899213.1 protein_id gnl|my_center|LOCUS_11060 321468 320515 gene locus_tag LOCUS_11070 321468 320515 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411405.1 protein_id gnl|my_center|LOCUS_11070 322065 321646 gene locus_tag LOCUS_11080 322065 321646 CDS product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907986.1 protein_id gnl|my_center|LOCUS_11080 323075 322080 gene locus_tag LOCUS_11090 323075 322080 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899214.1 protein_id gnl|my_center|LOCUS_11090 323339 325330 gene locus_tag LOCUS_11100 gene asnB 323339 325330 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411413.1 protein_id gnl|my_center|LOCUS_11100 326329 325397 gene locus_tag LOCUS_11110 326329 325397 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411414.1 protein_id gnl|my_center|LOCUS_11110 326550 327242 gene locus_tag LOCUS_11120 326550 327242 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411415.1 protein_id gnl|my_center|LOCUS_11120 327630 327274 gene locus_tag LOCUS_11130 327630 327274 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411418.1 protein_id gnl|my_center|LOCUS_11130 328888 327698 gene locus_tag LOCUS_11140 328888 327698 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411420.1 protein_id gnl|my_center|LOCUS_11140 329126 329635 gene locus_tag LOCUS_11150 329126 329635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 329635 330210 gene locus_tag LOCUS_11160 gene cobU 329635 330210 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163803955.1 protein_id gnl|my_center|LOCUS_11160 330225 331256 gene locus_tag LOCUS_11170 gene cobT 330225 331256 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411429.1 protein_id gnl|my_center|LOCUS_11170 331253 332002 gene locus_tag LOCUS_11180 331253 332002 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411433.1 protein_id gnl|my_center|LOCUS_11180 332079 333656 gene locus_tag LOCUS_11190 332079 333656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899218.1 protein_id gnl|my_center|LOCUS_11190 334688 333582 gene locus_tag LOCUS_11200 334688 333582 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411438.1 protein_id gnl|my_center|LOCUS_11200 336425 334923 gene locus_tag LOCUS_11210 gene ltrA 336425 334923 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_11210 336578 336775 gene locus_tag LOCUS_11220 336578 336775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence26 647 348 gene locus_tag LOCUS_11230 647 348 CDS product type VII secretion system ESX-5 target PE18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408976.1 protein_id gnl|my_center|LOCUS_11230 2173 974 gene locus_tag LOCUS_11240 2173 974 CDS product type VII secretion system ESX-5 target PPE26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408979.1 protein_id gnl|my_center|LOCUS_11240 2486 2187 gene locus_tag LOCUS_11250 2486 2187 CDS product type VII secretion system ESX-5 target PE18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408976.1 protein_id gnl|my_center|LOCUS_11250 3831 2647 gene locus_tag LOCUS_11260 3831 2647 CDS product type VII secretion system ESX-5 target PPE25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901254.1 protein_id gnl|my_center|LOCUS_11260 4456 4262 gene locus_tag LOCUS_11270 4456 4262 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408803.1 protein_id gnl|my_center|LOCUS_11270 4580 5773 gene locus_tag LOCUS_11280 4580 5773 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408802.1 protein_id gnl|my_center|LOCUS_11280 9941 5778 gene locus_tag LOCUS_11290 gene eccC5 9941 5778 CDS product type VII secretion system ESX-5 FtsK/SpoIIIE family ATPase EccC5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950600.1 protein_id gnl|my_center|LOCUS_11290 11329 9938 gene locus_tag LOCUS_11300 gene eccB5 11329 9938 CDS product type VII secretion system ESX-5 subunit EccB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899021.1 protein_id gnl|my_center|LOCUS_11300 11753 14002 gene locus_tag LOCUS_11310 gene malQ 11753 14002 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408795.1 protein_id gnl|my_center|LOCUS_11310 14573 14010 gene locus_tag LOCUS_11320 14573 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408792.1 protein_id gnl|my_center|LOCUS_11320 14797 16599 gene locus_tag LOCUS_11330 14797 16599 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408781.1 protein_id gnl|my_center|LOCUS_11330 16792 17238 gene locus_tag LOCUS_11340 16792 17238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408775.1 protein_id gnl|my_center|LOCUS_11340 18522 17308 gene locus_tag LOCUS_11350 gene cyp144 18522 17308 CDS product cytochrome P450 Cyp144 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408772.1 protein_id gnl|my_center|LOCUS_11350 18689 18519 gene locus_tag LOCUS_11360 18689 18519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 23821 18887 gene locus_tag LOCUS_11370 23821 18887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 24184 24741 gene locus_tag LOCUS_11380 24184 24741 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899018.1 protein_id gnl|my_center|LOCUS_11380 25556 24747 gene locus_tag LOCUS_11390 25556 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408760.1 protein_id gnl|my_center|LOCUS_11390 26896 25556 gene locus_tag LOCUS_11400 26896 25556 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899017.1 protein_id gnl|my_center|LOCUS_11400 27018 27710 gene locus_tag LOCUS_11410 27018 27710 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408754.1 protein_id gnl|my_center|LOCUS_11410 29135 27753 gene locus_tag LOCUS_11420 29135 27753 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729414.1 protein_id gnl|my_center|LOCUS_11420 30494 29265 gene locus_tag LOCUS_11430 30494 29265 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408749.1 protein_id gnl|my_center|LOCUS_11430 32030 30744 gene locus_tag LOCUS_11440 32030 30744 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408749.1 protein_id gnl|my_center|LOCUS_11440 33232 32027 gene locus_tag LOCUS_11450 33232 32027 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899014.1 protein_id gnl|my_center|LOCUS_11450 34616 33372 gene locus_tag LOCUS_11460 34616 33372 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904700.1 protein_id gnl|my_center|LOCUS_11460 36649 34769 gene locus_tag LOCUS_11470 36649 34769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence27 460 945 gene locus_tag LOCUS_11480 460 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1364 1708 gene locus_tag LOCUS_11490 1364 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2950 2222 gene locus_tag LOCUS_11500 2950 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3596 2952 gene locus_tag LOCUS_11510 gene narJ 3596 2952 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406093.1 protein_id gnl|my_center|LOCUS_11510 5242 3593 gene locus_tag LOCUS_11520 gene narH 5242 3593 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_11520 8916 5239 gene locus_tag LOCUS_11530 8916 5239 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878246.1 protein_id gnl|my_center|LOCUS_11530 10139 8913 gene locus_tag LOCUS_11540 10139 8913 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730343.1 protein_id gnl|my_center|LOCUS_11540 10587 10243 gene locus_tag LOCUS_11550 gene mazF6 10587 10243 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_11550 10829 10581 gene locus_tag LOCUS_11560 10829 10581 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410014.1 protein_id gnl|my_center|LOCUS_11560 11098 10826 gene locus_tag LOCUS_11570 11098 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11570 11592 13967 gene locus_tag LOCUS_11580 11592 13967 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900178.1 protein_id gnl|my_center|LOCUS_11580 16613 13974 gene locus_tag LOCUS_11590 16613 13974 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403055.1 protein_id gnl|my_center|LOCUS_11590 16777 17454 gene locus_tag LOCUS_11600 16777 17454 CDS product LpqN/LpqT family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403052.1 protein_id gnl|my_center|LOCUS_11600 17515 18084 gene locus_tag LOCUS_11610 17515 18084 CDS product mycobacterial cell wall protein Rv0580c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403017.1 protein_id gnl|my_center|LOCUS_11610 18466 20025 gene locus_tag LOCUS_11620 18466 20025 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899285.1 protein_id gnl|my_center|LOCUS_11620 20808 20062 gene locus_tag LOCUS_11630 20808 20062 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_11630 20931 22058 gene locus_tag LOCUS_11640 20931 22058 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403008.1 protein_id gnl|my_center|LOCUS_11640 22331 23707 gene locus_tag LOCUS_11650 22331 23707 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403007.1 protein_id gnl|my_center|LOCUS_11650 23821 24255 gene locus_tag LOCUS_11660 gene hrp1 23821 24255 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_11660 24281 24733 gene locus_tag LOCUS_11670 24281 24733 CDS product DUF5709 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027314.1 protein_id gnl|my_center|LOCUS_11670 25345 25124 gene locus_tag LOCUS_11680 25345 25124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 25516 26997 gene locus_tag LOCUS_11690 25516 26997 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_11690 27022 27444 gene locus_tag LOCUS_11700 27022 27444 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413614.1 protein_id gnl|my_center|LOCUS_11700 27457 28878 gene locus_tag LOCUS_11710 gene rtcB 27457 28878 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413616.1 protein_id gnl|my_center|LOCUS_11710 28987 29652 gene locus_tag LOCUS_11720 gene phoU 28987 29652 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064270.1 protein_id gnl|my_center|LOCUS_11720 30452 29667 gene locus_tag LOCUS_11730 30452 29667 CDS product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877865.1 protein_id gnl|my_center|LOCUS_11730 32635 30605 gene locus_tag LOCUS_11740 32635 30605 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402998.1 protein_id gnl|my_center|LOCUS_11740 32987 32715 gene locus_tag LOCUS_11750 32987 32715 CDS product DUF1918 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402995.1 protein_id gnl|my_center|LOCUS_11750 34618 33257 gene locus_tag LOCUS_11760 34618 33257 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402992.1 protein_id gnl|my_center|LOCUS_11760 34895 36475 gene locus_tag LOCUS_11770 34895 36475 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896832.1 protein_id gnl|my_center|LOCUS_11770 37619 36990 gene locus_tag LOCUS_11780 37619 36990 CDS product DUF5134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898666.1 protein_id gnl|my_center|LOCUS_11780 40020 37651 gene locus_tag LOCUS_11790 40020 37651 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935691.1 protein_id gnl|my_center|LOCUS_11790 40312 40010 gene locus_tag LOCUS_11800 40312 40010 CDS product DUF1490 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404939.1 protein_id gnl|my_center|LOCUS_11800 40720 40364 gene locus_tag LOCUS_11810 gene csoR 40720 40364 CDS product copper-sensing transcriptional repressor CsoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404935.1 protein_id gnl|my_center|LOCUS_11810 41178 43142 gene locus_tag LOCUS_11820 41178 43142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 43399 43316 gene locus_tag LOCUS_t00180 43399 43316 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 43469 43960 gene locus_tag LOCUS_11830 43469 43960 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402987.1 protein_id gnl|my_center|LOCUS_11830 44043 45542 gene locus_tag LOCUS_11840 44043 45542 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402981.1 protein_id gnl|my_center|LOCUS_11840 45566 46591 gene locus_tag LOCUS_11850 45566 46591 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900965.1 protein_id gnl|my_center|LOCUS_11850 47458 46595 gene locus_tag LOCUS_11860 gene htpX 47458 46595 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402959.1 protein_id gnl|my_center|LOCUS_11860 48545 47556 gene locus_tag LOCUS_11870 gene grcC 48545 47556 CDS product polyprenyl-diphosphate synthase GrcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402957.1 protein_id gnl|my_center|LOCUS_11870 48580 49827 gene locus_tag LOCUS_11880 gene menJ 48580 49827 CDS product menaquinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402939.1 protein_id gnl|my_center|LOCUS_11880 50711 49845 gene locus_tag LOCUS_11890 50711 49845 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033434014.1 protein_id gnl|my_center|LOCUS_11890 50926 51255 gene locus_tag LOCUS_11900 50926 51255 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402937.1 protein_id gnl|my_center|LOCUS_11900 51960 51256 gene locus_tag LOCUS_11910 51960 51256 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402936.1 protein_id gnl|my_center|LOCUS_11910 53109 51979 gene locus_tag LOCUS_11920 gene mgtA 53109 51979 CDS product GDP-mannose-dependent alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900963.1 protein_id gnl|my_center|LOCUS_11920 53673 53173 gene locus_tag LOCUS_11930 53673 53173 CDS product DUF3592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402929.1 protein_id gnl|my_center|LOCUS_11930 55313 53670 gene locus_tag LOCUS_11940 gene menD 55313 53670 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402927.1 protein_id gnl|my_center|LOCUS_11940 56120 55326 gene locus_tag LOCUS_11950 56120 55326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402925.1 protein_id gnl|my_center|LOCUS_11950 57066 56113 gene locus_tag LOCUS_11960 57066 56113 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402923.1 protein_id gnl|my_center|LOCUS_11960 58688 57084 gene locus_tag LOCUS_11970 58688 57084 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402920.1 protein_id gnl|my_center|LOCUS_11970 58842 60443 gene locus_tag LOCUS_11980 gene fadD8 58842 60443 CDS product fatty-acid--CoA ligase FadD8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402917.1 protein_id gnl|my_center|LOCUS_11980 60532 61428 gene locus_tag LOCUS_11990 60532 61428 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402911.1 protein_id gnl|my_center|LOCUS_11990 61543 62433 gene locus_tag LOCUS_12000 61543 62433 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402909.1 protein_id gnl|my_center|LOCUS_12000 62449 63069 gene locus_tag LOCUS_12010 62449 63069 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030760.1 protein_id gnl|my_center|LOCUS_12010 63080 63496 gene locus_tag LOCUS_12020 63080 63496 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402907.1 protein_id gnl|my_center|LOCUS_12020 63616 64839 gene locus_tag LOCUS_12030 63616 64839 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402904.1 protein_id gnl|my_center|LOCUS_12030 64836 65123 gene locus_tag LOCUS_12040 64836 65123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402901.1 protein_id gnl|my_center|LOCUS_12040 65190 65492 gene locus_tag LOCUS_12050 65190 65492 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402896.1 protein_id gnl|my_center|LOCUS_12050 65537 66643 gene locus_tag LOCUS_12060 gene menE 65537 66643 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402892.1 protein_id gnl|my_center|LOCUS_12060 66655 68019 gene locus_tag LOCUS_12070 66655 68019 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402890.1 protein_id gnl|my_center|LOCUS_12070 68579 68743 gene locus_tag LOCUS_12080 68579 68743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 68716 69543 gene locus_tag LOCUS_12090 68716 69543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12090 69506 70240 gene locus_tag LOCUS_12100 69506 70240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12100 70889 70218 gene locus_tag LOCUS_12110 70889 70218 CDS product DUF2064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402886.1 protein_id gnl|my_center|LOCUS_12110 71548 70886 gene locus_tag LOCUS_12120 71548 70886 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898499.1 protein_id gnl|my_center|LOCUS_12120 73243 71564 gene locus_tag LOCUS_12130 73243 71564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 72879 72789 gene locus_tag LOCUS_t00190 72879 72789 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 73562 75124 gene locus_tag LOCUS_12140 73562 75124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402870.1 protein_id gnl|my_center|LOCUS_12140 76165 75134 gene locus_tag LOCUS_12150 76165 75134 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402868.1 protein_id gnl|my_center|LOCUS_12150 76950 76168 gene locus_tag LOCUS_12160 76950 76168 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402867.1 protein_id gnl|my_center|LOCUS_12160 76985 77863 gene locus_tag LOCUS_12170 76985 77863 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402865.1 protein_id gnl|my_center|LOCUS_12170 77945 78961 gene locus_tag LOCUS_12180 gene fabH 77945 78961 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402861.1 protein_id gnl|my_center|LOCUS_12180 79291 78965 gene locus_tag LOCUS_12190 79291 78965 CDS product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402853.1 protein_id gnl|my_center|LOCUS_12190 79338 79499 gene locus_tag LOCUS_12200 79338 79499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402851.1 protein_id gnl|my_center|LOCUS_12200 80840 79509 gene locus_tag LOCUS_12210 80840 79509 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898495.1 protein_id gnl|my_center|LOCUS_12210 81855 80881 gene locus_tag LOCUS_12220 gene ccsB 81855 80881 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402849.1 protein_id gnl|my_center|LOCUS_12220 83471 81852 gene locus_tag LOCUS_12230 83471 81852 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402848.1 protein_id gnl|my_center|LOCUS_12230 84280 83522 gene locus_tag LOCUS_12240 84280 83522 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402847.1 protein_id gnl|my_center|LOCUS_12240 84945 84277 gene locus_tag LOCUS_12250 84945 84277 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402846.1 protein_id gnl|my_center|LOCUS_12250 85623 85015 gene locus_tag LOCUS_12260 85623 85015 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402845.1 protein_id gnl|my_center|LOCUS_12260 87008 85623 gene locus_tag LOCUS_12270 gene hemL 87008 85623 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402844.1 protein_id gnl|my_center|LOCUS_12270 88546 87089 gene locus_tag LOCUS_12280 88546 87089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 88654 89055 gene locus_tag LOCUS_12290 88654 89055 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402842.1 protein_id gnl|my_center|LOCUS_12290 90425 89052 gene locus_tag LOCUS_12300 90425 89052 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900165.1 protein_id gnl|my_center|LOCUS_12300 91680 91117 gene locus_tag LOCUS_12310 91680 91117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 92172 91954 gene locus_tag LOCUS_12320 92172 91954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 92351 93223 gene locus_tag LOCUS_12330 92351 93223 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402824.1 protein_id gnl|my_center|LOCUS_12330 93233 93535 gene locus_tag LOCUS_12340 93233 93535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 94948 93698 gene locus_tag LOCUS_12350 94948 93698 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402810.1 protein_id gnl|my_center|LOCUS_12350 95266 95721 gene locus_tag LOCUS_12360 95266 95721 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402807.1 protein_id gnl|my_center|LOCUS_12360 95954 95718 gene locus_tag LOCUS_12370 95954 95718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 96490 95951 gene locus_tag LOCUS_12380 96490 95951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402713.1 protein_id gnl|my_center|LOCUS_12380 97670 96528 gene locus_tag LOCUS_12390 gene hemB 97670 96528 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898491.1 protein_id gnl|my_center|LOCUS_12390 99436 97727 gene locus_tag LOCUS_12400 99436 97727 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900163.1 protein_id gnl|my_center|LOCUS_12400 100403 99453 gene locus_tag LOCUS_12410 gene hemC 100403 99453 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402702.1 protein_id gnl|my_center|LOCUS_12410 101844 100417 gene locus_tag LOCUS_12420 101844 100417 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402699.1 protein_id gnl|my_center|LOCUS_12420 102203 101919 gene locus_tag LOCUS_12430 102203 101919 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402695.1 protein_id gnl|my_center|LOCUS_12430 105124 102221 gene locus_tag LOCUS_12440 gene mmpL2 105124 102221 CDS product RND transporter MmpL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911183.1 protein_id gnl|my_center|LOCUS_12440 105558 105121 gene locus_tag LOCUS_12450 105558 105121 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900160.1 protein_id gnl|my_center|LOCUS_12450 106080 106991 gene locus_tag LOCUS_12460 106080 106991 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908888.1 protein_id gnl|my_center|LOCUS_12460 107157 107657 gene locus_tag LOCUS_12470 107157 107657 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402626.1 protein_id gnl|my_center|LOCUS_12470 107681 108586 gene locus_tag LOCUS_12480 gene cmaA2 107681 108586 CDS product cyclopropane mycolic acid synthase CmaA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402621.1 protein_id gnl|my_center|LOCUS_12480 109579 108623 gene locus_tag LOCUS_12490 109579 108623 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898486.1 protein_id gnl|my_center|LOCUS_12490 110813 109698 gene locus_tag LOCUS_12500 110813 109698 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402607.1 protein_id gnl|my_center|LOCUS_12500 111299 111105 gene locus_tag LOCUS_12510 111299 111105 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402437.1 protein_id gnl|my_center|LOCUS_12510 112385 111498 gene locus_tag LOCUS_12520 gene proC 112385 111498 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900159.1 protein_id gnl|my_center|LOCUS_12520 113277 112474 gene locus_tag LOCUS_12530 113277 112474 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402432.1 protein_id gnl|my_center|LOCUS_12530 114395 113334 gene locus_tag LOCUS_12540 114395 113334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402426.1 protein_id gnl|my_center|LOCUS_12540 115411 114392 gene locus_tag LOCUS_12550 gene ppx1 115411 114392 CDS product exopolyphosphatase Ppx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402419.1 protein_id gnl|my_center|LOCUS_12550 115575 116381 gene locus_tag LOCUS_12560 115575 116381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898484.1 protein_id gnl|my_center|LOCUS_12560 117105 116344 gene locus_tag LOCUS_12570 117105 116344 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402414.1 protein_id gnl|my_center|LOCUS_12570 117147 118112 gene locus_tag LOCUS_12580 117147 118112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898482.1 protein_id gnl|my_center|LOCUS_12580 118109 118450 gene locus_tag LOCUS_12590 118109 118450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402400.1 protein_id gnl|my_center|LOCUS_12590 118447 120336 gene locus_tag LOCUS_12600 118447 120336 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908534.1 protein_id gnl|my_center|LOCUS_12600 121086 120394 gene locus_tag LOCUS_12610 gene regX 121086 120394 CDS product two-component sensory transduction protein RegX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402393.1 protein_id gnl|my_center|LOCUS_12610 122483 121242 gene locus_tag LOCUS_12620 gene senX3 122483 121242 CDS product two-component system sensor histidine kinase SenX3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402390.1 protein_id gnl|my_center|LOCUS_12620 123376 122621 gene locus_tag LOCUS_12630 123376 122621 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402379.1 protein_id gnl|my_center|LOCUS_12630 123920 123390 gene locus_tag LOCUS_12640 123920 123390 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892360.1 protein_id gnl|my_center|LOCUS_12640 125260 123917 gene locus_tag LOCUS_12650 gene mshA 125260 123917 CDS product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402367.1 protein_id gnl|my_center|LOCUS_12650 126636 125329 gene locus_tag LOCUS_12660 126636 125329 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402361.1 protein_id gnl|my_center|LOCUS_12660 126819 127571 gene locus_tag LOCUS_12670 126819 127571 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402359.1 protein_id gnl|my_center|LOCUS_12670 128812 127568 gene locus_tag LOCUS_12680 gene ldtMt5 128812 127568 CDS product L,D-transpeptidase LdtMt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402357.1 protein_id gnl|my_center|LOCUS_12680 129940 128969 gene locus_tag LOCUS_12690 129940 128969 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402354.1 protein_id gnl|my_center|LOCUS_12690 130114 130614 gene locus_tag LOCUS_12700 130114 130614 CDS product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402351.1 protein_id gnl|my_center|LOCUS_12700 130963 131817 gene locus_tag LOCUS_12710 130963 131817 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402350.1 protein_id gnl|my_center|LOCUS_12710 131814 132860 gene locus_tag LOCUS_12720 131814 132860 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898475.1 protein_id gnl|my_center|LOCUS_12720 133553 132867 gene locus_tag LOCUS_12730 gene deoC 133553 132867 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402347.1 protein_id gnl|my_center|LOCUS_12730 133975 133553 gene locus_tag LOCUS_12740 133975 133553 CDS product DUF2599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402344.1 protein_id gnl|my_center|LOCUS_12740 134266 133979 gene locus_tag LOCUS_12750 134266 133979 CDS product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908910.1 protein_id gnl|my_center|LOCUS_12750 134963 134373 gene locus_tag LOCUS_12760 gene hbhA 134963 134373 CDS product heparin-binding hemagglutinin HbhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402339.1 protein_id gnl|my_center|LOCUS_12760 135631 135215 gene locus_tag LOCUS_12770 135631 135215 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402335.1 protein_id gnl|my_center|LOCUS_12770 137088 135718 gene locus_tag LOCUS_12780 137088 135718 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402332.1 protein_id gnl|my_center|LOCUS_12780 137223 137927 gene locus_tag LOCUS_12790 137223 137927 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402330.1 protein_id gnl|my_center|LOCUS_12790 137937 138941 gene locus_tag LOCUS_12800 137937 138941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 139097 139960 gene locus_tag LOCUS_12810 gene pcaA 139097 139960 CDS product cyclopropane mycolic acid synthase PcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908913.1 protein_id gnl|my_center|LOCUS_12810 140857 139994 gene locus_tag LOCUS_12820 140857 139994 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908914.1 protein_id gnl|my_center|LOCUS_12820 142225 140939 gene locus_tag LOCUS_12830 gene aceA 142225 140939 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402316.1 protein_id gnl|my_center|LOCUS_12830 143429 142479 gene locus_tag LOCUS_12840 143429 142479 CDS product acyl-[acyl-carrier-protein] thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402311.1 protein_id gnl|my_center|LOCUS_12840 143422 144837 gene locus_tag LOCUS_12850 gene ramB 143422 144837 CDS product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898467.1 protein_id gnl|my_center|LOCUS_12850 144834 145421 gene locus_tag LOCUS_12860 144834 145421 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402306.1 protein_id gnl|my_center|LOCUS_12860 145705 145412 gene locus_tag LOCUS_12870 145705 145412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402304.1 protein_id gnl|my_center|LOCUS_12870 147110 145716 gene locus_tag LOCUS_12880 gene lpdA 147110 145716 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402301.1 protein_id gnl|my_center|LOCUS_12880 147654 147145 gene locus_tag LOCUS_12890 147654 147145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402299.1 protein_id gnl|my_center|LOCUS_12890 147925 147647 gene locus_tag LOCUS_12900 147925 147647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 148437 147937 gene locus_tag LOCUS_12910 148437 147937 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898464.1 protein_id gnl|my_center|LOCUS_12910 149921 148437 gene locus_tag LOCUS_12920 149921 148437 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402294.1 protein_id gnl|my_center|LOCUS_12920 150014 152065 gene locus_tag LOCUS_12930 150014 152065 CDS product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402292.1 protein_id gnl|my_center|LOCUS_12930 152094 153119 gene locus_tag LOCUS_12940 152094 153119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296513.1 protein_id gnl|my_center|LOCUS_12940 153141 154058 gene locus_tag LOCUS_12950 153141 154058 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898463.1 protein_id gnl|my_center|LOCUS_12950 154055 154561 gene locus_tag LOCUS_12960 154055 154561 CDS product DUF5078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402286.1 protein_id gnl|my_center|LOCUS_12960 154850 155173 gene locus_tag LOCUS_12970 154850 155173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908862.1 protein_id gnl|my_center|LOCUS_12970 155939 155250 gene locus_tag LOCUS_12980 155939 155250 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402282.1 protein_id gnl|my_center|LOCUS_12980 156175 156597 gene locus_tag LOCUS_12990 gene mmpS4 156175 156597 CDS product siderophore RND transporter accessory protein MmpS4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402272.1 protein_id gnl|my_center|LOCUS_12990 156594 159485 gene locus_tag LOCUS_13000 gene mmpL4 156594 159485 CDS product siderophore RND transporter MmpL4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898458.1 protein_id gnl|my_center|LOCUS_13000 159532 160839 gene locus_tag LOCUS_13010 159532 160839 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402268.1 protein_id gnl|my_center|LOCUS_13010 160833 161537 gene locus_tag LOCUS_13020 160833 161537 CDS product DUF1365 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402266.1 protein_id gnl|my_center|LOCUS_13020 161534 162796 gene locus_tag LOCUS_13030 161534 162796 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402250.1 protein_id gnl|my_center|LOCUS_13030 162793 163575 gene locus_tag LOCUS_13040 162793 163575 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402248.1 protein_id gnl|my_center|LOCUS_13040 163624 164187 gene locus_tag LOCUS_13050 gene sigK 163624 164187 CDS product sigma-70 family RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402246.1 protein_id gnl|my_center|LOCUS_13050 164215 164910 gene locus_tag LOCUS_13060 gene rskA 164215 164910 CDS product anti-sigma-K factor RskA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898455.1 protein_id gnl|my_center|LOCUS_13060 165870 164995 gene locus_tag LOCUS_13070 165870 164995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727270.1 protein_id gnl|my_center|LOCUS_13070 166395 165880 gene locus_tag LOCUS_13080 166395 165880 CDS product mycothiol transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402240.1 protein_id gnl|my_center|LOCUS_13080 166766 166338 gene locus_tag LOCUS_13090 166766 166338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 166672 168039 gene locus_tag LOCUS_13100 166672 168039 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402239.1 protein_id gnl|my_center|LOCUS_13100 168062 168517 gene locus_tag LOCUS_13110 168062 168517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402238.1 protein_id gnl|my_center|LOCUS_13110 170213 168591 gene locus_tag LOCUS_13120 gene groL 170213 168591 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402236.1 protein_id gnl|my_center|LOCUS_13120 170654 170466 gene locus_tag LOCUS_13130 170654 170466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 170934 171341 gene locus_tag LOCUS_13140 170934 171341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 171549 171800 gene locus_tag LOCUS_13150 171549 171800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 171794 172195 gene locus_tag LOCUS_13160 171794 172195 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417998.1 protein_id gnl|my_center|LOCUS_13160 172338 173567 gene locus_tag LOCUS_13170 172338 173567 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876895.1 protein_id gnl|my_center|LOCUS_13170 173652 174374 gene locus_tag LOCUS_13180 173652 174374 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402216.1 protein_id gnl|my_center|LOCUS_13180 174371 175231 gene locus_tag LOCUS_13190 gene pssA 174371 175231 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402213.1 protein_id gnl|my_center|LOCUS_13190 175228 177408 gene locus_tag LOCUS_13200 175228 177408 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402206.1 protein_id gnl|my_center|LOCUS_13200 177681 177427 gene locus_tag LOCUS_13210 177681 177427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 178936 177785 gene locus_tag LOCUS_13220 178936 177785 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900145.1 protein_id gnl|my_center|LOCUS_13220 179633 178917 gene locus_tag LOCUS_13230 179633 178917 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402198.1 protein_id gnl|my_center|LOCUS_13230 180160 179690 gene locus_tag LOCUS_13240 180160 179690 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898448.1 protein_id gnl|my_center|LOCUS_13240 180529 180233 gene locus_tag LOCUS_13250 180529 180233 CDS product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908621.1 protein_id gnl|my_center|LOCUS_13250 181086 181679 gene locus_tag LOCUS_13260 181086 181679 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402185.1 protein_id gnl|my_center|LOCUS_13260 181901 182806 gene locus_tag LOCUS_13270 181901 182806 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402176.1 protein_id gnl|my_center|LOCUS_13270 182973 183425 gene locus_tag LOCUS_13280 182973 183425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 183475 187944 gene locus_tag LOCUS_13290 183475 187944 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904400.1 protein_id gnl|my_center|LOCUS_13290 187994 188269 gene locus_tag LOCUS_13300 187994 188269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402157.1 protein_id gnl|my_center|LOCUS_13300 190293 188641 gene locus_tag LOCUS_13310 gene tnpB 190293 188641 CDS product IS607 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404761.1 protein_id gnl|my_center|LOCUS_13310 190559 190290 gene locus_tag LOCUS_13320 190559 190290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 190846 190586 gene locus_tag LOCUS_13330 190846 190586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 191100 190840 gene locus_tag LOCUS_13340 191100 190840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 193139 192117 gene locus_tag LOCUS_13350 gene gnd 193139 192117 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405880.1 protein_id gnl|my_center|LOCUS_13350 193505 193269 gene locus_tag LOCUS_13360 193505 193269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 193598 194422 gene locus_tag LOCUS_13370 193598 194422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 194583 194374 gene locus_tag LOCUS_13380 194583 194374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 194616 195311 gene locus_tag LOCUS_13390 194616 195311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898734.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 195464 197209 gene locus_tag LOCUS_13400 195464 197209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 197569 197246 gene locus_tag LOCUS_13410 197569 197246 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405871.1 protein_id gnl|my_center|LOCUS_13410 198174 197686 gene locus_tag LOCUS_13420 198174 197686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 199137 198748 gene locus_tag LOCUS_13430 199137 198748 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405865.1 protein_id gnl|my_center|LOCUS_13430 199334 199134 gene locus_tag LOCUS_13440 199334 199134 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_13440 200627 199536 gene locus_tag LOCUS_13450 gene ychF 200627 199536 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898732.1 protein_id gnl|my_center|LOCUS_13450 200825 201958 gene locus_tag LOCUS_13460 200825 201958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492561.1 protein_id gnl|my_center|LOCUS_13460 202959 201961 gene locus_tag LOCUS_13470 202959 201961 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405853.1 protein_id gnl|my_center|LOCUS_13470 203049 203672 gene locus_tag LOCUS_13480 203049 203672 CDS product lipid droplet-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898730.1 protein_id gnl|my_center|LOCUS_13480 203669 204925 gene locus_tag LOCUS_13490 gene xseA 203669 204925 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405846.1 protein_id gnl|my_center|LOCUS_13490 204915 205187 gene locus_tag LOCUS_13500 204915 205187 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405844.1 protein_id gnl|my_center|LOCUS_13500 205251 206393 gene locus_tag LOCUS_13510 205251 206393 CDS product 3 beta-hydroxysteroid dehydrogenase/delta 5-->4-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405840.1 protein_id gnl|my_center|LOCUS_13510 206539 206291 gene locus_tag LOCUS_13520 206539 206291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 206511 207599 gene locus_tag LOCUS_13530 206511 207599 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898727.1 protein_id gnl|my_center|LOCUS_13530 208252 207605 gene locus_tag LOCUS_13540 208252 207605 CDS product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405815.1 protein_id gnl|my_center|LOCUS_13540 208321 209409 gene locus_tag LOCUS_13550 gene glpX 208321 209409 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898726.1 protein_id gnl|my_center|LOCUS_13550 209434 210855 gene locus_tag LOCUS_13560 209434 210855 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405805.1 protein_id gnl|my_center|LOCUS_13560 211094 212047 gene locus_tag LOCUS_13570 211094 212047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405804.1 protein_id gnl|my_center|LOCUS_13570 212986 212111 gene locus_tag LOCUS_13580 212986 212111 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898725.1 protein_id gnl|my_center|LOCUS_13580 214314 213013 gene locus_tag LOCUS_13590 214314 213013 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405802.1 protein_id gnl|my_center|LOCUS_13590 215349 214522 gene locus_tag LOCUS_13600 215349 214522 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405801.1 protein_id gnl|my_center|LOCUS_13600 216763 215483 gene locus_tag LOCUS_13610 216763 215483 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916776.1 protein_id gnl|my_center|LOCUS_13610 216902 217840 gene locus_tag LOCUS_13620 gene coaA 216902 217840 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405790.1 protein_id gnl|my_center|LOCUS_13620 221491 217880 gene locus_tag LOCUS_13630 221491 217880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 222296 221883 gene locus_tag LOCUS_13640 222296 221883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730420.1 protein_id gnl|my_center|LOCUS_13640 223388 222411 gene locus_tag LOCUS_13650 223388 222411 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169618726.1 protein_id gnl|my_center|LOCUS_13650 223844 223566 gene locus_tag LOCUS_13660 223844 223566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 226800 224068 gene locus_tag LOCUS_13670 226800 224068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13670 227425 227123 gene locus_tag LOCUS_13680 227425 227123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 228216 227422 gene locus_tag LOCUS_13690 228216 227422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13690 228920 228378 gene locus_tag LOCUS_13700 228920 228378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 229909 229121 gene locus_tag LOCUS_13710 229909 229121 CDS product (2Z,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903314.1 protein_id gnl|my_center|LOCUS_13710 230057 230797 gene locus_tag LOCUS_13720 230057 230797 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901993.1 protein_id gnl|my_center|LOCUS_13720 232895 230856 gene locus_tag LOCUS_13730 232895 230856 CDS product DUF255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405750.1 protein_id gnl|my_center|LOCUS_13730 233148 232882 gene locus_tag LOCUS_13740 233148 232882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405749.1 protein_id gnl|my_center|LOCUS_13740 234017 233145 gene locus_tag LOCUS_13750 gene mca 234017 233145 CDS product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405746.1 protein_id gnl|my_center|LOCUS_13750 234105 234539 gene locus_tag LOCUS_13760 234105 234539 CDS product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405744.1 protein_id gnl|my_center|LOCUS_13760 234767 235261 gene locus_tag LOCUS_13770 gene greA 234767 235261 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405742.1 protein_id gnl|my_center|LOCUS_13770 236498 235314 gene locus_tag LOCUS_13780 236498 235314 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405736.1 protein_id gnl|my_center|LOCUS_13780 237247 236540 gene locus_tag LOCUS_13790 237247 236540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 238747 237353 gene locus_tag LOCUS_13800 238747 237353 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405730.1 protein_id gnl|my_center|LOCUS_13800 239894 238818 gene locus_tag LOCUS_13810 239894 238818 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769636.1 protein_id gnl|my_center|LOCUS_13810 240116 241063 gene locus_tag LOCUS_13820 240116 241063 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405726.1 protein_id gnl|my_center|LOCUS_13820 241141 242358 gene locus_tag LOCUS_13830 241141 242358 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405724.1 protein_id gnl|my_center|LOCUS_13830 242580 242410 gene locus_tag LOCUS_13840 242580 242410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13840 243262 242855 gene locus_tag LOCUS_13850 243262 242855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13850 244205 243366 gene locus_tag LOCUS_13860 244205 243366 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405719.1 protein_id gnl|my_center|LOCUS_13860 244407 245444 gene locus_tag LOCUS_13870 244407 245444 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405716.1 protein_id gnl|my_center|LOCUS_13870 245456 246229 gene locus_tag LOCUS_13880 245456 246229 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405712.1 protein_id gnl|my_center|LOCUS_13880 246226 247995 gene locus_tag LOCUS_13890 246226 247995 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405708.1 protein_id gnl|my_center|LOCUS_13890 248379 247984 gene locus_tag LOCUS_13900 248379 247984 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405651.1 protein_id gnl|my_center|LOCUS_13900 248918 248376 gene locus_tag LOCUS_13910 248918 248376 CDS product cysteine dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405649.1 protein_id gnl|my_center|LOCUS_13910 249254 250273 gene locus_tag LOCUS_13920 249254 250273 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405642.1 protein_id gnl|my_center|LOCUS_13920 250871 250398 gene locus_tag LOCUS_13930 250871 250398 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405633.1 protein_id gnl|my_center|LOCUS_13930 252026 250968 gene locus_tag LOCUS_13940 252026 250968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405629.1 protein_id gnl|my_center|LOCUS_13940 253736 252105 gene locus_tag LOCUS_13950 253736 252105 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405625.1 protein_id gnl|my_center|LOCUS_13950 254995 253844 gene locus_tag LOCUS_13960 254995 253844 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405622.1 protein_id gnl|my_center|LOCUS_13960 256703 255432 gene locus_tag LOCUS_13970 256703 255432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 256718 256643 gene locus_tag LOCUS_t00200 256718 256643 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 257048 256767 gene locus_tag LOCUS_13980 257048 256767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 257140 256958 gene locus_tag LOCUS_13990 257140 256958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 257349 257819 gene locus_tag LOCUS_14000 257349 257819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14000 257871 258539 gene locus_tag LOCUS_14010 257871 258539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14010 258536 258706 gene locus_tag LOCUS_14020 258536 258706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 258707 258871 gene locus_tag LOCUS_14030 258707 258871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 259121 260545 gene locus_tag LOCUS_14040 259121 260545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 261363 261130 gene locus_tag LOCUS_14050 261363 261130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14050 >Feature sequence28 714 1607 gene locus_tag LOCUS_14060 714 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1930 1580 gene locus_tag LOCUS_14070 1930 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2625 2293 gene locus_tag LOCUS_14080 2625 2293 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406566.1 protein_id gnl|my_center|LOCUS_14080 4628 2721 gene locus_tag LOCUS_14090 4628 2721 CDS product fatty acid ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406569.1 protein_id gnl|my_center|LOCUS_14090 6367 4625 gene locus_tag LOCUS_14100 6367 4625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406574.1 protein_id gnl|my_center|LOCUS_14100 6525 7082 gene locus_tag LOCUS_14110 6525 7082 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406577.1 protein_id gnl|my_center|LOCUS_14110 7088 7621 gene locus_tag LOCUS_14120 7088 7621 CDS product DUF3558 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900308.1 protein_id gnl|my_center|LOCUS_14120 8026 7820 gene locus_tag LOCUS_14130 8026 7820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 8100 10319 gene locus_tag LOCUS_14140 8100 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 10847 10335 gene locus_tag LOCUS_14150 10847 10335 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406581.1 protein_id gnl|my_center|LOCUS_14150 11246 11100 gene locus_tag LOCUS_14160 11246 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 11395 11243 gene locus_tag LOCUS_14170 11395 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 11617 12768 gene locus_tag LOCUS_14180 11617 12768 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406584.1 protein_id gnl|my_center|LOCUS_14180 12765 15392 gene locus_tag LOCUS_14190 12765 15392 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898806.1 protein_id gnl|my_center|LOCUS_14190 15410 16999 gene locus_tag LOCUS_14200 15410 16999 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406598.1 protein_id gnl|my_center|LOCUS_14200 17319 17699 gene locus_tag LOCUS_14210 17319 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14210 17751 18266 gene locus_tag LOCUS_14220 17751 18266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14220 19927 18236 gene locus_tag LOCUS_14230 gene oppA 19927 18236 CDS product oligopeptide ABC transporter substrate-binding protein OppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900310.1 protein_id gnl|my_center|LOCUS_14230 21785 19920 gene locus_tag LOCUS_14240 21785 19920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406602.1 protein_id gnl|my_center|LOCUS_14240 22684 21782 gene locus_tag LOCUS_14250 22684 21782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406607.1 protein_id gnl|my_center|LOCUS_14250 23709 22681 gene locus_tag LOCUS_14260 23709 22681 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406613.1 protein_id gnl|my_center|LOCUS_14260 24168 23944 gene locus_tag LOCUS_14270 24168 23944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 24071 25594 gene locus_tag LOCUS_14280 24071 25594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 25821 26372 gene locus_tag LOCUS_14290 gene canA 25821 26372 CDS product beta-carbonic anhydrase CanA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406616.1 protein_id gnl|my_center|LOCUS_14290 26532 27455 gene locus_tag LOCUS_14300 gene cysD 26532 27455 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911471.1 protein_id gnl|my_center|LOCUS_14300 27455 29308 gene locus_tag LOCUS_14310 gene cysC 27455 29308 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406621.1 protein_id gnl|my_center|LOCUS_14310 29305 30033 gene locus_tag LOCUS_14320 29305 30033 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730227.1 protein_id gnl|my_center|LOCUS_14320 30065 30547 gene locus_tag LOCUS_14330 30065 30547 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406624.1 protein_id gnl|my_center|LOCUS_14330 32493 30700 gene locus_tag LOCUS_14340 32493 30700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 32593 33060 gene locus_tag LOCUS_14350 32593 33060 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080323.1 protein_id gnl|my_center|LOCUS_14350 33092 33628 gene locus_tag LOCUS_14360 33092 33628 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229502.1 protein_id gnl|my_center|LOCUS_14360 35189 33753 gene locus_tag LOCUS_14370 35189 33753 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406627.1 protein_id gnl|my_center|LOCUS_14370 37084 35288 gene locus_tag LOCUS_14380 37084 35288 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030563.1 protein_id gnl|my_center|LOCUS_14380 37163 37822 gene locus_tag LOCUS_14390 37163 37822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 40676 37935 gene locus_tag LOCUS_14400 40676 37935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 40980 40906 gene locus_tag LOCUS_t00210 40980 40906 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41094 42746 gene locus_tag LOCUS_14410 gene argS 41094 42746 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406630.1 protein_id gnl|my_center|LOCUS_14410 42827 44161 gene locus_tag LOCUS_14420 gene lysA 42827 44161 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406632.1 protein_id gnl|my_center|LOCUS_14420 44165 45490 gene locus_tag LOCUS_14430 44165 45490 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406648.1 protein_id gnl|my_center|LOCUS_14430 45487 46569 gene locus_tag LOCUS_14440 gene thrC 45487 46569 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406652.1 protein_id gnl|my_center|LOCUS_14440 46569 47522 gene locus_tag LOCUS_14450 gene thrB 46569 47522 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618321.1 protein_id gnl|my_center|LOCUS_14450 47783 49576 gene locus_tag LOCUS_14460 gene rho 47783 49576 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898814.1 protein_id gnl|my_center|LOCUS_14460 49750 49992 gene locus_tag LOCUS_14470 gene rpmE 49750 49992 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406668.1 protein_id gnl|my_center|LOCUS_14470 50091 51164 gene locus_tag LOCUS_14480 gene prfA 50091 51164 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406670.1 protein_id gnl|my_center|LOCUS_14480 51164 52093 gene locus_tag LOCUS_14490 51164 52093 CDS product HemK/PrmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911420.1 protein_id gnl|my_center|LOCUS_14490 52191 52844 gene locus_tag LOCUS_14500 52191 52844 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898815.1 protein_id gnl|my_center|LOCUS_14500 52945 54138 gene locus_tag LOCUS_14510 gene rfe 52945 54138 CDS product UDP-N-acetylglucosamine--decaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898816.1 protein_id gnl|my_center|LOCUS_14510 54419 54895 gene locus_tag LOCUS_14520 54419 54895 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406680.1 protein_id gnl|my_center|LOCUS_14520 54888 55640 gene locus_tag LOCUS_14530 gene atpB 54888 55640 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406681.1 protein_id gnl|my_center|LOCUS_14530 55691 55936 gene locus_tag LOCUS_14540 55691 55936 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406686.1 protein_id gnl|my_center|LOCUS_14540 55969 56493 gene locus_tag LOCUS_14550 55969 56493 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898818.1 protein_id gnl|my_center|LOCUS_14550 56501 57841 gene locus_tag LOCUS_14560 56501 57841 CDS product F0F1 ATP synthase subunit B/delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406697.1 protein_id gnl|my_center|LOCUS_14560 57888 59537 gene locus_tag LOCUS_14570 gene atpA 57888 59537 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406699.1 protein_id gnl|my_center|LOCUS_14570 59556 60467 gene locus_tag LOCUS_14580 59556 60467 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898819.1 protein_id gnl|my_center|LOCUS_14580 60497 61951 gene locus_tag LOCUS_14590 gene atpD 60497 61951 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406701.1 protein_id gnl|my_center|LOCUS_14590 61983 62348 gene locus_tag LOCUS_14600 61983 62348 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406708.1 protein_id gnl|my_center|LOCUS_14600 62368 62799 gene locus_tag LOCUS_14610 62368 62799 CDS product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406722.1 protein_id gnl|my_center|LOCUS_14610 63423 62803 gene locus_tag LOCUS_14620 63423 62803 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406839.1 protein_id gnl|my_center|LOCUS_14620 63529 64749 gene locus_tag LOCUS_14630 gene murA 63529 64749 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406845.1 protein_id gnl|my_center|LOCUS_14630 65024 66553 gene locus_tag LOCUS_r00010 65024 66553 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 66845 69952 gene locus_tag LOCUS_r00020 66845 69952 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 70052 70127 gene locus_tag LOCUS_r00030 70052 70127 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 5S ribosomal RNA 70702 70205 gene locus_tag LOCUS_14640 gene ogt 70702 70205 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406857.1 protein_id gnl|my_center|LOCUS_14640 72207 70699 gene locus_tag LOCUS_14650 gene alkA 72207 70699 CDS product bifunctional regulatory protein/DNA repair enzyme AlkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900313.1 protein_id gnl|my_center|LOCUS_14650 73931 72306 gene locus_tag LOCUS_14660 73931 72306 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406864.1 protein_id gnl|my_center|LOCUS_14660 73976 74647 gene locus_tag LOCUS_14670 gene nucS 73976 74647 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886111.1 protein_id gnl|my_center|LOCUS_14670 75422 74967 gene locus_tag LOCUS_14680 gene mce 75422 74967 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406879.1 protein_id gnl|my_center|LOCUS_14680 75504 76685 gene locus_tag LOCUS_14690 75504 76685 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898824.1 protein_id gnl|my_center|LOCUS_14690 76844 77725 gene locus_tag LOCUS_14700 76844 77725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14700 77686 77871 gene locus_tag LOCUS_14710 77686 77871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14710 77877 78008 gene locus_tag LOCUS_14720 77877 78008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14720 79850 78036 gene locus_tag LOCUS_14730 79850 78036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 80176 80409 gene locus_tag LOCUS_14740 80176 80409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14740 80443 80817 gene locus_tag LOCUS_14750 80443 80817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14750 80655 80661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 82360 80861 gene locus_tag LOCUS_14760 82360 80861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 84723 82516 gene locus_tag LOCUS_14770 gene glgB 84723 82516 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406892.1 protein_id gnl|my_center|LOCUS_14770 84648 84732 gene locus_tag LOCUS_t00220 84648 84732 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 86814 84730 gene locus_tag LOCUS_14780 gene glgE 86814 84730 CDS product alpha-1,4-glucan:maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406897.1 protein_id gnl|my_center|LOCUS_14780 86949 89534 gene locus_tag LOCUS_14790 86949 89534 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901135.1 protein_id gnl|my_center|LOCUS_14790 91497 89521 gene locus_tag LOCUS_14800 gene dinG 91497 89521 CDS product ATP-dependent helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898827.1 protein_id gnl|my_center|LOCUS_14800 92794 91538 gene locus_tag LOCUS_14810 92794 91538 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911483.1 protein_id gnl|my_center|LOCUS_14810 92961 93266 gene locus_tag LOCUS_14820 gene clpS 92961 93266 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406906.1 protein_id gnl|my_center|LOCUS_14820 93292 93879 gene locus_tag LOCUS_14830 93292 93879 CDS product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898829.1 protein_id gnl|my_center|LOCUS_14830 93890 94930 gene locus_tag LOCUS_14840 93890 94930 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406908.1 protein_id gnl|my_center|LOCUS_14840 94927 95382 gene locus_tag LOCUS_14850 gene mec 94927 95382 CDS product CysO-cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898830.1 protein_id gnl|my_center|LOCUS_14850 95393 95674 gene locus_tag LOCUS_14860 gene cysO 95393 95674 CDS product sulfur carrier protein CysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406910.1 protein_id gnl|my_center|LOCUS_14860 95684 96655 gene locus_tag LOCUS_14870 gene cysM 95684 96655 CDS product O-phosphoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406912.1 protein_id gnl|my_center|LOCUS_14870 96646 97317 gene locus_tag LOCUS_14880 96646 97317 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898831.1 protein_id gnl|my_center|LOCUS_14880 97314 98129 gene locus_tag LOCUS_14890 gene murI 97314 98129 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406919.1 protein_id gnl|my_center|LOCUS_14890 98201 98980 gene locus_tag LOCUS_14900 98201 98980 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406922.1 protein_id gnl|my_center|LOCUS_14900 99013 99792 gene locus_tag LOCUS_14910 gene rph 99013 99792 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406926.1 protein_id gnl|my_center|LOCUS_14910 99846 100388 gene locus_tag LOCUS_14920 gene rdgB 99846 100388 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406931.1 protein_id gnl|my_center|LOCUS_14920 100735 100385 gene locus_tag LOCUS_14930 100735 100385 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908182.1 protein_id gnl|my_center|LOCUS_14930 101124 100732 gene locus_tag LOCUS_14940 101124 100732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898833.1 protein_id gnl|my_center|LOCUS_14940 101892 101149 gene locus_tag LOCUS_14950 101892 101149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 101982 102069 gene locus_tag LOCUS_t00230 101982 102069 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 102126 102266 gene locus_tag LOCUS_14960 102126 102266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 102600 102283 gene locus_tag LOCUS_14970 102600 102283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 102763 103446 gene locus_tag LOCUS_14980 gene fabG 102763 103446 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406963.1 protein_id gnl|my_center|LOCUS_14980 103636 103920 gene locus_tag LOCUS_14990 103636 103920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 104005 104370 gene locus_tag LOCUS_15000 104005 104370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406967.1 protein_id gnl|my_center|LOCUS_15000 104706 105833 gene locus_tag LOCUS_15010 104706 105833 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898842.1 protein_id gnl|my_center|LOCUS_15010 107096 106428 gene locus_tag LOCUS_15020 107096 106428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407152.1 protein_id gnl|my_center|LOCUS_15020 107878 107093 gene locus_tag LOCUS_15030 107878 107093 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407157.1 protein_id gnl|my_center|LOCUS_15030 110244 108280 gene locus_tag LOCUS_15040 110244 108280 CDS product sigma-F factor regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950533.1 protein_id gnl|my_center|LOCUS_15040 110767 110381 gene locus_tag LOCUS_15050 110767 110381 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413657.1 protein_id gnl|my_center|LOCUS_15050 111545 111811 gene locus_tag LOCUS_15060 111545 111811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 112684 112121 gene locus_tag LOCUS_15070 112684 112121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275369.1 protein_id gnl|my_center|LOCUS_15070 113104 112748 gene locus_tag LOCUS_15080 113104 112748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 113258 114022 gene locus_tag LOCUS_15090 113258 114022 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407164.1 protein_id gnl|my_center|LOCUS_15090 114015 114251 gene locus_tag LOCUS_15100 114015 114251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907641.1 protein_id gnl|my_center|LOCUS_15100 114631 115149 gene locus_tag LOCUS_15110 114631 115149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 115079 115098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 115149 115601 gene locus_tag LOCUS_15120 115149 115601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 115980 117209 gene locus_tag LOCUS_15130 gene istA 115980 117209 CDS product IS21-like element ISMbo1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414864.1 protein_id gnl|my_center|LOCUS_15130 117209 118009 gene locus_tag LOCUS_15140 117209 118009 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 protein_id gnl|my_center|LOCUS_15140 119189 118521 gene locus_tag LOCUS_15150 119189 118521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 120032 119391 gene locus_tag LOCUS_15160 120032 119391 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417146.1 protein_id gnl|my_center|LOCUS_15160 120259 120029 gene locus_tag LOCUS_15170 120259 120029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15170 122048 120408 gene locus_tag LOCUS_15180 122048 120408 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417136.1 protein_id gnl|my_center|LOCUS_15180 122105 122908 gene locus_tag LOCUS_15190 122105 122908 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417133.1 protein_id gnl|my_center|LOCUS_15190 122961 123191 gene locus_tag LOCUS_15200 122961 123191 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402915.1 protein_id gnl|my_center|LOCUS_15200 123188 123598 gene locus_tag LOCUS_15210 123188 123598 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898500.1 protein_id gnl|my_center|LOCUS_15210 123653 124171 gene locus_tag LOCUS_15220 123653 124171 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417130.1 protein_id gnl|my_center|LOCUS_15220 124800 124126 gene locus_tag LOCUS_15230 124800 124126 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899998.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15230 124990 126165 gene locus_tag LOCUS_15240 124990 126165 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417126.1 protein_id gnl|my_center|LOCUS_15240 126162 126677 gene locus_tag LOCUS_15250 gene purE 126162 126677 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417123.1 protein_id gnl|my_center|LOCUS_15250 126691 127860 gene locus_tag LOCUS_15260 126691 127860 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417122.1 protein_id gnl|my_center|LOCUS_15260 130067 127824 gene locus_tag LOCUS_15270 130067 127824 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417121.1 protein_id gnl|my_center|LOCUS_15270 131582 130404 gene locus_tag LOCUS_15280 131582 130404 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417120.1 protein_id gnl|my_center|LOCUS_15280 131687 132343 gene locus_tag LOCUS_15290 131687 132343 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417119.1 protein_id gnl|my_center|LOCUS_15290 134542 132356 gene locus_tag LOCUS_15300 gene ctpC 134542 132356 CDS product manganese-exporting P-type ATPase CtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899995.1 protein_id gnl|my_center|LOCUS_15300 134829 134548 gene locus_tag LOCUS_15310 134829 134548 CDS product DUF1490 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417115.1 protein_id gnl|my_center|LOCUS_15310 136417 134948 gene locus_tag LOCUS_15320 gene lcp1 136417 134948 CDS product phosphotransferase Lcp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417107.1 protein_id gnl|my_center|LOCUS_15320 136444 137421 gene locus_tag LOCUS_15330 gene rfbD 136444 137421 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417101.1 protein_id gnl|my_center|LOCUS_15330 137414 138343 gene locus_tag LOCUS_15340 gene wbbL 137414 138343 CDS product N-acetylglucosaminyl-diphospho-decaprenol L-rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901582.1 protein_id gnl|my_center|LOCUS_15340 138345 139421 gene locus_tag LOCUS_15350 138345 139421 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907907.1 protein_id gnl|my_center|LOCUS_15350 139742 140158 gene locus_tag LOCUS_15360 139742 140158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 140692 140165 gene locus_tag LOCUS_15370 140692 140165 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727936.1 protein_id gnl|my_center|LOCUS_15370 142320 140731 gene locus_tag LOCUS_15380 142320 140731 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417095.1 protein_id gnl|my_center|LOCUS_15380 143663 142317 gene locus_tag LOCUS_15390 143663 142317 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900663.1 protein_id gnl|my_center|LOCUS_15390 144643 143660 gene locus_tag LOCUS_15400 gene cofD 144643 143660 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417087.1 protein_id gnl|my_center|LOCUS_15400 144545 144814 gene locus_tag LOCUS_15410 144545 144814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 144978 145349 gene locus_tag LOCUS_15420 144978 145349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 145805 145386 gene locus_tag LOCUS_15430 145805 145386 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417076.1 protein_id gnl|my_center|LOCUS_15430 146036 146434 gene locus_tag LOCUS_15440 146036 146434 CDS product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197492465.1 protein_id gnl|my_center|LOCUS_15440 146528 147925 gene locus_tag LOCUS_15450 146528 147925 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901581.1 protein_id gnl|my_center|LOCUS_15450 147922 149019 gene locus_tag LOCUS_15460 147922 149019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907917.1 protein_id gnl|my_center|LOCUS_15460 149028 150254 gene locus_tag LOCUS_15470 gene manA 149028 150254 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417054.1 protein_id gnl|my_center|LOCUS_15470 151644 150232 gene locus_tag LOCUS_15480 151644 150232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899988.1 protein_id gnl|my_center|LOCUS_15480 151610 153220 gene locus_tag LOCUS_15490 151610 153220 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417049.1 protein_id gnl|my_center|LOCUS_15490 153329 154576 gene locus_tag LOCUS_15500 153329 154576 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417047.1 protein_id gnl|my_center|LOCUS_15500 154573 154746 gene locus_tag LOCUS_15510 154573 154746 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417045.1 protein_id gnl|my_center|LOCUS_15510 154757 154939 gene locus_tag LOCUS_15520 gene rubB 154757 154939 CDS product rubredoxin RubB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417044.1 protein_id gnl|my_center|LOCUS_15520 154936 155571 gene locus_tag LOCUS_15530 154936 155571 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417042.1 protein_id gnl|my_center|LOCUS_15530 155684 157171 gene locus_tag LOCUS_15540 gene ahcY 155684 157171 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417039.1 protein_id gnl|my_center|LOCUS_15540 157182 157838 gene locus_tag LOCUS_15550 157182 157838 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907920.1 protein_id gnl|my_center|LOCUS_15550 157954 158616 gene locus_tag LOCUS_15560 gene mtrA 157954 158616 CDS product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007168097.1 protein_id gnl|my_center|LOCUS_15560 158696 160306 gene locus_tag LOCUS_15570 gene mtrB 158696 160306 CDS product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416988.1 protein_id gnl|my_center|LOCUS_15570 160306 162072 gene locus_tag LOCUS_15580 gene lpqB 160306 162072 CDS product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618314.1 protein_id gnl|my_center|LOCUS_15580 162138 162980 gene locus_tag LOCUS_15590 162138 162980 CDS product LmeA family phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416966.1 protein_id gnl|my_center|LOCUS_15590 162977 163651 gene locus_tag LOCUS_15600 162977 163651 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881065.1 protein_id gnl|my_center|LOCUS_15600 163951 164682 gene locus_tag LOCUS_15610 gene raiA 163951 164682 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901577.1 protein_id gnl|my_center|LOCUS_15610 164759 167605 gene locus_tag LOCUS_15620 gene secA 164759 167605 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901576.1 protein_id gnl|my_center|LOCUS_15620 167665 168147 gene locus_tag LOCUS_15630 167665 168147 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899982.1 protein_id gnl|my_center|LOCUS_15630 168152 169297 gene locus_tag LOCUS_15640 168152 169297 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907929.1 protein_id gnl|my_center|LOCUS_15640 169660 169313 gene locus_tag LOCUS_15650 169660 169313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 169997 171499 gene locus_tag LOCUS_15660 169997 171499 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416930.1 protein_id gnl|my_center|LOCUS_15660 171541 172407 gene locus_tag LOCUS_15670 gene ppk2 171541 172407 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416928.1 protein_id gnl|my_center|LOCUS_15670 172418 172918 gene locus_tag LOCUS_15680 172418 172918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416925.1 protein_id gnl|my_center|LOCUS_15680 173022 174182 gene locus_tag LOCUS_15690 173022 174182 CDS product NADPH oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416922.1 protein_id gnl|my_center|LOCUS_15690 174256 175524 gene locus_tag LOCUS_15700 174256 175524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 176473 175481 gene locus_tag LOCUS_15710 gene rsgA 176473 175481 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416916.1 protein_id gnl|my_center|LOCUS_15710 177765 176470 gene locus_tag LOCUS_15720 gene aroA 177765 176470 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950853.1 protein_id gnl|my_center|LOCUS_15720 177820 178593 gene locus_tag LOCUS_15730 177820 178593 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416907.1 protein_id gnl|my_center|LOCUS_15730 179538 178648 gene locus_tag LOCUS_15740 179538 178648 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_15740 179966 179538 gene locus_tag LOCUS_15750 179966 179538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 180828 179980 gene locus_tag LOCUS_15760 180828 179980 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416899.1 protein_id gnl|my_center|LOCUS_15760 181011 181721 gene locus_tag LOCUS_15770 gene sigH 181011 181721 CDS product sigma-70 family RNA polymerase sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416897.1 protein_id gnl|my_center|LOCUS_15770 181718 182032 gene locus_tag LOCUS_15780 gene rsrA 181718 182032 CDS product mycothiol system anti-sigma-R factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416891.1 protein_id gnl|my_center|LOCUS_15780 182312 182527 gene locus_tag LOCUS_15790 182312 182527 CDS product biotin/lipoyl-binding carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416887.1 protein_id gnl|my_center|LOCUS_15790 182582 184084 gene locus_tag LOCUS_15800 182582 184084 CDS product histidine kinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416886.1 protein_id gnl|my_center|LOCUS_15800 184402 184148 gene locus_tag LOCUS_15810 gene whiB1 184402 184148 CDS product transcriptional regulator WhiB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416884.1 protein_id gnl|my_center|LOCUS_15810 185663 184683 gene locus_tag LOCUS_15820 185663 184683 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416883.1 protein_id gnl|my_center|LOCUS_15820 186104 186535 gene locus_tag LOCUS_15830 186104 186535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416881.1 protein_id gnl|my_center|LOCUS_15830 186969 186487 gene locus_tag LOCUS_15840 186969 186487 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015288476.1 protein_id gnl|my_center|LOCUS_15840 188066 186966 gene locus_tag LOCUS_15850 188066 186966 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416879.1 protein_id gnl|my_center|LOCUS_15850 188709 188119 gene locus_tag LOCUS_15860 188709 188119 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416878.1 protein_id gnl|my_center|LOCUS_15860 188786 189586 gene locus_tag LOCUS_15870 188786 189586 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901572.1 protein_id gnl|my_center|LOCUS_15870 190892 189669 gene locus_tag LOCUS_15880 190892 189669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416876.1 protein_id gnl|my_center|LOCUS_15880 192454 190904 gene locus_tag LOCUS_15890 192454 190904 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416875.1 protein_id gnl|my_center|LOCUS_15890 192741 193436 gene locus_tag LOCUS_15900 192741 193436 CDS product ferritin-like fold-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416873.1 protein_id gnl|my_center|LOCUS_15900 194443 193700 gene locus_tag LOCUS_15910 194443 193700 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416868.1 protein_id gnl|my_center|LOCUS_15910 194627 194893 gene locus_tag LOCUS_15920 194627 194893 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416863.1 protein_id gnl|my_center|LOCUS_15920 195566 194865 gene locus_tag LOCUS_15930 195566 194865 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416861.1 protein_id gnl|my_center|LOCUS_15930 195778 196785 gene locus_tag LOCUS_15940 195778 196785 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907946.1 protein_id gnl|my_center|LOCUS_15940 197073 198251 gene locus_tag LOCUS_15950 gene moeZ 197073 198251 CDS product adenylyltransferase/sulfurtransferase MoeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416855.1 protein_id gnl|my_center|LOCUS_15950 198291 199226 gene locus_tag LOCUS_15960 198291 199226 CDS product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899969.1 protein_id gnl|my_center|LOCUS_15960 199549 199244 gene locus_tag LOCUS_15970 199549 199244 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416847.1 protein_id gnl|my_center|LOCUS_15970 200337 199537 gene locus_tag LOCUS_15980 gene lipV 200337 199537 CDS product lipase LipV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899968.1 protein_id gnl|my_center|LOCUS_15980 200615 200403 gene locus_tag LOCUS_15990 200615 200403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907005.1 protein_id gnl|my_center|LOCUS_15990 200852 201274 gene locus_tag LOCUS_16000 gene hsp18 200852 201274 CDS product molecular chaperone Hsp18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908539.1 protein_id gnl|my_center|LOCUS_16000 201362 201679 gene locus_tag LOCUS_16010 201362 201679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 201765 204926 gene locus_tag LOCUS_16020 gene adnA 201765 204926 CDS product ATP-dependent DNA helicase AdnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905015.1 protein_id gnl|my_center|LOCUS_16020 204923 208249 gene locus_tag LOCUS_16030 gene adnB 204923 208249 CDS product ATP-dependent DNA helicase AdnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728029.1 protein_id gnl|my_center|LOCUS_16030 208312 209388 gene locus_tag LOCUS_16040 208312 209388 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416831.1 protein_id gnl|my_center|LOCUS_16040 209397 210320 gene locus_tag LOCUS_16050 gene nudC 209397 210320 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416829.1 protein_id gnl|my_center|LOCUS_16050 210865 210332 gene locus_tag LOCUS_16060 210865 210332 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404362.1 protein_id gnl|my_center|LOCUS_16060 210816 211085 gene locus_tag LOCUS_16070 210816 211085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 211343 211089 gene locus_tag LOCUS_16080 gene mrx1 211343 211089 CDS product mycoredoxin Mrx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416827.1 protein_id gnl|my_center|LOCUS_16080 211417 213558 gene locus_tag LOCUS_16090 gene uvrD2 211417 213558 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416822.1 protein_id gnl|my_center|LOCUS_16090 213700 213858 gene locus_tag LOCUS_16100 213700 213858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 214013 214276 gene locus_tag LOCUS_16110 gene whiB7 214013 214276 CDS product transcriptional regulator WhiB7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899963.1 protein_id gnl|my_center|LOCUS_16110 215626 214283 gene locus_tag LOCUS_16120 215626 214283 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416815.1 protein_id gnl|my_center|LOCUS_16120 215803 215976 gene locus_tag LOCUS_16130 215803 215976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416812.1 protein_id gnl|my_center|LOCUS_16130 216849 215995 gene locus_tag LOCUS_16140 216849 215995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416809.1 protein_id gnl|my_center|LOCUS_16140 218255 216888 gene locus_tag LOCUS_16150 218255 216888 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416804.1 protein_id gnl|my_center|LOCUS_16150 218463 218260 gene locus_tag LOCUS_16160 218463 218260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 218378 219376 gene locus_tag LOCUS_16170 218378 219376 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416799.1 protein_id gnl|my_center|LOCUS_16170 219516 222443 gene locus_tag LOCUS_16180 219516 222443 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416795.1 protein_id gnl|my_center|LOCUS_16180 222614 222690 gene locus_tag LOCUS_t00240 222614 222690 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 223276 222824 gene locus_tag LOCUS_16190 223276 222824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 223454 223218 gene locus_tag LOCUS_16200 223454 223218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 223654 223881 gene locus_tag LOCUS_16210 223654 223881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 225468 223972 gene locus_tag LOCUS_16220 225468 223972 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082592.1 protein_id gnl|my_center|LOCUS_16220 225538 226296 gene locus_tag LOCUS_16230 225538 226296 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095681.1 protein_id gnl|my_center|LOCUS_16230 226519 226280 gene locus_tag LOCUS_16240 226519 226280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 226640 227614 gene locus_tag LOCUS_16250 226640 227614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416610.1 protein_id gnl|my_center|LOCUS_16250 228937 227609 gene locus_tag LOCUS_16260 228937 227609 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_16260 230113 228998 gene locus_tag LOCUS_16270 230113 228998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_16270 231249 230113 gene locus_tag LOCUS_16280 231249 230113 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900650.1 protein_id gnl|my_center|LOCUS_16280 231294 231929 gene locus_tag LOCUS_16290 231294 231929 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416599.1 protein_id gnl|my_center|LOCUS_16290 232076 233011 gene locus_tag LOCUS_16300 232076 233011 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900649.1 protein_id gnl|my_center|LOCUS_16300 233008 233490 gene locus_tag LOCUS_16310 233008 233490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416593.1 protein_id gnl|my_center|LOCUS_16310 233506 234474 gene locus_tag LOCUS_16320 233506 234474 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416588.1 protein_id gnl|my_center|LOCUS_16320 234482 235738 gene locus_tag LOCUS_16330 234482 235738 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416584.1 protein_id gnl|my_center|LOCUS_16330 235783 236187 gene locus_tag LOCUS_16340 235783 236187 CDS product integral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900648.1 protein_id gnl|my_center|LOCUS_16340 236242 236514 gene locus_tag LOCUS_16350 236242 236514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 236525 237112 gene locus_tag LOCUS_16360 236525 237112 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416573.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence29 2301 922 gene locus_tag LOCUS_16370 2301 922 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412200.1 protein_id gnl|my_center|LOCUS_16370 2511 2915 gene locus_tag LOCUS_16380 2511 2915 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412205.1 protein_id gnl|my_center|LOCUS_16380 3001 3393 gene locus_tag LOCUS_16390 gene zur 3001 3393 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903860.1 protein_id gnl|my_center|LOCUS_16390 3994 3548 gene locus_tag LOCUS_16400 3994 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906807.1 protein_id gnl|my_center|LOCUS_16400 4887 3994 gene locus_tag LOCUS_16410 4887 3994 CDS product decaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412212.1 protein_id gnl|my_center|LOCUS_16410 5678 4890 gene locus_tag LOCUS_16420 gene recO 5678 4890 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412222.1 protein_id gnl|my_center|LOCUS_16420 5740 7194 gene locus_tag LOCUS_16430 5740 7194 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412223.1 protein_id gnl|my_center|LOCUS_16430 8108 7191 gene locus_tag LOCUS_16440 gene era 8108 7191 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412224.1 protein_id gnl|my_center|LOCUS_16440 8505 8155 gene locus_tag LOCUS_16450 8505 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412226.1 protein_id gnl|my_center|LOCUS_16450 9775 8468 gene locus_tag LOCUS_16460 9775 8468 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412229.1 protein_id gnl|my_center|LOCUS_16460 10320 9772 gene locus_tag LOCUS_16470 gene ybeY 10320 9772 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899292.1 protein_id gnl|my_center|LOCUS_16470 11370 10324 gene locus_tag LOCUS_16480 11370 10324 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412235.1 protein_id gnl|my_center|LOCUS_16480 12246 11485 gene locus_tag LOCUS_16490 12246 11485 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900509.1 protein_id gnl|my_center|LOCUS_16490 13416 12268 gene locus_tag LOCUS_16500 gene dnaJ 13416 12268 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899294.1 protein_id gnl|my_center|LOCUS_16500 14520 13489 gene locus_tag LOCUS_16510 gene hrcA 14520 13489 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412252.1 protein_id gnl|my_center|LOCUS_16510 14699 15013 gene locus_tag LOCUS_16520 14699 15013 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412258.1 protein_id gnl|my_center|LOCUS_16520 15132 16559 gene locus_tag LOCUS_16530 15132 16559 CDS product SagB family peptide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092398.1 protein_id gnl|my_center|LOCUS_16530 19996 16508 gene locus_tag LOCUS_16540 19996 16508 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110650.1 protein_id gnl|my_center|LOCUS_16540 24590 20037 gene locus_tag LOCUS_16550 24590 20037 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110647.1 protein_id gnl|my_center|LOCUS_16550 29605 24587 gene locus_tag LOCUS_16560 29605 24587 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110645.1 protein_id gnl|my_center|LOCUS_16560 30590 29652 gene locus_tag LOCUS_16570 30590 29652 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086043.1 protein_id gnl|my_center|LOCUS_16570 30762 31520 gene locus_tag LOCUS_16580 30762 31520 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080163.1 protein_id gnl|my_center|LOCUS_16580 31517 32833 gene locus_tag LOCUS_16590 31517 32833 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080165.1 protein_id gnl|my_center|LOCUS_16590 32846 35917 gene locus_tag LOCUS_16600 gene nbtC 32846 35917 CDS product nocobactin polyketide synthase NbtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110643.1 protein_id gnl|my_center|LOCUS_16600 36148 35933 gene locus_tag LOCUS_16610 36148 35933 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729883.1 protein_id gnl|my_center|LOCUS_16610 37415 36129 gene locus_tag LOCUS_16620 gene mbtG 37415 36129 CDS product NADPH-dependent L-lysine N(6)-monooxygenase MbtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899296.1 protein_id gnl|my_center|LOCUS_16620 37611 39251 gene locus_tag LOCUS_16630 gene mbtA 37611 39251 CDS product bifunctional salicyl-AMP ligase/salicyl-S-ArCP synthetase MbtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412282.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence30 1381 260 gene locus_tag LOCUS_16640 1381 260 CDS product type VII secretion system ESX-1 target PPE68 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399879.1 protein_id gnl|my_center|LOCUS_16640 1711 1415 gene locus_tag LOCUS_16650 1711 1415 CDS product type VII secretion system ESX-1 target PE35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912361.1 protein_id gnl|my_center|LOCUS_16650 3372 1927 gene locus_tag LOCUS_16660 gene eccB1 3372 1927 CDS product type VII secretion system ESX-1 subunit EccB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399854.1 protein_id gnl|my_center|LOCUS_16660 3567 3376 gene locus_tag LOCUS_16670 3567 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4201 3554 gene locus_tag LOCUS_16680 gene espH 4201 3554 CDS product type VII secretion system ESX-1 associated protein EspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399844.1 protein_id gnl|my_center|LOCUS_16680 5795 6853 gene locus_tag LOCUS_16690 5795 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6856 7164 gene locus_tag LOCUS_16700 6856 7164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence31 1859 846 gene locus_tag LOCUS_16710 gene ilvC 1859 846 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899581.1 protein_id gnl|my_center|LOCUS_16710 2385 1879 gene locus_tag LOCUS_16720 gene ilvN 2385 1879 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415167.1 protein_id gnl|my_center|LOCUS_16720 4241 2385 gene locus_tag LOCUS_16730 4241 2385 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415168.1 protein_id gnl|my_center|LOCUS_16730 4510 4896 gene locus_tag LOCUS_16740 4510 4896 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415170.1 protein_id gnl|my_center|LOCUS_16740 6148 5171 gene locus_tag LOCUS_16750 6148 5171 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415171.1 protein_id gnl|my_center|LOCUS_16750 6246 7367 gene locus_tag LOCUS_16760 6246 7367 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415173.1 protein_id gnl|my_center|LOCUS_16760 8058 7495 gene locus_tag LOCUS_16770 8058 7495 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415174.1 protein_id gnl|my_center|LOCUS_16770 9664 8144 gene locus_tag LOCUS_16780 gene gatB 9664 8144 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415248.1 protein_id gnl|my_center|LOCUS_16780 10725 9694 gene locus_tag LOCUS_16790 10725 9694 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908491.1 protein_id gnl|my_center|LOCUS_16790 12226 10745 gene locus_tag LOCUS_16800 gene gatA 12226 10745 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950812.1 protein_id gnl|my_center|LOCUS_16800 12522 12223 gene locus_tag LOCUS_16810 gene gatC 12522 12223 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415256.1 protein_id gnl|my_center|LOCUS_16810 12622 13263 gene locus_tag LOCUS_16820 12622 13263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901515.1 protein_id gnl|my_center|LOCUS_16820 13699 13271 gene locus_tag LOCUS_16830 13699 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 15796 13706 gene locus_tag LOCUS_16840 gene ligA 15796 13706 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415263.1 protein_id gnl|my_center|LOCUS_16840 16069 16578 gene locus_tag LOCUS_16850 16069 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16850 17597 16584 gene locus_tag LOCUS_16860 17597 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415268.1 protein_id gnl|my_center|LOCUS_16860 17691 18323 gene locus_tag LOCUS_16870 17691 18323 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415270.1 protein_id gnl|my_center|LOCUS_16870 18891 18601 gene locus_tag LOCUS_16880 18891 18601 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415340.1 protein_id gnl|my_center|LOCUS_16880 19218 18925 gene locus_tag LOCUS_16890 gene esxG 19218 18925 CDS product type VII secretion system protein EsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415342.1 protein_id gnl|my_center|LOCUS_16890 20572 19283 gene locus_tag LOCUS_16900 20572 19283 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910691.1 protein_id gnl|my_center|LOCUS_16900 20880 20569 gene locus_tag LOCUS_16910 20880 20569 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415766.1 protein_id gnl|my_center|LOCUS_16910 22245 21142 gene locus_tag LOCUS_16920 gene mnmA 22245 21142 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415909.1 protein_id gnl|my_center|LOCUS_16920 23424 22246 gene locus_tag LOCUS_16930 23424 22246 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415911.1 protein_id gnl|my_center|LOCUS_16930 24346 23501 gene locus_tag LOCUS_16940 24346 23501 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415914.1 protein_id gnl|my_center|LOCUS_16940 25206 24343 gene locus_tag LOCUS_16950 25206 24343 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900617.1 protein_id gnl|my_center|LOCUS_16950 26263 25307 gene locus_tag LOCUS_16960 26263 25307 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899889.1 protein_id gnl|my_center|LOCUS_16960 27139 26339 gene locus_tag LOCUS_16970 27139 26339 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415921.1 protein_id gnl|my_center|LOCUS_16970 27370 28170 gene locus_tag LOCUS_16980 27370 28170 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415922.1 protein_id gnl|my_center|LOCUS_16980 28167 29744 gene locus_tag LOCUS_16990 28167 29744 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899891.1 protein_id gnl|my_center|LOCUS_16990 29839 31083 gene locus_tag LOCUS_17000 29839 31083 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415928.1 protein_id gnl|my_center|LOCUS_17000 31286 31828 gene locus_tag LOCUS_17010 31286 31828 CDS product DUF4333 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415932.1 protein_id gnl|my_center|LOCUS_17010 32602 31865 gene locus_tag LOCUS_17020 32602 31865 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902399.1 protein_id gnl|my_center|LOCUS_17020 32759 34048 gene locus_tag LOCUS_17030 32759 34048 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180139.1 protein_id gnl|my_center|LOCUS_17030 34776 34090 gene locus_tag LOCUS_17040 34776 34090 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415939.1 protein_id gnl|my_center|LOCUS_17040 36098 34848 gene locus_tag LOCUS_17050 36098 34848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178125321.1 protein_id gnl|my_center|LOCUS_17050 37015 36032 gene locus_tag LOCUS_17060 37015 36032 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415941.1 protein_id gnl|my_center|LOCUS_17060 37790 37026 gene locus_tag LOCUS_17070 37790 37026 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415942.1 protein_id gnl|my_center|LOCUS_17070 38566 37787 gene locus_tag LOCUS_17080 38566 37787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415943.1 protein_id gnl|my_center|LOCUS_17080 39456 38611 gene locus_tag LOCUS_17090 39456 38611 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415944.1 protein_id gnl|my_center|LOCUS_17090 40780 39545 gene locus_tag LOCUS_17100 gene serB 40780 39545 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950818.1 protein_id gnl|my_center|LOCUS_17100 42567 40834 gene locus_tag LOCUS_17110 gene ctaD 42567 40834 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415946.1 protein_id gnl|my_center|LOCUS_17110 42843 43826 gene locus_tag LOCUS_17120 42843 43826 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415959.1 protein_id gnl|my_center|LOCUS_17120 43917 44957 gene locus_tag LOCUS_17130 43917 44957 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415965.1 protein_id gnl|my_center|LOCUS_17130 45320 44946 gene locus_tag LOCUS_17140 45320 44946 CDS product DUF3349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415968.1 protein_id gnl|my_center|LOCUS_17140 46463 45480 gene locus_tag LOCUS_17150 gene nrdF 46463 45480 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415973.1 protein_id gnl|my_center|LOCUS_17150 48190 46628 gene locus_tag LOCUS_17160 48190 46628 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899895.1 protein_id gnl|my_center|LOCUS_17160 49036 48311 gene locus_tag LOCUS_17170 49036 48311 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415979.1 protein_id gnl|my_center|LOCUS_17170 51338 49176 gene locus_tag LOCUS_17180 gene nrdE 51338 49176 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003914457.1 protein_id gnl|my_center|LOCUS_17180 51766 51308 gene locus_tag LOCUS_17190 gene nrdI 51766 51308 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415981.1 protein_id gnl|my_center|LOCUS_17190 52024 51785 gene locus_tag LOCUS_17200 gene nrdH 52024 51785 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415982.1 protein_id gnl|my_center|LOCUS_17200 52507 53088 gene locus_tag LOCUS_17210 52507 53088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 53738 53139 gene locus_tag LOCUS_17220 53738 53139 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415983.1 protein_id gnl|my_center|LOCUS_17220 53798 54412 gene locus_tag LOCUS_17230 53798 54412 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415984.1 protein_id gnl|my_center|LOCUS_17230 54409 55473 gene locus_tag LOCUS_17240 54409 55473 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899898.1 protein_id gnl|my_center|LOCUS_17240 56414 55533 gene locus_tag LOCUS_17250 56414 55533 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415986.1 protein_id gnl|my_center|LOCUS_17250 57141 56464 gene locus_tag LOCUS_17260 57141 56464 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415987.1 protein_id gnl|my_center|LOCUS_17260 57235 58713 gene locus_tag LOCUS_17270 57235 58713 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415988.1 protein_id gnl|my_center|LOCUS_17270 58952 59134 gene locus_tag LOCUS_17280 58952 59134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 60415 59444 gene locus_tag LOCUS_17290 60415 59444 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225143.1 protein_id gnl|my_center|LOCUS_17290 63010 60845 gene locus_tag LOCUS_17300 63010 60845 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902404.1 protein_id gnl|my_center|LOCUS_17300 63545 65833 gene locus_tag LOCUS_17310 63545 65833 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917116.1 protein_id gnl|my_center|LOCUS_17310 66815 66117 gene locus_tag LOCUS_17320 66815 66117 CDS product MspA family porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057745.1 protein_id gnl|my_center|LOCUS_17320 67002 67271 gene locus_tag LOCUS_17330 67002 67271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 67347 68171 gene locus_tag LOCUS_17340 67347 68171 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408425.1 protein_id gnl|my_center|LOCUS_17340 68199 69605 gene locus_tag LOCUS_17350 68199 69605 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417900.1 protein_id gnl|my_center|LOCUS_17350 70673 69852 gene locus_tag LOCUS_17360 70673 69852 CDS product diterpene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417908.1 protein_id gnl|my_center|LOCUS_17360 71894 71427 gene locus_tag LOCUS_17370 71894 71427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 73638 72082 gene locus_tag LOCUS_17380 73638 72082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 75164 73635 gene locus_tag LOCUS_17390 75164 73635 CDS product type B diterpene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417905.1 protein_id gnl|my_center|LOCUS_17390 77213 75486 gene locus_tag LOCUS_17400 77213 75486 CDS product 1-deoxy-D-xylulose-5-phosphate synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417910.1 protein_id gnl|my_center|LOCUS_17400 78262 77273 gene locus_tag LOCUS_17410 gene ispH 78262 77273 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417912.1 protein_id gnl|my_center|LOCUS_17410 79179 78262 gene locus_tag LOCUS_17420 79179 78262 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900678.1 protein_id gnl|my_center|LOCUS_17420 80275 80610 gene locus_tag LOCUS_17430 gene mmr 80275 80610 CDS product multidrug efflux SMR transporter Mmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415995.1 protein_id gnl|my_center|LOCUS_17430 80616 81167 gene locus_tag LOCUS_17440 80616 81167 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416005.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence32 173 2095 gene locus_tag LOCUS_17450 gene typA 173 2095 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406099.1 protein_id gnl|my_center|LOCUS_17450 2100 4004 gene locus_tag LOCUS_17460 gene lpqW 2100 4004 CDS product lipoarabinomannan biosynthesis protein LpqW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406102.1 protein_id gnl|my_center|LOCUS_17460 4141 5295 gene locus_tag LOCUS_17470 4141 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 5511 6404 gene locus_tag LOCUS_17480 gene mshB 5511 6404 CDS product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406154.1 protein_id gnl|my_center|LOCUS_17480 6419 6571 gene locus_tag LOCUS_17490 6419 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 6523 7011 gene locus_tag LOCUS_17500 6523 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406163.1 protein_id gnl|my_center|LOCUS_17500 7855 6977 gene locus_tag LOCUS_17510 7855 6977 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898753.1 protein_id gnl|my_center|LOCUS_17510 7981 10533 gene locus_tag LOCUS_17520 7981 10533 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406167.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence33 <1 3857 gene locus_tag LOCUS_17530 <1 3857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_067456433.1:type I polyketide synthase >Feature sequence34 >Feature sequence35 356 904 gene locus_tag LOCUS_17540 356 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1011 1805 gene locus_tag LOCUS_17550 1011 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17550 2186 2458 gene locus_tag LOCUS_17560 2186 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17560 2442 3827 gene locus_tag LOCUS_17570 2442 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 4350 4168 gene locus_tag LOCUS_17580 4350 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5846 4290 gene locus_tag LOCUS_17590 gene nuoN 5846 4290 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900644.1 protein_id gnl|my_center|LOCUS_17590 7426 5843 gene locus_tag LOCUS_17600 7426 5843 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416460.1 protein_id gnl|my_center|LOCUS_17600 9306 7420 gene locus_tag LOCUS_17610 gene nuoL 9306 7420 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900642.1 protein_id gnl|my_center|LOCUS_17610 9616 9317 gene locus_tag LOCUS_17620 gene nuoK 9616 9317 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416452.1 protein_id gnl|my_center|LOCUS_17620 10389 9613 gene locus_tag LOCUS_17630 10389 9613 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416449.1 protein_id gnl|my_center|LOCUS_17630 11012 10386 gene locus_tag LOCUS_17640 gene nuoI 11012 10386 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416447.1 protein_id gnl|my_center|LOCUS_17640 12228 11005 gene locus_tag LOCUS_17650 gene nuoH 12228 11005 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416445.1 protein_id gnl|my_center|LOCUS_17650 14636 12225 gene locus_tag LOCUS_17660 14636 12225 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899937.1 protein_id gnl|my_center|LOCUS_17660 16040 14712 gene locus_tag LOCUS_17670 gene nuoF 16040 14712 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416439.1 protein_id gnl|my_center|LOCUS_17670 16798 16037 gene locus_tag LOCUS_17680 gene nuoE 16798 16037 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416434.1 protein_id gnl|my_center|LOCUS_17680 18117 16795 gene locus_tag LOCUS_17690 gene nuoD 18117 16795 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416430.1 protein_id gnl|my_center|LOCUS_17690 18833 18117 gene locus_tag LOCUS_17700 18833 18117 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416425.1 protein_id gnl|my_center|LOCUS_17700 19384 18830 gene locus_tag LOCUS_17710 19384 18830 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416420.1 protein_id gnl|my_center|LOCUS_17710 19767 19393 gene locus_tag LOCUS_17720 19767 19393 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416417.1 protein_id gnl|my_center|LOCUS_17720 20125 21348 gene locus_tag LOCUS_17730 20125 21348 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003913805.1 protein_id gnl|my_center|LOCUS_17730 21797 21372 gene locus_tag LOCUS_17740 21797 21372 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416410.1 protein_id gnl|my_center|LOCUS_17740 22204 21884 gene locus_tag LOCUS_17750 22204 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 23106 22201 gene locus_tag LOCUS_17760 23106 22201 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550569.1 protein_id gnl|my_center|LOCUS_17760 23670 23221 gene locus_tag LOCUS_17770 23670 23221 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 protein_id gnl|my_center|LOCUS_17770 23857 26766 gene locus_tag LOCUS_17780 23857 26766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17780 26923 28224 gene locus_tag LOCUS_17790 26923 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17790 28589 31984 gene locus_tag LOCUS_17800 28589 31984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 32381 32043 gene locus_tag LOCUS_17810 32381 32043 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728129.1 protein_id gnl|my_center|LOCUS_17810 33346 32378 gene locus_tag LOCUS_17820 33346 32378 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728130.1 protein_id gnl|my_center|LOCUS_17820 34593 33343 gene locus_tag LOCUS_17830 34593 33343 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893439.1 protein_id gnl|my_center|LOCUS_17830 35500 34595 gene locus_tag LOCUS_17840 35500 34595 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893441.1 protein_id gnl|my_center|LOCUS_17840 36702 35497 gene locus_tag LOCUS_17850 36702 35497 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095590.1 protein_id gnl|my_center|LOCUS_17850 36925 37545 gene locus_tag LOCUS_17860 36925 37545 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899374.1 protein_id gnl|my_center|LOCUS_17860 37623 39038 gene locus_tag LOCUS_17870 37623 39038 CDS product selenium-binding protein SBP56-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728146.1 protein_id gnl|my_center|LOCUS_17870 40035 39064 gene locus_tag LOCUS_17880 40035 39064 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416403.1 protein_id gnl|my_center|LOCUS_17880 41076 40084 gene locus_tag LOCUS_17890 41076 40084 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728135.1 protein_id gnl|my_center|LOCUS_17890 41168 41398 gene locus_tag LOCUS_17900 41168 41398 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242138.1 protein_id gnl|my_center|LOCUS_17900 41395 41778 gene locus_tag LOCUS_17910 41395 41778 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_17910 41915 43150 gene locus_tag LOCUS_17920 41915 43150 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403128.1 protein_id gnl|my_center|LOCUS_17920 44374 43169 gene locus_tag LOCUS_17930 44374 43169 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899936.1 protein_id gnl|my_center|LOCUS_17930 45672 44395 gene locus_tag LOCUS_17940 45672 44395 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900638.1 protein_id gnl|my_center|LOCUS_17940 46965 45871 gene locus_tag LOCUS_17950 gene amrS 46965 45871 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899934.1 protein_id gnl|my_center|LOCUS_17950 47773 46985 gene locus_tag LOCUS_17960 gene hisN 47773 46985 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416388.1 protein_id gnl|my_center|LOCUS_17960 47815 48129 gene locus_tag LOCUS_17970 47815 48129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416383.1 protein_id gnl|my_center|LOCUS_17970 48340 49146 gene locus_tag LOCUS_17980 48340 49146 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416373.1 protein_id gnl|my_center|LOCUS_17980 49187 49825 gene locus_tag LOCUS_17990 gene devR 49187 49825 CDS product two-component system response regulator DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416369.1 protein_id gnl|my_center|LOCUS_17990 49822 51558 gene locus_tag LOCUS_18000 gene devS 49822 51558 CDS product two-component system sensor histidine kinase DevS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416363.1 protein_id gnl|my_center|LOCUS_18000 52566 51580 gene locus_tag LOCUS_18010 52566 51580 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416362.1 protein_id gnl|my_center|LOCUS_18010 52763 54148 gene locus_tag LOCUS_18020 gene tgs1 52763 54148 CDS product diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899932.1 protein_id gnl|my_center|LOCUS_18020 54593 54165 gene locus_tag LOCUS_18030 54593 54165 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082943.1 protein_id gnl|my_center|LOCUS_18030 55571 54597 gene locus_tag LOCUS_18040 55571 54597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416354.1 protein_id gnl|my_center|LOCUS_18040 56055 56258 gene locus_tag LOCUS_18050 56055 56258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 56265 57845 gene locus_tag LOCUS_18060 56265 57845 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_18060 57714 57787 gene locus_tag LOCUS_t00250 57714 57787 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 59559 58189 gene locus_tag LOCUS_18070 gene fprA 59559 58189 CDS product ferredoxin--NADP(+) reductase FprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900632.1 protein_id gnl|my_center|LOCUS_18070 59662 60777 gene locus_tag LOCUS_18080 gene prfB 59662 60777 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416129.1 protein_id gnl|my_center|LOCUS_18080 60767 61726 gene locus_tag LOCUS_18090 60767 61726 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416127.1 protein_id gnl|my_center|LOCUS_18090 61723 62190 gene locus_tag LOCUS_18100 61723 62190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 62234 62923 gene locus_tag LOCUS_18110 gene ftsE 62234 62923 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416120.1 protein_id gnl|my_center|LOCUS_18110 62924 63817 gene locus_tag LOCUS_18120 gene ftsX 62924 63817 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416117.1 protein_id gnl|my_center|LOCUS_18120 63820 64302 gene locus_tag LOCUS_18130 gene smpB 63820 64302 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416113.1 protein_id gnl|my_center|LOCUS_18130 64909 65754 gene locus_tag LOCUS_18140 64909 65754 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416111.1 protein_id gnl|my_center|LOCUS_18140 65834 66201 gene locus_tag LOCUS_tm00010 65834 66201 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 66392 68029 gene locus_tag LOCUS_18150 gene lipY 66392 68029 CDS product triacylglycerol lipase LipY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901542.1 protein_id gnl|my_center|LOCUS_18150 68446 68075 gene locus_tag LOCUS_18160 68446 68075 CDS product thiocyanate hydrolase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897690.1 protein_id gnl|my_center|LOCUS_18160 69171 68467 gene locus_tag LOCUS_18170 gene scnC 69171 68467 CDS product thiocyanate hydrolase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731167.1 protein_id gnl|my_center|LOCUS_18170 70061 69222 gene locus_tag LOCUS_18180 70061 69222 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104591.1 protein_id gnl|my_center|LOCUS_18180 71383 70247 gene locus_tag LOCUS_18190 71383 70247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899909.1 protein_id gnl|my_center|LOCUS_18190 71713 72873 gene locus_tag LOCUS_18200 71713 72873 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416097.1 protein_id gnl|my_center|LOCUS_18200 72870 73175 gene locus_tag LOCUS_18210 72870 73175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18210 73172 73381 gene locus_tag LOCUS_18220 73172 73381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18220 73465 74430 gene locus_tag LOCUS_18230 73465 74430 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891984.1 protein_id gnl|my_center|LOCUS_18230 74935 74375 gene locus_tag LOCUS_18240 74935 74375 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917120.1 protein_id gnl|my_center|LOCUS_18240 76741 74978 gene locus_tag LOCUS_18250 76741 74978 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 protein_id gnl|my_center|LOCUS_18250 77577 76690 gene locus_tag LOCUS_18260 77577 76690 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416086.1 protein_id gnl|my_center|LOCUS_18260 78524 77937 gene locus_tag LOCUS_18270 78524 77937 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416617.1 protein_id gnl|my_center|LOCUS_18270 78636 79427 gene locus_tag LOCUS_18280 78636 79427 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189232801.1 protein_id gnl|my_center|LOCUS_18280 79580 80398 gene locus_tag LOCUS_18290 79580 80398 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416061.1 protein_id gnl|my_center|LOCUS_18290 80803 80612 gene locus_tag LOCUS_18300 80803 80612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18300 82656 80845 gene locus_tag LOCUS_18310 82656 80845 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901535.1 protein_id gnl|my_center|LOCUS_18310 83122 82649 gene locus_tag LOCUS_18320 83122 82649 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416053.1 protein_id gnl|my_center|LOCUS_18320 83214 84134 gene locus_tag LOCUS_18330 83214 84134 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416052.1 protein_id gnl|my_center|LOCUS_18330 85504 84395 gene locus_tag LOCUS_18340 85504 84395 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901532.1 protein_id gnl|my_center|LOCUS_18340 85875 85501 gene locus_tag LOCUS_18350 gene crcB 85875 85501 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416046.1 protein_id gnl|my_center|LOCUS_18350 86270 85872 gene locus_tag LOCUS_18360 gene crcB 86270 85872 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416045.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18360 86388 88040 gene locus_tag LOCUS_18370 gene pgm 86388 88040 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899902.1 protein_id gnl|my_center|LOCUS_18370 88337 88122 gene locus_tag LOCUS_18380 88337 88122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 88672 88597 gene locus_tag LOCUS_t00260 88672 88597 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 89364 88717 gene locus_tag LOCUS_18390 gene orn 89364 88717 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899361.1 protein_id gnl|my_center|LOCUS_18390 89477 91096 gene locus_tag LOCUS_18400 89477 91096 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412803.1 protein_id gnl|my_center|LOCUS_18400 91978 91100 gene locus_tag LOCUS_18410 gene cmrA 91978 91100 CDS product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412799.1 protein_id gnl|my_center|LOCUS_18410 92096 93439 gene locus_tag LOCUS_18420 92096 93439 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412798.1 protein_id gnl|my_center|LOCUS_18420 94232 93444 gene locus_tag LOCUS_18430 94232 93444 CDS product MmpS family transport accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907725.1 protein_id gnl|my_center|LOCUS_18430 95141 94500 gene locus_tag LOCUS_18440 95141 94500 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412790.1 protein_id gnl|my_center|LOCUS_18440 95239 96858 gene locus_tag LOCUS_18450 95239 96858 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899357.1 protein_id gnl|my_center|LOCUS_18450 96967 97713 gene locus_tag LOCUS_18460 96967 97713 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412786.1 protein_id gnl|my_center|LOCUS_18460 97710 98366 gene locus_tag LOCUS_18470 97710 98366 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412782.1 protein_id gnl|my_center|LOCUS_18470 98363 99940 gene locus_tag LOCUS_18480 98363 99940 CDS product acetyl-/propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412778.1 protein_id gnl|my_center|LOCUS_18480 99942 101927 gene locus_tag LOCUS_18490 99942 101927 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899356.1 protein_id gnl|my_center|LOCUS_18490 101914 103086 gene locus_tag LOCUS_18500 101914 103086 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412771.1 protein_id gnl|my_center|LOCUS_18500 103191 103667 gene locus_tag LOCUS_18510 103191 103667 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412768.1 protein_id gnl|my_center|LOCUS_18510 103664 104485 gene locus_tag LOCUS_18520 gene citE 103664 104485 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412766.1 protein_id gnl|my_center|LOCUS_18520 104767 105834 gene locus_tag LOCUS_18530 gene pdhA 104767 105834 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412761.1 protein_id gnl|my_center|LOCUS_18530 105844 106878 gene locus_tag LOCUS_18540 gene bkdB 105844 106878 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412757.1 protein_id gnl|my_center|LOCUS_18540 106875 108065 gene locus_tag LOCUS_18550 106875 108065 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886148.1 protein_id gnl|my_center|LOCUS_18550 108509 108093 gene locus_tag LOCUS_18560 108509 108093 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412752.1 protein_id gnl|my_center|LOCUS_18560 108737 108516 gene locus_tag LOCUS_18570 108737 108516 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412749.1 protein_id gnl|my_center|LOCUS_18570 108990 108912 gene locus_tag LOCUS_t00270 108990 108912 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 109176 110429 gene locus_tag LOCUS_18580 109176 110429 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412725.1 protein_id gnl|my_center|LOCUS_18580 110609 112087 gene locus_tag LOCUS_18590 110609 112087 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412717.1 protein_id gnl|my_center|LOCUS_18590 112084 113862 gene locus_tag LOCUS_18600 112084 113862 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412713.1 protein_id gnl|my_center|LOCUS_18600 113859 116225 gene locus_tag LOCUS_18610 113859 116225 CDS product glycerol-3-phosphate 1-O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950725.1 protein_id gnl|my_center|LOCUS_18610 117169 116213 gene locus_tag LOCUS_18620 117169 116213 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891479.1 protein_id gnl|my_center|LOCUS_18620 117439 117233 gene locus_tag LOCUS_18630 117439 117233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 117704 118210 gene locus_tag LOCUS_18640 117704 118210 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412710.1 protein_id gnl|my_center|LOCUS_18640 118278 119954 gene locus_tag LOCUS_18650 gene ettA 118278 119954 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412708.1 protein_id gnl|my_center|LOCUS_18650 120055 124875 gene locus_tag LOCUS_18660 120055 124875 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910563.1 protein_id gnl|my_center|LOCUS_18660 124872 125288 gene locus_tag LOCUS_18670 124872 125288 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412703.1 protein_id gnl|my_center|LOCUS_18670 125273 125941 gene locus_tag LOCUS_18680 125273 125941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412698.1 protein_id gnl|my_center|LOCUS_18680 126258 125959 gene locus_tag LOCUS_18690 gene mazF3 126258 125959 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405820.1 protein_id gnl|my_center|LOCUS_18690 126491 126258 gene locus_tag LOCUS_18700 126491 126258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 128167 126542 gene locus_tag LOCUS_18710 128167 126542 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899336.1 protein_id gnl|my_center|LOCUS_18710 128568 128167 gene locus_tag LOCUS_18720 gene glbO 128568 128167 CDS product group 2 truncated hemoglobin GlbO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412688.1 protein_id gnl|my_center|LOCUS_18720 128691 129362 gene locus_tag LOCUS_18730 128691 129362 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910562.1 protein_id gnl|my_center|LOCUS_18730 129427 129669 gene locus_tag LOCUS_18740 129427 129669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412671.1 protein_id gnl|my_center|LOCUS_18740 129656 130123 gene locus_tag LOCUS_18750 129656 130123 CDS product DUF5130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412669.1 protein_id gnl|my_center|LOCUS_18750 132846 130201 gene locus_tag LOCUS_18760 gene pepN 132846 130201 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412666.1 protein_id gnl|my_center|LOCUS_18760 132960 133583 gene locus_tag LOCUS_18770 132960 133583 CDS product Rv2466c family mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412664.1 protein_id gnl|my_center|LOCUS_18770 133611 133844 gene locus_tag LOCUS_18780 133611 133844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 134376 135944 gene locus_tag LOCUS_18790 gene ffh 134376 135944 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414748.1 protein_id gnl|my_center|LOCUS_18790 135972 137084 gene locus_tag LOCUS_18800 135972 137084 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899537.1 protein_id gnl|my_center|LOCUS_18800 137153 138862 gene locus_tag LOCUS_18810 gene pknI 137153 138862 CDS product serine/threonine protein kinase PknI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900593.1 protein_id gnl|my_center|LOCUS_18810 138944 140740 gene locus_tag LOCUS_18820 138944 140740 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899536.1 protein_id gnl|my_center|LOCUS_18820 140742 141434 gene locus_tag LOCUS_18830 140742 141434 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414739.1 protein_id gnl|my_center|LOCUS_18830 141431 141724 gene locus_tag LOCUS_18840 141431 141724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 141733 142659 gene locus_tag LOCUS_18850 141733 142659 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029934.1 protein_id gnl|my_center|LOCUS_18850 143785 142913 gene locus_tag LOCUS_18860 gene dacB2 143785 142913 CDS product D-alanyl-D-alanine carboxypeptidase DacB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414736.1 protein_id gnl|my_center|LOCUS_18860 143854 144300 gene locus_tag LOCUS_18870 143854 144300 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414734.1 protein_id gnl|my_center|LOCUS_18870 144569 145069 gene locus_tag LOCUS_18880 144569 145069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 145078 145320 gene locus_tag LOCUS_18890 145078 145320 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414728.1 protein_id gnl|my_center|LOCUS_18890 145336 145863 gene locus_tag LOCUS_18900 gene rimM 145336 145863 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414726.1 protein_id gnl|my_center|LOCUS_18900 145860 146558 gene locus_tag LOCUS_18910 gene trmD 145860 146558 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414722.1 protein_id gnl|my_center|LOCUS_18910 147505 146564 gene locus_tag LOCUS_18920 147505 146564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414720.1 protein_id gnl|my_center|LOCUS_18920 147876 148217 gene locus_tag LOCUS_18930 gene rplS 147876 148217 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414717.1 protein_id gnl|my_center|LOCUS_18930 148287 149150 gene locus_tag LOCUS_18940 gene lepB 148287 149150 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950797.1 protein_id gnl|my_center|LOCUS_18940 149153 149881 gene locus_tag LOCUS_18950 149153 149881 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414713.1 protein_id gnl|my_center|LOCUS_18950 149888 150307 gene locus_tag LOCUS_18960 149888 150307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 150381 152702 gene locus_tag LOCUS_18970 150381 152702 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899532.1 protein_id gnl|my_center|LOCUS_18970 152702 153523 gene locus_tag LOCUS_18980 gene fdhD 152702 153523 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414705.1 protein_id gnl|my_center|LOCUS_18980 153640 154017 gene locus_tag LOCUS_18990 153640 154017 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414702.1 protein_id gnl|my_center|LOCUS_18990 154017 155528 gene locus_tag LOCUS_19000 154017 155528 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414700.1 protein_id gnl|my_center|LOCUS_19000 155525 156694 gene locus_tag LOCUS_19010 gene dprA 155525 156694 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414694.1 protein_id gnl|my_center|LOCUS_19010 156876 157784 gene locus_tag LOCUS_19020 156876 157784 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414689.1 protein_id gnl|my_center|LOCUS_19020 158057 158206 gene locus_tag LOCUS_19030 158057 158206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 158215 159498 gene locus_tag LOCUS_19040 158215 159498 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414680.1 protein_id gnl|my_center|LOCUS_19040 159992 159462 gene locus_tag LOCUS_19050 159992 159462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19050 160314 161159 gene locus_tag LOCUS_19060 gene rpsB 160314 161159 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899528.1 protein_id gnl|my_center|LOCUS_19060 161173 162003 gene locus_tag LOCUS_19070 gene tsf 161173 162003 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899527.1 protein_id gnl|my_center|LOCUS_19070 162046 163476 gene locus_tag LOCUS_19080 162046 163476 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414672.1 protein_id gnl|my_center|LOCUS_19080 164551 163817 gene locus_tag LOCUS_19090 164551 163817 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414666.1 protein_id gnl|my_center|LOCUS_19090 165004 165693 gene locus_tag LOCUS_19100 gene pyrH 165004 165693 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414665.1 protein_id gnl|my_center|LOCUS_19100 165914 166471 gene locus_tag LOCUS_19110 gene frr 165914 166471 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414663.1 protein_id gnl|my_center|LOCUS_19110 166504 167430 gene locus_tag LOCUS_19120 166504 167430 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414661.1 protein_id gnl|my_center|LOCUS_19120 167453 168547 gene locus_tag LOCUS_19130 gene rlmN 167453 168547 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414658.1 protein_id gnl|my_center|LOCUS_19130 168697 169206 gene locus_tag LOCUS_19140 168697 169206 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414654.1 protein_id gnl|my_center|LOCUS_19140 169206 170072 gene locus_tag LOCUS_19150 169206 170072 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904947.1 protein_id gnl|my_center|LOCUS_19150 170331 170077 gene locus_tag LOCUS_19160 170331 170077 CDS product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899522.1 protein_id gnl|my_center|LOCUS_19160 172431 170671 gene locus_tag LOCUS_19170 172431 170671 CDS product cytochrome c biogenesis protein DipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936521.1 protein_id gnl|my_center|LOCUS_19170 173227 172562 gene locus_tag LOCUS_19180 gene mpt83 173227 172562 CDS product cell surface glycolipoprotein Mpt83 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414630.1 protein_id gnl|my_center|LOCUS_19180 173335 174582 gene locus_tag LOCUS_19190 gene dxr 173335 174582 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414613.1 protein_id gnl|my_center|LOCUS_19190 174627 175838 gene locus_tag LOCUS_19200 gene rip 174627 175838 CDS product zinc metalloprotease Rip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414610.1 protein_id gnl|my_center|LOCUS_19200 175936 177117 gene locus_tag LOCUS_19210 gene ispG 175936 177117 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899517.1 protein_id gnl|my_center|LOCUS_19210 177172 178017 gene locus_tag LOCUS_19220 177172 178017 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899516.1 protein_id gnl|my_center|LOCUS_19220 178473 180290 gene locus_tag LOCUS_19230 178473 180290 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414596.1 protein_id gnl|my_center|LOCUS_19230 180772 180392 gene locus_tag LOCUS_19240 180772 180392 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414592.1 protein_id gnl|my_center|LOCUS_19240 181218 181805 gene locus_tag LOCUS_19250 181218 181805 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950792.1 protein_id gnl|my_center|LOCUS_19250 181844 182701 gene locus_tag LOCUS_19260 gene map 181844 182701 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899513.1 protein_id gnl|my_center|LOCUS_19260 183059 184408 gene locus_tag LOCUS_19270 183059 184408 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414579.1 protein_id gnl|my_center|LOCUS_19270 184395 185126 gene locus_tag LOCUS_19280 184395 185126 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900586.1 protein_id gnl|my_center|LOCUS_19280 185131 186498 gene locus_tag LOCUS_19290 185131 186498 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900585.1 protein_id gnl|my_center|LOCUS_19290 186498 187280 gene locus_tag LOCUS_19300 186498 187280 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414570.1 protein_id gnl|my_center|LOCUS_19300 188470 187352 gene locus_tag LOCUS_19310 188470 187352 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030493.1 protein_id gnl|my_center|LOCUS_19310 189632 188499 gene locus_tag LOCUS_19320 gene hypD 189632 188499 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_19320 189911 189639 gene locus_tag LOCUS_19330 gene hypC 189911 189639 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894089.1 protein_id gnl|my_center|LOCUS_19330 190993 189923 gene locus_tag LOCUS_19340 gene hypE 190993 189923 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728538.1 protein_id gnl|my_center|LOCUS_19340 191694 191032 gene locus_tag LOCUS_19350 191694 191032 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894091.1 protein_id gnl|my_center|LOCUS_19350 192422 191691 gene locus_tag LOCUS_19360 192422 191691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894092.1 protein_id gnl|my_center|LOCUS_19360 194806 192419 gene locus_tag LOCUS_19370 gene hypF 194806 192419 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894095.1 protein_id gnl|my_center|LOCUS_19370 195586 194828 gene locus_tag LOCUS_19380 gene hypB 195586 194828 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728271.1 protein_id gnl|my_center|LOCUS_19380 195934 195599 gene locus_tag LOCUS_19390 195934 195599 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728272.1 protein_id gnl|my_center|LOCUS_19390 196452 196192 gene locus_tag LOCUS_19400 196452 196192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 198003 196624 gene locus_tag LOCUS_19410 gene mtr 198003 196624 CDS product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414557.1 protein_id gnl|my_center|LOCUS_19410 199026 198016 gene locus_tag LOCUS_19420 199026 198016 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414553.1 protein_id gnl|my_center|LOCUS_19420 199318 200772 gene locus_tag LOCUS_19430 gene mqo 199318 200772 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414545.1 protein_id gnl|my_center|LOCUS_19430 200769 201239 gene locus_tag LOCUS_19440 200769 201239 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414543.1 protein_id gnl|my_center|LOCUS_19440 201491 202717 gene locus_tag LOCUS_19450 gene cobA 201491 202717 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414535.1 protein_id gnl|my_center|LOCUS_19450 202740 204332 gene locus_tag LOCUS_19460 gene efpA 202740 204332 CDS product multidrug efflux MFS transporter EfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414532.1 protein_id gnl|my_center|LOCUS_19460 204363 206198 gene locus_tag LOCUS_19470 204363 206198 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899508.1 protein_id gnl|my_center|LOCUS_19470 206706 206218 gene locus_tag LOCUS_19480 206706 206218 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414522.1 protein_id gnl|my_center|LOCUS_19480 207194 206703 gene locus_tag LOCUS_19490 207194 206703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414516.1 protein_id gnl|my_center|LOCUS_19490 207436 207978 gene locus_tag LOCUS_19500 gene rimP 207436 207978 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899507.1 protein_id gnl|my_center|LOCUS_19500 207975 209018 gene locus_tag LOCUS_19510 gene nusA 207975 209018 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414511.1 protein_id gnl|my_center|LOCUS_19510 211844 209241 gene locus_tag LOCUS_19520 211844 209241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 212698 215442 gene locus_tag LOCUS_19530 212698 215442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 215455 216006 gene locus_tag LOCUS_19540 gene rbfA 215455 216006 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414508.1 protein_id gnl|my_center|LOCUS_19540 215894 216994 gene locus_tag LOCUS_19550 gene nrnA 215894 216994 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414507.1 protein_id gnl|my_center|LOCUS_19550 217001 218335 gene locus_tag LOCUS_19560 217001 218335 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414506.1 protein_id gnl|my_center|LOCUS_19560 218424 219287 gene locus_tag LOCUS_19570 218424 219287 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414505.1 protein_id gnl|my_center|LOCUS_19570 219287 220114 gene locus_tag LOCUS_19580 219287 220114 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414504.1 protein_id gnl|my_center|LOCUS_19580 220117 221430 gene locus_tag LOCUS_19590 220117 221430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414501.1 protein_id gnl|my_center|LOCUS_19590 221423 222505 gene locus_tag LOCUS_19600 gene ugpC 221423 222505 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414499.1 protein_id gnl|my_center|LOCUS_19600 223268 222519 gene locus_tag LOCUS_19610 223268 222519 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414497.1 protein_id gnl|my_center|LOCUS_19610 223315 223530 gene locus_tag LOCUS_19620 223315 223530 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414495.1 protein_id gnl|my_center|LOCUS_19620 223527 223919 gene locus_tag LOCUS_19630 223527 223919 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414492.1 protein_id gnl|my_center|LOCUS_19630 223940 224209 gene locus_tag LOCUS_19640 223940 224209 CDS product DUF2277 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414489.1 protein_id gnl|my_center|LOCUS_19640 224206 224751 gene locus_tag LOCUS_19650 224206 224751 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899500.1 protein_id gnl|my_center|LOCUS_19650 225061 225948 gene locus_tag LOCUS_19660 225061 225948 CDS product type IV toxin-antitoxin system AbiEi family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414414.1 protein_id gnl|my_center|LOCUS_19660 225945 226835 gene locus_tag LOCUS_19670 225945 226835 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414409.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence36 994 152 gene locus_tag LOCUS_19680 994 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 3804 1192 gene locus_tag LOCUS_19690 3804 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4757 3801 gene locus_tag LOCUS_19700 4757 3801 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_19700 4957 5889 gene locus_tag LOCUS_19710 4957 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 6973 6506 gene locus_tag LOCUS_19720 6973 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 7076 7660 gene locus_tag LOCUS_19730 7076 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 8527 8072 gene locus_tag LOCUS_19740 8527 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 9024 9893 gene locus_tag LOCUS_19750 9024 9893 CDS product PE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405370.1 protein_id gnl|my_center|LOCUS_19750 9966 11153 gene locus_tag LOCUS_19760 9966 11153 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405368.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence37 >Feature sequence38 1608 1330 gene locus_tag LOCUS_19770 1608 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1697 1915 gene locus_tag LOCUS_19780 1697 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1957 3240 gene locus_tag LOCUS_19790 1957 3240 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901231.1 protein_id gnl|my_center|LOCUS_19790 4284 3223 gene locus_tag LOCUS_19800 4284 3223 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408248.1 protein_id gnl|my_center|LOCUS_19800 7386 4441 gene locus_tag LOCUS_19810 7386 4441 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910414.1 protein_id gnl|my_center|LOCUS_19810 13765 7400 gene locus_tag LOCUS_19820 13765 7400 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900387.1 protein_id gnl|my_center|LOCUS_19820 19504 13787 gene locus_tag LOCUS_19830 19504 13787 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900387.1 protein_id gnl|my_center|LOCUS_19830 19425 19670 gene locus_tag LOCUS_19840 19425 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 21293 20232 gene locus_tag LOCUS_19850 21293 20232 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408181.1 protein_id gnl|my_center|LOCUS_19850 22814 21402 gene locus_tag LOCUS_19860 gene argH 22814 21402 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408180.1 protein_id gnl|my_center|LOCUS_19860 24090 22894 gene locus_tag LOCUS_19870 24090 22894 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408179.1 protein_id gnl|my_center|LOCUS_19870 24605 24099 gene locus_tag LOCUS_19880 24605 24099 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408178.1 protein_id gnl|my_center|LOCUS_19880 25528 24602 gene locus_tag LOCUS_19890 gene argF 25528 24602 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408165.1 protein_id gnl|my_center|LOCUS_19890 26726 25521 gene locus_tag LOCUS_19900 26726 25521 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408163.1 protein_id gnl|my_center|LOCUS_19900 27604 26723 gene locus_tag LOCUS_19910 gene argB 27604 26723 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408161.1 protein_id gnl|my_center|LOCUS_19910 28817 27612 gene locus_tag LOCUS_19920 gene argJ 28817 27612 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408160.1 protein_id gnl|my_center|LOCUS_19920 29857 28814 gene locus_tag LOCUS_19930 gene argC 29857 28814 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898960.1 protein_id gnl|my_center|LOCUS_19930 32655 30157 gene locus_tag LOCUS_19940 gene pheT 32655 30157 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901220.1 protein_id gnl|my_center|LOCUS_19940 33698 32655 gene locus_tag LOCUS_19950 gene pheS 33698 32655 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901219.1 protein_id gnl|my_center|LOCUS_19950 34928 33981 gene locus_tag LOCUS_19960 34928 33981 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408144.1 protein_id gnl|my_center|LOCUS_19960 35973 35035 gene locus_tag LOCUS_19970 35973 35035 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900384.1 protein_id gnl|my_center|LOCUS_19970 36341 37327 gene locus_tag LOCUS_19980 36341 37327 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408141.1 protein_id gnl|my_center|LOCUS_19980 38097 37330 gene locus_tag LOCUS_19990 38097 37330 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408112.1 protein_id gnl|my_center|LOCUS_19990 38526 38137 gene locus_tag LOCUS_20000 gene rplT 38526 38137 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408108.1 protein_id gnl|my_center|LOCUS_20000 38780 38586 gene locus_tag LOCUS_20010 gene rpmI 38780 38586 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408106.1 protein_id gnl|my_center|LOCUS_20010 39243 38812 gene locus_tag LOCUS_20020 39243 38812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 39130 39600 gene locus_tag LOCUS_20030 39130 39600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 39880 43173 gene locus_tag LOCUS_20040 gene lysX 39880 43173 CDS product bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408102.1 protein_id gnl|my_center|LOCUS_20040 43289 43534 gene locus_tag LOCUS_20050 43289 43534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408096.1 protein_id gnl|my_center|LOCUS_20050 46529 43608 gene locus_tag LOCUS_20060 gene uvrA 46529 43608 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408092.1 protein_id gnl|my_center|LOCUS_20060 46748 47425 gene locus_tag LOCUS_20070 46748 47425 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898956.1 protein_id gnl|my_center|LOCUS_20070 47876 47436 gene locus_tag LOCUS_20080 47876 47436 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408085.1 protein_id gnl|my_center|LOCUS_20080 48060 49769 gene locus_tag LOCUS_20090 48060 49769 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408080.1 protein_id gnl|my_center|LOCUS_20090 51164 49758 gene locus_tag LOCUS_20100 51164 49758 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408079.1 protein_id gnl|my_center|LOCUS_20100 53359 51161 gene locus_tag LOCUS_20110 gene uvrB 53359 51161 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911575.1 protein_id gnl|my_center|LOCUS_20110 53691 54134 gene locus_tag LOCUS_20120 53691 54134 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898953.1 protein_id gnl|my_center|LOCUS_20120 55350 54112 gene locus_tag LOCUS_20130 gene coaE 55350 54112 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408069.1 protein_id gnl|my_center|LOCUS_20130 56821 55376 gene locus_tag LOCUS_20140 gene rpsA 56821 55376 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408066.1 protein_id gnl|my_center|LOCUS_20140 59702 56988 gene locus_tag LOCUS_20150 gene polA 59702 56988 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408063.1 protein_id gnl|my_center|LOCUS_20150 59810 60256 gene locus_tag LOCUS_20160 59810 60256 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408058.1 protein_id gnl|my_center|LOCUS_20160 60253 61455 gene locus_tag LOCUS_20170 60253 61455 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408054.1 protein_id gnl|my_center|LOCUS_20170 62151 61525 gene locus_tag LOCUS_20180 62151 61525 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908245.1 protein_id gnl|my_center|LOCUS_20180 62258 62332 gene locus_tag LOCUS_t00280 62258 62332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 62768 63289 gene locus_tag LOCUS_20190 62768 63289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 64114 63311 gene locus_tag LOCUS_20200 64114 63311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412932.1 protein_id gnl|my_center|LOCUS_20200 64361 64104 gene locus_tag LOCUS_20210 64361 64104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412936.1 protein_id gnl|my_center|LOCUS_20210 64661 65992 gene locus_tag LOCUS_20220 gene cya 64661 65992 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408035.1 protein_id gnl|my_center|LOCUS_20220 66104 66640 gene locus_tag LOCUS_20230 66104 66640 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408030.1 protein_id gnl|my_center|LOCUS_20230 66745 68202 gene locus_tag LOCUS_20240 66745 68202 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408027.1 protein_id gnl|my_center|LOCUS_20240 68234 69274 gene locus_tag LOCUS_20250 gene cydB 68234 69274 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408024.1 protein_id gnl|my_center|LOCUS_20250 69331 70941 gene locus_tag LOCUS_20260 gene cydD 69331 70941 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408022.1 protein_id gnl|my_center|LOCUS_20260 70928 72658 gene locus_tag LOCUS_20270 gene cydC 70928 72658 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908715.1 protein_id gnl|my_center|LOCUS_20270 74030 72633 gene locus_tag LOCUS_20280 74030 72633 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900378.1 protein_id gnl|my_center|LOCUS_20280 75032 74121 gene locus_tag LOCUS_20290 gene tesB 75032 74121 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408017.1 protein_id gnl|my_center|LOCUS_20290 76402 75047 gene locus_tag LOCUS_20300 gene pyk 76402 75047 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898945.1 protein_id gnl|my_center|LOCUS_20300 76895 76542 gene locus_tag LOCUS_20310 76895 76542 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408005.1 protein_id gnl|my_center|LOCUS_20310 77337 76936 gene locus_tag LOCUS_20320 77337 76936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 79330 77672 gene locus_tag LOCUS_20330 79330 77672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 80139 79327 gene locus_tag LOCUS_20340 gene trpA 80139 79327 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407999.1 protein_id gnl|my_center|LOCUS_20340 81428 80139 gene locus_tag LOCUS_20350 gene trpB 81428 80139 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016721143.1 protein_id gnl|my_center|LOCUS_20350 82279 81461 gene locus_tag LOCUS_20360 gene trpC 82279 81461 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407990.1 protein_id gnl|my_center|LOCUS_20360 82956 82360 gene locus_tag LOCUS_20370 82956 82360 CDS product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407980.1 protein_id gnl|my_center|LOCUS_20370 84532 82982 gene locus_tag LOCUS_20380 84532 82982 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407977.1 protein_id gnl|my_center|LOCUS_20380 84865 85311 gene locus_tag LOCUS_20390 gene bcpB 84865 85311 CDS product peroxiredoxin BcpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407974.1 protein_id gnl|my_center|LOCUS_20390 86489 85335 gene locus_tag LOCUS_20400 86489 85335 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409179.1 protein_id gnl|my_center|LOCUS_20400 87052 86699 gene locus_tag LOCUS_20410 87052 86699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 87514 87167 gene locus_tag LOCUS_20420 gene hisI 87514 87167 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407963.1 protein_id gnl|my_center|LOCUS_20420 88314 87511 gene locus_tag LOCUS_20430 gene hisF 88314 87511 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898942.1 protein_id gnl|my_center|LOCUS_20430 89116 88316 gene locus_tag LOCUS_20440 89116 88316 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911572.1 protein_id gnl|my_center|LOCUS_20440 89857 89123 gene locus_tag LOCUS_20450 gene priA 89857 89123 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900374.1 protein_id gnl|my_center|LOCUS_20450 90478 89858 gene locus_tag LOCUS_20460 gene hisH 90478 89858 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407952.1 protein_id gnl|my_center|LOCUS_20460 91095 90475 gene locus_tag LOCUS_20470 gene hisB 91095 90475 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407950.1 protein_id gnl|my_center|LOCUS_20470 92231 91092 gene locus_tag LOCUS_20480 92231 91092 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407947.1 protein_id gnl|my_center|LOCUS_20480 93574 92228 gene locus_tag LOCUS_20490 gene hisD 93574 92228 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900373.1 protein_id gnl|my_center|LOCUS_20490 93637 94047 gene locus_tag LOCUS_20500 93637 94047 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407939.1 protein_id gnl|my_center|LOCUS_20500 94133 94705 gene locus_tag LOCUS_20510 94133 94705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 94760 95479 gene locus_tag LOCUS_20520 94760 95479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 96334 95480 gene locus_tag LOCUS_20530 gene nadC 96334 95480 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407935.1 protein_id gnl|my_center|LOCUS_20530 97917 96334 gene locus_tag LOCUS_20540 97917 96334 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901204.1 protein_id gnl|my_center|LOCUS_20540 98963 97914 gene locus_tag LOCUS_20550 gene nadA 98963 97914 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407931.1 protein_id gnl|my_center|LOCUS_20550 99011 99715 gene locus_tag LOCUS_20560 99011 99715 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898937.1 protein_id gnl|my_center|LOCUS_20560 99961 101301 gene locus_tag LOCUS_20570 99961 101301 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407926.1 protein_id gnl|my_center|LOCUS_20570 101976 101308 gene locus_tag LOCUS_20580 101976 101308 CDS product DUF2567 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003914321.1 protein_id gnl|my_center|LOCUS_20580 102200 101973 gene locus_tag LOCUS_20590 102200 101973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407914.1 protein_id gnl|my_center|LOCUS_20590 103245 102214 gene locus_tag LOCUS_20600 gene bioB 103245 102214 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898934.1 protein_id gnl|my_center|LOCUS_20600 104068 103559 gene locus_tag LOCUS_20610 104068 103559 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407809.1 protein_id gnl|my_center|LOCUS_20610 104748 104068 gene locus_tag LOCUS_20620 gene bioD 104748 104068 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407806.1 protein_id gnl|my_center|LOCUS_20620 105905 104745 gene locus_tag LOCUS_20630 105905 104745 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407805.1 protein_id gnl|my_center|LOCUS_20630 107195 105912 gene locus_tag LOCUS_20640 107195 105912 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407803.1 protein_id gnl|my_center|LOCUS_20640 107240 107746 gene locus_tag LOCUS_20650 107240 107746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 108043 108720 gene locus_tag LOCUS_20660 108043 108720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 108809 110959 gene locus_tag LOCUS_20670 108809 110959 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407794.1 protein_id gnl|my_center|LOCUS_20670 110983 113175 gene locus_tag LOCUS_20680 gene glgX 110983 113175 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898930.1 protein_id gnl|my_center|LOCUS_20680 113179 115476 gene locus_tag LOCUS_20690 gene treY 113179 115476 CDS product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407790.1 protein_id gnl|my_center|LOCUS_20690 115469 117202 gene locus_tag LOCUS_20700 gene treZ 115469 117202 CDS product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950559.1 protein_id gnl|my_center|LOCUS_20700 118608 117274 gene locus_tag LOCUS_20710 118608 117274 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027746.1 protein_id gnl|my_center|LOCUS_20710 118639 119295 gene locus_tag LOCUS_20720 118639 119295 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977465.1 protein_id gnl|my_center|LOCUS_20720 120563 119283 gene locus_tag LOCUS_20730 gene ilvA 120563 119283 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407781.1 protein_id gnl|my_center|LOCUS_20730 120752 120597 gene locus_tag LOCUS_20740 120752 120597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 121087 120752 gene locus_tag LOCUS_20750 gene frdD 121087 120752 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407771.1 protein_id gnl|my_center|LOCUS_20750 121497 121114 gene locus_tag LOCUS_20760 121497 121114 CDS product fumarate reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916859.1 protein_id gnl|my_center|LOCUS_20760 122237 121494 gene locus_tag LOCUS_20770 gene sdhB 122237 121494 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407767.1 protein_id gnl|my_center|LOCUS_20770 123988 122240 gene locus_tag LOCUS_20780 gene frdA 123988 122240 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898925.1 protein_id gnl|my_center|LOCUS_20780 124231 123998 gene locus_tag LOCUS_20790 124231 123998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 126191 124317 gene locus_tag LOCUS_20800 126191 124317 CDS product lysophospholipid acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407762.1 protein_id gnl|my_center|LOCUS_20800 128028 126205 gene locus_tag LOCUS_20810 gene fadD11 128028 126205 CDS product fatty acid--CoA ligase FadD11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180066.1 protein_id gnl|my_center|LOCUS_20810 128606 130645 gene locus_tag LOCUS_20820 128606 130645 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950556.1 protein_id gnl|my_center|LOCUS_20820 130805 130608 gene locus_tag LOCUS_20830 130805 130608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 131355 133586 gene locus_tag LOCUS_20840 131355 133586 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405919.1 protein_id gnl|my_center|LOCUS_20840 137150 133635 gene locus_tag LOCUS_20850 gene dnaE 137150 133635 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407751.1 protein_id gnl|my_center|LOCUS_20850 137746 137315 gene locus_tag LOCUS_20860 137746 137315 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407748.1 protein_id gnl|my_center|LOCUS_20860 137750 138058 gene locus_tag LOCUS_20870 137750 138058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 138773 137970 gene locus_tag LOCUS_20880 138773 137970 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407737.1 protein_id gnl|my_center|LOCUS_20880 139794 138778 gene locus_tag LOCUS_20890 139794 138778 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407734.1 protein_id gnl|my_center|LOCUS_20890 140017 140439 gene locus_tag LOCUS_20900 gene glbN 140017 140439 CDS product group 1 truncated hemoglobin GlbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407730.1 protein_id gnl|my_center|LOCUS_20900 141136 140918 gene locus_tag LOCUS_20910 141136 140918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 141036 141902 gene locus_tag LOCUS_20920 141036 141902 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898940.1 protein_id gnl|my_center|LOCUS_20920 142959 141910 gene locus_tag LOCUS_20930 142959 141910 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407723.1 protein_id gnl|my_center|LOCUS_20930 143606 142959 gene locus_tag LOCUS_20940 gene lspA 143606 142959 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407722.1 protein_id gnl|my_center|LOCUS_20940 143625 144575 gene locus_tag LOCUS_20950 143625 144575 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407720.1 protein_id gnl|my_center|LOCUS_20950 145934 144540 gene locus_tag LOCUS_20960 145934 144540 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904641.1 protein_id gnl|my_center|LOCUS_20960 146059 146550 gene locus_tag LOCUS_20970 146059 146550 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420880.1 protein_id gnl|my_center|LOCUS_20970 147451 146570 gene locus_tag LOCUS_20980 147451 146570 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420612.1 protein_id gnl|my_center|LOCUS_20980 147815 149203 gene locus_tag LOCUS_20990 147815 149203 CDS product IS30-like element ISBlo4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783747.1 protein_id gnl|my_center|LOCUS_20990 149306 150229 gene locus_tag LOCUS_21000 149306 150229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420615.1 protein_id gnl|my_center|LOCUS_21000 151468 150248 gene locus_tag LOCUS_21010 151468 150248 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420618.1 protein_id gnl|my_center|LOCUS_21010 154627 151481 gene locus_tag LOCUS_21020 gene ileS 154627 151481 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407714.1 protein_id gnl|my_center|LOCUS_21020 154669 154977 gene locus_tag LOCUS_21030 154669 154977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 155207 154974 gene locus_tag LOCUS_21040 155207 154974 CDS product Rv1535 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407710.1 protein_id gnl|my_center|LOCUS_21040 156509 155793 gene locus_tag LOCUS_21050 156509 155793 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407700.1 protein_id gnl|my_center|LOCUS_21050 157631 156516 gene locus_tag LOCUS_21060 157631 156516 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898921.1 protein_id gnl|my_center|LOCUS_21060 157673 158137 gene locus_tag LOCUS_21070 157673 158137 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407695.1 protein_id gnl|my_center|LOCUS_21070 158796 158218 gene locus_tag LOCUS_21080 158796 158218 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407692.1 protein_id gnl|my_center|LOCUS_21080 159896 158793 gene locus_tag LOCUS_21090 159896 158793 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_21090 161649 159901 gene locus_tag LOCUS_21100 gene fadD24 161649 159901 CDS product fatty-acid--AMP ligase FAAL24/FadD24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898920.1 protein_id gnl|my_center|LOCUS_21100 161859 168131 gene locus_tag LOCUS_21110 161859 168131 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950554.1 protein_id gnl|my_center|LOCUS_21110 168187 169644 gene locus_tag LOCUS_21120 gene papA2 168187 169644 CDS product trehalose-2-sulfate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899707.1 protein_id gnl|my_center|LOCUS_21120 171005 172360 gene locus_tag LOCUS_21130 171005 172360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21130 >Feature sequence39 1079 348 gene locus_tag LOCUS_21140 1079 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence40 >Feature sequence41 >Feature sequence42 713 162 gene locus_tag LOCUS_21150 713 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 932 1677 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcggcgacggcggcgacgg 2934 1918 gene locus_tag LOCUS_21160 2934 1918 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908751.1 protein_id gnl|my_center|LOCUS_21160 4493 3141 gene locus_tag LOCUS_21170 gene mbtI 4493 3141 CDS product mycobactin biosynthesis salicylate synthase MbtI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412287.1 protein_id gnl|my_center|LOCUS_21170 4767 5066 gene locus_tag LOCUS_21180 4767 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5321 6544 gene locus_tag LOCUS_21190 5321 6544 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412289.1 protein_id gnl|my_center|LOCUS_21190 7704 6553 gene locus_tag LOCUS_21200 gene hemW 7704 6553 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901389.1 protein_id gnl|my_center|LOCUS_21200 8074 9738 gene locus_tag LOCUS_21210 gene sirA 8074 9738 CDS product sulfite reductase SirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899303.1 protein_id gnl|my_center|LOCUS_21210 9735 10475 gene locus_tag LOCUS_21220 9735 10475 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412303.1 protein_id gnl|my_center|LOCUS_21220 10454 11209 gene locus_tag LOCUS_21230 10454 11209 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412306.1 protein_id gnl|my_center|LOCUS_21230 11521 11925 gene locus_tag LOCUS_21240 11521 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 13061 11976 gene locus_tag LOCUS_21250 13061 11976 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412325.1 protein_id gnl|my_center|LOCUS_21250 13882 13064 gene locus_tag LOCUS_21260 gene cysW 13882 13064 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950711.1 protein_id gnl|my_center|LOCUS_21260 14640 13879 gene locus_tag LOCUS_21270 gene cysT 14640 13879 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412332.1 protein_id gnl|my_center|LOCUS_21270 15812 14769 gene locus_tag LOCUS_21280 15812 14769 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412335.1 protein_id gnl|my_center|LOCUS_21280 16393 16199 gene locus_tag LOCUS_21290 16393 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412337.1 protein_id gnl|my_center|LOCUS_21290 16549 18591 gene locus_tag LOCUS_21300 16549 18591 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003913344.1 protein_id gnl|my_center|LOCUS_21300 20413 18671 gene locus_tag LOCUS_21310 gene lepA 20413 18671 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900516.1 protein_id gnl|my_center|LOCUS_21310 20560 21240 gene locus_tag LOCUS_21320 20560 21240 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412345.1 protein_id gnl|my_center|LOCUS_21320 21810 21382 gene locus_tag LOCUS_21330 21810 21382 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412347.1 protein_id gnl|my_center|LOCUS_21330 21993 22835 gene locus_tag LOCUS_21340 21993 22835 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_21340 23073 24491 gene locus_tag LOCUS_21350 23073 24491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 25327 24488 gene locus_tag LOCUS_21360 25327 24488 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412357.1 protein_id gnl|my_center|LOCUS_21360 26304 25327 gene locus_tag LOCUS_21370 26304 25327 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412359.1 protein_id gnl|my_center|LOCUS_21370 27974 26304 gene locus_tag LOCUS_21380 27974 26304 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412363.1 protein_id gnl|my_center|LOCUS_21380 28098 28361 gene locus_tag LOCUS_21390 gene rpsT 28098 28361 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907833.1 protein_id gnl|my_center|LOCUS_21390 29319 28366 gene locus_tag LOCUS_21400 29319 28366 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903885.1 protein_id gnl|my_center|LOCUS_21400 30936 29371 gene locus_tag LOCUS_21410 30936 29371 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412371.1 protein_id gnl|my_center|LOCUS_21410 31886 30942 gene locus_tag LOCUS_21420 31886 30942 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412373.1 protein_id gnl|my_center|LOCUS_21420 33349 32156 gene locus_tag LOCUS_21430 33349 32156 CDS product enhanced intracellular survival protein Eis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412375.1 protein_id gnl|my_center|LOCUS_21430 33470 34519 gene locus_tag LOCUS_21440 33470 34519 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727034.1 protein_id gnl|my_center|LOCUS_21440 34712 36235 gene locus_tag LOCUS_21450 34712 36235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 37086 36256 gene locus_tag LOCUS_21460 37086 36256 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412381.1 protein_id gnl|my_center|LOCUS_21460 37919 37083 gene locus_tag LOCUS_21470 37919 37083 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412384.1 protein_id gnl|my_center|LOCUS_21470 38589 37909 gene locus_tag LOCUS_21480 gene gpgP 38589 37909 CDS product glucosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412388.1 protein_id gnl|my_center|LOCUS_21480 38981 38601 gene locus_tag LOCUS_21490 gene rsfS 38981 38601 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412394.1 protein_id gnl|my_center|LOCUS_21490 39613 38978 gene locus_tag LOCUS_21500 gene nadD 39613 38978 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908347.1 protein_id gnl|my_center|LOCUS_21500 39766 40812 gene locus_tag LOCUS_21510 39766 40812 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_21510 42190 40823 gene locus_tag LOCUS_21520 42190 40823 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412513.1 protein_id gnl|my_center|LOCUS_21520 43154 42276 gene locus_tag LOCUS_21530 43154 42276 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412514.1 protein_id gnl|my_center|LOCUS_21530 44441 43170 gene locus_tag LOCUS_21540 44441 43170 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412516.1 protein_id gnl|my_center|LOCUS_21540 46099 44696 gene locus_tag LOCUS_21550 46099 44696 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900521.1 protein_id gnl|my_center|LOCUS_21550 48294 46096 gene locus_tag LOCUS_21560 48294 46096 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412557.1 protein_id gnl|my_center|LOCUS_21560 48844 49713 gene locus_tag LOCUS_21570 gene rbsK 48844 49713 CDS product ribokinase RbsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936616.1 protein_id gnl|my_center|LOCUS_21570 49713 50333 gene locus_tag LOCUS_21580 49713 50333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 50497 50919 gene locus_tag LOCUS_21590 50497 50919 CDS product DUF6188 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416407.1 protein_id gnl|my_center|LOCUS_21590 53002 50960 gene locus_tag LOCUS_21600 53002 50960 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901403.1 protein_id gnl|my_center|LOCUS_21600 54640 53402 gene locus_tag LOCUS_21610 gene proB 54640 53402 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412568.1 protein_id gnl|my_center|LOCUS_21610 56079 54637 gene locus_tag LOCUS_21620 gene obgE 56079 54637 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901405.1 protein_id gnl|my_center|LOCUS_21620 56448 56182 gene locus_tag LOCUS_21630 gene rpmA 56448 56182 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908352.1 protein_id gnl|my_center|LOCUS_21630 56891 56463 gene locus_tag LOCUS_21640 56891 56463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 59841 56983 gene locus_tag LOCUS_21650 59841 56983 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899322.1 protein_id gnl|my_center|LOCUS_21650 60680 60261 gene locus_tag LOCUS_21660 gene ndk 60680 60261 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412592.1 protein_id gnl|my_center|LOCUS_21660 61346 60951 gene locus_tag LOCUS_21670 61346 60951 CDS product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412596.1 protein_id gnl|my_center|LOCUS_21670 62785 61343 gene locus_tag LOCUS_21680 gene folC 62785 61343 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899324.1 protein_id gnl|my_center|LOCUS_21680 65433 62782 gene locus_tag LOCUS_21690 65433 62782 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412604.1 protein_id gnl|my_center|LOCUS_21690 66728 65502 gene locus_tag LOCUS_21700 66728 65502 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412609.1 protein_id gnl|my_center|LOCUS_21700 66840 68003 gene locus_tag LOCUS_21710 66840 68003 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896017.1 protein_id gnl|my_center|LOCUS_21710 68631 68080 gene locus_tag LOCUS_21720 gene rpfE 68631 68080 CDS product resuscitation-promoting factor protein RpfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412613.1 protein_id gnl|my_center|LOCUS_21720 70086 69550 gene locus_tag LOCUS_21730 70086 69550 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412618.1 protein_id gnl|my_center|LOCUS_21730 71248 70157 gene locus_tag LOCUS_21740 71248 70157 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412624.1 protein_id gnl|my_center|LOCUS_21740 73297 71321 gene locus_tag LOCUS_21750 73297 71321 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412627.1 protein_id gnl|my_center|LOCUS_21750 74842 73562 gene locus_tag LOCUS_21760 gene clpX 74842 73562 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412634.1 protein_id gnl|my_center|LOCUS_21760 75131 76036 gene locus_tag LOCUS_21770 gene mmuM 75131 76036 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911868.1 protein_id gnl|my_center|LOCUS_21770 76692 76057 gene locus_tag LOCUS_21780 gene clpP2 76692 76057 CDS product ATP-dependent CLP protease proteolytic subunit ClpP2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412648.1 protein_id gnl|my_center|LOCUS_21780 77282 76689 gene locus_tag LOCUS_21790 gene clpP1 77282 76689 CDS product ATP-dependent CLP protease proteolytic subunit ClpP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412650.1 protein_id gnl|my_center|LOCUS_21790 78791 77406 gene locus_tag LOCUS_21800 gene tig 78791 77406 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412652.1 protein_id gnl|my_center|LOCUS_21800 78902 78826 gene locus_tag LOCUS_t00290 78902 78826 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 79037 79108 gene locus_tag LOCUS_t00300 79037 79108 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 79141 80325 gene locus_tag LOCUS_21810 79141 80325 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412656.1 protein_id gnl|my_center|LOCUS_21810 81554 80736 gene locus_tag LOCUS_21820 81554 80736 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412657.1 protein_id gnl|my_center|LOCUS_21820 82043 81564 gene locus_tag LOCUS_21830 82043 81564 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899332.1 protein_id gnl|my_center|LOCUS_21830 85129 82781 gene locus_tag LOCUS_21840 85129 82781 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899539.1 protein_id gnl|my_center|LOCUS_21840 85651 85313 gene locus_tag LOCUS_21850 gene glnB 85651 85313 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414756.1 protein_id gnl|my_center|LOCUS_21850 87081 85648 gene locus_tag LOCUS_21860 87081 85648 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899540.1 protein_id gnl|my_center|LOCUS_21860 88489 87224 gene locus_tag LOCUS_21870 gene ftsY 88489 87224 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899541.1 protein_id gnl|my_center|LOCUS_21870 92134 88523 gene locus_tag LOCUS_21880 gene smc 92134 88523 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950799.1 protein_id gnl|my_center|LOCUS_21880 92427 92146 gene locus_tag LOCUS_21890 92427 92146 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414811.1 protein_id gnl|my_center|LOCUS_21890 92827 92414 gene locus_tag LOCUS_21900 92827 92414 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414812.1 protein_id gnl|my_center|LOCUS_21900 93806 92892 gene locus_tag LOCUS_21910 gene mutM 93806 92892 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414814.1 protein_id gnl|my_center|LOCUS_21910 94739 94023 gene locus_tag LOCUS_21920 gene rnc 94739 94023 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414820.1 protein_id gnl|my_center|LOCUS_21920 95293 94736 gene locus_tag LOCUS_21930 95293 94736 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414824.1 protein_id gnl|my_center|LOCUS_21930 96123 95380 gene locus_tag LOCUS_21940 96123 95380 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414826.1 protein_id gnl|my_center|LOCUS_21940 96387 97166 gene locus_tag LOCUS_21950 96387 97166 CDS product thioesterase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908858.1 protein_id gnl|my_center|LOCUS_21950 97858 99609 gene locus_tag LOCUS_21960 gene fadD26 97858 99609 CDS product long-chain-fatty-acid--AMP ligase FAAL26/FadD26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904960.1 protein_id gnl|my_center|LOCUS_21960 99606 101765 gene locus_tag LOCUS_21970 99606 101765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 101851 101929 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 101955 102350 gene locus_tag LOCUS_21980 101955 102350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 102452 104263 gene locus_tag LOCUS_21990 102452 104263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21990 104263 110757 gene locus_tag LOCUS_22000 gene ppsC 104263 110757 CDS product phthiocerol type I polyketide synthase PpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414837.1 protein_id gnl|my_center|LOCUS_22000 110754 116180 gene locus_tag LOCUS_22010 gene ppsD 110754 116180 CDS product phthiocerol type I polyketide synthase PpsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899549.1 protein_id gnl|my_center|LOCUS_22010 116177 120577 gene locus_tag LOCUS_22020 gene ppsE 116177 120577 CDS product phthiocerol type I polyketide synthase PpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904964.1 protein_id gnl|my_center|LOCUS_22020 120589 121578 gene locus_tag LOCUS_22030 120589 121578 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908851.1 protein_id gnl|my_center|LOCUS_22030 121635 122444 gene locus_tag LOCUS_22040 gene drrA 121635 122444 CDS product daunorubicin ABC transporter ATP-binding protein DrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414848.1 protein_id gnl|my_center|LOCUS_22040 122480 123271 gene locus_tag LOCUS_22050 122480 123271 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908849.1 protein_id gnl|my_center|LOCUS_22050 123306 124550 gene locus_tag LOCUS_22060 123306 124550 CDS product phthiocerol/phthiodiolone dimycocerosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908848.1 protein_id gnl|my_center|LOCUS_22060 130857 124567 gene locus_tag LOCUS_22070 gene mas 130857 124567 CDS product mycocerosate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899551.1 protein_id gnl|my_center|LOCUS_22070 131231 132973 gene locus_tag LOCUS_22080 gene fadD28 131231 132973 CDS product fatty-acid--AMP ligase FAAL28/FadD28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950803.1 protein_id gnl|my_center|LOCUS_22080 132975 135629 gene locus_tag LOCUS_22090 gene mmpL7 132975 135629 CDS product phthiocerol dimycocerosate RND transporter MmpL7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414861.1 protein_id gnl|my_center|LOCUS_22090 136367 135672 gene locus_tag LOCUS_22100 136367 135672 CDS product LppX_LprAFG lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414872.1 protein_id gnl|my_center|LOCUS_22100 142606 136364 gene locus_tag LOCUS_22110 142606 136364 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180293.1 protein_id gnl|my_center|LOCUS_22110 144882 142762 gene locus_tag LOCUS_22120 144882 142762 CDS product p-hydroxybenzoic acid--AMP ligase FadD22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414884.1 protein_id gnl|my_center|LOCUS_22120 145596 144958 gene locus_tag LOCUS_22130 145596 144958 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907552.1 protein_id gnl|my_center|LOCUS_22130 147466 145739 gene locus_tag LOCUS_22140 147466 145739 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907551.1 protein_id gnl|my_center|LOCUS_22140 149242 148079 gene locus_tag LOCUS_22150 149242 148079 CDS product phthiodiolone/phenolphthiodiolone dimycocerosates ketoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414891.1 protein_id gnl|my_center|LOCUS_22150 149186 150154 gene locus_tag LOCUS_22160 149186 150154 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414900.1 protein_id gnl|my_center|LOCUS_22160 150221 151477 gene locus_tag LOCUS_22170 150221 151477 CDS product trans-acting enoyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414903.1 protein_id gnl|my_center|LOCUS_22170 152291 151497 gene locus_tag LOCUS_22180 152291 151497 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907545.1 protein_id gnl|my_center|LOCUS_22180 153664 152261 gene locus_tag LOCUS_22190 153664 152261 CDS product PGL/p-HBAD biosynthesis rhamnosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414922.1 protein_id gnl|my_center|LOCUS_22190 154042 155271 gene locus_tag LOCUS_22200 154042 155271 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414924.1 protein_id gnl|my_center|LOCUS_22200 155566 156279 gene locus_tag LOCUS_22210 gene purU 155566 156279 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899559.1 protein_id gnl|my_center|LOCUS_22210 156505 156690 gene locus_tag LOCUS_22220 156505 156690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 157439 156957 gene locus_tag LOCUS_22230 gene coaD 157439 156957 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728327.1 protein_id gnl|my_center|LOCUS_22230 158091 157525 gene locus_tag LOCUS_22240 gene rsmD 158091 157525 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415001.1 protein_id gnl|my_center|LOCUS_22240 161547 158164 gene locus_tag LOCUS_22250 161547 158164 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415003.1 protein_id gnl|my_center|LOCUS_22250 162123 161560 gene locus_tag LOCUS_22260 162123 161560 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415007.1 protein_id gnl|my_center|LOCUS_22260 162951 162190 gene locus_tag LOCUS_22270 162951 162190 CDS product mycothiol-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415010.1 protein_id gnl|my_center|LOCUS_22270 164149 163031 gene locus_tag LOCUS_22280 gene lipN 164149 163031 CDS product lipase/esterase LipN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415015.1 protein_id gnl|my_center|LOCUS_22280 164679 165467 gene locus_tag LOCUS_22290 164679 165467 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908468.1 protein_id gnl|my_center|LOCUS_22290 166195 165482 gene locus_tag LOCUS_22300 166195 165482 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415024.1 protein_id gnl|my_center|LOCUS_22300 168411 166192 gene locus_tag LOCUS_22310 gene recG 168411 166192 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908469.1 protein_id gnl|my_center|LOCUS_22310 170069 168414 gene locus_tag LOCUS_22320 170069 168414 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902383.1 protein_id gnl|my_center|LOCUS_22320 170374 170568 gene locus_tag LOCUS_22330 gene rpmB 170374 170568 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415030.1 protein_id gnl|my_center|LOCUS_22330 171345 170617 gene locus_tag LOCUS_22340 171345 170617 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899565.1 protein_id gnl|my_center|LOCUS_22340 172323 171355 gene locus_tag LOCUS_22350 172323 171355 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908471.1 protein_id gnl|my_center|LOCUS_22350 172418 172984 gene locus_tag LOCUS_22360 172418 172984 CDS product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591914.1 protein_id gnl|my_center|LOCUS_22360 174114 172993 gene locus_tag LOCUS_22370 gene ddlA 174114 172993 CDS product D-alanine--D-alanine ligase DdlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912011.1 protein_id gnl|my_center|LOCUS_22370 175211 174192 gene locus_tag LOCUS_22380 175211 174192 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415091.1 protein_id gnl|my_center|LOCUS_22380 175348 175998 gene locus_tag LOCUS_22390 gene cofC 175348 175998 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415094.1 protein_id gnl|my_center|LOCUS_22390 176128 178314 gene locus_tag LOCUS_22400 176128 178314 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415097.1 protein_id gnl|my_center|LOCUS_22400 178437 179351 gene locus_tag LOCUS_22410 178437 179351 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899569.1 protein_id gnl|my_center|LOCUS_22410 180081 179422 gene locus_tag LOCUS_22420 180081 179422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22420 180900 180304 gene locus_tag LOCUS_22430 gene leuD 180900 180304 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415110.1 protein_id gnl|my_center|LOCUS_22430 182341 180926 gene locus_tag LOCUS_22440 gene leuC 182341 180926 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899570.1 protein_id gnl|my_center|LOCUS_22440 182391 183092 gene locus_tag LOCUS_22450 182391 183092 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415115.1 protein_id gnl|my_center|LOCUS_22450 183199 183711 gene locus_tag LOCUS_22460 183199 183711 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899572.1 protein_id gnl|my_center|LOCUS_22460 183785 183712 gene locus_tag LOCUS_t00310 183785 183712 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 183896 183824 gene locus_tag LOCUS_t00320 183896 183824 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 185496 184024 gene locus_tag LOCUS_22470 gene gltX 185496 184024 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415122.1 protein_id gnl|my_center|LOCUS_22470 186365 185493 gene locus_tag LOCUS_22480 186365 185493 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322908.1 protein_id gnl|my_center|LOCUS_22480 187462 186647 gene locus_tag LOCUS_22490 187462 186647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 188589 187561 gene locus_tag LOCUS_22500 188589 187561 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899576.1 protein_id gnl|my_center|LOCUS_22500 190271 188586 gene locus_tag LOCUS_22510 gene serA 190271 188586 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899578.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence43 >Feature sequence44 1176 211 gene locus_tag LOCUS_22520 1176 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 4501 1436 gene locus_tag LOCUS_22530 4501 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4919 5704 gene locus_tag LOCUS_22540 gene trcR 4919 5704 CDS product two-component system response regulator TrcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405328.1 protein_id gnl|my_center|LOCUS_22540 5766 7226 gene locus_tag LOCUS_22550 5766 7226 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405324.1 protein_id gnl|my_center|LOCUS_22550 7318 7506 gene locus_tag LOCUS_22560 7318 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 7506 9176 gene locus_tag LOCUS_22570 gene kdpA 7506 9176 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730504.1 protein_id gnl|my_center|LOCUS_22570 9181 11313 gene locus_tag LOCUS_22580 gene kdpB 9181 11313 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730505.1 protein_id gnl|my_center|LOCUS_22580 11316 12248 gene locus_tag LOCUS_22590 11316 12248 CDS product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730506.1 protein_id gnl|my_center|LOCUS_22590 12268 14832 gene locus_tag LOCUS_22600 gene kdpD 12268 14832 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915886.1 protein_id gnl|my_center|LOCUS_22600 14829 15509 gene locus_tag LOCUS_22610 gene kdpE 14829 15509 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405305.1 protein_id gnl|my_center|LOCUS_22610 15929 15627 gene locus_tag LOCUS_22620 15929 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110193.1 protein_id gnl|my_center|LOCUS_22620 16985 16032 gene locus_tag LOCUS_22630 gene ppx2 16985 16032 CDS product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405299.1 protein_id gnl|my_center|LOCUS_22630 17473 16982 gene locus_tag LOCUS_22640 17473 16982 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907636.1 protein_id gnl|my_center|LOCUS_22640 18119 17466 gene locus_tag LOCUS_22650 18119 17466 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405293.1 protein_id gnl|my_center|LOCUS_22650 19420 18131 gene locus_tag LOCUS_22660 gene eno 19420 18131 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405290.1 protein_id gnl|my_center|LOCUS_22660 20204 19491 gene locus_tag LOCUS_22670 20204 19491 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405288.1 protein_id gnl|my_center|LOCUS_22670 21458 20433 gene locus_tag LOCUS_22680 21458 20433 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405276.1 protein_id gnl|my_center|LOCUS_22680 25120 21455 gene locus_tag LOCUS_22690 gene mfd 25120 21455 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405273.1 protein_id gnl|my_center|LOCUS_22690 25843 25193 gene locus_tag LOCUS_22700 25843 25193 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405271.1 protein_id gnl|my_center|LOCUS_22700 26036 26108 gene locus_tag LOCUS_t00330 26036 26108 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 26166 27677 gene locus_tag LOCUS_22710 gene glmU 26166 27677 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405267.1 protein_id gnl|my_center|LOCUS_22710 27769 28749 gene locus_tag LOCUS_22720 27769 28749 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405263.1 protein_id gnl|my_center|LOCUS_22720 28750 29106 gene locus_tag LOCUS_22730 gene arsC 28750 29106 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896825.1 protein_id gnl|my_center|LOCUS_22730 29410 29192 gene locus_tag LOCUS_22740 29410 29192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 29304 29765 gene locus_tag LOCUS_22750 29304 29765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 29958 30617 gene locus_tag LOCUS_22760 29958 30617 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405254.1 protein_id gnl|my_center|LOCUS_22760 30630 31229 gene locus_tag LOCUS_22770 gene pth 30630 31229 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_22770 32937 31303 gene locus_tag LOCUS_22780 32937 31303 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907626.1 protein_id gnl|my_center|LOCUS_22780 34243 33239 gene locus_tag LOCUS_22790 34243 33239 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405199.1 protein_id gnl|my_center|LOCUS_22790 35173 34253 gene locus_tag LOCUS_22800 gene rsmA 35173 34253 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405191.1 protein_id gnl|my_center|LOCUS_22800 36234 35146 gene locus_tag LOCUS_22810 gene rpfB 36234 35146 CDS product resuscitation-promoting factor protein RpfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405187.1 protein_id gnl|my_center|LOCUS_22810 37302 36433 gene locus_tag LOCUS_22820 37302 36433 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180038.1 protein_id gnl|my_center|LOCUS_22820 37323 38867 gene locus_tag LOCUS_22830 gene metG 37323 38867 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405183.1 protein_id gnl|my_center|LOCUS_22830 40564 38918 gene locus_tag LOCUS_22840 40564 38918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405180.1 protein_id gnl|my_center|LOCUS_22840 41098 40814 gene locus_tag LOCUS_22850 41098 40814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 41116 42306 gene locus_tag LOCUS_22860 41116 42306 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896840.1 protein_id gnl|my_center|LOCUS_22860 42303 43208 gene locus_tag LOCUS_22870 42303 43208 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730538.1 protein_id gnl|my_center|LOCUS_22870 43259 44524 gene locus_tag LOCUS_22880 43259 44524 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905428.1 protein_id gnl|my_center|LOCUS_22880 44576 45811 gene locus_tag LOCUS_22890 44576 45811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22890 46688 45825 gene locus_tag LOCUS_22900 gene rsmI 46688 45825 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405173.1 protein_id gnl|my_center|LOCUS_22900 46759 48282 gene locus_tag LOCUS_22910 46759 48282 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898685.1 protein_id gnl|my_center|LOCUS_22910 49503 48295 gene locus_tag LOCUS_22920 gene arcA 49503 48295 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405169.1 protein_id gnl|my_center|LOCUS_22920 49583 50179 gene locus_tag LOCUS_22930 49583 50179 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898684.1 protein_id gnl|my_center|LOCUS_22930 50848 50183 gene locus_tag LOCUS_22940 50848 50183 CDS product DUF5642 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405165.1 protein_id gnl|my_center|LOCUS_22940 51569 50877 gene locus_tag LOCUS_22950 51569 50877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 52561 51569 gene locus_tag LOCUS_22960 52561 51569 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405164.1 protein_id gnl|my_center|LOCUS_22960 52647 53393 gene locus_tag LOCUS_22970 52647 53393 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080268.1 protein_id gnl|my_center|LOCUS_22970 53656 53405 gene locus_tag LOCUS_22980 53656 53405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405150.1 protein_id gnl|my_center|LOCUS_22980 55527 53881 gene locus_tag LOCUS_22990 55527 53881 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089081.1 protein_id gnl|my_center|LOCUS_22990 56535 56236 gene locus_tag LOCUS_23000 56535 56236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 57400 56540 gene locus_tag LOCUS_23010 57400 56540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 57958 57503 gene locus_tag LOCUS_23020 57958 57503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 58140 57955 gene locus_tag LOCUS_23030 58140 57955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 59467 58130 gene locus_tag LOCUS_23040 59467 58130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 60918 59464 gene locus_tag LOCUS_23050 60918 59464 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165899772.1 protein_id gnl|my_center|LOCUS_23050 61328 60915 gene locus_tag LOCUS_23060 61328 60915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 61567 61325 gene locus_tag LOCUS_23070 61567 61325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 61860 61564 gene locus_tag LOCUS_23080 61860 61564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 63294 61990 gene locus_tag LOCUS_23090 63294 61990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 64238 63291 gene locus_tag LOCUS_23100 64238 63291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 64537 65115 gene locus_tag LOCUS_23110 64537 65115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 65112 66311 gene locus_tag LOCUS_23120 65112 66311 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678909.1 protein_id gnl|my_center|LOCUS_23120 66425 66352 gene locus_tag LOCUS_t00340 66425 66352 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 67523 66474 gene locus_tag LOCUS_23130 67523 66474 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950481.1 protein_id gnl|my_center|LOCUS_23130 68354 67701 gene locus_tag LOCUS_23140 68354 67701 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322321.1 protein_id gnl|my_center|LOCUS_23140 69650 68376 gene locus_tag LOCUS_23150 69650 68376 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405146.1 protein_id gnl|my_center|LOCUS_23150 70588 69677 gene locus_tag LOCUS_23160 70588 69677 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405145.1 protein_id gnl|my_center|LOCUS_23160 70665 71258 gene locus_tag LOCUS_23170 70665 71258 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405144.1 protein_id gnl|my_center|LOCUS_23170 71332 71649 gene locus_tag LOCUS_23180 71332 71649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 71722 72390 gene locus_tag LOCUS_23190 71722 72390 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405138.1 protein_id gnl|my_center|LOCUS_23190 72457 72900 gene locus_tag LOCUS_23200 gene mscL 72457 72900 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405128.1 protein_id gnl|my_center|LOCUS_23200 73468 72923 gene locus_tag LOCUS_23210 73468 72923 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405127.1 protein_id gnl|my_center|LOCUS_23210 74793 73468 gene locus_tag LOCUS_23220 gene pepD 74793 73468 CDS product serine protease PepD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886101.1 protein_id gnl|my_center|LOCUS_23220 76431 74968 gene locus_tag LOCUS_23230 gene mprB 76431 74968 CDS product two-component system sensor histidine kinase MprB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405123.1 protein_id gnl|my_center|LOCUS_23230 77165 76512 gene locus_tag LOCUS_23240 gene mprA 77165 76512 CDS product two-component system response regulator MprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014588181.1 protein_id gnl|my_center|LOCUS_23240 77509 77291 gene locus_tag LOCUS_23250 gene rpmF 77509 77291 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907574.1 protein_id gnl|my_center|LOCUS_23250 80843 77613 gene locus_tag LOCUS_23260 80843 77613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 81032 82729 gene locus_tag LOCUS_23270 81032 82729 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404960.1 protein_id gnl|my_center|LOCUS_23270 82734 83894 gene locus_tag LOCUS_23280 82734 83894 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898670.1 protein_id gnl|my_center|LOCUS_23280 83992 85587 gene locus_tag LOCUS_23290 83992 85587 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900245.1 protein_id gnl|my_center|LOCUS_23290 85644 87593 gene locus_tag LOCUS_23300 85644 87593 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900244.1 protein_id gnl|my_center|LOCUS_23300 87590 88756 gene locus_tag LOCUS_23310 87590 88756 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898667.1 protein_id gnl|my_center|LOCUS_23310 88756 89556 gene locus_tag LOCUS_23320 88756 89556 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404949.1 protein_id gnl|my_center|LOCUS_23320 90909 89617 gene locus_tag LOCUS_23330 90909 89617 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898977.1 protein_id gnl|my_center|LOCUS_23330 91289 90984 gene locus_tag LOCUS_23340 91289 90984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 91310 92056 gene locus_tag LOCUS_23350 91310 92056 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729123.1 protein_id gnl|my_center|LOCUS_23350 92059 93393 gene locus_tag LOCUS_23360 92059 93393 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401056.1 protein_id gnl|my_center|LOCUS_23360 94549 93443 gene locus_tag LOCUS_23370 94549 93443 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401058.1 protein_id gnl|my_center|LOCUS_23370 94564 95016 gene locus_tag LOCUS_23380 94564 95016 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401060.1 protein_id gnl|my_center|LOCUS_23380 95072 95512 gene locus_tag LOCUS_23390 95072 95512 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401063.1 protein_id gnl|my_center|LOCUS_23390 96219 95518 gene locus_tag LOCUS_23400 96219 95518 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041179536.1 protein_id gnl|my_center|LOCUS_23400 96357 97997 gene locus_tag LOCUS_23410 gene fadD5 96357 97997 CDS product fatty-acid--CoA ligase FadD5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950356.1 protein_id gnl|my_center|LOCUS_23410 98212 99018 gene locus_tag LOCUS_23420 98212 99018 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401074.1 protein_id gnl|my_center|LOCUS_23420 99020 99889 gene locus_tag LOCUS_23430 99020 99889 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401077.1 protein_id gnl|my_center|LOCUS_23430 99894 101270 gene locus_tag LOCUS_23440 99894 101270 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950357.1 protein_id gnl|my_center|LOCUS_23440 101267 102307 gene locus_tag LOCUS_23450 101267 102307 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908976.1 protein_id gnl|my_center|LOCUS_23450 102304 103869 gene locus_tag LOCUS_23460 102304 103869 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901818.1 protein_id gnl|my_center|LOCUS_23460 103866 105458 gene locus_tag LOCUS_23470 103866 105458 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401084.1 protein_id gnl|my_center|LOCUS_23470 105578 106723 gene locus_tag LOCUS_23480 105578 106723 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323508.1 protein_id gnl|my_center|LOCUS_23480 106717 108273 gene locus_tag LOCUS_23490 106717 108273 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908980.1 protein_id gnl|my_center|LOCUS_23490 108243 109001 gene locus_tag LOCUS_23500 108243 109001 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401093.1 protein_id gnl|my_center|LOCUS_23500 108998 109975 gene locus_tag LOCUS_23510 108998 109975 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908982.1 protein_id gnl|my_center|LOCUS_23510 110086 110526 gene locus_tag LOCUS_23520 110086 110526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908983.1 protein_id gnl|my_center|LOCUS_23520 110523 111254 gene locus_tag LOCUS_23530 110523 111254 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899844.1 protein_id gnl|my_center|LOCUS_23530 111288 111989 gene locus_tag LOCUS_23540 111288 111989 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891476.1 protein_id gnl|my_center|LOCUS_23540 113078 111996 gene locus_tag LOCUS_23550 113078 111996 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899845.1 protein_id gnl|my_center|LOCUS_23550 114582 113185 gene locus_tag LOCUS_23560 114582 113185 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899846.1 protein_id gnl|my_center|LOCUS_23560 115337 114609 gene locus_tag LOCUS_23570 115337 114609 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401107.1 protein_id gnl|my_center|LOCUS_23570 116348 115350 gene locus_tag LOCUS_23580 gene sigG 116348 115350 CDS product sigma-70 family RNA polymerase sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401110.1 protein_id gnl|my_center|LOCUS_23580 116453 117247 gene locus_tag LOCUS_23590 116453 117247 CDS product monoacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401112.1 protein_id gnl|my_center|LOCUS_23590 117288 118037 gene locus_tag LOCUS_23600 117288 118037 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401116.1 protein_id gnl|my_center|LOCUS_23600 118034 118564 gene locus_tag LOCUS_23610 118034 118564 CDS product TIGR04338 family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401120.1 protein_id gnl|my_center|LOCUS_23610 118552 120675 gene locus_tag LOCUS_23620 118552 120675 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401122.1 protein_id gnl|my_center|LOCUS_23620 121289 121729 gene locus_tag LOCUS_23630 121289 121729 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401141.1 protein_id gnl|my_center|LOCUS_23630 123503 121809 gene locus_tag LOCUS_23640 gene ilvD 123503 121809 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900824.1 protein_id gnl|my_center|LOCUS_23640 123818 125059 gene locus_tag LOCUS_23650 123818 125059 CDS product Rv0191 family MFS efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401149.1 protein_id gnl|my_center|LOCUS_23650 125229 126227 gene locus_tag LOCUS_23660 125229 126227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 126382 126978 gene locus_tag LOCUS_23670 126382 126978 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401168.1 protein_id gnl|my_center|LOCUS_23670 126965 129214 gene locus_tag LOCUS_23680 126965 129214 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003908489.1 protein_id gnl|my_center|LOCUS_23680 131237 129252 gene locus_tag LOCUS_23690 gene zmp1 131237 129252 CDS product zinc metalloprotease Zmp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401172.1 protein_id gnl|my_center|LOCUS_23690 131280 131903 gene locus_tag LOCUS_23700 131280 131903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401181.1 protein_id gnl|my_center|LOCUS_23700 131900 132589 gene locus_tag LOCUS_23710 131900 132589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401184.1 protein_id gnl|my_center|LOCUS_23710 133640 132684 gene locus_tag LOCUS_23720 133640 132684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23720 133807 133568 gene locus_tag LOCUS_23730 133807 133568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23730 134506 134015 gene locus_tag LOCUS_23740 134506 134015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401187.1 protein_id gnl|my_center|LOCUS_23740 137424 134503 gene locus_tag LOCUS_23750 gene mmpL11 137424 134503 CDS product RND transporter MmpL11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401190.1 protein_id gnl|my_center|LOCUS_23750 137954 137571 gene locus_tag LOCUS_23760 137954 137571 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085647.1 protein_id gnl|my_center|LOCUS_23760 139418 138216 gene locus_tag LOCUS_23770 139418 138216 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901825.1 protein_id gnl|my_center|LOCUS_23770 139591 140742 gene locus_tag LOCUS_23780 139591 140742 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899854.1 protein_id gnl|my_center|LOCUS_23780 143706 140761 gene locus_tag LOCUS_23790 gene mmpL3 143706 140761 CDS product trehalose monomycolate RND transporter MmpL3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899855.1 protein_id gnl|my_center|LOCUS_23790 144495 143773 gene locus_tag LOCUS_23800 144495 143773 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401202.1 protein_id gnl|my_center|LOCUS_23800 145232 144504 gene locus_tag LOCUS_23810 gene trmB 145232 144504 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401204.1 protein_id gnl|my_center|LOCUS_23810 145410 146531 gene locus_tag LOCUS_23820 145410 146531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401206.1 protein_id gnl|my_center|LOCUS_23820 146528 148096 gene locus_tag LOCUS_23830 146528 148096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401208.1 protein_id gnl|my_center|LOCUS_23830 148289 150109 gene locus_tag LOCUS_23840 148289 150109 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401212.1 protein_id gnl|my_center|LOCUS_23840 151283 150123 gene locus_tag LOCUS_23850 151283 150123 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902894.1 protein_id gnl|my_center|LOCUS_23850 151321 152355 gene locus_tag LOCUS_23860 151321 152355 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401224.1 protein_id gnl|my_center|LOCUS_23860 152377 153561 gene locus_tag LOCUS_23870 152377 153561 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726790.1 protein_id gnl|my_center|LOCUS_23870 153555 154868 gene locus_tag LOCUS_23880 153555 154868 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726791.1 protein_id gnl|my_center|LOCUS_23880 155821 154853 gene locus_tag LOCUS_23890 155821 154853 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401227.1 protein_id gnl|my_center|LOCUS_23890 155866 157200 gene locus_tag LOCUS_23900 155866 157200 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950362.1 protein_id gnl|my_center|LOCUS_23900 157197 157703 gene locus_tag LOCUS_23910 157197 157703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401230.1 protein_id gnl|my_center|LOCUS_23910 157820 159022 gene locus_tag LOCUS_23920 gene lipC 157820 159022 CDS product esterase LipC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899863.1 protein_id gnl|my_center|LOCUS_23920 159049 160461 gene locus_tag LOCUS_23930 159049 160461 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900834.1 protein_id gnl|my_center|LOCUS_23930 162021 160552 gene locus_tag LOCUS_23940 162021 160552 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899865.1 protein_id gnl|my_center|LOCUS_23940 162955 162188 gene locus_tag LOCUS_23950 162955 162188 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950364.1 protein_id gnl|my_center|LOCUS_23950 163018 164172 gene locus_tag LOCUS_23960 163018 164172 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908971.1 protein_id gnl|my_center|LOCUS_23960 165923 164187 gene locus_tag LOCUS_23970 165923 164187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401250.1 protein_id gnl|my_center|LOCUS_23970 167226 165934 gene locus_tag LOCUS_23980 167226 165934 CDS product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401257.1 protein_id gnl|my_center|LOCUS_23980 167411 168568 gene locus_tag LOCUS_23990 167411 168568 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401260.1 protein_id gnl|my_center|LOCUS_23990 169527 168607 gene locus_tag LOCUS_24000 169527 168607 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900835.1 protein_id gnl|my_center|LOCUS_24000 169713 171431 gene locus_tag LOCUS_24010 169713 171431 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401265.1 protein_id gnl|my_center|LOCUS_24010 171551 172222 gene locus_tag LOCUS_24020 171551 172222 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401268.1 protein_id gnl|my_center|LOCUS_24020 173702 172326 gene locus_tag LOCUS_24030 173702 172326 CDS product NADP-dependent succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912534.1 protein_id gnl|my_center|LOCUS_24030 174525 173998 gene locus_tag LOCUS_24040 174525 173998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 174564 175016 gene locus_tag LOCUS_24050 174564 175016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24050 176413 174974 gene locus_tag LOCUS_24060 176413 174974 CDS product lipase maturation factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401279.1 protein_id gnl|my_center|LOCUS_24060 180673 176498 gene locus_tag LOCUS_24070 180673 176498 CDS product DUF3367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950366.1 protein_id gnl|my_center|LOCUS_24070 180558 180788 gene locus_tag LOCUS_24080 180558 180788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 180923 180750 gene locus_tag LOCUS_24090 180923 180750 CDS product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401289.1 protein_id gnl|my_center|LOCUS_24090 181068 182252 gene locus_tag LOCUS_24100 gene lpqI 181068 182252 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401295.1 protein_id gnl|my_center|LOCUS_24100 182311 182937 gene locus_tag LOCUS_24110 182311 182937 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401297.1 protein_id gnl|my_center|LOCUS_24110 182943 184214 gene locus_tag LOCUS_24120 182943 184214 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229369.1 protein_id gnl|my_center|LOCUS_24120 185060 184218 gene locus_tag LOCUS_24130 gene htdX 185060 184218 CDS product 3-hydroxyacyl-thioester dehydratase HtdX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401305.1 protein_id gnl|my_center|LOCUS_24130 186462 185086 gene locus_tag LOCUS_24140 186462 185086 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899869.1 protein_id gnl|my_center|LOCUS_24140 186636 187910 gene locus_tag LOCUS_24150 186636 187910 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401309.1 protein_id gnl|my_center|LOCUS_24150 190020 188185 gene locus_tag LOCUS_24160 190020 188185 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401312.1 protein_id gnl|my_center|LOCUS_24160 190305 190793 gene locus_tag LOCUS_24170 190305 190793 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401313.1 protein_id gnl|my_center|LOCUS_24170 191831 191085 gene locus_tag LOCUS_24180 191831 191085 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401319.1 protein_id gnl|my_center|LOCUS_24180 193756 191828 gene locus_tag LOCUS_24190 193756 191828 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401322.1 protein_id gnl|my_center|LOCUS_24190 194638 193817 gene locus_tag LOCUS_24200 194638 193817 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401324.1 protein_id gnl|my_center|LOCUS_24200 195014 194718 gene locus_tag LOCUS_24210 195014 194718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401329.1 protein_id gnl|my_center|LOCUS_24210 196198 195755 gene locus_tag LOCUS_24220 gene acr2 196198 195755 CDS product stress-responsive chaperone Acr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900838.1 protein_id gnl|my_center|LOCUS_24220 196467 198983 gene locus_tag LOCUS_24230 gene nirB 196467 198983 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401336.1 protein_id gnl|my_center|LOCUS_24230 199048 199404 gene locus_tag LOCUS_24240 gene nirD 199048 199404 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401341.1 protein_id gnl|my_center|LOCUS_24240 199944 199492 gene locus_tag LOCUS_24250 199944 199492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401352.1 protein_id gnl|my_center|LOCUS_24250 200749 199976 gene locus_tag LOCUS_24260 200749 199976 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401354.1 protein_id gnl|my_center|LOCUS_24260 201891 200746 gene locus_tag LOCUS_24270 201891 200746 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401357.1 protein_id gnl|my_center|LOCUS_24270 202513 203073 gene locus_tag LOCUS_24280 202513 203073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24280 202968 203756 gene locus_tag LOCUS_24290 202968 203756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24290 205378 203969 gene locus_tag LOCUS_24300 205378 203969 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401360.1 protein_id gnl|my_center|LOCUS_24300 206108 205563 gene locus_tag LOCUS_24310 gene aac(2')-Ic 206108 205563 CDS product aminoglycoside N-acetyltransferase AAC(2')-Ic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899880.1 protein_id gnl|my_center|LOCUS_24310 207027 206119 gene locus_tag LOCUS_24320 207027 206119 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401367.1 protein_id gnl|my_center|LOCUS_24320 207723 207037 gene locus_tag LOCUS_24330 207723 207037 CDS product allophanate hydrolase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401370.1 protein_id gnl|my_center|LOCUS_24330 208900 207941 gene locus_tag LOCUS_24340 208900 207941 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401373.1 protein_id gnl|my_center|LOCUS_24340 212587 208973 gene locus_tag LOCUS_24350 212587 208973 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899883.1 protein_id gnl|my_center|LOCUS_24350 212910 212620 gene locus_tag LOCUS_24360 212910 212620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 213901 213008 gene locus_tag LOCUS_24370 213901 213008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 215132 213924 gene locus_tag LOCUS_24380 215132 213924 CDS product DNA polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401386.1 protein_id gnl|my_center|LOCUS_24380 215196 216878 gene locus_tag LOCUS_24390 gene fadD2 215196 216878 CDS product long-chain-fatty-acid--CoA ligase FadD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899884.1 protein_id gnl|my_center|LOCUS_24390 219140 216942 gene locus_tag LOCUS_24400 219140 216942 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401392.1 protein_id gnl|my_center|LOCUS_24400 219667 220671 gene locus_tag LOCUS_24410 219667 220671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 221034 221339 gene locus_tag LOCUS_24420 221034 221339 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172591936.1 protein_id gnl|my_center|LOCUS_24420 222761 221628 gene locus_tag LOCUS_24430 222761 221628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401394.1 protein_id gnl|my_center|LOCUS_24430 223036 222764 gene locus_tag LOCUS_24440 223036 222764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 223102 223686 gene locus_tag LOCUS_24450 223102 223686 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401399.1 protein_id gnl|my_center|LOCUS_24450 224391 223678 gene locus_tag LOCUS_24460 224391 223678 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899886.1 protein_id gnl|my_center|LOCUS_24460 224480 225388 gene locus_tag LOCUS_24470 224480 225388 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401404.1 protein_id gnl|my_center|LOCUS_24470 225829 225401 gene locus_tag LOCUS_24480 225829 225401 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403837.1 protein_id gnl|my_center|LOCUS_24480 226111 225854 gene locus_tag LOCUS_24490 226111 225854 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403834.1 protein_id gnl|my_center|LOCUS_24490 226544 228049 gene locus_tag LOCUS_24500 226544 228049 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886073.1 protein_id gnl|my_center|LOCUS_24500 228132 229037 gene locus_tag LOCUS_24510 228132 229037 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401448.1 protein_id gnl|my_center|LOCUS_24510 229296 231182 gene locus_tag LOCUS_24520 gene eccA3 229296 231182 CDS product type VII secretion system ESX-3 AAA family ATPase EccA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898392.1 protein_id gnl|my_center|LOCUS_24520 231179 232813 gene locus_tag LOCUS_24530 gene eccB3 231179 232813 CDS product type VII secretion system ESX-3 subunit EccB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401472.1 protein_id gnl|my_center|LOCUS_24530 232810 236790 gene locus_tag LOCUS_24540 gene eccC3 232810 236790 CDS product type VII secretion system ESX-3 FtsK/SpoIIIE family ATPase EccC3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401478.1 protein_id gnl|my_center|LOCUS_24540 236793 237101 gene locus_tag LOCUS_24550 236793 237101 CDS product type VII secretion system ESX-3 target PE5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401485.1 protein_id gnl|my_center|LOCUS_24550 237107 238636 gene locus_tag LOCUS_24560 237107 238636 CDS product type VII secretion system ESX-3 target PPE4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401488.1 protein_id gnl|my_center|LOCUS_24560 238676 238969 gene locus_tag LOCUS_24570 gene esxG 238676 238969 CDS product type VII secretion system protein EsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401503.1 protein_id gnl|my_center|LOCUS_24570 239010 239300 gene locus_tag LOCUS_24580 239010 239300 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415340.1 protein_id gnl|my_center|LOCUS_24580 239311 240210 gene locus_tag LOCUS_24590 gene espG3 239311 240210 CDS product type VII secretion system ESX-3 associated protein EspG3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401521.1 protein_id gnl|my_center|LOCUS_24590 240271 241683 gene locus_tag LOCUS_24600 gene eccD3 240271 241683 CDS product type VII secretion system ESX-3 subunit EccD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401524.1 protein_id gnl|my_center|LOCUS_24600 241683 243071 gene locus_tag LOCUS_24610 gene mycP3 241683 243071 CDS product type VII secretion system ESX-3 serine protease mycosin MycP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401528.1 protein_id gnl|my_center|LOCUS_24610 243068 244021 gene locus_tag LOCUS_24620 gene eccE3 243068 244021 CDS product type VII secretion system ESX-3 subunit EccE3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401533.1 protein_id gnl|my_center|LOCUS_24620 245258 244008 gene locus_tag LOCUS_24630 245258 244008 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898396.1 protein_id gnl|my_center|LOCUS_24630 245422 246201 gene locus_tag LOCUS_24640 245422 246201 CDS product trans-aconitate 2-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401538.1 protein_id gnl|my_center|LOCUS_24640 247569 246190 gene locus_tag LOCUS_24650 247569 246190 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401544.1 protein_id gnl|my_center|LOCUS_24650 248141 247830 gene locus_tag LOCUS_24660 gene mazF4 248141 247830 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407593.1 protein_id gnl|my_center|LOCUS_24660 249030 248548 gene locus_tag LOCUS_24670 249030 248548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401589.1 protein_id gnl|my_center|LOCUS_24670 249089 249778 gene locus_tag LOCUS_24680 249089 249778 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401594.1 protein_id gnl|my_center|LOCUS_24680 249815 250471 gene locus_tag LOCUS_24690 249815 250471 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401597.1 protein_id gnl|my_center|LOCUS_24690 251053 250568 gene locus_tag LOCUS_24700 251053 250568 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401601.1 protein_id gnl|my_center|LOCUS_24700 251247 253058 gene locus_tag LOCUS_24710 251247 253058 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900119.1 protein_id gnl|my_center|LOCUS_24710 253212 254750 gene locus_tag LOCUS_24720 253212 254750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 254820 255215 gene locus_tag LOCUS_24730 254820 255215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401613.1 protein_id gnl|my_center|LOCUS_24730 255974 255243 gene locus_tag LOCUS_24740 255974 255243 CDS product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401619.1 protein_id gnl|my_center|LOCUS_24740 255974 257020 gene locus_tag LOCUS_24750 255974 257020 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_24750 257134 258021 gene locus_tag LOCUS_24760 257134 258021 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401621.1 protein_id gnl|my_center|LOCUS_24760 258135 258749 gene locus_tag LOCUS_24770 258135 258749 CDS product muconolactone Delta-isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401623.1 protein_id gnl|my_center|LOCUS_24770 258844 260781 gene locus_tag LOCUS_24780 258844 260781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 261928 261131 gene locus_tag LOCUS_24790 261928 261131 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401625.1 protein_id gnl|my_center|LOCUS_24790 262308 261928 gene locus_tag LOCUS_24800 262308 261928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 262493 262421 gene locus_tag LOCUS_t00350 262493 262421 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 263251 262550 gene locus_tag LOCUS_24810 263251 262550 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401627.1 protein_id gnl|my_center|LOCUS_24810 263399 264067 gene locus_tag LOCUS_24820 gene pcp 263399 264067 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401632.1 protein_id gnl|my_center|LOCUS_24820 264462 264926 gene locus_tag LOCUS_24830 264462 264926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 264971 265543 gene locus_tag LOCUS_24840 gene dcd 264971 265543 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898399.1 protein_id gnl|my_center|LOCUS_24840 265682 265984 gene locus_tag LOCUS_24850 265682 265984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 266061 267398 gene locus_tag LOCUS_24860 266061 267398 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898400.1 protein_id gnl|my_center|LOCUS_24860 267949 268623 gene locus_tag LOCUS_24870 267949 268623 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906339.1 protein_id gnl|my_center|LOCUS_24870 269439 268624 gene locus_tag LOCUS_24880 269439 268624 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416945.1 protein_id gnl|my_center|LOCUS_24880 269615 270286 gene locus_tag LOCUS_24890 269615 270286 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900903.1 protein_id gnl|my_center|LOCUS_24890 271602 270283 gene locus_tag LOCUS_24900 271602 270283 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401650.1 protein_id gnl|my_center|LOCUS_24900 272021 271599 gene locus_tag LOCUS_24910 272021 271599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 272087 272683 gene locus_tag LOCUS_24920 272087 272683 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401651.1 protein_id gnl|my_center|LOCUS_24920 272807 273127 gene locus_tag LOCUS_24930 272807 273127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 273810 273184 gene locus_tag LOCUS_24940 273810 273184 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401654.1 protein_id gnl|my_center|LOCUS_24940 274587 273835 gene locus_tag LOCUS_24950 274587 273835 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401656.1 protein_id gnl|my_center|LOCUS_24950 274780 275946 gene locus_tag LOCUS_24960 274780 275946 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900904.1 protein_id gnl|my_center|LOCUS_24960 277771 276167 gene locus_tag LOCUS_24970 277771 276167 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898977.1 protein_id gnl|my_center|LOCUS_24970 278116 277784 gene locus_tag LOCUS_24980 278116 277784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 278315 281980 gene locus_tag LOCUS_24990 278315 281980 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972444.1 protein_id gnl|my_center|LOCUS_24990 281983 283578 gene locus_tag LOCUS_25000 gene narH 281983 283578 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730341.1 protein_id gnl|my_center|LOCUS_25000 283581 284249 gene locus_tag LOCUS_25010 gene narJ 283581 284249 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026934.1 protein_id gnl|my_center|LOCUS_25010 284246 284989 gene locus_tag LOCUS_25020 gene narI 284246 284989 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775894.1 protein_id gnl|my_center|LOCUS_25020 285092 286534 gene locus_tag LOCUS_25030 285092 286534 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077324.1 protein_id gnl|my_center|LOCUS_25030 286586 287341 gene locus_tag LOCUS_25040 286586 287341 CDS product maleylpyruvate isomerase family mycothiol-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401662.1 protein_id gnl|my_center|LOCUS_25040 287368 287742 gene locus_tag LOCUS_25050 287368 287742 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401666.1 protein_id gnl|my_center|LOCUS_25050 287760 288623 gene locus_tag LOCUS_25060 gene rfbA 287760 288623 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401670.1 protein_id gnl|my_center|LOCUS_25060 290080 288788 gene locus_tag LOCUS_25070 290080 288788 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401733.1 protein_id gnl|my_center|LOCUS_25070 292810 290111 gene locus_tag LOCUS_25080 292810 290111 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401734.1 protein_id gnl|my_center|LOCUS_25080 295402 292922 gene locus_tag LOCUS_25090 gene iniR 295402 292922 CDS product isoniazid response ATPase/transcriptional regulator IniR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401735.1 protein_id gnl|my_center|LOCUS_25090 295592 296134 gene locus_tag LOCUS_25100 295592 296134 CDS product IniB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401737.1 protein_id gnl|my_center|LOCUS_25100 296345 298477 gene locus_tag LOCUS_25110 296345 298477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 298724 299887 gene locus_tag LOCUS_25120 298724 299887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 299680 299686 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 300144 301985 gene locus_tag LOCUS_25130 gene iniA 300144 301985 CDS product isoniazid-induced dynamin-like GTPase IniA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900124.1 protein_id gnl|my_center|LOCUS_25130 301982 303469 gene locus_tag LOCUS_25140 gene iniC 301982 303469 CDS product isoniazid-induced dynamin-like GTPase IniC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401747.1 protein_id gnl|my_center|LOCUS_25140 305275 303482 gene locus_tag LOCUS_25150 305275 303482 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727124.1 protein_id gnl|my_center|LOCUS_25150 306214 305651 gene locus_tag LOCUS_25160 306214 305651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401751.1 protein_id gnl|my_center|LOCUS_25160 307930 306509 gene locus_tag LOCUS_25170 307930 306509 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898409.1 protein_id gnl|my_center|LOCUS_25170 308671 308231 gene locus_tag LOCUS_25180 308671 308231 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911071.1 protein_id gnl|my_center|LOCUS_25180 308698 308862 gene locus_tag LOCUS_25190 308698 308862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 309134 309937 gene locus_tag LOCUS_25200 309134 309937 CDS product TIGR04255 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401755.1 protein_id gnl|my_center|LOCUS_25200 309940 310593 gene locus_tag LOCUS_25210 gene mosR 309940 310593 CDS product hypoxia/intracellular survival transcriptional regulator MosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401756.1 protein_id gnl|my_center|LOCUS_25210 310596 311063 gene locus_tag LOCUS_25220 310596 311063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25220 311462 313327 gene locus_tag LOCUS_25230 gene dnaK 311462 313327 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401814.1 protein_id gnl|my_center|LOCUS_25230 313324 314022 gene locus_tag LOCUS_25240 gene grpE 313324 314022 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401817.1 protein_id gnl|my_center|LOCUS_25240 314078 315247 gene locus_tag LOCUS_25250 gene dnaJ 314078 315247 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401821.1 protein_id gnl|my_center|LOCUS_25250 315248 315637 gene locus_tag LOCUS_25260 gene hspR 315248 315637 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401823.1 protein_id gnl|my_center|LOCUS_25260 326207 315663 gene locus_tag LOCUS_25270 326207 315663 CDS product PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916655.1 protein_id gnl|my_center|LOCUS_25270 327698 326535 gene locus_tag LOCUS_25280 327698 326535 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401910.1 protein_id gnl|my_center|LOCUS_25280 327911 330406 gene locus_tag LOCUS_25290 gene clpB 327911 330406 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401905.1 protein_id gnl|my_center|LOCUS_25290 330512 331342 gene locus_tag LOCUS_25300 gene ttfA 330512 331342 CDS product trehalose monomycolate transport factor TtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401897.1 protein_id gnl|my_center|LOCUS_25300 331436 331975 gene locus_tag LOCUS_25310 gene pyrE 331436 331975 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401894.1 protein_id gnl|my_center|LOCUS_25310 331953 332891 gene locus_tag LOCUS_25320 331953 332891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401890.1 protein_id gnl|my_center|LOCUS_25320 332987 333532 gene locus_tag LOCUS_25330 332987 333532 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401887.1 protein_id gnl|my_center|LOCUS_25330 333766 333551 gene locus_tag LOCUS_25340 gene secE2 333766 333551 CDS product calcium dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401885.1 protein_id gnl|my_center|LOCUS_25340 334166 333789 gene locus_tag LOCUS_25350 334166 333789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 336104 334224 gene locus_tag LOCUS_25360 336104 334224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 337433 336468 gene locus_tag LOCUS_25370 337433 336468 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401875.1 protein_id gnl|my_center|LOCUS_25370 337458 338609 gene locus_tag LOCUS_25380 337458 338609 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401873.1 protein_id gnl|my_center|LOCUS_25380 338683 339543 gene locus_tag LOCUS_25390 338683 339543 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401869.1 protein_id gnl|my_center|LOCUS_25390 339639 340118 gene locus_tag LOCUS_25400 339639 340118 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401867.1 protein_id gnl|my_center|LOCUS_25400 340115 342514 gene locus_tag LOCUS_25410 340115 342514 CDS product aerobic carbon-monoxide dehydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900133.1 protein_id gnl|my_center|LOCUS_25410 342535 343290 gene locus_tag LOCUS_25420 342535 343290 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401865.1 protein_id gnl|my_center|LOCUS_25420 343287 343880 gene locus_tag LOCUS_25430 343287 343880 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401864.1 protein_id gnl|my_center|LOCUS_25430 343901 344755 gene locus_tag LOCUS_25440 343901 344755 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401863.1 protein_id gnl|my_center|LOCUS_25440 344776 345405 gene locus_tag LOCUS_25450 344776 345405 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727165.1 protein_id gnl|my_center|LOCUS_25450 345408 346613 gene locus_tag LOCUS_25460 345408 346613 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950389.1 protein_id gnl|my_center|LOCUS_25460 346630 347736 gene locus_tag LOCUS_25470 346630 347736 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401858.1 protein_id gnl|my_center|LOCUS_25470 348396 347725 gene locus_tag LOCUS_25480 348396 347725 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401857.1 protein_id gnl|my_center|LOCUS_25480 348476 349510 gene locus_tag LOCUS_25490 gene fbaA 348476 349510 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401856.1 protein_id gnl|my_center|LOCUS_25490 350416 349580 gene locus_tag LOCUS_25500 350416 349580 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401853.1 protein_id gnl|my_center|LOCUS_25500 350478 350882 gene locus_tag LOCUS_25510 350478 350882 CDS product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898414.1 protein_id gnl|my_center|LOCUS_25510 352935 350983 gene locus_tag LOCUS_25520 352935 350983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 353724 352939 gene locus_tag LOCUS_25530 353724 352939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence45 624 211 gene locus_tag LOCUS_25540 624 211 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401566.1 protein_id gnl|my_center|LOCUS_25540 842 615 gene locus_tag LOCUS_25550 842 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1308 979 gene locus_tag LOCUS_25560 1308 979 CDS product DUF2710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400413.1 protein_id gnl|my_center|LOCUS_25560 2105 1614 gene locus_tag LOCUS_25570 2105 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25570 2358 2164 gene locus_tag LOCUS_25580 2358 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25580 3533 2466 gene locus_tag LOCUS_25590 3533 2466 CDS product DUF5631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400411.1 protein_id gnl|my_center|LOCUS_25590 4096 3869 gene locus_tag LOCUS_25600 4096 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4508 4191 gene locus_tag LOCUS_25610 4508 4191 CDS product ESX-1 secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400401.1 protein_id gnl|my_center|LOCUS_25610 5877 4567 gene locus_tag LOCUS_25620 5877 4567 CDS product DUF4226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287743.1 protein_id gnl|my_center|LOCUS_25620 6366 6007 gene locus_tag LOCUS_25630 6366 6007 CDS product DUF4226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400395.1 protein_id gnl|my_center|LOCUS_25630 7179 6415 gene locus_tag LOCUS_25640 7179 6415 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400393.1 protein_id gnl|my_center|LOCUS_25640 8018 7248 gene locus_tag LOCUS_25650 8018 7248 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400391.1 protein_id gnl|my_center|LOCUS_25650 8163 8579 gene locus_tag LOCUS_25660 gene whiB5 8163 8579 CDS product transcriptional regulator WhiB5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400388.1 protein_id gnl|my_center|LOCUS_25660 9313 8936 gene locus_tag LOCUS_25670 9313 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25670 10931 9450 gene locus_tag LOCUS_25680 10931 9450 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 protein_id gnl|my_center|LOCUS_25680 11404 11320 gene locus_tag LOCUS_t00360 11404 11320 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11613 13253 gene locus_tag LOCUS_25690 gene fhaA 11613 13253 CDS product cell division-associated protein FhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912368.1 protein_id gnl|my_center|LOCUS_25690 13390 13857 gene locus_tag LOCUS_25700 13390 13857 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400373.1 protein_id gnl|my_center|LOCUS_25700 13854 15338 gene locus_tag LOCUS_25710 gene pstP 13854 15338 CDS product serine/threonine phosphatase PstP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886062.1 protein_id gnl|my_center|LOCUS_25710 15335 16744 gene locus_tag LOCUS_25720 gene rodA 15335 16744 CDS product cell shape-determining peptidoglycan glycosyltransferase RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400364.1 protein_id gnl|my_center|LOCUS_25720 16741 18216 gene locus_tag LOCUS_25730 gene pbpA 16741 18216 CDS product D,D-transpeptidase PbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899775.1 protein_id gnl|my_center|LOCUS_25730 18213 19505 gene locus_tag LOCUS_25740 gene pknA 18213 19505 CDS product serine/threonine protein kinase PknA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400358.1 protein_id gnl|my_center|LOCUS_25740 19502 21382 gene locus_tag LOCUS_25750 gene pknB 19502 21382 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400356.1 protein_id gnl|my_center|LOCUS_25750 22046 21360 gene locus_tag LOCUS_25760 22046 21360 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400352.1 protein_id gnl|my_center|LOCUS_25760 22811 22068 gene locus_tag LOCUS_25770 22811 22068 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886061.1 protein_id gnl|my_center|LOCUS_25770 22935 23216 gene locus_tag LOCUS_25780 gene crgA 22935 23216 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400344.1 protein_id gnl|my_center|LOCUS_25780 23348 23779 gene locus_tag LOCUS_25790 23348 23779 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899772.1 protein_id gnl|my_center|LOCUS_25790 24411 23863 gene locus_tag LOCUS_25800 gene ppiA 24411 23863 CDS product peptidylprolyl isomerase PpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400321.1 protein_id gnl|my_center|LOCUS_25800 24554 24982 gene locus_tag LOCUS_25810 gene cwsA 24554 24982 CDS product cell wall synthesis protein CwsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400307.1 protein_id gnl|my_center|LOCUS_25810 25172 25099 gene locus_tag LOCUS_t00370 25172 25099 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 25390 25316 gene locus_tag LOCUS_t00380 25390 25316 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 26356 25481 gene locus_tag LOCUS_25820 26356 25481 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400291.1 protein_id gnl|my_center|LOCUS_25820 30153 26509 gene locus_tag LOCUS_25830 gene gyrA 30153 26509 CDS product intein-containing DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012634405.1 protein_id gnl|my_center|LOCUS_25830 32236 30164 gene locus_tag LOCUS_25840 gene gyrB 32236 30164 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917863.1 protein_id gnl|my_center|LOCUS_25840 32994 32446 gene locus_tag LOCUS_25850 32994 32446 CDS product DNA replication protein DciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899769.1 protein_id gnl|my_center|LOCUS_25850 34148 32991 gene locus_tag LOCUS_25860 gene recF 34148 32991 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400273.1 protein_id gnl|my_center|LOCUS_25860 35368 34169 gene locus_tag LOCUS_25870 gene dnaN 35368 34169 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400271.1 protein_id gnl|my_center|LOCUS_25870 37412 35892 gene locus_tag LOCUS_25880 gene dnaA 37412 35892 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400253.1 protein_id gnl|my_center|LOCUS_25880 37938 38114 gene locus_tag LOCUS_25890 37938 38114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 38188 38493 gene locus_tag LOCUS_25900 gene rnpA 38188 38493 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899767.1 protein_id gnl|my_center|LOCUS_25900 38490 38825 gene locus_tag LOCUS_25910 38490 38825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 38809 39936 gene locus_tag LOCUS_25920 gene yidC 38809 39936 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899765.1 protein_id gnl|my_center|LOCUS_25920 40034 40639 gene locus_tag LOCUS_25930 40034 40639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899764.1 protein_id gnl|my_center|LOCUS_25930 40710 41483 gene locus_tag LOCUS_25940 gene rsmG 40710 41483 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899763.1 protein_id gnl|my_center|LOCUS_25940 41480 42520 gene locus_tag LOCUS_25950 gene parA 41480 42520 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400180.1 protein_id gnl|my_center|LOCUS_25950 42517 43506 gene locus_tag LOCUS_25960 42517 43506 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400175.1 protein_id gnl|my_center|LOCUS_25960 43777 44589 gene locus_tag LOCUS_25970 43777 44589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400171.1 protein_id gnl|my_center|LOCUS_25970 45834 44617 gene locus_tag LOCUS_25980 gene cwlM 45834 44617 CDS product N-acetylmuramoyl-L-alanine amidase CwlM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400168.1 protein_id gnl|my_center|LOCUS_25980 46318 45965 gene locus_tag LOCUS_25990 gene trxA 46318 45965 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400164.1 protein_id gnl|my_center|LOCUS_25990 47316 46315 gene locus_tag LOCUS_26000 gene trxB 47316 46315 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900782.1 protein_id gnl|my_center|LOCUS_26000 48148 47405 gene locus_tag LOCUS_26010 gene rsmA 48148 47405 CDS product anti-sigma-M factor RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400148.1 protein_id gnl|my_center|LOCUS_26010 48772 48206 gene locus_tag LOCUS_26020 gene sigM 48772 48206 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400144.1 protein_id gnl|my_center|LOCUS_26020 52433 48828 gene locus_tag LOCUS_26030 gene murJ 52433 48828 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902580.1 protein_id gnl|my_center|LOCUS_26030 54841 52430 gene locus_tag LOCUS_26040 54841 52430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900781.1 protein_id gnl|my_center|LOCUS_26040 55518 54838 gene locus_tag LOCUS_26050 55518 54838 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400124.1 protein_id gnl|my_center|LOCUS_26050 55754 55515 gene locus_tag LOCUS_26060 55754 55515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 57080 58675 gene locus_tag LOCUS_26070 57080 58675 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400120.1 protein_id gnl|my_center|LOCUS_26070 58700 59215 gene locus_tag LOCUS_26080 58700 59215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400109.1 protein_id gnl|my_center|LOCUS_26080 59275 59586 gene locus_tag LOCUS_26090 gene esxF 59275 59586 CDS product pore-forming CpnT exporter EsxF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400100.1 protein_id gnl|my_center|LOCUS_26090 59579 59869 gene locus_tag LOCUS_26100 gene esxE 59579 59869 CDS product pore-forming CpnT exporter EsxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400094.1 protein_id gnl|my_center|LOCUS_26100 59874 62240 gene locus_tag LOCUS_26110 59874 62240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 62245 62682 gene locus_tag LOCUS_26120 62245 62682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 62993 63208 gene locus_tag LOCUS_26130 62993 63208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 63490 63834 gene locus_tag LOCUS_26140 63490 63834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26140 65527 64040 gene locus_tag LOCUS_26150 65527 64040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 66293 66718 gene locus_tag LOCUS_26160 66293 66718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26160 66705 68873 gene locus_tag LOCUS_26170 66705 68873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 69170 70066 gene locus_tag LOCUS_26180 69170 70066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122526282.1 protein_id gnl|my_center|LOCUS_26180 70215 71126 gene locus_tag LOCUS_26190 70215 71126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917259.1 protein_id gnl|my_center|LOCUS_26190 71129 72616 gene locus_tag LOCUS_26200 gene eccB2 71129 72616 CDS product type VII secretion system ESX-2 subunit EccB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400065.1 protein_id gnl|my_center|LOCUS_26200 72617 76813 gene locus_tag LOCUS_26210 gene eccC2 72617 76813 CDS product type VII secretion system ESX-2 FtsK/SpoIIIE family ATPase EccC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014002018.1 protein_id gnl|my_center|LOCUS_26210 76816 77130 gene locus_tag LOCUS_26220 76816 77130 CDS product DUF2563 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410700.1 protein_id gnl|my_center|LOCUS_26220 77112 79058 gene locus_tag LOCUS_26230 77112 79058 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950653.1 protein_id gnl|my_center|LOCUS_26230 79154 79627 gene locus_tag LOCUS_26240 79154 79627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 79879 80181 gene locus_tag LOCUS_26250 79879 80181 CDS product PE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400047.1 protein_id gnl|my_center|LOCUS_26250 80188 81387 gene locus_tag LOCUS_26260 80188 81387 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899752.1 protein_id gnl|my_center|LOCUS_26260 81505 81831 gene locus_tag LOCUS_26270 81505 81831 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400035.1 protein_id gnl|my_center|LOCUS_26270 81879 82166 gene locus_tag LOCUS_26280 81879 82166 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899750.1 protein_id gnl|my_center|LOCUS_26280 82272 83102 gene locus_tag LOCUS_26290 gene espG2 82272 83102 CDS product type VII secretion system ESX-2 associated protein EspG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400028.1 protein_id gnl|my_center|LOCUS_26290 83273 84232 gene locus_tag LOCUS_26300 83273 84232 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899748.1 protein_id gnl|my_center|LOCUS_26300 84229 85758 gene locus_tag LOCUS_26310 gene eccD2 84229 85758 CDS product type VII secretion system ESX-2 subunit EccD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900775.1 protein_id gnl|my_center|LOCUS_26310 85743 87407 gene locus_tag LOCUS_26320 85743 87407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 87404 89014 gene locus_tag LOCUS_26330 gene eccE2 87404 89014 CDS product type VII secretion system ESX-2 subunit EccE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902572.1 protein_id gnl|my_center|LOCUS_26330 89039 90877 gene locus_tag LOCUS_26340 gene eccA2 89039 90877 CDS product type VII secretion system ESX-2 AAA family ATPase EccA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400005.1 protein_id gnl|my_center|LOCUS_26340 91032 92369 gene locus_tag LOCUS_26350 gene mycP1 91032 92369 CDS product type VII secretion system ESX-1 serine protease mycosin MycP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400004.1 protein_id gnl|my_center|LOCUS_26350 92389 93765 gene locus_tag LOCUS_26360 gene eccE1 92389 93765 CDS product type VII secretion system ESX-1 subunit EccE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400000.1 protein_id gnl|my_center|LOCUS_26360 93873 95255 gene locus_tag LOCUS_26370 gene espB 93873 95255 CDS product type VII secretion system ESX-1 target EspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950953.1 protein_id gnl|my_center|LOCUS_26370 95258 95608 gene locus_tag LOCUS_26380 gene espL 95258 95608 CDS product type VII secretion system ESX-1 associated protein EspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399988.1 protein_id gnl|my_center|LOCUS_26380 95952 98249 gene locus_tag LOCUS_26390 95952 98249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 99141 98374 gene locus_tag LOCUS_26400 gene espJ 99141 98374 CDS product type VII secretion system ESX-1 associated protein EspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950951.1 protein_id gnl|my_center|LOCUS_26400 100780 99245 gene locus_tag LOCUS_26410 gene eccD1 100780 99245 CDS product type VII secretion system ESX-1 subunit EccD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399976.1 protein_id gnl|my_center|LOCUS_26410 101565 100777 gene locus_tag LOCUS_26420 101565 100777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26420 102335 102559 gene locus_tag LOCUS_26430 102335 102559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence46 609 622 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2262 874 gene locus_tag LOCUS_26440 2262 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 2496 2500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence47 277 1686 gene locus_tag LOCUS_26450 277 1686 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_26450 1686 2090 gene locus_tag LOCUS_26460 1686 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26460 2162 2458 gene locus_tag LOCUS_26470 2162 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26470 2567 3166 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcggcggccgcacttcatcgaggc 3404 3625 gene locus_tag LOCUS_26480 gene vapB20 3404 3625 CDS product type II toxin-antitoxin system antitoxin VapB20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413183.1 protein_id gnl|my_center|LOCUS_26480 3622 4014 gene locus_tag LOCUS_26490 gene vapC20 3622 4014 CDS product type II toxin-antitoxin system toxin 23S rRNA-specific endonuclease VapC20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413180.1 protein_id gnl|my_center|LOCUS_26490 4034 4411 gene locus_tag LOCUS_26500 4034 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413177.1 protein_id gnl|my_center|LOCUS_26500 4804 4427 gene locus_tag LOCUS_26510 4804 4427 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413174.1 protein_id gnl|my_center|LOCUS_26510 5073 4801 gene locus_tag LOCUS_26520 5073 4801 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413167.1 protein_id gnl|my_center|LOCUS_26520 5444 5097 gene locus_tag LOCUS_26530 5444 5097 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413164.1 protein_id gnl|my_center|LOCUS_26530 5722 5510 gene locus_tag LOCUS_26540 5722 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26540 6443 5883 gene locus_tag LOCUS_26550 6443 5883 CDS product LppA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900847.1 protein_id gnl|my_center|LOCUS_26550 7201 6542 gene locus_tag LOCUS_26560 7201 6542 CDS product LppA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900848.1 protein_id gnl|my_center|LOCUS_26560 7335 7198 gene locus_tag LOCUS_26570 7335 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 7528 7328 gene locus_tag LOCUS_26580 7528 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 8058 7498 gene locus_tag LOCUS_26590 8058 7498 CDS product LppA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900846.1 protein_id gnl|my_center|LOCUS_26590 9734 8157 gene locus_tag LOCUS_26600 9734 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 10048 9734 gene locus_tag LOCUS_26610 10048 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413029.1 protein_id gnl|my_center|LOCUS_26610 12041 10236 gene locus_tag LOCUS_26620 12041 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 12294 13751 gene locus_tag LOCUS_26630 gene aroC 12294 13751 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413027.1 protein_id gnl|my_center|LOCUS_26630 13755 14285 gene locus_tag LOCUS_26640 gene aroK 13755 14285 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413021.1 protein_id gnl|my_center|LOCUS_26640 14282 15370 gene locus_tag LOCUS_26650 gene aroB 14282 15370 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413008.1 protein_id gnl|my_center|LOCUS_26650 15367 15804 gene locus_tag LOCUS_26660 gene aroQ 15367 15804 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413001.1 protein_id gnl|my_center|LOCUS_26660 16547 15873 gene locus_tag LOCUS_26670 16547 15873 CDS product B-4DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412998.1 protein_id gnl|my_center|LOCUS_26670 16580 17698 gene locus_tag LOCUS_26680 16580 17698 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412996.1 protein_id gnl|my_center|LOCUS_26680 17713 18276 gene locus_tag LOCUS_26690 gene efp 17713 18276 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412989.1 protein_id gnl|my_center|LOCUS_26690 18279 18773 gene locus_tag LOCUS_26700 gene nusB 18279 18773 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412985.1 protein_id gnl|my_center|LOCUS_26700 18770 19177 gene locus_tag LOCUS_26710 18770 19177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412981.1 protein_id gnl|my_center|LOCUS_26710 19324 22173 gene locus_tag LOCUS_26720 19324 22173 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899363.1 protein_id gnl|my_center|LOCUS_26720 22204 22428 gene locus_tag LOCUS_26730 22204 22428 CDS product antitoxin VapB39 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412975.1 protein_id gnl|my_center|LOCUS_26730 22425 22844 gene locus_tag LOCUS_26740 22425 22844 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412970.1 protein_id gnl|my_center|LOCUS_26740 23855 22845 gene locus_tag LOCUS_26750 23855 22845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_26750 23875 24126 gene locus_tag LOCUS_26760 23875 24126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 24486 25406 gene locus_tag LOCUS_26770 24486 25406 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412965.1 protein_id gnl|my_center|LOCUS_26770 25842 25441 gene locus_tag LOCUS_26780 25842 25441 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412963.1 protein_id gnl|my_center|LOCUS_26780 26024 25839 gene locus_tag LOCUS_26790 26024 25839 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412960.1 protein_id gnl|my_center|LOCUS_26790 26262 27116 gene locus_tag LOCUS_26800 26262 27116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 27120 27560 gene locus_tag LOCUS_26810 27120 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 28899 27667 gene locus_tag LOCUS_26820 28899 27667 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728773.1 protein_id gnl|my_center|LOCUS_26820 30115 28910 gene locus_tag LOCUS_26830 30115 28910 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003918234.1 protein_id gnl|my_center|LOCUS_26830 30661 30395 gene locus_tag LOCUS_26840 30661 30395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 30597 31241 gene locus_tag LOCUS_26850 gene lprF 30597 31241 CDS product lipoprotein LprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407180.1 protein_id gnl|my_center|LOCUS_26850 31514 32980 gene locus_tag LOCUS_26860 31514 32980 CDS product cytochrome b5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900326.1 protein_id gnl|my_center|LOCUS_26860 32977 34158 gene locus_tag LOCUS_26870 32977 34158 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407185.1 protein_id gnl|my_center|LOCUS_26870 34164 35141 gene locus_tag LOCUS_26880 34164 35141 CDS product glycolipid sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898849.1 protein_id gnl|my_center|LOCUS_26880 35797 35138 gene locus_tag LOCUS_26890 35797 35138 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898852.1 protein_id gnl|my_center|LOCUS_26890 36067 36636 gene locus_tag LOCUS_26900 gene pyrR 36067 36636 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407196.1 protein_id gnl|my_center|LOCUS_26900 36633 37577 gene locus_tag LOCUS_26910 36633 37577 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407200.1 protein_id gnl|my_center|LOCUS_26910 37574 38878 gene locus_tag LOCUS_26920 37574 38878 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407204.1 protein_id gnl|my_center|LOCUS_26920 38979 39473 gene locus_tag LOCUS_26930 38979 39473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898853.1 protein_id gnl|my_center|LOCUS_26930 39485 40600 gene locus_tag LOCUS_26940 gene carA 39485 40600 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407208.1 protein_id gnl|my_center|LOCUS_26940 40618 43947 gene locus_tag LOCUS_26950 gene carB 40618 43947 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407211.1 protein_id gnl|my_center|LOCUS_26950 43944 44780 gene locus_tag LOCUS_26960 gene pyrF 43944 44780 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407220.1 protein_id gnl|my_center|LOCUS_26960 45175 44786 gene locus_tag LOCUS_26970 45175 44786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 45587 45904 gene locus_tag LOCUS_26980 45587 45904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 45999 46592 gene locus_tag LOCUS_26990 gene gmk 45999 46592 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900331.1 protein_id gnl|my_center|LOCUS_26990 46656 46982 gene locus_tag LOCUS_27000 gene rpoZ 46656 46982 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407248.1 protein_id gnl|my_center|LOCUS_27000 47004 48245 gene locus_tag LOCUS_27010 gene coaBC 47004 48245 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898859.1 protein_id gnl|my_center|LOCUS_27010 48322 49542 gene locus_tag LOCUS_27020 gene metK 48322 49542 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900333.1 protein_id gnl|my_center|LOCUS_27020 50207 49539 gene locus_tag LOCUS_27030 50207 49539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 51685 50216 gene locus_tag LOCUS_27040 51685 50216 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407257.1 protein_id gnl|my_center|LOCUS_27040 53010 51685 gene locus_tag LOCUS_27050 53010 51685 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407260.1 protein_id gnl|my_center|LOCUS_27050 53150 54181 gene locus_tag LOCUS_27060 53150 54181 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407264.1 protein_id gnl|my_center|LOCUS_27060 55118 54198 gene locus_tag LOCUS_27070 55118 54198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 55594 55115 gene locus_tag LOCUS_27080 55594 55115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27080 56478 56251 gene locus_tag LOCUS_27090 56478 56251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27090 56820 56587 gene locus_tag LOCUS_27100 56820 56587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 56939 57205 gene locus_tag LOCUS_27110 56939 57205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 57213 57626 gene locus_tag LOCUS_27120 57213 57626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 58066 57641 gene locus_tag LOCUS_27130 58066 57641 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407268.1 protein_id gnl|my_center|LOCUS_27130 58337 59209 gene locus_tag LOCUS_27140 58337 59209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 59114 59133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 59134 59625 gene locus_tag LOCUS_27150 59134 59625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 59709 60611 gene locus_tag LOCUS_27160 59709 60611 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206791.1 protein_id gnl|my_center|LOCUS_27160 60745 62253 gene locus_tag LOCUS_27170 60745 62253 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900817.1 protein_id gnl|my_center|LOCUS_27170 62882 62259 gene locus_tag LOCUS_27180 62882 62259 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401044.1 protein_id gnl|my_center|LOCUS_27180 63011 63145 gene locus_tag LOCUS_27190 63011 63145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 64574 63150 gene locus_tag LOCUS_27200 64574 63150 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899835.1 protein_id gnl|my_center|LOCUS_27200 64951 64571 gene locus_tag LOCUS_27210 64951 64571 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401030.1 protein_id gnl|my_center|LOCUS_27210 66200 65103 gene locus_tag LOCUS_27220 66200 65103 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401026.1 protein_id gnl|my_center|LOCUS_27220 66384 67658 gene locus_tag LOCUS_27230 66384 67658 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401015.1 protein_id gnl|my_center|LOCUS_27230 67651 68475 gene locus_tag LOCUS_27240 gene ptbB 67651 68475 CDS product tyrosine-protein phosphatase PtbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401010.1 protein_id gnl|my_center|LOCUS_27240 68588 70231 gene locus_tag LOCUS_27250 68588 70231 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400998.1 protein_id gnl|my_center|LOCUS_27250 70440 72152 gene locus_tag LOCUS_27260 70440 72152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 73140 72172 gene locus_tag LOCUS_27270 73140 72172 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400985.1 protein_id gnl|my_center|LOCUS_27270 74006 73146 gene locus_tag LOCUS_27280 74006 73146 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400979.1 protein_id gnl|my_center|LOCUS_27280 75462 74035 gene locus_tag LOCUS_27290 75462 74035 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400974.1 protein_id gnl|my_center|LOCUS_27290 75863 75597 gene locus_tag LOCUS_27300 75863 75597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 76889 75888 gene locus_tag LOCUS_27310 76889 75888 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900814.1 protein_id gnl|my_center|LOCUS_27310 77712 77089 gene locus_tag LOCUS_27320 77712 77089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27320 78452 79873 gene locus_tag LOCUS_27330 78452 79873 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899828.1 protein_id gnl|my_center|LOCUS_27330 80927 80016 gene locus_tag LOCUS_27340 80927 80016 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400956.1 protein_id gnl|my_center|LOCUS_27340 80972 81382 gene locus_tag LOCUS_27350 80972 81382 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400951.1 protein_id gnl|my_center|LOCUS_27350 81725 81363 gene locus_tag LOCUS_27360 81725 81363 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400949.1 protein_id gnl|my_center|LOCUS_27360 81847 82005 gene locus_tag LOCUS_27370 81847 82005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 83098 82079 gene locus_tag LOCUS_27380 83098 82079 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400947.1 protein_id gnl|my_center|LOCUS_27380 83601 83095 gene locus_tag LOCUS_27390 83601 83095 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400945.1 protein_id gnl|my_center|LOCUS_27390 83687 84202 gene locus_tag LOCUS_27400 gene msrA 83687 84202 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400942.1 protein_id gnl|my_center|LOCUS_27400 85540 84215 gene locus_tag LOCUS_27410 85540 84215 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400938.1 protein_id gnl|my_center|LOCUS_27410 85669 86283 gene locus_tag LOCUS_27420 85669 86283 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400935.1 protein_id gnl|my_center|LOCUS_27420 86599 86811 gene locus_tag LOCUS_27430 86599 86811 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631673.1 protein_id gnl|my_center|LOCUS_27430 87875 86985 gene locus_tag LOCUS_27440 87875 86985 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899827.1 protein_id gnl|my_center|LOCUS_27440 89640 88600 gene locus_tag LOCUS_27450 89640 88600 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229398.1 protein_id gnl|my_center|LOCUS_27450 90224 89640 gene locus_tag LOCUS_27460 90224 89640 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229399.1 protein_id gnl|my_center|LOCUS_27460 90226 90429 gene locus_tag LOCUS_27470 90226 90429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 91029 90481 gene locus_tag LOCUS_27480 91029 90481 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_27480 91313 92260 gene locus_tag LOCUS_27490 91313 92260 CDS product F420-dependent hydroxymycolic acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899826.1 protein_id gnl|my_center|LOCUS_27490 92238 92456 gene locus_tag LOCUS_27500 92238 92456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 92682 93737 gene locus_tag LOCUS_27510 92682 93737 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899659.1 protein_id gnl|my_center|LOCUS_27510 95043 93685 gene locus_tag LOCUS_27520 95043 93685 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900746.1 protein_id gnl|my_center|LOCUS_27520 96583 95072 gene locus_tag LOCUS_27530 96583 95072 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226334.1 protein_id gnl|my_center|LOCUS_27530 97160 96762 gene locus_tag LOCUS_27540 97160 96762 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_27540 97297 97680 gene locus_tag LOCUS_27550 97297 97680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899671.1 protein_id gnl|my_center|LOCUS_27550 98163 98522 gene locus_tag LOCUS_27560 98163 98522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899672.1 protein_id gnl|my_center|LOCUS_27560 99164 98739 gene locus_tag LOCUS_27570 99164 98739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 99520 99272 gene locus_tag LOCUS_27580 99520 99272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 100298 99489 gene locus_tag LOCUS_27590 100298 99489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 100439 100603 gene locus_tag LOCUS_27600 100439 100603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 100707 100619 gene locus_tag LOCUS_t00390 100707 100619 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 101309 100737 gene locus_tag LOCUS_27610 101309 100737 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420508.1 protein_id gnl|my_center|LOCUS_27610 101836 101306 gene locus_tag LOCUS_27620 101836 101306 CDS product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420511.1 protein_id gnl|my_center|LOCUS_27620 101964 102902 gene locus_tag LOCUS_27630 101964 102902 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085324582.1 protein_id gnl|my_center|LOCUS_27630 103419 102865 gene locus_tag LOCUS_27640 103419 102865 CDS product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420517.1 protein_id gnl|my_center|LOCUS_27640 104230 103484 gene locus_tag LOCUS_27650 gene proZ 104230 103484 CDS product glycine betaine/carnitine/choline/L-proline ABC transporter permease ProZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420520.1 protein_id gnl|my_center|LOCUS_27650 104910 104227 gene locus_tag LOCUS_27660 gene proW 104910 104227 CDS product glycine betaine/carnitine/choline/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420526.1 protein_id gnl|my_center|LOCUS_27660 106014 104914 gene locus_tag LOCUS_27670 gene proV 106014 104914 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420529.1 protein_id gnl|my_center|LOCUS_27670 106962 106024 gene locus_tag LOCUS_27680 gene proX 106962 106024 CDS product glycine betaine/carnitine/choline/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950935.1 protein_id gnl|my_center|LOCUS_27680 107074 107412 gene locus_tag LOCUS_27690 107074 107412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 108035 107505 gene locus_tag LOCUS_27700 108035 107505 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080691825.1 protein_id gnl|my_center|LOCUS_27700 109365 108313 gene locus_tag LOCUS_27710 109365 108313 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420539.1 protein_id gnl|my_center|LOCUS_27710 109983 109375 gene locus_tag LOCUS_27720 109983 109375 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731215.1 protein_id gnl|my_center|LOCUS_27720 111987 110047 gene locus_tag LOCUS_27730 111987 110047 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900750.1 protein_id gnl|my_center|LOCUS_27730 112107 112580 gene locus_tag LOCUS_27740 gene lpqH 112107 112580 CDS product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420544.1 protein_id gnl|my_center|LOCUS_27740 114073 112646 gene locus_tag LOCUS_27750 gene tcrY 114073 112646 CDS product two-component system sensor histidine kinase TcrY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886181.1 protein_id gnl|my_center|LOCUS_27750 114866 114126 gene locus_tag LOCUS_27760 gene tcrX 114866 114126 CDS product two-component system response regulator TcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420552.1 protein_id gnl|my_center|LOCUS_27760 115332 114970 gene locus_tag LOCUS_27770 115332 114970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 115476 116303 gene locus_tag LOCUS_27780 115476 116303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912342.1 protein_id gnl|my_center|LOCUS_27780 116475 116810 gene locus_tag LOCUS_27790 116475 116810 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420560.1 protein_id gnl|my_center|LOCUS_27790 117228 117467 gene locus_tag LOCUS_27800 117228 117467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 117848 117543 gene locus_tag LOCUS_27810 117848 117543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 118475 119095 gene locus_tag LOCUS_27820 118475 119095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406626.1 protein_id gnl|my_center|LOCUS_27820 119187 119114 gene locus_tag LOCUS_t00400 119187 119114 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 119298 119208 gene locus_tag LOCUS_t00410 119298 119208 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 119382 120518 gene locus_tag LOCUS_27830 gene hisC 119382 120518 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420576.1 protein_id gnl|my_center|LOCUS_27830 121038 120493 gene locus_tag LOCUS_27840 121038 120493 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420580.1 protein_id gnl|my_center|LOCUS_27840 121110 121934 gene locus_tag LOCUS_27850 121110 121934 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420587.1 protein_id gnl|my_center|LOCUS_27850 121939 123210 gene locus_tag LOCUS_27860 gene lipE 121939 123210 CDS product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420590.1 protein_id gnl|my_center|LOCUS_27860 123411 123324 gene locus_tag LOCUS_t00420 123411 123324 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 123450 124430 gene locus_tag LOCUS_27870 123450 124430 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003907125.1 protein_id gnl|my_center|LOCUS_27870 125636 124440 gene locus_tag LOCUS_27880 125636 124440 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420595.1 protein_id gnl|my_center|LOCUS_27880 125762 127768 gene locus_tag LOCUS_27890 125762 127768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420597.1 protein_id gnl|my_center|LOCUS_27890 127784 128326 gene locus_tag LOCUS_27900 gene bpa 127784 128326 CDS product proteasome activator protein Bpa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900754.1 protein_id gnl|my_center|LOCUS_27900 128330 129169 gene locus_tag LOCUS_27910 128330 129169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907535.1 protein_id gnl|my_center|LOCUS_27910 129162 130091 gene locus_tag LOCUS_27920 gene glfT1 129162 130091 CDS product galactofuranosyl transferase GlfT1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420606.1 protein_id gnl|my_center|LOCUS_27920 130072 130914 gene locus_tag LOCUS_27930 130072 130914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420610.1 protein_id gnl|my_center|LOCUS_27930 130905 131309 gene locus_tag LOCUS_27940 130905 131309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 131619 131401 gene locus_tag LOCUS_27950 131619 131401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 131506 131877 gene locus_tag LOCUS_27960 131506 131877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 131942 132382 gene locus_tag LOCUS_27970 131942 132382 CDS product arabinogalactan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420627.1 protein_id gnl|my_center|LOCUS_27970 132405 133817 gene locus_tag LOCUS_27980 gene dprE1 132405 133817 CDS product decaprenylphospho-beta-D-ribofuranose 2-dehydrogenase DprE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420630.1 protein_id gnl|my_center|LOCUS_27980 133818 134582 gene locus_tag LOCUS_27990 133818 134582 CDS product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420632.1 protein_id gnl|my_center|LOCUS_27990 134669 136513 gene locus_tag LOCUS_28000 gene aftA 134669 136513 CDS product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899694.1 protein_id gnl|my_center|LOCUS_28000 136676 139909 gene locus_tag LOCUS_28010 gene embC 136676 139909 CDS product arabinosyltransferase EmbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420638.1 protein_id gnl|my_center|LOCUS_28010 140568 139945 gene locus_tag LOCUS_28020 140568 139945 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_28020 140727 144002 gene locus_tag LOCUS_28030 gene embA 140727 144002 CDS product arabinosyltransferase EmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899696.1 protein_id gnl|my_center|LOCUS_28030 144083 147232 gene locus_tag LOCUS_28040 gene embB 144083 147232 CDS product arabinosyltransferase EmbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950939.1 protein_id gnl|my_center|LOCUS_28040 148653 147238 gene locus_tag LOCUS_28050 148653 147238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 148889 149419 gene locus_tag LOCUS_28060 148889 149419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 149457 151250 gene locus_tag LOCUS_28070 149457 151250 CDS product DNA alkylation response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900757.1 protein_id gnl|my_center|LOCUS_28070 152885 151299 gene locus_tag LOCUS_28080 152885 151299 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420767.1 protein_id gnl|my_center|LOCUS_28080 158146 152882 gene locus_tag LOCUS_28090 gene pks13 158146 152882 CDS product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902557.1 protein_id gnl|my_center|LOCUS_28090 160050 158158 gene locus_tag LOCUS_28100 gene fadD32 160050 158158 CDS product long-chain-fatty-acid--AMP ligase FadD32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899700.1 protein_id gnl|my_center|LOCUS_28100 161388 160378 gene locus_tag LOCUS_28110 161388 160378 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420779.1 protein_id gnl|my_center|LOCUS_28110 162532 161570 gene locus_tag LOCUS_28120 162532 161570 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420783.1 protein_id gnl|my_center|LOCUS_28120 163656 162631 gene locus_tag LOCUS_28130 gene ag85A 163656 162631 CDS product diacylglycerol acyltransferase/mycolyltransferase Ag85A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900759.1 protein_id gnl|my_center|LOCUS_28130 165998 164010 gene locus_tag LOCUS_28140 gene aftB 165998 164010 CDS product terminal beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420786.1 protein_id gnl|my_center|LOCUS_28140 166890 165976 gene locus_tag LOCUS_28150 166890 165976 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420788.1 protein_id gnl|my_center|LOCUS_28150 167504 166887 gene locus_tag LOCUS_28160 167504 166887 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420792.1 protein_id gnl|my_center|LOCUS_28160 169428 167497 gene locus_tag LOCUS_28170 gene glfT2 169428 167497 CDS product galactofuranosyl transferase GlfT2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900761.1 protein_id gnl|my_center|LOCUS_28170 170621 169425 gene locus_tag LOCUS_28180 gene glf 170621 169425 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420798.1 protein_id gnl|my_center|LOCUS_28180 170909 171844 gene locus_tag LOCUS_28190 170909 171844 CDS product exported repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420801.1 protein_id gnl|my_center|LOCUS_28190 172043 173671 gene locus_tag LOCUS_28200 172043 173671 CDS product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420805.1 protein_id gnl|my_center|LOCUS_28200 173780 175186 gene locus_tag LOCUS_28210 173780 175186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 175362 176972 gene locus_tag LOCUS_28220 175362 176972 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420809.1 protein_id gnl|my_center|LOCUS_28220 177123 176989 gene locus_tag LOCUS_28230 177123 176989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 178082 177261 gene locus_tag LOCUS_28240 178082 177261 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420817.1 protein_id gnl|my_center|LOCUS_28240 178881 178096 gene locus_tag LOCUS_28250 178881 178096 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420820.1 protein_id gnl|my_center|LOCUS_28250 179659 178904 gene locus_tag LOCUS_28260 179659 178904 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420824.1 protein_id gnl|my_center|LOCUS_28260 180442 179663 gene locus_tag LOCUS_28270 180442 179663 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420827.1 protein_id gnl|my_center|LOCUS_28270 180510 181235 gene locus_tag LOCUS_28280 180510 181235 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420830.1 protein_id gnl|my_center|LOCUS_28280 181305 182855 gene locus_tag LOCUS_28290 181305 182855 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420837.1 protein_id gnl|my_center|LOCUS_28290 182852 183184 gene locus_tag LOCUS_28300 182852 183184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420840.1 protein_id gnl|my_center|LOCUS_28300 184521 183250 gene locus_tag LOCUS_28310 gene serS 184521 183250 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420889.1 protein_id gnl|my_center|LOCUS_28310 184632 186008 gene locus_tag LOCUS_28320 184632 186008 CDS product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420892.1 protein_id gnl|my_center|LOCUS_28320 186013 186363 gene locus_tag LOCUS_28330 186013 186363 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899719.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28330 186436 186639 gene locus_tag LOCUS_28340 186436 186639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897825.1 protein_id gnl|my_center|LOCUS_28340 187341 186655 gene locus_tag LOCUS_28350 187341 186655 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899720.1 protein_id gnl|my_center|LOCUS_28350 188312 187338 gene locus_tag LOCUS_28360 gene pheA 188312 187338 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420906.1 protein_id gnl|my_center|LOCUS_28360 188405 189187 gene locus_tag LOCUS_28370 188405 189187 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420910.1 protein_id gnl|my_center|LOCUS_28370 189531 190472 gene locus_tag LOCUS_28380 189531 190472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28380 190638 191183 gene locus_tag LOCUS_28390 gene bfrB 190638 191183 CDS product ferritin BfrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420920.1 protein_id gnl|my_center|LOCUS_28390 192105 191281 gene locus_tag LOCUS_28400 192105 191281 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420924.1 protein_id gnl|my_center|LOCUS_28400 192871 192110 gene locus_tag LOCUS_28410 192871 192110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 193667 193822 gene locus_tag LOCUS_28420 193667 193822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 193979 194602 gene locus_tag LOCUS_28430 193979 194602 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399735.1 protein_id gnl|my_center|LOCUS_28430 194934 195347 gene locus_tag LOCUS_28440 194934 195347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899730.1 protein_id gnl|my_center|LOCUS_28440 195599 196297 gene locus_tag LOCUS_28450 195599 196297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28450 196761 197159 gene locus_tag LOCUS_28460 gene espR 196761 197159 CDS product type VII secretion system ESX-1 transcriptional regulator EspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399759.1 protein_id gnl|my_center|LOCUS_28460 197266 197922 gene locus_tag LOCUS_28470 197266 197922 CDS product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399771.1 protein_id gnl|my_center|LOCUS_28470 197935 198225 gene locus_tag LOCUS_28480 197935 198225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 198314 198724 gene locus_tag LOCUS_28490 gene hns 198314 198724 CDS product histone-like protein Hns inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399779.1 protein_id gnl|my_center|LOCUS_28490 198742 199230 gene locus_tag LOCUS_28500 gene rraA 198742 199230 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399786.1 protein_id gnl|my_center|LOCUS_28500 200712 199234 gene locus_tag LOCUS_28510 gene ethA 200712 199234 CDS product FAD-containing monooxygenase EthA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899731.1 protein_id gnl|my_center|LOCUS_28510 200877 201434 gene locus_tag LOCUS_28520 gene ethR 200877 201434 CDS product HTH-type transcriptional regulator EthR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399797.1 protein_id gnl|my_center|LOCUS_28520 202473 201466 gene locus_tag LOCUS_28530 202473 201466 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399801.1 protein_id gnl|my_center|LOCUS_28530 202915 202703 gene locus_tag LOCUS_28540 202915 202703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 202844 203158 gene locus_tag LOCUS_28550 202844 203158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 204855 203389 gene locus_tag LOCUS_28560 204855 203389 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899732.1 protein_id gnl|my_center|LOCUS_28560 209443 204848 gene locus_tag LOCUS_28570 gene gltB 209443 204848 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399810.1 protein_id gnl|my_center|LOCUS_28570 209768 209983 gene locus_tag LOCUS_28580 209768 209983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 210612 211496 gene locus_tag LOCUS_28590 210612 211496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28590 211924 211637 gene locus_tag LOCUS_28600 gene whiB6 211924 211637 CDS product transcriptional regulator WhiB6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899734.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28600 212315 213496 gene locus_tag LOCUS_28610 212315 213496 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899735.1 protein_id gnl|my_center|LOCUS_28610 213742 214998 gene locus_tag LOCUS_28620 gene espE 213742 214998 CDS product type VII secretion system ESX-1 associated protein EspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399828.1 protein_id gnl|my_center|LOCUS_28620 215083 215394 gene locus_tag LOCUS_28630 gene espF 215083 215394 CDS product type VII secretion system ESX-1 associated protein EspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899737.1 protein_id gnl|my_center|LOCUS_28630 215397 216248 gene locus_tag LOCUS_28640 gene espG1 215397 216248 CDS product type VII secretion system ESX-1 adaptor EspG1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399839.1 protein_id gnl|my_center|LOCUS_28640 216229 216831 gene locus_tag LOCUS_28650 gene espH 216229 216831 CDS product type VII secretion system ESX-1 associated protein EspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399844.1 protein_id gnl|my_center|LOCUS_28650 216840 218549 gene locus_tag LOCUS_28660 gene eccA1 216840 218549 CDS product type VII secretion system ESX-1 AAA family ATPase EccA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399850.1 protein_id gnl|my_center|LOCUS_28660 218553 219995 gene locus_tag LOCUS_28670 gene eccB1 218553 219995 CDS product type VII secretion system ESX-1 subunit EccB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399854.1 protein_id gnl|my_center|LOCUS_28670 219995 222256 gene locus_tag LOCUS_28680 gene eccCa1 219995 222256 CDS product type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899738.1 protein_id gnl|my_center|LOCUS_28680 222253 224028 gene locus_tag LOCUS_28690 gene eccCb1 222253 224028 CDS product type VII secretion system ESX-1 FtsK/SpoIIIE family ATPase EccCb1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399865.1 protein_id gnl|my_center|LOCUS_28690 224287 225393 gene locus_tag LOCUS_28700 224287 225393 CDS product type VII secretion system ESX-1 target PPE68 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399879.1 protein_id gnl|my_center|LOCUS_28700 225486 225686 gene locus_tag LOCUS_28710 225486 225686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 225611 225913 gene locus_tag LOCUS_28720 gene esxB 225611 225913 CDS product type VII secretion system ESX-1 WXG100 family target CFP-10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399940.1 protein_id gnl|my_center|LOCUS_28720 >Feature sequence48 1377 631 gene locus_tag LOCUS_28730 gene istB 1377 631 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_28730 1835 1425 gene locus_tag LOCUS_28740 1835 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2346 1801 gene locus_tag LOCUS_28750 2346 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28750 2663 2872 gene locus_tag LOCUS_28760 2663 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 >Feature sequence49 402 974 gene locus_tag LOCUS_28770 402 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28770 971 1210 gene locus_tag LOCUS_28780 971 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28780 1354 1602 gene locus_tag LOCUS_28790 1354 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence50 1537 254 gene locus_tag LOCUS_28800 gene lipD 1537 254 CDS product lipase LipD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900433.1 protein_id gnl|my_center|LOCUS_28800 2898 2074 gene locus_tag LOCUS_28810 2898 2074 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_28810 3025 3492 gene locus_tag LOCUS_28820 3025 3492 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899082.1 protein_id gnl|my_center|LOCUS_28820 3970 8844 gene locus_tag LOCUS_28830 3970 8844 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886134.1 protein_id gnl|my_center|LOCUS_28830 9080 9289 gene locus_tag LOCUS_28840 9080 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 9277 9708 gene locus_tag LOCUS_28850 gene vapC21 9277 9708 CDS product type II toxin-antitoxin system toxin ribonuclease C21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414059.1 protein_id gnl|my_center|LOCUS_28850 12032 9732 gene locus_tag LOCUS_28860 gene aceA 12032 9732 CDS product isocitrate lyase ICL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409584.1 protein_id gnl|my_center|LOCUS_28860 12268 12477 gene locus_tag LOCUS_28870 12268 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 12967 12587 gene locus_tag LOCUS_28880 12967 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 13261 13752 gene locus_tag LOCUS_28890 13261 13752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 14339 13698 gene locus_tag LOCUS_28900 14339 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 15251 14616 gene locus_tag LOCUS_28910 15251 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 15576 15220 gene locus_tag LOCUS_28920 15576 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 16016 17020 gene locus_tag LOCUS_28930 16016 17020 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_28930 17017 17613 gene locus_tag LOCUS_28940 17017 17613 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409568.1 protein_id gnl|my_center|LOCUS_28940 18566 17688 gene locus_tag LOCUS_28950 18566 17688 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411952.1 protein_id gnl|my_center|LOCUS_28950 20017 18563 gene locus_tag LOCUS_28960 20017 18563 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411955.1 protein_id gnl|my_center|LOCUS_28960 20265 20450 gene locus_tag LOCUS_28970 20265 20450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 21292 20468 gene locus_tag LOCUS_28980 21292 20468 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411966.1 protein_id gnl|my_center|LOCUS_28980 23250 21289 gene locus_tag LOCUS_28990 23250 21289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411969.1 protein_id gnl|my_center|LOCUS_28990 23458 23940 gene locus_tag LOCUS_29000 23458 23940 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411970.1 protein_id gnl|my_center|LOCUS_29000 25173 23980 gene locus_tag LOCUS_29010 25173 23980 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235632064.1 protein_id gnl|my_center|LOCUS_29010 26886 25522 gene locus_tag LOCUS_29020 26886 25522 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411973.1 protein_id gnl|my_center|LOCUS_29020 27743 27240 gene locus_tag LOCUS_29030 27743 27240 CDS product LppP/LprE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411974.1 protein_id gnl|my_center|LOCUS_29030 27857 28438 gene locus_tag LOCUS_29040 27857 28438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29040 28554 29042 gene locus_tag LOCUS_29050 28554 29042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29050 29070 30710 gene locus_tag LOCUS_29060 29070 30710 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950697.1 protein_id gnl|my_center|LOCUS_29060 32304 30745 gene locus_tag LOCUS_29070 gene stp 32304 30745 CDS product multidrug resistance protein Stp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906797.1 protein_id gnl|my_center|LOCUS_29070 33160 32408 gene locus_tag LOCUS_29080 33160 32408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 33665 34876 gene locus_tag LOCUS_29090 33665 34876 CDS product TQXA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907958.1 protein_id gnl|my_center|LOCUS_29090 34873 35805 gene locus_tag LOCUS_29100 gene cysK 34873 35805 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_29100 35808 36515 gene locus_tag LOCUS_29110 gene cysE 35808 36515 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907956.1 protein_id gnl|my_center|LOCUS_29110 36538 36957 gene locus_tag LOCUS_29120 36538 36957 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730788.1 protein_id gnl|my_center|LOCUS_29120 37157 37609 gene locus_tag LOCUS_29130 37157 37609 CDS product DUF4395 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897207.1 protein_id gnl|my_center|LOCUS_29130 38101 37775 gene locus_tag LOCUS_29140 38101 37775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 38295 38222 gene locus_tag LOCUS_t00430 38295 38222 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 38461 38754 gene locus_tag LOCUS_29150 38461 38754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412045.1 protein_id gnl|my_center|LOCUS_29150 40626 38767 gene locus_tag LOCUS_29160 gene dnaG 40626 38767 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412049.1 protein_id gnl|my_center|LOCUS_29160 41983 40712 gene locus_tag LOCUS_29170 41983 40712 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899281.1 protein_id gnl|my_center|LOCUS_29170 42049 44055 gene locus_tag LOCUS_29180 42049 44055 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899282.1 protein_id gnl|my_center|LOCUS_29180 >Feature sequence51 >Feature sequence52 1076 105 gene locus_tag LOCUS_29190 1076 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2017 1241 gene locus_tag LOCUS_29200 2017 1241 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906617.1 protein_id gnl|my_center|LOCUS_29200 2400 3320 gene locus_tag LOCUS_29210 2400 3320 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407655.1 protein_id gnl|my_center|LOCUS_29210 4427 3330 gene locus_tag LOCUS_29220 4427 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 5494 4427 gene locus_tag LOCUS_29230 5494 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 6282 5491 gene locus_tag LOCUS_29240 6282 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 7960 6458 gene locus_tag LOCUS_29250 7960 6458 CDS product glycosyltransferase 87 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898905.1 protein_id gnl|my_center|LOCUS_29250 8139 9071 gene locus_tag LOCUS_29260 8139 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 9860 9081 gene locus_tag LOCUS_29270 9860 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 10761 10030 gene locus_tag LOCUS_29280 10761 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 11873 10764 gene locus_tag LOCUS_29290 11873 10764 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870578.1 protein_id gnl|my_center|LOCUS_29290 13784 11976 gene locus_tag LOCUS_29300 13784 11976 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775906.1 protein_id gnl|my_center|LOCUS_29300 14719 13781 gene locus_tag LOCUS_29310 14719 13781 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705135.1 protein_id gnl|my_center|LOCUS_29310 15498 14722 gene locus_tag LOCUS_29320 gene rfbF 15498 14722 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_29320 15580 17022 gene locus_tag LOCUS_29330 gene rfbH 15580 17022 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261040.1 protein_id gnl|my_center|LOCUS_29330 17025 18041 gene locus_tag LOCUS_29340 gene rfbG 17025 18041 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535171.1 protein_id gnl|my_center|LOCUS_29340 18038 18529 gene locus_tag LOCUS_29350 18038 18529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 18898 19122 gene locus_tag LOCUS_29360 18898 19122 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898900.1 protein_id gnl|my_center|LOCUS_29360 20295 19132 gene locus_tag LOCUS_29370 20295 19132 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407599.1 protein_id gnl|my_center|LOCUS_29370 21471 20482 gene locus_tag LOCUS_29380 gene meaB 21471 20482 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407596.1 protein_id gnl|my_center|LOCUS_29380 22777 21542 gene locus_tag LOCUS_29390 22777 21542 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898896.1 protein_id gnl|my_center|LOCUS_29390 25174 22910 gene locus_tag LOCUS_29400 gene scpA 25174 22910 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407587.1 protein_id gnl|my_center|LOCUS_29400 27060 25180 gene locus_tag LOCUS_29410 gene mutA 27060 25180 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407585.1 protein_id gnl|my_center|LOCUS_29410 27253 28020 gene locus_tag LOCUS_29420 27253 28020 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407583.1 protein_id gnl|my_center|LOCUS_29420 28075 28308 gene locus_tag LOCUS_29430 28075 28308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 28305 28712 gene locus_tag LOCUS_29440 28305 28712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 28717 29664 gene locus_tag LOCUS_29450 28717 29664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 <30325 29763 gene locus_tag LOCUS_29460 <30325 29763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003898977.1:HNH endonuclease signature motif containing protein >Feature sequence53 >Feature sequence54 52 1428 gene locus_tag LOCUS_29470 52 1428 CDS product IS30-like element ISBlo4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783747.1 protein_id gnl|my_center|LOCUS_29470 2950 1628 gene locus_tag LOCUS_29480 2950 1628 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419776.1 protein_id gnl|my_center|LOCUS_29480 3927 2950 gene locus_tag LOCUS_29490 3927 2950 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419775.1 protein_id gnl|my_center|LOCUS_29490 5066 3924 gene locus_tag LOCUS_29500 5066 3924 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899642.1 protein_id gnl|my_center|LOCUS_29500 5716 5063 gene locus_tag LOCUS_29510 5716 5063 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419770.1 protein_id gnl|my_center|LOCUS_29510 6880 5729 gene locus_tag LOCUS_29520 6880 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 7761 6931 gene locus_tag LOCUS_29530 7761 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 8041 8505 gene locus_tag LOCUS_29540 8041 8505 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419765.1 protein_id gnl|my_center|LOCUS_29540 10704 8500 gene locus_tag LOCUS_29550 10704 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 11327 10701 gene locus_tag LOCUS_29560 11327 10701 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256364.1 protein_id gnl|my_center|LOCUS_29560 11730 11317 gene locus_tag LOCUS_29570 gene rsbT 11730 11317 CDS product serine/threonine-protein kinase RsbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246640.1 protein_id gnl|my_center|LOCUS_29570 12121 11720 gene locus_tag LOCUS_29580 gene rsbS 12121 11720 CDS product RsbT antagonist protein RsbS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225190.1 protein_id gnl|my_center|LOCUS_29580 13056 12163 gene locus_tag LOCUS_29590 13056 12163 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257192.1 protein_id gnl|my_center|LOCUS_29590 13221 13589 gene locus_tag LOCUS_29600 13221 13589 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419762.1 protein_id gnl|my_center|LOCUS_29600 14753 13689 gene locus_tag LOCUS_29610 14753 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 15209 15529 gene locus_tag LOCUS_29620 15209 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 15679 15978 gene locus_tag LOCUS_29630 15679 15978 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908083.1 protein_id gnl|my_center|LOCUS_29630 16181 17539 gene locus_tag LOCUS_29640 16181 17539 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420440.1 protein_id gnl|my_center|LOCUS_29640 17553 18110 gene locus_tag LOCUS_29650 17553 18110 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420437.1 protein_id gnl|my_center|LOCUS_29650 19136 18030 gene locus_tag LOCUS_29660 19136 18030 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420436.1 protein_id gnl|my_center|LOCUS_29660 19198 20424 gene locus_tag LOCUS_29670 19198 20424 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104331.1 protein_id gnl|my_center|LOCUS_29670 20858 20421 gene locus_tag LOCUS_29680 20858 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 22028 20886 gene locus_tag LOCUS_29690 22028 20886 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420435.1 protein_id gnl|my_center|LOCUS_29690 21940 23106 gene locus_tag LOCUS_29700 gene ligD 21940 23106 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899657.1 protein_id gnl|my_center|LOCUS_29700 23287 23212 gene locus_tag LOCUS_t00440 23287 23212 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24455 23349 gene locus_tag LOCUS_29710 24455 23349 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901694.1 protein_id gnl|my_center|LOCUS_29710 25471 24452 gene locus_tag LOCUS_29720 25471 24452 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899637.1 protein_id gnl|my_center|LOCUS_29720 27867 25528 gene locus_tag LOCUS_29730 gene ponA2 27867 25528 CDS product transglycosylase/D,D-transpeptidase PonA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419746.1 protein_id gnl|my_center|LOCUS_29730 27806 28054 gene locus_tag LOCUS_29740 27806 28054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 28314 28670 gene locus_tag LOCUS_29750 gene whiB4 28314 28670 CDS product transcriptional regulator WhiB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419743.1 protein_id gnl|my_center|LOCUS_29750 29950 28808 gene locus_tag LOCUS_29760 29950 28808 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_29760 31008 29986 gene locus_tag LOCUS_29770 31008 29986 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419738.1 protein_id gnl|my_center|LOCUS_29770 31085 31246 gene locus_tag LOCUS_29780 31085 31246 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419736.1 protein_id gnl|my_center|LOCUS_29780 31260 31727 gene locus_tag LOCUS_29790 31260 31727 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_29790 31733 32521 gene locus_tag LOCUS_29800 31733 32521 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908818.1 protein_id gnl|my_center|LOCUS_29800 33406 32732 gene locus_tag LOCUS_29810 gene crp 33406 32732 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897584.1 protein_id gnl|my_center|LOCUS_29810 33897 33466 gene locus_tag LOCUS_29820 33897 33466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899635.1 protein_id gnl|my_center|LOCUS_29820 34071 34751 gene locus_tag LOCUS_29830 gene nth 34071 34751 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419724.1 protein_id gnl|my_center|LOCUS_29830 34770 35408 gene locus_tag LOCUS_29840 34770 35408 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419721.1 protein_id gnl|my_center|LOCUS_29840 35487 36272 gene locus_tag LOCUS_29850 35487 36272 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419718.1 protein_id gnl|my_center|LOCUS_29850 36269 37471 gene locus_tag LOCUS_29860 gene marP 36269 37471 CDS product acid resistance serine protease MarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419714.1 protein_id gnl|my_center|LOCUS_29860 38429 37464 gene locus_tag LOCUS_29870 38429 37464 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419712.1 protein_id gnl|my_center|LOCUS_29870 38936 38430 gene locus_tag LOCUS_29880 38936 38430 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419710.1 protein_id gnl|my_center|LOCUS_29880 39119 39817 gene locus_tag LOCUS_29890 39119 39817 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419708.1 protein_id gnl|my_center|LOCUS_29890 41818 39836 gene locus_tag LOCUS_29900 gene acs 41818 39836 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950924.1 protein_id gnl|my_center|LOCUS_29900 41869 43479 gene locus_tag LOCUS_29910 41869 43479 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950923.1 protein_id gnl|my_center|LOCUS_29910 43481 44407 gene locus_tag LOCUS_29920 43481 44407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419701.1 protein_id gnl|my_center|LOCUS_29920 44400 45263 gene locus_tag LOCUS_29930 44400 45263 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419699.1 protein_id gnl|my_center|LOCUS_29930 45260 46939 gene locus_tag LOCUS_29940 45260 46939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900733.1 protein_id gnl|my_center|LOCUS_29940 46936 47703 gene locus_tag LOCUS_29950 46936 47703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908809.1 protein_id gnl|my_center|LOCUS_29950 48989 48138 gene locus_tag LOCUS_29960 48989 48138 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419689.1 protein_id gnl|my_center|LOCUS_29960 49438 50559 gene locus_tag LOCUS_29970 gene ssd 49438 50559 CDS product septum site-determining protein Ssd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419685.1 protein_id gnl|my_center|LOCUS_29970 50556 51722 gene locus_tag LOCUS_29980 50556 51722 CDS product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901691.1 protein_id gnl|my_center|LOCUS_29980 51719 52513 gene locus_tag LOCUS_29990 51719 52513 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419679.1 protein_id gnl|my_center|LOCUS_29990 52510 53112 gene locus_tag LOCUS_30000 52510 53112 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419675.1 protein_id gnl|my_center|LOCUS_30000 53125 53328 gene locus_tag LOCUS_30010 53125 53328 CDS product DUF4244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419673.1 protein_id gnl|my_center|LOCUS_30010 53337 53651 gene locus_tag LOCUS_30020 53337 53651 CDS product TadE family type IV pilus minor pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419671.1 protein_id gnl|my_center|LOCUS_30020 53737 53997 gene locus_tag LOCUS_30030 53737 53997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 55485 54448 gene locus_tag LOCUS_30040 55485 54448 CDS product DUF5628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419657.1 protein_id gnl|my_center|LOCUS_30040 58567 56018 gene locus_tag LOCUS_30050 58567 56018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 61022 58704 gene locus_tag LOCUS_30060 61022 58704 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419652.1 protein_id gnl|my_center|LOCUS_30060 61270 61473 gene locus_tag LOCUS_30070 gene cspA 61270 61473 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419650.1 protein_id gnl|my_center|LOCUS_30070 61613 62191 gene locus_tag LOCUS_30080 61613 62191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419642.1 protein_id gnl|my_center|LOCUS_30080 62457 65186 gene locus_tag LOCUS_30090 gene topA 62457 65186 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899617.1 protein_id gnl|my_center|LOCUS_30090 66821 65190 gene locus_tag LOCUS_30100 66821 65190 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419638.1 protein_id gnl|my_center|LOCUS_30100 67302 67066 gene locus_tag LOCUS_30110 67302 67066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 67256 68182 gene locus_tag LOCUS_30120 67256 68182 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419637.1 protein_id gnl|my_center|LOCUS_30120 68228 68303 gene locus_tag LOCUS_t00450 68228 68303 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 68795 68454 gene locus_tag LOCUS_30130 68795 68454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 68716 69120 gene locus_tag LOCUS_30140 68716 69120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30140 71311 69503 gene locus_tag LOCUS_30150 71311 69503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419613.1 protein_id gnl|my_center|LOCUS_30150 71277 72218 gene locus_tag LOCUS_30160 gene galE1 71277 72218 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419610.1 protein_id gnl|my_center|LOCUS_30160 72643 72302 gene locus_tag LOCUS_30170 72643 72302 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419590.1 protein_id gnl|my_center|LOCUS_30170 73344 72640 gene locus_tag LOCUS_30180 73344 72640 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419585.1 protein_id gnl|my_center|LOCUS_30180 75658 74162 gene locus_tag LOCUS_30190 75658 74162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 77300 76026 gene locus_tag LOCUS_30200 77300 76026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419582.1 protein_id gnl|my_center|LOCUS_30200 77506 78633 gene locus_tag LOCUS_30210 77506 78633 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419580.1 protein_id gnl|my_center|LOCUS_30210 79161 78646 gene locus_tag LOCUS_30220 gene ppa 79161 78646 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419577.1 protein_id gnl|my_center|LOCUS_30220 79250 80638 gene locus_tag LOCUS_30230 gene dacB 79250 80638 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899610.1 protein_id gnl|my_center|LOCUS_30230 80614 81684 gene locus_tag LOCUS_30240 80614 81684 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419571.1 protein_id gnl|my_center|LOCUS_30240 81663 82658 gene locus_tag LOCUS_30250 gene tilS 81663 82658 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899608.1 protein_id gnl|my_center|LOCUS_30250 82698 83306 gene locus_tag LOCUS_30260 gene hpt 82698 83306 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419558.1 protein_id gnl|my_center|LOCUS_30260 84061 83312 gene locus_tag LOCUS_30270 84061 83312 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899606.1 protein_id gnl|my_center|LOCUS_30270 84576 84875 gene locus_tag LOCUS_30280 84576 84875 CDS product PE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899605.1 protein_id gnl|my_center|LOCUS_30280 84889 86130 gene locus_tag LOCUS_30290 84889 86130 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900723.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence55 <1 1260 gene locus_tag LOCUS_30300 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028592.1:cellulose binding domain-containing protein 1610 2716 gene locus_tag LOCUS_30310 1610 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30310 3129 2797 gene locus_tag LOCUS_30320 3129 2797 CDS product hemophore-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406169.1 protein_id gnl|my_center|LOCUS_30320 5367 3337 gene locus_tag LOCUS_30330 5367 3337 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911416.1 protein_id gnl|my_center|LOCUS_30330 5909 5364 gene locus_tag LOCUS_30340 5909 5364 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406182.1 protein_id gnl|my_center|LOCUS_30340 6135 6461 gene locus_tag LOCUS_30350 6135 6461 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908368.1 protein_id gnl|my_center|LOCUS_30350 6494 7594 gene locus_tag LOCUS_30360 gene dapC 6494 7594 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903345.1 protein_id gnl|my_center|LOCUS_30360 10415 7671 gene locus_tag LOCUS_30370 10415 7671 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_30370 10578 10844 gene locus_tag LOCUS_30380 10578 10844 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_30380 10829 11221 gene locus_tag LOCUS_30390 10829 11221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 12341 11565 gene locus_tag LOCUS_30400 12341 11565 CDS product Stf0 family sulphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093093.1 protein_id gnl|my_center|LOCUS_30400 12838 12443 gene locus_tag LOCUS_30410 12838 12443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 13120 12839 gene locus_tag LOCUS_30420 13120 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 14893 13310 gene locus_tag LOCUS_30430 14893 13310 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406197.1 protein_id gnl|my_center|LOCUS_30430 14982 16613 gene locus_tag LOCUS_30440 gene pruA 14982 16613 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900286.1 protein_id gnl|my_center|LOCUS_30440 16613 17602 gene locus_tag LOCUS_30450 16613 17602 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900287.1 protein_id gnl|my_center|LOCUS_30450 17967 18437 gene locus_tag LOCUS_30460 17967 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30460 18415 18867 gene locus_tag LOCUS_30470 18415 18867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 18898 19854 gene locus_tag LOCUS_30480 18898 19854 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406215.1 protein_id gnl|my_center|LOCUS_30480 19942 20769 gene locus_tag LOCUS_30490 19942 20769 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898763.1 protein_id gnl|my_center|LOCUS_30490 20807 22225 gene locus_tag LOCUS_30500 20807 22225 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406218.1 protein_id gnl|my_center|LOCUS_30500 24920 22347 gene locus_tag LOCUS_30510 24920 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 25988 25653 gene locus_tag LOCUS_30520 25988 25653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 26918 26376 gene locus_tag LOCUS_30530 26918 26376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 28530 27610 gene locus_tag LOCUS_30540 gene dapD 28530 27610 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898768.1 protein_id gnl|my_center|LOCUS_30540 28654 29715 gene locus_tag LOCUS_30550 gene dapE 28654 29715 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406235.1 protein_id gnl|my_center|LOCUS_30550 32008 29813 gene locus_tag LOCUS_30560 32008 29813 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104277.1 protein_id gnl|my_center|LOCUS_30560 32098 32655 gene locus_tag LOCUS_30570 32098 32655 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898770.1 protein_id gnl|my_center|LOCUS_30570 32687 34480 gene locus_tag LOCUS_30580 gene fadD6 32687 34480 CDS product long-chain-acyl-CoA synthetase FadD6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406240.1 protein_id gnl|my_center|LOCUS_30580 34931 36202 gene locus_tag LOCUS_30590 gene lipY 34931 36202 CDS product triacylglycerol lipase LipY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901542.1 protein_id gnl|my_center|LOCUS_30590 36496 37458 gene locus_tag LOCUS_30600 gene folP 36496 37458 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406241.1 protein_id gnl|my_center|LOCUS_30600 37455 38435 gene locus_tag LOCUS_30610 37455 38435 CDS product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406242.1 protein_id gnl|my_center|LOCUS_30610 38474 38836 gene locus_tag LOCUS_30620 38474 38836 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908107.1 protein_id gnl|my_center|LOCUS_30620 38833 39465 gene locus_tag LOCUS_30630 38833 39465 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406244.1 protein_id gnl|my_center|LOCUS_30630 39580 39747 gene locus_tag LOCUS_30640 39580 39747 CDS product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406247.1 protein_id gnl|my_center|LOCUS_30640 40935 39772 gene locus_tag LOCUS_30650 gene glgA 40935 39772 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898773.1 protein_id gnl|my_center|LOCUS_30650 41175 42389 gene locus_tag LOCUS_30660 gene glgC 41175 42389 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406249.1 protein_id gnl|my_center|LOCUS_30660 44160 42472 gene locus_tag LOCUS_30670 44160 42472 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904576.1 protein_id gnl|my_center|LOCUS_30670 44900 44226 gene locus_tag LOCUS_30680 44900 44226 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406252.1 protein_id gnl|my_center|LOCUS_30680 46578 44932 gene locus_tag LOCUS_30690 46578 44932 CDS product multidrug efflux ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898775.1 protein_id gnl|my_center|LOCUS_30690 47522 46575 gene locus_tag LOCUS_30700 47522 46575 CDS product multidrug efflux ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900295.1 protein_id gnl|my_center|LOCUS_30700 48180 47512 gene locus_tag LOCUS_30710 gene raaS 48180 47512 CDS product transcriptional regulator RaaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406254.1 protein_id gnl|my_center|LOCUS_30710 48972 48277 gene locus_tag LOCUS_30720 48972 48277 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908112.1 protein_id gnl|my_center|LOCUS_30720 49164 49928 gene locus_tag LOCUS_30730 gene sigE 49164 49928 CDS product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323761.1 protein_id gnl|my_center|LOCUS_30730 50085 50471 gene locus_tag LOCUS_30740 gene rseA 50085 50471 CDS product anti-sigma E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406258.1 protein_id gnl|my_center|LOCUS_30740 50621 52138 gene locus_tag LOCUS_30750 gene htrA 50621 52138 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898779.1 protein_id gnl|my_center|LOCUS_30750 52191 52565 gene locus_tag LOCUS_30760 gene tatB 52191 52565 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406260.1 protein_id gnl|my_center|LOCUS_30760 53749 52640 gene locus_tag LOCUS_30770 53749 52640 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406273.1 protein_id gnl|my_center|LOCUS_30770 55184 53838 gene locus_tag LOCUS_30780 55184 53838 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950506.1 protein_id gnl|my_center|LOCUS_30780 55842 55300 gene locus_tag LOCUS_30790 55842 55300 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406283.1 protein_id gnl|my_center|LOCUS_30790 57206 55839 gene locus_tag LOCUS_30800 57206 55839 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406286.1 protein_id gnl|my_center|LOCUS_30800 57806 57213 gene locus_tag LOCUS_30810 57806 57213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 58084 58530 gene locus_tag LOCUS_30820 58084 58530 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406290.1 protein_id gnl|my_center|LOCUS_30820 58538 59941 gene locus_tag LOCUS_30830 gene lpqY 58538 59941 CDS product trehalose ABC transporter substrate-binding protein LpqY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898783.1 protein_id gnl|my_center|LOCUS_30830 59938 60846 gene locus_tag LOCUS_30840 gene sugA 59938 60846 CDS product trehalose ABC transporter permease SugA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406295.1 protein_id gnl|my_center|LOCUS_30840 60836 61690 gene locus_tag LOCUS_30850 gene sugB 60836 61690 CDS product trehalose ABC transporter permease SugB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900298.1 protein_id gnl|my_center|LOCUS_30850 61695 62867 gene locus_tag LOCUS_30860 gene sugC 61695 62867 CDS product trehalose ABC transporter ATP-binding protein SugC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406299.1 protein_id gnl|my_center|LOCUS_30860 63942 62941 gene locus_tag LOCUS_30870 gene corA 63942 62941 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003916789.1 protein_id gnl|my_center|LOCUS_30870 64210 65199 gene locus_tag LOCUS_30880 64210 65199 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406301.1 protein_id gnl|my_center|LOCUS_30880 66005 65685 gene locus_tag LOCUS_30890 66005 65685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 66338 67612 gene locus_tag LOCUS_30900 66338 67612 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878221.1 protein_id gnl|my_center|LOCUS_30900 67609 68460 gene locus_tag LOCUS_30910 67609 68460 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900301.1 protein_id gnl|my_center|LOCUS_30910 69367 68537 gene locus_tag LOCUS_30920 69367 68537 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898788.1 protein_id gnl|my_center|LOCUS_30920 73312 69668 gene locus_tag LOCUS_30930 73312 69668 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950509.1 protein_id gnl|my_center|LOCUS_30930 74232 73558 gene locus_tag LOCUS_30940 74232 73558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406325.1 protein_id gnl|my_center|LOCUS_30940 74467 75249 gene locus_tag LOCUS_30950 74467 75249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30950 75177 76286 gene locus_tag LOCUS_30960 75177 76286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30960 76647 76366 gene locus_tag LOCUS_30970 76647 76366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30970 76712 77044 gene locus_tag LOCUS_30980 76712 77044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 77267 78409 gene locus_tag LOCUS_30990 77267 78409 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908130.1 protein_id gnl|my_center|LOCUS_30990 78410 79954 gene locus_tag LOCUS_31000 78410 79954 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093271.1 protein_id gnl|my_center|LOCUS_31000 80008 80814 gene locus_tag LOCUS_31010 80008 80814 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085299.1 protein_id gnl|my_center|LOCUS_31010 80795 82039 gene locus_tag LOCUS_31020 80795 82039 CDS product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296487.1 protein_id gnl|my_center|LOCUS_31020 82113 82829 gene locus_tag LOCUS_31030 82113 82829 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110745.1 protein_id gnl|my_center|LOCUS_31030 83781 82843 gene locus_tag LOCUS_31040 83781 82843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 84032 83832 gene locus_tag LOCUS_31050 84032 83832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31050 85486 84119 gene locus_tag LOCUS_31060 85486 84119 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406358.1 protein_id gnl|my_center|LOCUS_31060 86744 85497 gene locus_tag LOCUS_31070 86744 85497 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406359.1 protein_id gnl|my_center|LOCUS_31070 86853 87665 gene locus_tag LOCUS_31080 86853 87665 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406360.1 protein_id gnl|my_center|LOCUS_31080 87680 88816 gene locus_tag LOCUS_31090 87680 88816 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406361.1 protein_id gnl|my_center|LOCUS_31090 89280 88861 gene locus_tag LOCUS_31100 89280 88861 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406366.1 protein_id gnl|my_center|LOCUS_31100 89348 90739 gene locus_tag LOCUS_31110 89348 90739 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406369.1 protein_id gnl|my_center|LOCUS_31110 90794 91948 gene locus_tag LOCUS_31120 90794 91948 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406372.1 protein_id gnl|my_center|LOCUS_31120 92220 92813 gene locus_tag LOCUS_31130 gene abmR 92220 92813 CDS product transcriptional regulator AbmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406375.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31130 94244 92844 gene locus_tag LOCUS_31140 94244 92844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31140 <94834 94250 gene locus_tag LOCUS_31150 <94834 94250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950514.1:serine/threonine-protein kinase PknH/PknJ >Feature sequence56 911 588 gene locus_tag LOCUS_31160 911 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1048 896 gene locus_tag LOCUS_31170 1048 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 1905 1045 gene locus_tag LOCUS_31180 gene mmaA1 1905 1045 CDS product mycolic acid methyltransferase MmaA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403310.1 protein_id gnl|my_center|LOCUS_31180 2864 1959 gene locus_tag LOCUS_31190 gene lipG 2864 1959 CDS product lipase/esterase LipG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403314.1 protein_id gnl|my_center|LOCUS_31190 4210 2864 gene locus_tag LOCUS_31200 4210 2864 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403317.1 protein_id gnl|my_center|LOCUS_31200 4690 6978 gene locus_tag LOCUS_31210 4690 6978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 7178 7420 gene locus_tag LOCUS_31220 7178 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 7803 10847 gene locus_tag LOCUS_31230 7803 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 11193 15908 gene locus_tag LOCUS_31240 11193 15908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 16441 15905 gene locus_tag LOCUS_31250 16441 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 16846 21027 gene locus_tag LOCUS_31260 16846 21027 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003910172.1 protein_id gnl|my_center|LOCUS_31260 21024 21635 gene locus_tag LOCUS_31270 21024 21635 CDS product malonyl CoA-ACP transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403326.1 protein_id gnl|my_center|LOCUS_31270 21641 22561 gene locus_tag LOCUS_31280 21641 22561 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403330.1 protein_id gnl|my_center|LOCUS_31280 22859 23428 gene locus_tag LOCUS_31290 gene rplJ 22859 23428 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403341.1 protein_id gnl|my_center|LOCUS_31290 23460 23852 gene locus_tag LOCUS_31300 gene rplL 23460 23852 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403353.1 protein_id gnl|my_center|LOCUS_31300 24531 23845 gene locus_tag LOCUS_31310 24531 23845 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403355.1 protein_id gnl|my_center|LOCUS_31310 24633 26138 gene locus_tag LOCUS_31320 24633 26138 CDS product carotenoid cleavage oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403360.1 protein_id gnl|my_center|LOCUS_31320 26287 27297 gene locus_tag LOCUS_31330 26287 27297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403363.1 protein_id gnl|my_center|LOCUS_31330 27737 31303 gene locus_tag LOCUS_31340 27737 31303 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900992.1 protein_id gnl|my_center|LOCUS_31340 31344 35294 gene locus_tag LOCUS_31350 31344 35294 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403413.1 protein_id gnl|my_center|LOCUS_31350 35545 35291 gene locus_tag LOCUS_31360 35545 35291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 35573 36301 gene locus_tag LOCUS_31370 35573 36301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411581.1 protein_id gnl|my_center|LOCUS_31370 38328 36394 gene locus_tag LOCUS_31380 38328 36394 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900995.1 protein_id gnl|my_center|LOCUS_31380 38471 39229 gene locus_tag LOCUS_31390 38471 39229 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403419.1 protein_id gnl|my_center|LOCUS_31390 39284 40129 gene locus_tag LOCUS_31400 39284 40129 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_31400 40186 41826 gene locus_tag LOCUS_31410 40186 41826 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403423.1 protein_id gnl|my_center|LOCUS_31410 41823 42761 gene locus_tag LOCUS_31420 41823 42761 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403426.1 protein_id gnl|my_center|LOCUS_31420 42776 43504 gene locus_tag LOCUS_31430 42776 43504 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403429.1 protein_id gnl|my_center|LOCUS_31430 43497 44261 gene locus_tag LOCUS_31440 43497 44261 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403433.1 protein_id gnl|my_center|LOCUS_31440 44746 44267 gene locus_tag LOCUS_31450 44746 44267 CDS product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403446.1 protein_id gnl|my_center|LOCUS_31450 45128 44763 gene locus_tag LOCUS_31460 45128 44763 CDS product DUF3060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403448.1 protein_id gnl|my_center|LOCUS_31460 45362 46009 gene locus_tag LOCUS_31470 45362 46009 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403451.1 protein_id gnl|my_center|LOCUS_31470 46261 46635 gene locus_tag LOCUS_31480 gene rpsL 46261 46635 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007167812.1 protein_id gnl|my_center|LOCUS_31480 46635 47105 gene locus_tag LOCUS_31490 gene rpsG 46635 47105 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908590.1 protein_id gnl|my_center|LOCUS_31490 47180 49285 gene locus_tag LOCUS_31500 gene fusA 47180 49285 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898554.1 protein_id gnl|my_center|LOCUS_31500 49476 50666 gene locus_tag LOCUS_31510 gene tuf 49476 50666 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403463.1 protein_id gnl|my_center|LOCUS_31510 50797 51603 gene locus_tag LOCUS_31520 50797 51603 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403465.1 protein_id gnl|my_center|LOCUS_31520 51687 52514 gene locus_tag LOCUS_31530 51687 52514 CDS product Rv0687 family mycofactocin-dependent SDR oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403468.1 protein_id gnl|my_center|LOCUS_31530 52539 53723 gene locus_tag LOCUS_31540 52539 53723 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901000.1 protein_id gnl|my_center|LOCUS_31540 53962 54480 gene locus_tag LOCUS_31550 53962 54480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 54480 54887 gene locus_tag LOCUS_31560 54480 54887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 56385 55339 gene locus_tag LOCUS_31570 56385 55339 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403477.1 protein_id gnl|my_center|LOCUS_31570 56978 56382 gene locus_tag LOCUS_31580 gene mftR 56978 56382 CDS product mycofactocin system transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403482.1 protein_id gnl|my_center|LOCUS_31580 57155 57448 gene locus_tag LOCUS_31590 gene mftB 57155 57448 CDS product mycofactocin biosynthesis chaperone MftB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403486.1 protein_id gnl|my_center|LOCUS_31590 57445 58623 gene locus_tag LOCUS_31600 gene mftC 57445 58623 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403490.1 protein_id gnl|my_center|LOCUS_31600 58626 59816 gene locus_tag LOCUS_31610 gene mftD 58626 59816 CDS product mycofactocin biosynthesis FMN-dependent deaminase MftD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898557.1 protein_id gnl|my_center|LOCUS_31610 59918 60649 gene locus_tag LOCUS_31620 gene mftE 59918 60649 CDS product mycofactocin biosynthesis peptidyl-dipeptidase MftE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403497.1 protein_id gnl|my_center|LOCUS_31620 60647 60876 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgaccgcgccggcgacgatgcagagc 60773 60786 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 60903 62321 gene locus_tag LOCUS_31630 gene mftF 60903 62321 CDS product mycofactocin biosynthesis glycosyltransferase MftF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403501.1 protein_id gnl|my_center|LOCUS_31630 62325 63764 gene locus_tag LOCUS_31640 gene mftG 62325 63764 CDS product mycofactocin system GMC family oxidoreductase MftG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403503.1 protein_id gnl|my_center|LOCUS_31640 64151 64456 gene locus_tag LOCUS_31650 gene rpsJ 64151 64456 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403578.1 protein_id gnl|my_center|LOCUS_31650 64471 65124 gene locus_tag LOCUS_31660 gene rplC 64471 65124 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403579.1 protein_id gnl|my_center|LOCUS_31660 65124 65786 gene locus_tag LOCUS_31670 gene rplD 65124 65786 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403580.1 protein_id gnl|my_center|LOCUS_31670 65786 66088 gene locus_tag LOCUS_31680 gene rplW 65786 66088 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403581.1 protein_id gnl|my_center|LOCUS_31680 66196 67038 gene locus_tag LOCUS_31690 gene rplB 66196 67038 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403582.1 protein_id gnl|my_center|LOCUS_31690 67105 67386 gene locus_tag LOCUS_31700 gene rpsS 67105 67386 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892827.1 protein_id gnl|my_center|LOCUS_31700 67424 67999 gene locus_tag LOCUS_31710 gene rplV 67424 67999 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403587.1 protein_id gnl|my_center|LOCUS_31710 67999 68841 gene locus_tag LOCUS_31720 gene rpsC 67999 68841 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403590.1 protein_id gnl|my_center|LOCUS_31720 68845 69261 gene locus_tag LOCUS_31730 gene rplP 68845 69261 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908579.1 protein_id gnl|my_center|LOCUS_31730 69261 69503 gene locus_tag LOCUS_31740 gene rpmC 69261 69503 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323024.1 protein_id gnl|my_center|LOCUS_31740 69503 69886 gene locus_tag LOCUS_31750 gene rpsQ 69503 69886 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898560.1 protein_id gnl|my_center|LOCUS_31750 71173 70487 gene locus_tag LOCUS_31760 71173 70487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 71288 72535 gene locus_tag LOCUS_31770 71288 72535 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898584.1 protein_id gnl|my_center|LOCUS_31770 72639 74999 gene locus_tag LOCUS_31780 gene atsA 72639 74999 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898561.1 protein_id gnl|my_center|LOCUS_31780 75007 75669 gene locus_tag LOCUS_31790 75007 75669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 75671 76567 gene locus_tag LOCUS_31800 75671 76567 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403610.1 protein_id gnl|my_center|LOCUS_31800 76810 78162 gene locus_tag LOCUS_31810 76810 78162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 78790 79056 gene locus_tag LOCUS_31820 78790 79056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 79064 79432 gene locus_tag LOCUS_31830 79064 79432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 79609 79977 gene locus_tag LOCUS_31840 gene rplN 79609 79977 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403649.1 protein_id gnl|my_center|LOCUS_31840 79978 80295 gene locus_tag LOCUS_31850 gene rplX 79978 80295 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403654.1 protein_id gnl|my_center|LOCUS_31850 80298 80870 gene locus_tag LOCUS_31860 gene rplE 80298 80870 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403660.1 protein_id gnl|my_center|LOCUS_31860 80875 81060 gene locus_tag LOCUS_31870 80875 81060 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908573.1 protein_id gnl|my_center|LOCUS_31870 81136 81534 gene locus_tag LOCUS_31880 gene rpsH 81136 81534 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403669.1 protein_id gnl|my_center|LOCUS_31880 81558 82097 gene locus_tag LOCUS_31890 gene rplF 81558 82097 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403673.1 protein_id gnl|my_center|LOCUS_31890 82094 82468 gene locus_tag LOCUS_31900 gene rplR 82094 82468 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403677.1 protein_id gnl|my_center|LOCUS_31900 82488 83165 gene locus_tag LOCUS_31910 gene rpsE 82488 83165 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403680.1 protein_id gnl|my_center|LOCUS_31910 83162 83377 gene locus_tag LOCUS_31920 gene rpmD 83162 83377 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403683.1 protein_id gnl|my_center|LOCUS_31920 83374 83814 gene locus_tag LOCUS_31930 gene rplO 83374 83814 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403685.1 protein_id gnl|my_center|LOCUS_31930 83917 85698 gene locus_tag LOCUS_31940 gene sppA 83917 85698 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898564.1 protein_id gnl|my_center|LOCUS_31940 86625 85687 gene locus_tag LOCUS_31950 86625 85687 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408497.1 protein_id gnl|my_center|LOCUS_31950 87590 86622 gene locus_tag LOCUS_31960 87590 86622 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403691.1 protein_id gnl|my_center|LOCUS_31960 87773 88069 gene locus_tag LOCUS_31970 87773 88069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 88122 88352 gene locus_tag LOCUS_31980 88122 88352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 89089 88397 gene locus_tag LOCUS_31990 89089 88397 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403695.1 protein_id gnl|my_center|LOCUS_31990 90075 89086 gene locus_tag LOCUS_32000 gene serA 90075 89086 CDS product D-3-phosphoglycerate dehydrogenase SerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403698.1 protein_id gnl|my_center|LOCUS_32000 90088 91437 gene locus_tag LOCUS_32010 90088 91437 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403701.1 protein_id gnl|my_center|LOCUS_32010 91465 92130 gene locus_tag LOCUS_32020 91465 92130 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403710.1 protein_id gnl|my_center|LOCUS_32020 92637 93962 gene locus_tag LOCUS_32030 gene secY 92637 93962 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403723.1 protein_id gnl|my_center|LOCUS_32030 93971 94561 gene locus_tag LOCUS_32040 93971 94561 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403726.1 protein_id gnl|my_center|LOCUS_32040 94564 95364 gene locus_tag LOCUS_32050 gene map 94564 95364 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403728.1 protein_id gnl|my_center|LOCUS_32050 95712 96245 gene locus_tag LOCUS_32060 gene sigL 95712 96245 CDS product sigma-70 family RNA polymerase sigma factor SigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403731.1 protein_id gnl|my_center|LOCUS_32060 96318 97043 gene locus_tag LOCUS_32070 gene rslA 96318 97043 CDS product anti-sigma-L factor RslA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403733.1 protein_id gnl|my_center|LOCUS_32070 97103 97417 gene locus_tag LOCUS_32080 97103 97417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 98371 97745 gene locus_tag LOCUS_32090 98371 97745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 98452 98619 gene locus_tag LOCUS_32100 98452 98619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 98818 98624 gene locus_tag LOCUS_32110 98818 98624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 98772 99272 gene locus_tag LOCUS_32120 98772 99272 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403738.1 protein_id gnl|my_center|LOCUS_32120 99706 100254 gene locus_tag LOCUS_32130 99706 100254 CDS product TIGR03086 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403741.1 protein_id gnl|my_center|LOCUS_32130 100309 100953 gene locus_tag LOCUS_32140 100309 100953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32140 101562 101699 gene locus_tag LOCUS_32150 101562 101699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32150 102592 101717 gene locus_tag LOCUS_32160 gene mmsB 102592 101717 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403844.1 protein_id gnl|my_center|LOCUS_32160 103763 102603 gene locus_tag LOCUS_32170 103763 102603 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403845.1 protein_id gnl|my_center|LOCUS_32170 105297 103777 gene locus_tag LOCUS_32180 105297 103777 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403847.1 protein_id gnl|my_center|LOCUS_32180 106679 105390 gene locus_tag LOCUS_32190 106679 105390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899261.1 protein_id gnl|my_center|LOCUS_32190 <107571 106978 gene locus_tag LOCUS_32200 <107571 106978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003906341.1:HNH endonuclease signature motif containing protein >Feature sequence57 >Feature sequence58 >Feature sequence59 1105 308 gene locus_tag LOCUS_32210 1105 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32210 2679 1102 gene locus_tag LOCUS_32220 2679 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32220 2855 3127 gene locus_tag LOCUS_32230 2855 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3124 3573 gene locus_tag LOCUS_32240 3124 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408263.1 protein_id gnl|my_center|LOCUS_32240 4883 3585 gene locus_tag LOCUS_32250 4883 3585 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408264.1 protein_id gnl|my_center|LOCUS_32250 5859 4927 gene locus_tag LOCUS_32260 5859 4927 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_32260 6106 5903 gene locus_tag LOCUS_32270 6106 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32270 7588 6917 gene locus_tag LOCUS_32280 gene merB 7588 6917 CDS product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296236.1 protein_id gnl|my_center|LOCUS_32280 9009 7600 gene locus_tag LOCUS_32290 gene merA 9009 7600 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 protein_id gnl|my_center|LOCUS_32290 9116 9484 gene locus_tag LOCUS_32300 9116 9484 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296233.1 protein_id gnl|my_center|LOCUS_32300 9890 10390 gene locus_tag LOCUS_32310 9890 10390 CDS product hypoxia response transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900026.1 protein_id gnl|my_center|LOCUS_32310 11251 10517 gene locus_tag LOCUS_32320 gene cmr 11251 10517 CDS product HTH-type transcriptional regulator Cmr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408268.1 protein_id gnl|my_center|LOCUS_32320 11371 11940 gene locus_tag LOCUS_32330 11371 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 11966 12277 gene locus_tag LOCUS_32340 11966 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 12322 12897 gene locus_tag LOCUS_32350 12322 12897 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408270.1 protein_id gnl|my_center|LOCUS_32350 13118 14026 gene locus_tag LOCUS_32360 13118 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408272.1 protein_id gnl|my_center|LOCUS_32360 14026 15147 gene locus_tag LOCUS_32370 14026 15147 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408274.1 protein_id gnl|my_center|LOCUS_32370 15156 15980 gene locus_tag LOCUS_32380 15156 15980 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898971.1 protein_id gnl|my_center|LOCUS_32380 15974 16972 gene locus_tag LOCUS_32390 15974 16972 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408279.1 protein_id gnl|my_center|LOCUS_32390 17151 17678 gene locus_tag LOCUS_32400 17151 17678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 19220 17688 gene locus_tag LOCUS_32410 19220 17688 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898492.1 protein_id gnl|my_center|LOCUS_32410 19376 22420 gene locus_tag LOCUS_32420 19376 22420 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408360.1 protein_id gnl|my_center|LOCUS_32420 22413 22637 gene locus_tag LOCUS_32430 22413 22637 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408362.1 protein_id gnl|my_center|LOCUS_32430 23094 22603 gene locus_tag LOCUS_32440 23094 22603 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408366.1 protein_id gnl|my_center|LOCUS_32440 24046 23228 gene locus_tag LOCUS_32450 24046 23228 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912666.1 protein_id gnl|my_center|LOCUS_32450 24720 23980 gene locus_tag LOCUS_32460 24720 23980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895205.1 protein_id gnl|my_center|LOCUS_32460 24803 25414 gene locus_tag LOCUS_32470 24803 25414 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408373.1 protein_id gnl|my_center|LOCUS_32470 25433 26698 gene locus_tag LOCUS_32480 gene tyrS 25433 26698 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408375.1 protein_id gnl|my_center|LOCUS_32480 29322 28141 gene locus_tag LOCUS_32490 29322 28141 CDS product YcaO-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898850.1 protein_id gnl|my_center|LOCUS_32490 29908 30291 gene locus_tag LOCUS_32500 gene lprJ 29908 30291 CDS product lipoprotein LprJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408378.1 protein_id gnl|my_center|LOCUS_32500 30491 31180 gene locus_tag LOCUS_32510 30491 31180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408379.1 protein_id gnl|my_center|LOCUS_32510 31173 32183 gene locus_tag LOCUS_32520 31173 32183 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408380.1 protein_id gnl|my_center|LOCUS_32520 32208 32396 gene locus_tag LOCUS_32530 32208 32396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408381.1 protein_id gnl|my_center|LOCUS_32530 32404 33213 gene locus_tag LOCUS_32540 gene tlyA 32404 33213 CDS product 16S/23S rRNA (cytidine-2'-O)-methyltransferase TlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408382.1 protein_id gnl|my_center|LOCUS_32540 33210 34133 gene locus_tag LOCUS_32550 33210 34133 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408383.1 protein_id gnl|my_center|LOCUS_32550 34130 35896 gene locus_tag LOCUS_32560 gene recN 34130 35896 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408385.1 protein_id gnl|my_center|LOCUS_32560 36069 37250 gene locus_tag LOCUS_32570 gene steA 36069 37250 CDS product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408387.1 protein_id gnl|my_center|LOCUS_32570 37263 38210 gene locus_tag LOCUS_32580 gene mctB 37263 38210 CDS product copper transporter MctB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408390.1 protein_id gnl|my_center|LOCUS_32580 38320 40071 gene locus_tag LOCUS_32590 38320 40071 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408396.1 protein_id gnl|my_center|LOCUS_32590 40064 40687 gene locus_tag LOCUS_32600 40064 40687 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408399.1 protein_id gnl|my_center|LOCUS_32600 40684 41625 gene locus_tag LOCUS_32610 gene xerD 40684 41625 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408401.1 protein_id gnl|my_center|LOCUS_32610 41652 43433 gene locus_tag LOCUS_32620 41652 43433 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049746009.1 protein_id gnl|my_center|LOCUS_32620 46895 43665 gene locus_tag LOCUS_32630 46895 43665 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776321.1 protein_id gnl|my_center|LOCUS_32630 47745 46993 gene locus_tag LOCUS_32640 47745 46993 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014848103.1 protein_id gnl|my_center|LOCUS_32640 48023 47745 gene locus_tag LOCUS_32650 48023 47745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 47947 49089 gene locus_tag LOCUS_32660 47947 49089 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_32660 49053 49937 gene locus_tag LOCUS_32670 49053 49937 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028852.1 protein_id gnl|my_center|LOCUS_32670 49937 51358 gene locus_tag LOCUS_32680 49937 51358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 51355 52206 gene locus_tag LOCUS_32690 51355 52206 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028849.1 protein_id gnl|my_center|LOCUS_32690 52206 53336 gene locus_tag LOCUS_32700 gene eboE 52206 53336 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031018.1 protein_id gnl|my_center|LOCUS_32700 53333 54718 gene locus_tag LOCUS_32710 53333 54718 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715488.1 protein_id gnl|my_center|LOCUS_32710 54727 55944 gene locus_tag LOCUS_32720 54727 55944 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104541.1 protein_id gnl|my_center|LOCUS_32720 57491 55947 gene locus_tag LOCUS_32730 57491 55947 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403977.1 protein_id gnl|my_center|LOCUS_32730 57832 59253 gene locus_tag LOCUS_32740 57832 59253 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950576.1 protein_id gnl|my_center|LOCUS_32740 59308 60264 gene locus_tag LOCUS_32750 59308 60264 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898982.1 protein_id gnl|my_center|LOCUS_32750 60261 61151 gene locus_tag LOCUS_32760 60261 61151 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408432.1 protein_id gnl|my_center|LOCUS_32760 61114 61809 gene locus_tag LOCUS_32770 gene scpB 61114 61809 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408436.1 protein_id gnl|my_center|LOCUS_32770 61806 62561 gene locus_tag LOCUS_32780 61806 62561 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408439.1 protein_id gnl|my_center|LOCUS_32780 62645 63328 gene locus_tag LOCUS_32790 gene cmk 62645 63328 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408441.1 protein_id gnl|my_center|LOCUS_32790 63325 64716 gene locus_tag LOCUS_32800 gene der 63325 64716 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898984.1 protein_id gnl|my_center|LOCUS_32800 64892 65692 gene locus_tag LOCUS_32810 64892 65692 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408444.1 protein_id gnl|my_center|LOCUS_32810 65686 66591 gene locus_tag LOCUS_32820 65686 66591 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898985.1 protein_id gnl|my_center|LOCUS_32820 66594 67418 gene locus_tag LOCUS_32830 66594 67418 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075549536.1 protein_id gnl|my_center|LOCUS_32830 67418 67762 gene locus_tag LOCUS_32840 67418 67762 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898986.1 protein_id gnl|my_center|LOCUS_32840 67759 68577 gene locus_tag LOCUS_32850 67759 68577 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408456.1 protein_id gnl|my_center|LOCUS_32850 68591 69370 gene locus_tag LOCUS_32860 68591 69370 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408460.1 protein_id gnl|my_center|LOCUS_32860 69487 69645 gene locus_tag LOCUS_32870 69487 69645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 69806 69880 gene locus_tag LOCUS_t00460 69806 69880 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 70465 70025 gene locus_tag LOCUS_32880 70465 70025 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393507.1 protein_id gnl|my_center|LOCUS_32880 70691 70452 gene locus_tag LOCUS_32890 70691 70452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 71346 70849 gene locus_tag LOCUS_32900 71346 70849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408483.1 protein_id gnl|my_center|LOCUS_32900 72167 71496 gene locus_tag LOCUS_32910 72167 71496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408495.1 protein_id gnl|my_center|LOCUS_32910 72626 72270 gene locus_tag LOCUS_32920 72626 72270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 73662 72592 gene locus_tag LOCUS_32930 73662 72592 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_32930 75193 73724 gene locus_tag LOCUS_32940 75193 73724 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095821.1 protein_id gnl|my_center|LOCUS_32940 75646 77202 gene locus_tag LOCUS_32950 75646 77202 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898989.1 protein_id gnl|my_center|LOCUS_32950 77760 77212 gene locus_tag LOCUS_32960 77760 77212 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408503.1 protein_id gnl|my_center|LOCUS_32960 79647 77977 gene locus_tag LOCUS_32970 79647 77977 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_32970 79764 80129 gene locus_tag LOCUS_32980 gene vapC30 79764 80129 CDS product type II toxin-antitoxin system toxin ribonuclease C30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403236.1 protein_id gnl|my_center|LOCUS_32980 80139 80876 gene locus_tag LOCUS_32990 80139 80876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898997.1 protein_id gnl|my_center|LOCUS_32990 81074 82888 gene locus_tag LOCUS_33000 gene pknE 81074 82888 CDS product serine/threonine protein kinase PknE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898998.1 protein_id gnl|my_center|LOCUS_33000 82937 83533 gene locus_tag LOCUS_33010 82937 83533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 85679 83511 gene locus_tag LOCUS_33020 85679 83511 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727254.1 protein_id gnl|my_center|LOCUS_33020 86653 85676 gene locus_tag LOCUS_33030 86653 85676 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727255.1 protein_id gnl|my_center|LOCUS_33030 87254 86658 gene locus_tag LOCUS_33040 87254 86658 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157890372.1 protein_id gnl|my_center|LOCUS_33040 87553 88986 gene locus_tag LOCUS_33050 gene pknF 87553 88986 CDS product serine/threonine protein kinase PknF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899000.1 protein_id gnl|my_center|LOCUS_33050 89032 91668 gene locus_tag LOCUS_33060 89032 91668 CDS product ATP transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408545.1 protein_id gnl|my_center|LOCUS_33060 91721 92110 gene locus_tag LOCUS_33070 91721 92110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 92175 92849 gene locus_tag LOCUS_33080 92175 92849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408551.1 protein_id gnl|my_center|LOCUS_33080 94607 93006 gene locus_tag LOCUS_33090 gene fadD1 94607 93006 CDS product fatty-acid--CoA ligase FadD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408558.1 protein_id gnl|my_center|LOCUS_33090 95254 94604 gene locus_tag LOCUS_33100 95254 94604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 95362 96612 gene locus_tag LOCUS_33110 95362 96612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730849.1 protein_id gnl|my_center|LOCUS_33110 97103 97279 gene locus_tag LOCUS_33120 97103 97279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 97422 99428 gene locus_tag LOCUS_33130 97422 99428 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901256.1 protein_id gnl|my_center|LOCUS_33130 99540 100715 gene locus_tag LOCUS_33140 99540 100715 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408560.1 protein_id gnl|my_center|LOCUS_33140 100708 101712 gene locus_tag LOCUS_33150 100708 101712 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223398.1 protein_id gnl|my_center|LOCUS_33150 101914 102159 gene locus_tag LOCUS_33160 101914 102159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 103830 102259 gene locus_tag LOCUS_33170 103830 102259 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900400.1 protein_id gnl|my_center|LOCUS_33170 105146 104070 gene locus_tag LOCUS_33180 105146 104070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 105145 105363 gene locus_tag LOCUS_33190 105145 105363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 105374 108190 gene locus_tag LOCUS_33200 105374 108190 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903597.1 protein_id gnl|my_center|LOCUS_33200 108375 109058 gene locus_tag LOCUS_33210 gene cut1 108375 109058 CDS product cutinase Cut1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950592.1 protein_id gnl|my_center|LOCUS_33210 109291 110721 gene locus_tag LOCUS_33220 109291 110721 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886129.1 protein_id gnl|my_center|LOCUS_33220 111108 110725 gene locus_tag LOCUS_33230 111108 110725 CDS product DUF5073 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899008.1 protein_id gnl|my_center|LOCUS_33230 111896 111108 gene locus_tag LOCUS_33240 111896 111108 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899009.1 protein_id gnl|my_center|LOCUS_33240 112625 112134 gene locus_tag LOCUS_33250 112625 112134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728515.1 protein_id gnl|my_center|LOCUS_33250 112832 112650 gene locus_tag LOCUS_33260 112832 112650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 >Feature sequence60 >Feature sequence61 >Feature sequence62 899 174 gene locus_tag LOCUS_33270 gene ldtMt1 899 174 CDS product L,D-transpeptidase LdtMt1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400856.1 protein_id gnl|my_center|LOCUS_33270 1198 2148 gene locus_tag LOCUS_33280 gene oxyS 1198 2148 CDS product LysR family transcriptional regulator OxyS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400857.1 protein_id gnl|my_center|LOCUS_33280 3826 2132 gene locus_tag LOCUS_33290 gene oxc 3826 2132 CDS product oxalyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400858.1 protein_id gnl|my_center|LOCUS_33290 4074 5675 gene locus_tag LOCUS_33300 4074 5675 CDS product FadD7 family fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901806.1 protein_id gnl|my_center|LOCUS_33300 6215 5679 gene locus_tag LOCUS_33310 6215 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 8375 6228 gene locus_tag LOCUS_33320 8375 6228 CDS product elongation factor G-like protein EF-G2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400860.1 protein_id gnl|my_center|LOCUS_33320 8973 8566 gene locus_tag LOCUS_33330 8973 8566 CDS product TIGR03668 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400864.1 protein_id gnl|my_center|LOCUS_33330 9171 10184 gene locus_tag LOCUS_33340 9171 10184 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400885.1 protein_id gnl|my_center|LOCUS_33340 10192 12096 gene locus_tag LOCUS_33350 gene treS 10192 12096 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400893.1 protein_id gnl|my_center|LOCUS_33350 12093 13466 gene locus_tag LOCUS_33360 gene mak 12093 13466 CDS product maltokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899824.1 protein_id gnl|my_center|LOCUS_33360 14941 13928 gene locus_tag LOCUS_33370 gene ag85C 14941 13928 CDS product diacylglycerol acyltransferase/mycolyltransferase Ag85C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400908.1 protein_id gnl|my_center|LOCUS_33370 15163 15699 gene locus_tag LOCUS_33380 gene htdZ 15163 15699 CDS product 3-hydroxyacyl-thioester dehydratase HtdZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400912.1 protein_id gnl|my_center|LOCUS_33380 17071 15767 gene locus_tag LOCUS_33390 17071 15767 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400917.1 protein_id gnl|my_center|LOCUS_33390 18152 17574 gene locus_tag LOCUS_33400 18152 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086838026.1 protein_id gnl|my_center|LOCUS_33400 18454 18149 gene locus_tag LOCUS_33410 18454 18149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 21785 18579 gene locus_tag LOCUS_33420 21785 18579 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900743.1 protein_id gnl|my_center|LOCUS_33420 23626 21782 gene locus_tag LOCUS_33430 23626 21782 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420431.1 protein_id gnl|my_center|LOCUS_33430 25633 24443 gene locus_tag LOCUS_33440 25633 24443 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900742.1 protein_id gnl|my_center|LOCUS_33440 25773 25934 gene locus_tag LOCUS_33450 25773 25934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 26913 25936 gene locus_tag LOCUS_33460 26913 25936 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041180327.1 protein_id gnl|my_center|LOCUS_33460 27547 28926 gene locus_tag LOCUS_33470 27547 28926 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400938.1 protein_id gnl|my_center|LOCUS_33470 28927 29121 gene locus_tag LOCUS_33480 28927 29121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 29830 29528 gene locus_tag LOCUS_33490 29830 29528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33490 31991 30003 gene locus_tag LOCUS_33500 31991 30003 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899665.1 protein_id gnl|my_center|LOCUS_33500 32094 32444 gene locus_tag LOCUS_33510 gene nmtR 32094 32444 CDS product Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor NmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901716.1 protein_id gnl|my_center|LOCUS_33510 32477 33214 gene locus_tag LOCUS_33520 32477 33214 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_33520 34066 33224 gene locus_tag LOCUS_33530 gene lucA 34066 33224 CDS product lipid uptake coordinator LucA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420421.1 protein_id gnl|my_center|LOCUS_33530 34245 34157 gene locus_tag LOCUS_t00470 34245 34157 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34484 35779 gene locus_tag LOCUS_33540 34484 35779 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 protein_id gnl|my_center|LOCUS_33540 35867 37552 gene locus_tag LOCUS_33550 35867 37552 CDS product DNA polymerase III subunits gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420417.1 protein_id gnl|my_center|LOCUS_33550 38866 37556 gene locus_tag LOCUS_33560 38866 37556 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899652.1 protein_id gnl|my_center|LOCUS_33560 40062 38863 gene locus_tag LOCUS_33570 40062 38863 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917236.1 protein_id gnl|my_center|LOCUS_33570 40320 40766 gene locus_tag LOCUS_33580 40320 40766 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899651.1 protein_id gnl|my_center|LOCUS_33580 41506 40763 gene locus_tag LOCUS_33590 41506 40763 CDS product Rv3717 family N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420410.1 protein_id gnl|my_center|LOCUS_33590 41623 42084 gene locus_tag LOCUS_33600 41623 42084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 42096 42707 gene locus_tag LOCUS_33610 gene recR 42096 42707 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420407.1 protein_id gnl|my_center|LOCUS_33610 42951 43646 gene locus_tag LOCUS_33620 42951 43646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420405.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33620 44335 43643 gene locus_tag LOCUS_33630 44335 43643 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900739.1 protein_id gnl|my_center|LOCUS_33630 45581 44343 gene locus_tag LOCUS_33640 45581 44343 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900738.1 protein_id gnl|my_center|LOCUS_33640 45765 46697 gene locus_tag LOCUS_33650 45765 46697 CDS product DEDDh family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420320.1 protein_id gnl|my_center|LOCUS_33650 48702 46726 gene locus_tag LOCUS_33660 gene leuA 48702 46726 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023349635.1 protein_id gnl|my_center|LOCUS_33660 49031 50290 gene locus_tag LOCUS_33670 49031 50290 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911958.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence63 1645 1914 gene locus_tag LOCUS_33680 1645 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2006 2566 gene locus_tag LOCUS_33690 2006 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence64 1726 1980 gene locus_tag LOCUS_33700 1726 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 3596 2025 gene locus_tag LOCUS_33710 3596 2025 CDS product DUF4185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408678.1 protein_id gnl|my_center|LOCUS_33710 4888 3812 gene locus_tag LOCUS_33720 4888 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404767.1 protein_id gnl|my_center|LOCUS_33720 5699 4908 gene locus_tag LOCUS_33730 5699 4908 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404769.1 protein_id gnl|my_center|LOCUS_33730 6041 7147 gene locus_tag LOCUS_33740 gene pstS 6041 7147 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404775.1 protein_id gnl|my_center|LOCUS_33740 7169 8143 gene locus_tag LOCUS_33750 gene pstC 7169 8143 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404779.1 protein_id gnl|my_center|LOCUS_33750 8140 9042 gene locus_tag LOCUS_33760 gene pstA 8140 9042 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886095.1 protein_id gnl|my_center|LOCUS_33760 11175 9076 gene locus_tag LOCUS_33770 gene pknD 11175 9076 CDS product serine/threonine protein kinase PknD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404782.1 protein_id gnl|my_center|LOCUS_33770 12644 11538 gene locus_tag LOCUS_33780 gene pstS 12644 11538 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404784.1 protein_id gnl|my_center|LOCUS_33780 13548 12691 gene locus_tag LOCUS_33790 13548 12691 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404795.1 protein_id gnl|my_center|LOCUS_33790 13826 14530 gene locus_tag LOCUS_33800 13826 14530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 14362 14387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 14451 14693 gene locus_tag LOCUS_33810 14451 14693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 14734 14904 gene locus_tag LOCUS_33820 14734 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 14901 16322 gene locus_tag LOCUS_33830 14901 16322 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903979.1 protein_id gnl|my_center|LOCUS_33830 16319 16813 gene locus_tag LOCUS_33840 16319 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903978.1 protein_id gnl|my_center|LOCUS_33840 16886 17122 gene locus_tag LOCUS_33850 16886 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 17242 17508 gene locus_tag LOCUS_33860 17242 17508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 17510 19306 gene locus_tag LOCUS_33870 17510 19306 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921306.1 protein_id gnl|my_center|LOCUS_33870 19303 19710 gene locus_tag LOCUS_33880 19303 19710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900698.1 protein_id gnl|my_center|LOCUS_33880 19707 20039 gene locus_tag LOCUS_33890 19707 20039 CDS product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899414.1 protein_id gnl|my_center|LOCUS_33890 20151 20657 gene locus_tag LOCUS_33900 20151 20657 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900701.1 protein_id gnl|my_center|LOCUS_33900 20815 21348 gene locus_tag LOCUS_33910 20815 21348 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899412.1 protein_id gnl|my_center|LOCUS_33910 21353 22786 gene locus_tag LOCUS_33920 21353 22786 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900703.1 protein_id gnl|my_center|LOCUS_33920 23157 22912 gene locus_tag LOCUS_33930 23157 22912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 23333 23154 gene locus_tag LOCUS_33940 23333 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 23509 23330 gene locus_tag LOCUS_33950 23509 23330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 23738 24007 gene locus_tag LOCUS_33960 23738 24007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 24004 26433 gene locus_tag LOCUS_33970 24004 26433 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898655.1 protein_id gnl|my_center|LOCUS_33970 26430 28373 gene locus_tag LOCUS_33980 26430 28373 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404801.1 protein_id gnl|my_center|LOCUS_33980 29165 28461 gene locus_tag LOCUS_33990 29165 28461 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404823.1 protein_id gnl|my_center|LOCUS_33990 31039 29804 gene locus_tag LOCUS_34000 31039 29804 CDS product DUF4873 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898656.1 protein_id gnl|my_center|LOCUS_34000 31956 31036 gene locus_tag LOCUS_34010 31956 31036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 32388 34064 gene locus_tag LOCUS_34020 32388 34064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 34128 34991 gene locus_tag LOCUS_34030 34128 34991 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082947.1 protein_id gnl|my_center|LOCUS_34030 35008 35754 gene locus_tag LOCUS_34040 35008 35754 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404829.1 protein_id gnl|my_center|LOCUS_34040 37483 35822 gene locus_tag LOCUS_34050 gene pgi 37483 35822 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404830.1 protein_id gnl|my_center|LOCUS_34050 38582 37623 gene locus_tag LOCUS_34060 38582 37623 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729176.1 protein_id gnl|my_center|LOCUS_34060 38929 38657 gene locus_tag LOCUS_34070 38929 38657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 40216 39314 gene locus_tag LOCUS_34080 gene ag85B 40216 39314 CDS product diacylglycerol acyltransferase/mycolyltransferase Ag85B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409456.1 protein_id gnl|my_center|LOCUS_34080 40376 42685 gene locus_tag LOCUS_34090 gene pcrA 40376 42685 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404859.1 protein_id gnl|my_center|LOCUS_34090 43342 42761 gene locus_tag LOCUS_34100 43342 42761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730597.1 protein_id gnl|my_center|LOCUS_34100 44392 43346 gene locus_tag LOCUS_34110 44392 43346 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404862.1 protein_id gnl|my_center|LOCUS_34110 44590 45819 gene locus_tag LOCUS_34120 gene sucC 44590 45819 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898659.1 protein_id gnl|my_center|LOCUS_34120 45893 46795 gene locus_tag LOCUS_34130 gene sucD 45893 46795 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900240.1 protein_id gnl|my_center|LOCUS_34130 47709 46861 gene locus_tag LOCUS_34140 47709 46861 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404873.1 protein_id gnl|my_center|LOCUS_34140 47868 48770 gene locus_tag LOCUS_34150 47868 48770 CDS product DUF5336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404875.1 protein_id gnl|my_center|LOCUS_34150 48810 50147 gene locus_tag LOCUS_34160 48810 50147 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901049.1 protein_id gnl|my_center|LOCUS_34160 50340 50987 gene locus_tag LOCUS_34170 gene purN 50340 50987 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898661.1 protein_id gnl|my_center|LOCUS_34170 50984 52555 gene locus_tag LOCUS_34180 gene purH 50984 52555 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404890.1 protein_id gnl|my_center|LOCUS_34180 52711 54054 gene locus_tag LOCUS_34190 52711 54054 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404892.1 protein_id gnl|my_center|LOCUS_34190 54047 56029 gene locus_tag LOCUS_34200 54047 56029 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404895.1 protein_id gnl|my_center|LOCUS_34200 56666 56031 gene locus_tag LOCUS_34210 56666 56031 CDS product LppA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898662.1 protein_id gnl|my_center|LOCUS_34210 57370 56699 gene locus_tag LOCUS_34220 57370 56699 CDS product LppA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898662.1 protein_id gnl|my_center|LOCUS_34220 58947 57367 gene locus_tag LOCUS_34230 58947 57367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 59391 59047 gene locus_tag LOCUS_34240 59391 59047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404920.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34240 59894 59490 gene locus_tag LOCUS_34250 59894 59490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 60810 60208 gene locus_tag LOCUS_34260 60810 60208 CDS product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886096.1 protein_id gnl|my_center|LOCUS_34260 61114 61242 gene locus_tag LOCUS_34270 61114 61242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence65 1240 1935 gene locus_tag LOCUS_34280 1240 1935 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110996.1 protein_id gnl|my_center|LOCUS_34280 2710 2057 gene locus_tag LOCUS_34290 2710 2057 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413654.1 protein_id gnl|my_center|LOCUS_34290 3563 2874 gene locus_tag LOCUS_34300 3563 2874 CDS product chloramphenicol phosphotransferase CPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899406.1 protein_id gnl|my_center|LOCUS_34300 4061 3675 gene locus_tag LOCUS_34310 4061 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3979 6171 gene locus_tag LOCUS_34320 3979 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 6240 6548 gene locus_tag LOCUS_34330 6240 6548 CDS product DUF1876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413619.1 protein_id gnl|my_center|LOCUS_34330 7941 6616 gene locus_tag LOCUS_34340 7941 6616 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403001.1 protein_id gnl|my_center|LOCUS_34340 9153 8032 gene locus_tag LOCUS_34350 9153 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413610.1 protein_id gnl|my_center|LOCUS_34350 9408 10145 gene locus_tag LOCUS_34360 9408 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 10671 11699 gene locus_tag LOCUS_34370 10671 11699 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899402.1 protein_id gnl|my_center|LOCUS_34370 11975 11652 gene locus_tag LOCUS_34380 11975 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34380 13473 12271 gene locus_tag LOCUS_34390 13473 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 13758 13618 gene locus_tag LOCUS_34400 13758 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 15169 13742 gene locus_tag LOCUS_34410 gene tgs1 15169 13742 CDS product diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899932.1 protein_id gnl|my_center|LOCUS_34410 15346 16053 gene locus_tag LOCUS_34420 15346 16053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 16205 16636 gene locus_tag LOCUS_34430 gene hrp1 16205 16636 CDS product hypoxic response protein Hrp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413598.1 protein_id gnl|my_center|LOCUS_34430 16688 17827 gene locus_tag LOCUS_34440 16688 17827 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899401.1 protein_id gnl|my_center|LOCUS_34440 17867 18661 gene locus_tag LOCUS_34450 17867 18661 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413594.1 protein_id gnl|my_center|LOCUS_34450 19657 18830 gene locus_tag LOCUS_34460 19657 18830 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413589.1 protein_id gnl|my_center|LOCUS_34460 19911 20573 gene locus_tag LOCUS_34470 19911 20573 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413588.1 protein_id gnl|my_center|LOCUS_34470 20570 20995 gene locus_tag LOCUS_34480 20570 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077089871.1 protein_id gnl|my_center|LOCUS_34480 21029 21373 gene locus_tag LOCUS_34490 21029 21373 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413583.1 protein_id gnl|my_center|LOCUS_34490 22189 21479 gene locus_tag LOCUS_34500 22189 21479 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901437.1 protein_id gnl|my_center|LOCUS_34500 22286 22729 gene locus_tag LOCUS_34510 22286 22729 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413574.1 protein_id gnl|my_center|LOCUS_34510 23831 23328 gene locus_tag LOCUS_34520 23831 23328 CDS product DUF1990 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413569.1 protein_id gnl|my_center|LOCUS_34520 23889 24701 gene locus_tag LOCUS_34530 23889 24701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 24764 26584 gene locus_tag LOCUS_34540 24764 26584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 26801 27823 gene locus_tag LOCUS_34550 26801 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 27896 30019 gene locus_tag LOCUS_34560 gene thrS 27896 30019 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413486.1 protein_id gnl|my_center|LOCUS_34560 30012 30596 gene locus_tag LOCUS_34570 30012 30596 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413484.1 protein_id gnl|my_center|LOCUS_34570 30694 31359 gene locus_tag LOCUS_34580 gene pgsA1 30694 31359 CDS product phosphatidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413482.1 protein_id gnl|my_center|LOCUS_34580 31356 32360 gene locus_tag LOCUS_34590 31356 32360 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900533.1 protein_id gnl|my_center|LOCUS_34590 32371 33507 gene locus_tag LOCUS_34600 gene pimA 32371 33507 CDS product phosphatidyl-myo-inositol alpha-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413478.1 protein_id gnl|my_center|LOCUS_34600 33507 34553 gene locus_tag LOCUS_34610 33507 34553 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413475.1 protein_id gnl|my_center|LOCUS_34610 36347 34554 gene locus_tag LOCUS_34620 36347 34554 CDS product PE-PPE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899395.1 protein_id gnl|my_center|LOCUS_34620 36653 36408 gene locus_tag LOCUS_34630 36653 36408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 36652 37500 gene locus_tag LOCUS_34640 gene pdxS 36652 37500 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413468.1 protein_id gnl|my_center|LOCUS_34640 37510 38346 gene locus_tag LOCUS_34650 gene tesB 37510 38346 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413466.1 protein_id gnl|my_center|LOCUS_34650 38354 38950 gene locus_tag LOCUS_34660 gene pdxT 38354 38950 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413465.1 protein_id gnl|my_center|LOCUS_34660 39230 39985 gene locus_tag LOCUS_34670 39230 39985 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413464.1 protein_id gnl|my_center|LOCUS_34670 41356 40028 gene locus_tag LOCUS_34680 41356 40028 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904629.1 protein_id gnl|my_center|LOCUS_34680 42916 41357 gene locus_tag LOCUS_34690 42916 41357 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899392.1 protein_id gnl|my_center|LOCUS_34690 43395 42913 gene locus_tag LOCUS_34700 43395 42913 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413451.1 protein_id gnl|my_center|LOCUS_34700 43853 43422 gene locus_tag LOCUS_34710 43853 43422 CDS product DUF4247 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899390.1 protein_id gnl|my_center|LOCUS_34710 44362 43850 gene locus_tag LOCUS_34720 44362 43850 CDS product DUF2617 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413444.1 protein_id gnl|my_center|LOCUS_34720 44984 44376 gene locus_tag LOCUS_34730 44984 44376 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413441.1 protein_id gnl|my_center|LOCUS_34730 45493 45089 gene locus_tag LOCUS_34740 45493 45089 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413432.1 protein_id gnl|my_center|LOCUS_34740 45735 45490 gene locus_tag LOCUS_34750 45735 45490 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413429.1 protein_id gnl|my_center|LOCUS_34750 45856 46407 gene locus_tag LOCUS_34760 gene ruvC 45856 46407 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413426.1 protein_id gnl|my_center|LOCUS_34760 46404 47000 gene locus_tag LOCUS_34770 gene ruvA 46404 47000 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413421.1 protein_id gnl|my_center|LOCUS_34770 46997 48046 gene locus_tag LOCUS_34780 gene ruvB 46997 48046 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413416.1 protein_id gnl|my_center|LOCUS_34780 49475 48123 gene locus_tag LOCUS_34790 49475 48123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34790 49466 49801 gene locus_tag LOCUS_34800 49466 49801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 51115 49796 gene locus_tag LOCUS_34810 51115 49796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 51420 51064 gene locus_tag LOCUS_34820 51420 51064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34820 51653 51453 gene locus_tag LOCUS_34830 51653 51453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 55357 51833 gene locus_tag LOCUS_34840 55357 51833 CDS product thioester reductase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413409.1 protein_id gnl|my_center|LOCUS_34840 56841 55501 gene locus_tag LOCUS_34850 gene gabT 56841 55501 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413395.1 protein_id gnl|my_center|LOCUS_34850 57014 57367 gene locus_tag LOCUS_34860 gene yajC 57014 57367 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413391.1 protein_id gnl|my_center|LOCUS_34860 57408 59180 gene locus_tag LOCUS_34870 gene secD 57408 59180 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413385.1 protein_id gnl|my_center|LOCUS_34870 59185 60456 gene locus_tag LOCUS_34880 gene secF 59185 60456 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950745.1 protein_id gnl|my_center|LOCUS_34880 60463 62121 gene locus_tag LOCUS_34890 60463 62121 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413373.1 protein_id gnl|my_center|LOCUS_34890 62118 62660 gene locus_tag LOCUS_34900 62118 62660 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413369.1 protein_id gnl|my_center|LOCUS_34900 62904 62671 gene locus_tag LOCUS_34910 62904 62671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 62792 65095 gene locus_tag LOCUS_34920 62792 65095 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413368.1 protein_id gnl|my_center|LOCUS_34920 66060 65179 gene locus_tag LOCUS_34930 gene ppiB 66060 65179 CDS product peptidylprolyl isomerase PpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413367.1 protein_id gnl|my_center|LOCUS_34930 66159 66827 gene locus_tag LOCUS_34940 66159 66827 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413366.1 protein_id gnl|my_center|LOCUS_34940 66831 68129 gene locus_tag LOCUS_34950 gene hisS 66831 68129 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413365.1 protein_id gnl|my_center|LOCUS_34950 69008 68100 gene locus_tag LOCUS_34960 69008 68100 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_34960 69224 70246 gene locus_tag LOCUS_34970 69224 70246 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413359.1 protein_id gnl|my_center|LOCUS_34970 71851 70259 gene locus_tag LOCUS_34980 71851 70259 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413355.1 protein_id gnl|my_center|LOCUS_34980 72727 71897 gene locus_tag LOCUS_34990 72727 71897 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_34990 72820 73218 gene locus_tag LOCUS_35000 72820 73218 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413352.1 protein_id gnl|my_center|LOCUS_35000 74338 73322 gene locus_tag LOCUS_35010 74338 73322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 75336 74458 gene locus_tag LOCUS_35020 75336 74458 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899384.1 protein_id gnl|my_center|LOCUS_35020 76221 75346 gene locus_tag LOCUS_35030 76221 75346 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899384.1 protein_id gnl|my_center|LOCUS_35030 76762 76259 gene locus_tag LOCUS_35040 76762 76259 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413345.1 protein_id gnl|my_center|LOCUS_35040 76978 76772 gene locus_tag LOCUS_35050 76978 76772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 76863 78635 gene locus_tag LOCUS_35060 gene aspS 76863 78635 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899382.1 protein_id gnl|my_center|LOCUS_35060 78752 79822 gene locus_tag LOCUS_35070 78752 79822 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899381.1 protein_id gnl|my_center|LOCUS_35070 80203 79814 gene locus_tag LOCUS_35080 80203 79814 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413336.1 protein_id gnl|my_center|LOCUS_35080 80319 81263 gene locus_tag LOCUS_35090 80319 81263 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413334.1 protein_id gnl|my_center|LOCUS_35090 81256 82308 gene locus_tag LOCUS_35100 81256 82308 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413332.1 protein_id gnl|my_center|LOCUS_35100 83293 82736 gene locus_tag LOCUS_35110 83293 82736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 84289 83303 gene locus_tag LOCUS_35120 84289 83303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 84170 84937 gene locus_tag LOCUS_35130 84170 84937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 87637 84956 gene locus_tag LOCUS_35140 87637 84956 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413330.1 protein_id gnl|my_center|LOCUS_35140 90996 87637 gene locus_tag LOCUS_35150 90996 87637 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886150.1 protein_id gnl|my_center|LOCUS_35150 92250 91177 gene locus_tag LOCUS_35160 92250 91177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 92414 93772 gene locus_tag LOCUS_35170 92414 93772 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413216.1 protein_id gnl|my_center|LOCUS_35170 94398 93775 gene locus_tag LOCUS_35180 94398 93775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413213.1 protein_id gnl|my_center|LOCUS_35180 94799 94662 gene locus_tag LOCUS_35190 94799 94662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 95572 94898 gene locus_tag LOCUS_35200 95572 94898 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899374.1 protein_id gnl|my_center|LOCUS_35200 95689 96090 gene locus_tag LOCUS_35210 95689 96090 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413208.1 protein_id gnl|my_center|LOCUS_35210 96139 98853 gene locus_tag LOCUS_35220 gene alaS 96139 98853 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902305.1 protein_id gnl|my_center|LOCUS_35220 98854 99372 gene locus_tag LOCUS_35230 gene ruvX 98854 99372 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413197.1 protein_id gnl|my_center|LOCUS_35230 99365 100606 gene locus_tag LOCUS_35240 99365 100606 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413196.1 protein_id gnl|my_center|LOCUS_35240 100629 101411 gene locus_tag LOCUS_35250 100629 101411 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413193.1 protein_id gnl|my_center|LOCUS_35250 101423 101869 gene locus_tag LOCUS_35260 101423 101869 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413190.1 protein_id gnl|my_center|LOCUS_35260 102476 103681 gene locus_tag LOCUS_35270 102476 103681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 103686 105245 gene locus_tag LOCUS_35280 103686 105245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 105245 108064 gene locus_tag LOCUS_35290 105245 108064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 108439 109086 gene locus_tag LOCUS_35300 108439 109086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 109083 110678 gene locus_tag LOCUS_35310 gene cas1 109083 110678 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_35310 110675 110977 gene locus_tag LOCUS_35320 110675 110977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 111167 116340 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcggcggccgtttcggcggccgcacttcatcgaggc >Feature sequence66 1147 1632 gene locus_tag LOCUS_35330 1147 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 2044 3144 gene locus_tag LOCUS_35340 gene galT 2044 3144 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015287872.1 protein_id gnl|my_center|LOCUS_35340 3141 4256 gene locus_tag LOCUS_35350 3141 4256 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403225.1 protein_id gnl|my_center|LOCUS_35350 4837 5145 gene locus_tag LOCUS_35360 4837 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 5147 5671 gene locus_tag LOCUS_35370 5147 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 6061 7020 gene locus_tag LOCUS_35380 6061 7020 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930636.1 protein_id gnl|my_center|LOCUS_35380 7072 7227 gene locus_tag LOCUS_35390 7072 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 7250 7603 gene locus_tag LOCUS_35400 7250 7603 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_35400 7593 7928 gene locus_tag LOCUS_35410 7593 7928 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_35410 8495 8133 gene locus_tag LOCUS_35420 gene mazF7 8495 8133 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410654.1 protein_id gnl|my_center|LOCUS_35420 8715 8479 gene locus_tag LOCUS_35430 gene mazE7 8715 8479 CDS product type II toxin-antitoxin system antitoxin MazE7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410651.1 protein_id gnl|my_center|LOCUS_35430 9092 10327 gene locus_tag LOCUS_35440 9092 10327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903091.1 protein_id gnl|my_center|LOCUS_35440 10338 11285 gene locus_tag LOCUS_35450 10338 11285 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403232.1 protein_id gnl|my_center|LOCUS_35450 11756 12745 gene locus_tag LOCUS_35460 11756 12745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 12803 13036 gene locus_tag LOCUS_35470 12803 13036 CDS product antitoxin VapB29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403213.1 protein_id gnl|my_center|LOCUS_35470 13033 13434 gene locus_tag LOCUS_35480 gene vapC29 13033 13434 CDS product type II toxin-antitoxin system ribonuclease VapC29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403218.1 protein_id gnl|my_center|LOCUS_35480 13701 14705 gene locus_tag LOCUS_35490 13701 14705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 16223 15072 gene locus_tag LOCUS_35500 16223 15072 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404586.1 protein_id gnl|my_center|LOCUS_35500 17984 16257 gene locus_tag LOCUS_35510 gene recD 17984 16257 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900979.1 protein_id gnl|my_center|LOCUS_35510 21259 17981 gene locus_tag LOCUS_35520 gene recB 21259 17981 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003905355.1 protein_id gnl|my_center|LOCUS_35520 24555 21259 gene locus_tag LOCUS_35530 gene recC 24555 21259 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900193.1 protein_id gnl|my_center|LOCUS_35530 25370 24675 gene locus_tag LOCUS_35540 25370 24675 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403259.1 protein_id gnl|my_center|LOCUS_35540 26288 25503 gene locus_tag LOCUS_35550 26288 25503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403262.1 protein_id gnl|my_center|LOCUS_35550 27174 26368 gene locus_tag LOCUS_35560 27174 26368 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_35560 27216 27431 gene locus_tag LOCUS_35570 27216 27431 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908610.1 protein_id gnl|my_center|LOCUS_35570 27530 27603 gene locus_tag LOCUS_t00480 27530 27603 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 27655 27729 gene locus_tag LOCUS_t00490 27655 27729 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27765 27932 gene locus_tag LOCUS_35580 gene rpmG 27765 27932 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898538.1 protein_id gnl|my_center|LOCUS_35580 27982 28461 gene locus_tag LOCUS_35590 gene hadA 27982 28461 CDS product (3R)-hydroxyacyl-ACP dehydratase subunit HadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908608.1 protein_id gnl|my_center|LOCUS_35590 28448 28876 gene locus_tag LOCUS_35600 gene hadB 28448 28876 CDS product (3R)-hydroxyacyl-ACP dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903106.1 protein_id gnl|my_center|LOCUS_35600 28892 29392 gene locus_tag LOCUS_35610 gene hadC 28892 29392 CDS product (3R)-hydroxyacyl-ACP dehydratase subunit HadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403282.1 protein_id gnl|my_center|LOCUS_35610 29551 29624 gene locus_tag LOCUS_t00500 29551 29624 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 29841 30335 gene locus_tag LOCUS_35620 gene secE 29841 30335 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403284.1 protein_id gnl|my_center|LOCUS_35620 30367 31083 gene locus_tag LOCUS_35630 gene nusG 30367 31083 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403288.1 protein_id gnl|my_center|LOCUS_35630 31141 31572 gene locus_tag LOCUS_35640 gene rplK 31141 31572 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403291.1 protein_id gnl|my_center|LOCUS_35640 31637 32347 gene locus_tag LOCUS_35650 gene rplA 31637 32347 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403292.1 protein_id gnl|my_center|LOCUS_35650 33313 32417 gene locus_tag LOCUS_35660 gene mmaA4 33313 32417 CDS product hydroxymycolate synthase MmaA4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900195.1 protein_id gnl|my_center|LOCUS_35660 <33944 33385 gene locus_tag LOCUS_35670 <33944 33385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003403302.1:methoxy mycolic acid synthase MmaA3 >Feature sequence67 847 185 gene locus_tag LOCUS_35680 847 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 1255 2184 gene locus_tag LOCUS_35690 1255 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 2452 2189 gene locus_tag LOCUS_35700 2452 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 2670 3014 gene locus_tag LOCUS_35710 2670 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 3052 4362 gene locus_tag LOCUS_35720 3052 4362 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727856.1 protein_id gnl|my_center|LOCUS_35720 4840 5271 gene locus_tag LOCUS_35730 4840 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 5516 5160 gene locus_tag LOCUS_35740 5516 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 5755 5513 gene locus_tag LOCUS_35750 5755 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 6325 5786 gene locus_tag LOCUS_35760 6325 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 6380 6736 gene locus_tag LOCUS_35770 6380 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 7476 7198 gene locus_tag LOCUS_35780 7476 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 8163 9056 gene locus_tag LOCUS_35790 8163 9056 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417149.1 protein_id gnl|my_center|LOCUS_35790 9053 9484 gene locus_tag LOCUS_35800 9053 9484 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417152.1 protein_id gnl|my_center|LOCUS_35800 9595 11388 gene locus_tag LOCUS_35810 9595 11388 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417156.1 protein_id gnl|my_center|LOCUS_35810 12129 11395 gene locus_tag LOCUS_35820 gene sigF 12129 11395 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417158.1 protein_id gnl|my_center|LOCUS_35820 12628 12191 gene locus_tag LOCUS_35830 gene rsbW 12628 12191 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417160.1 protein_id gnl|my_center|LOCUS_35830 13163 12813 gene locus_tag LOCUS_35840 13163 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400878.1 protein_id gnl|my_center|LOCUS_35840 13473 13853 gene locus_tag LOCUS_35850 13473 13853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729804.1 protein_id gnl|my_center|LOCUS_35850 14037 14345 gene locus_tag LOCUS_35860 gene usfY 14037 14345 CDS product protein UsfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729803.1 protein_id gnl|my_center|LOCUS_35860 14765 14382 gene locus_tag LOCUS_35870 14765 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417165.1 protein_id gnl|my_center|LOCUS_35870 16136 14790 gene locus_tag LOCUS_35880 gene lat 16136 14790 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900004.1 protein_id gnl|my_center|LOCUS_35880 16640 16185 gene locus_tag LOCUS_35890 gene lrpA 16640 16185 CDS product transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417179.1 protein_id gnl|my_center|LOCUS_35890 16720 18234 gene locus_tag LOCUS_35900 16720 18234 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417187.1 protein_id gnl|my_center|LOCUS_35900 18241 18957 gene locus_tag LOCUS_35910 18241 18957 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417200.1 protein_id gnl|my_center|LOCUS_35910 18994 23532 gene locus_tag LOCUS_35920 18994 23532 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912132.1 protein_id gnl|my_center|LOCUS_35920 23536 24285 gene locus_tag LOCUS_35930 gene nei2 23536 24285 CDS product endonuclease VIII Nei2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900006.1 protein_id gnl|my_center|LOCUS_35930 25215 24298 gene locus_tag LOCUS_35940 25215 24298 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_35940 26373 25237 gene locus_tag LOCUS_35950 26373 25237 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911666.1 protein_id gnl|my_center|LOCUS_35950 27634 26459 gene locus_tag LOCUS_35960 gene pstS 27634 26459 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908715.1 protein_id gnl|my_center|LOCUS_35960 27855 28199 gene locus_tag LOCUS_35970 27855 28199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 31115 28212 gene locus_tag LOCUS_35980 gene atsB 31115 28212 CDS product arylsulfatase AtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417213.1 protein_id gnl|my_center|LOCUS_35980 31951 31112 gene locus_tag LOCUS_35990 31951 31112 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950868.1 protein_id gnl|my_center|LOCUS_35990 33744 31981 gene locus_tag LOCUS_36000 33744 31981 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417217.1 protein_id gnl|my_center|LOCUS_36000 35234 33819 gene locus_tag LOCUS_36010 35234 33819 CDS product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936266.1 protein_id gnl|my_center|LOCUS_36010 35479 35958 gene locus_tag LOCUS_36020 35479 35958 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417219.1 protein_id gnl|my_center|LOCUS_36020 36482 36189 gene locus_tag LOCUS_36030 36482 36189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36030 36632 36820 gene locus_tag LOCUS_36040 36632 36820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 37137 36874 gene locus_tag LOCUS_36050 37137 36874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36050 38530 37361 gene locus_tag LOCUS_36060 38530 37361 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417220.1 protein_id gnl|my_center|LOCUS_36060 38799 38527 gene locus_tag LOCUS_36070 38799 38527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 38885 39691 gene locus_tag LOCUS_36080 38885 39691 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417233.1 protein_id gnl|my_center|LOCUS_36080 39695 41287 gene locus_tag LOCUS_36090 39695 41287 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323714.1 protein_id gnl|my_center|LOCUS_36090 41912 41289 gene locus_tag LOCUS_36100 gene upp 41912 41289 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417245.1 protein_id gnl|my_center|LOCUS_36100 42018 42905 gene locus_tag LOCUS_36110 gene sapM 42018 42905 CDS product phosphatidylinositol-3-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900013.1 protein_id gnl|my_center|LOCUS_36110 42927 44234 gene locus_tag LOCUS_36120 42927 44234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417251.1 protein_id gnl|my_center|LOCUS_36120 45526 44438 gene locus_tag LOCUS_36130 45526 44438 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417259.1 protein_id gnl|my_center|LOCUS_36130 46824 45523 gene locus_tag LOCUS_36140 46824 45523 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900016.1 protein_id gnl|my_center|LOCUS_36140 47201 46821 gene locus_tag LOCUS_36150 47201 46821 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417264.1 protein_id gnl|my_center|LOCUS_36150 47476 47814 gene locus_tag LOCUS_36160 gene sdhC 47476 47814 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417267.1 protein_id gnl|my_center|LOCUS_36160 47811 48281 gene locus_tag LOCUS_36170 47811 48281 CDS product succinate dehydrogenase hydrophobic membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936281.1 protein_id gnl|my_center|LOCUS_36170 48285 50057 gene locus_tag LOCUS_36180 gene sdhA 48285 50057 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417273.1 protein_id gnl|my_center|LOCUS_36180 50057 50851 gene locus_tag LOCUS_36190 50057 50851 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417279.1 protein_id gnl|my_center|LOCUS_36190 50965 51570 gene locus_tag LOCUS_36200 50965 51570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 52450 51536 gene locus_tag LOCUS_36210 gene sigJ 52450 51536 CDS product sigma-70 family RNA polymerase sigma factor SigJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417413.1 protein_id gnl|my_center|LOCUS_36210 52505 53821 gene locus_tag LOCUS_36220 52505 53821 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080603738.1 protein_id gnl|my_center|LOCUS_36220 54102 55769 gene locus_tag LOCUS_36230 54102 55769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 55817 56134 gene locus_tag LOCUS_36240 55817 56134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 56524 58404 gene locus_tag LOCUS_36250 56524 58404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 58746 59222 gene locus_tag LOCUS_36260 58746 59222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 59189 59998 gene locus_tag LOCUS_36270 59189 59998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 >Feature sequence68 <1 1417 gene locus_tag LOCUS_36280 <1 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010950703.1:PPE family protein >Feature sequence69 1174 683 gene locus_tag LOCUS_36290 1174 683 CDS product lipoprotein LpqH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908650.1 protein_id gnl|my_center|LOCUS_36290 1875 1267 gene locus_tag LOCUS_36300 gene rfbC 1875 1267 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418610.1 protein_id gnl|my_center|LOCUS_36300 2872 1877 gene locus_tag LOCUS_36310 gene rfbB 2872 1877 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418607.1 protein_id gnl|my_center|LOCUS_36310 3816 2944 gene locus_tag LOCUS_36320 3816 2944 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418604.1 protein_id gnl|my_center|LOCUS_36320 4314 5021 gene locus_tag LOCUS_36330 4314 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 5388 5609 gene locus_tag LOCUS_36340 gene infA 5388 5609 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418601.1 protein_id gnl|my_center|LOCUS_36340 5830 6321 gene locus_tag LOCUS_36350 gene rpsM 5830 6321 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908646.1 protein_id gnl|my_center|LOCUS_36350 6325 6747 gene locus_tag LOCUS_36360 gene rpsK 6325 6747 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900064.1 protein_id gnl|my_center|LOCUS_36360 6757 7362 gene locus_tag LOCUS_36370 gene rpsD 6757 7362 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418354.1 protein_id gnl|my_center|LOCUS_36370 7474 8517 gene locus_tag LOCUS_36380 7474 8517 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418351.1 protein_id gnl|my_center|LOCUS_36380 8558 9271 gene locus_tag LOCUS_36390 8558 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 9354 10109 gene locus_tag LOCUS_36400 gene truA 9354 10109 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418344.1 protein_id gnl|my_center|LOCUS_36400 10723 10112 gene locus_tag LOCUS_36410 gene cut4 10723 10112 CDS product cutinase Cut4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418339.1 protein_id gnl|my_center|LOCUS_36410 11603 10800 gene locus_tag LOCUS_36420 11603 10800 CDS product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418336.1 protein_id gnl|my_center|LOCUS_36420 11724 13145 gene locus_tag LOCUS_36430 gene eccB4 11724 13145 CDS product type VII secretion system ESX-4 subunit EccB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418333.1 protein_id gnl|my_center|LOCUS_36430 14471 13107 gene locus_tag LOCUS_36440 gene mycP4 14471 13107 CDS product type VII secretion system ESX-4 serine protease mycosin MycP4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418331.1 protein_id gnl|my_center|LOCUS_36440 15820 14468 gene locus_tag LOCUS_36450 gene eccD4 15820 14468 CDS product type VII secretion system ESX-4 subunit EccD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900062.1 protein_id gnl|my_center|LOCUS_36450 15853 19602 gene locus_tag LOCUS_36460 gene eccC4 15853 19602 CDS product type VII secretion system ESX-4 FtsK/SpoIIIE family ATPase EccC4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003912232.1 protein_id gnl|my_center|LOCUS_36460 19674 20816 gene locus_tag LOCUS_36470 19674 20816 CDS product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418324.1 protein_id gnl|my_center|LOCUS_36470 20867 21193 gene locus_tag LOCUS_36480 gene esxU 20867 21193 CDS product type VII secretion system ESX-4 protein EsxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900060.1 protein_id gnl|my_center|LOCUS_36480 21208 21504 gene locus_tag LOCUS_36490 21208 21504 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900059.1 protein_id gnl|my_center|LOCUS_36490 21725 22168 gene locus_tag LOCUS_36500 gene rplM 21725 22168 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418312.1 protein_id gnl|my_center|LOCUS_36500 22165 22620 gene locus_tag LOCUS_36510 gene rpsI 22165 22620 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907685.1 protein_id gnl|my_center|LOCUS_36510 22747 24084 gene locus_tag LOCUS_36520 gene glmM 22747 24084 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418304.1 protein_id gnl|my_center|LOCUS_36520 24141 24440 gene locus_tag LOCUS_36530 24141 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 24443 25771 gene locus_tag LOCUS_36540 24443 25771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418300.1 protein_id gnl|my_center|LOCUS_36540 26846 25806 gene locus_tag LOCUS_36550 26846 25806 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054881081.1 protein_id gnl|my_center|LOCUS_36550 27705 26854 gene locus_tag LOCUS_36560 27705 26854 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418298.1 protein_id gnl|my_center|LOCUS_36560 28049 27831 gene locus_tag LOCUS_36570 28049 27831 CDS product Rv1535 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407710.1 protein_id gnl|my_center|LOCUS_36570 28792 30669 gene locus_tag LOCUS_36580 gene glmS 28792 30669 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418289.1 protein_id gnl|my_center|LOCUS_36580 30800 31657 gene locus_tag LOCUS_36590 30800 31657 CDS product DUF4436 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901640.1 protein_id gnl|my_center|LOCUS_36590 31719 32432 gene locus_tag LOCUS_36600 31719 32432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418284.1 protein_id gnl|my_center|LOCUS_36600 32467 33888 gene locus_tag LOCUS_36610 32467 33888 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 protein_id gnl|my_center|LOCUS_36610 33911 35293 gene locus_tag LOCUS_36620 33911 35293 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418277.1 protein_id gnl|my_center|LOCUS_36620 35566 36732 gene locus_tag LOCUS_36630 gene alr 35566 36732 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023637501.1 protein_id gnl|my_center|LOCUS_36630 36788 37231 gene locus_tag LOCUS_36640 gene tsaE 36788 37231 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418042.1 protein_id gnl|my_center|LOCUS_36640 37228 37854 gene locus_tag LOCUS_36650 37228 37854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36650 37851 38330 gene locus_tag LOCUS_36660 gene rimI 37851 38330 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418034.1 protein_id gnl|my_center|LOCUS_36660 38327 39364 gene locus_tag LOCUS_36670 gene tsaD 38327 39364 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900052.1 protein_id gnl|my_center|LOCUS_36670 39678 39980 gene locus_tag LOCUS_36680 gene groES 39678 39980 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418028.1 protein_id gnl|my_center|LOCUS_36680 40095 41705 gene locus_tag LOCUS_36690 gene groL 40095 41705 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418021.1 protein_id gnl|my_center|LOCUS_36690 42086 41778 gene locus_tag LOCUS_36700 gene whiB3 42086 41778 CDS product redox-responsive transcriptional regulator WhiB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418017.1 protein_id gnl|my_center|LOCUS_36700 42456 43307 gene locus_tag LOCUS_36710 42456 43307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900051.1 protein_id gnl|my_center|LOCUS_36710 43428 43973 gene locus_tag LOCUS_36720 gene sigD 43428 43973 CDS product ECF RNA polymerase sigma factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418013.1 protein_id gnl|my_center|LOCUS_36720 44014 44895 gene locus_tag LOCUS_36730 44014 44895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 45321 44908 gene locus_tag LOCUS_36740 45321 44908 CDS product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907700.1 protein_id gnl|my_center|LOCUS_36740 45511 47109 gene locus_tag LOCUS_36750 gene guaB 45511 47109 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900682.1 protein_id gnl|my_center|LOCUS_36750 47120 48247 gene locus_tag LOCUS_36760 47120 48247 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418005.1 protein_id gnl|my_center|LOCUS_36760 48336 50072 gene locus_tag LOCUS_36770 gene choD 48336 50072 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418002.1 protein_id gnl|my_center|LOCUS_36770 50391 50056 gene locus_tag LOCUS_36780 50391 50056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 51414 50527 gene locus_tag LOCUS_36790 51414 50527 CDS product alpha-ketoglutarate-dependent sulfate ester dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900050.1 protein_id gnl|my_center|LOCUS_36790 51507 52040 gene locus_tag LOCUS_36800 51507 52040 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417984.1 protein_id gnl|my_center|LOCUS_36800 52230 52910 gene locus_tag LOCUS_36810 52230 52910 CDS product dTDP-4-amino-4,6-dideoxyglucose formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417980.1 protein_id gnl|my_center|LOCUS_36810 53207 54856 gene locus_tag LOCUS_36820 53207 54856 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417969.1 protein_id gnl|my_center|LOCUS_36820 55015 56241 gene locus_tag LOCUS_36830 55015 56241 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900048.1 protein_id gnl|my_center|LOCUS_36830 56234 57325 gene locus_tag LOCUS_36840 56234 57325 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407657.1 protein_id gnl|my_center|LOCUS_36840 59764 57341 gene locus_tag LOCUS_36850 59764 57341 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900047.1 protein_id gnl|my_center|LOCUS_36850 60512 59778 gene locus_tag LOCUS_36860 60512 59778 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417961.1 protein_id gnl|my_center|LOCUS_36860 60992 60579 gene locus_tag LOCUS_36870 60992 60579 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030920.1 protein_id gnl|my_center|LOCUS_36870 61198 62721 gene locus_tag LOCUS_36880 gene guaA 61198 62721 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417952.1 protein_id gnl|my_center|LOCUS_36880 63526 62945 gene locus_tag LOCUS_36890 63526 62945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417950.1 protein_id gnl|my_center|LOCUS_36890 63702 64256 gene locus_tag LOCUS_36900 63702 64256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900043.1 protein_id gnl|my_center|LOCUS_36900 64263 65837 gene locus_tag LOCUS_36910 64263 65837 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900042.1 protein_id gnl|my_center|LOCUS_36910 66254 65892 gene locus_tag LOCUS_36920 66254 65892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 66922 66269 gene locus_tag LOCUS_36930 66922 66269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 68918 66993 gene locus_tag LOCUS_36940 68918 66993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417940.1 protein_id gnl|my_center|LOCUS_36940 69635 68967 gene locus_tag LOCUS_36950 69635 68967 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417932.1 protein_id gnl|my_center|LOCUS_36950 69520 69729 gene locus_tag LOCUS_36960 69520 69729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 69754 70626 gene locus_tag LOCUS_36970 gene htdY 69754 70626 CDS product 3-hydroxyacyl-thioester dehydratase HtdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417929.1 protein_id gnl|my_center|LOCUS_36970 70743 72532 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgccggccccgccgttgcc 73061 73336 gene locus_tag LOCUS_36980 73061 73336 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417918.1 protein_id gnl|my_center|LOCUS_36980 73336 73728 gene locus_tag LOCUS_36990 73336 73728 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_36990 74940 73798 gene locus_tag LOCUS_37000 gene otsB 74940 73798 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417892.1 protein_id gnl|my_center|LOCUS_37000 76329 74983 gene locus_tag LOCUS_37010 76329 74983 CDS product diacyglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417889.1 protein_id gnl|my_center|LOCUS_37010 76462 79761 gene locus_tag LOCUS_37020 gene dnaE2 76462 79761 CDS product error-prone DNA polymerase DnaE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417885.1 protein_id gnl|my_center|LOCUS_37020 80253 79843 gene locus_tag LOCUS_37030 80253 79843 CDS product TIGR03667 family PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417882.1 protein_id gnl|my_center|LOCUS_37030 80276 80920 gene locus_tag LOCUS_37040 80276 80920 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417881.1 protein_id gnl|my_center|LOCUS_37040 81385 80921 gene locus_tag LOCUS_37050 81385 80921 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417878.1 protein_id gnl|my_center|LOCUS_37050 81569 84205 gene locus_tag LOCUS_37060 81569 84205 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900676.1 protein_id gnl|my_center|LOCUS_37060 84202 84594 gene locus_tag LOCUS_37070 84202 84594 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417776.1 protein_id gnl|my_center|LOCUS_37070 84572 84943 gene locus_tag LOCUS_37080 84572 84943 CDS product DUF742 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417772.1 protein_id gnl|my_center|LOCUS_37080 84924 85511 gene locus_tag LOCUS_37090 84924 85511 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417769.1 protein_id gnl|my_center|LOCUS_37090 85939 85601 gene locus_tag LOCUS_37100 85939 85601 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417765.1 protein_id gnl|my_center|LOCUS_37100 88502 85962 gene locus_tag LOCUS_37110 88502 85962 CDS product ATP transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408545.1 protein_id gnl|my_center|LOCUS_37110 88874 100042 gene locus_tag LOCUS_37120 88874 100042 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939158.1 protein_id gnl|my_center|LOCUS_37120 97226 97127 gene locus_tag LOCUS_t00510 97226 97127 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 100723 107049 gene locus_tag LOCUS_37130 100723 107049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37130 107098 113304 gene locus_tag LOCUS_37140 107098 113304 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886163.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37140 113268 113870 gene locus_tag LOCUS_37150 113268 113870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37150 113756 116836 gene locus_tag LOCUS_37160 113756 116836 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950872.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37160 115217 115249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 117365 116985 gene locus_tag LOCUS_37170 117365 116985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 117250 119406 gene locus_tag LOCUS_37180 117250 119406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37180 119382 119960 gene locus_tag LOCUS_37190 119382 119960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37190 119976 126671 gene locus_tag LOCUS_37200 119976 126671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_37200 128195 126705 gene locus_tag LOCUS_37210 128195 126705 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939726.1 protein_id gnl|my_center|LOCUS_37210 129502 128192 gene locus_tag LOCUS_37220 129502 128192 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533134.1 protein_id gnl|my_center|LOCUS_37220 130502 129462 gene locus_tag LOCUS_37230 130502 129462 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970146.1 protein_id gnl|my_center|LOCUS_37230 131671 130610 gene locus_tag LOCUS_37240 131671 130610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086834.1 protein_id gnl|my_center|LOCUS_37240 131875 132723 gene locus_tag LOCUS_37250 131875 132723 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728421.1 protein_id gnl|my_center|LOCUS_37250 134058 132679 gene locus_tag LOCUS_37260 134058 132679 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730982.1 protein_id gnl|my_center|LOCUS_37260 135487 134267 gene locus_tag LOCUS_37270 135487 134267 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900033.1 protein_id gnl|my_center|LOCUS_37270 135527 136372 gene locus_tag LOCUS_37280 135527 136372 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417751.1 protein_id gnl|my_center|LOCUS_37280 136369 136662 gene locus_tag LOCUS_37290 136369 136662 CDS product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417749.1 protein_id gnl|my_center|LOCUS_37290 137058 136666 gene locus_tag LOCUS_37300 137058 136666 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417745.1 protein_id gnl|my_center|LOCUS_37300 138336 137593 gene locus_tag LOCUS_37310 138336 137593 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417461.1 protein_id gnl|my_center|LOCUS_37310 139463 138324 gene locus_tag LOCUS_37320 139463 138324 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417458.1 protein_id gnl|my_center|LOCUS_37320 140833 139475 gene locus_tag LOCUS_37330 140833 139475 CDS product bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900028.1 protein_id gnl|my_center|LOCUS_37330 140789 141019 gene locus_tag LOCUS_37340 140789 141019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 141936 141082 gene locus_tag LOCUS_37350 141936 141082 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044081650.1 protein_id gnl|my_center|LOCUS_37350 142020 143039 gene locus_tag LOCUS_37360 gene trpS 142020 143039 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417440.1 protein_id gnl|my_center|LOCUS_37360 143045 143959 gene locus_tag LOCUS_37370 gene yhjD 143045 143959 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417435.1 protein_id gnl|my_center|LOCUS_37370 145107 143956 gene locus_tag LOCUS_37380 gene nagA 145107 143956 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417418.1 protein_id gnl|my_center|LOCUS_37380 146546 145104 gene locus_tag LOCUS_37390 146546 145104 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886161.1 protein_id gnl|my_center|LOCUS_37390 146806 146480 gene locus_tag LOCUS_37400 146806 146480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 147986 146817 gene locus_tag LOCUS_37410 gene dacB1 147986 146817 CDS product D-alanyl-D-alanine carboxypeptidase DacB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417415.1 protein_id gnl|my_center|LOCUS_37410 148331 149779 gene locus_tag LOCUS_37420 148331 149779 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906341.1 protein_id gnl|my_center|LOCUS_37420 149985 149776 gene locus_tag LOCUS_37430 149985 149776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 150296 149982 gene locus_tag LOCUS_37440 150296 149982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 150709 150335 gene locus_tag LOCUS_37450 150709 150335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 >Feature sequence70 738 2615 gene locus_tag LOCUS_37460 gene fadD31 738 2615 CDS product fatty-acid--AMP ligase FAAL31/FadD31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409680.1 protein_id gnl|my_center|LOCUS_37460 3252 2773 gene locus_tag LOCUS_37470 gene mpt63 3252 2773 CDS product immunoprotective protein Mpt63 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409684.1 protein_id gnl|my_center|LOCUS_37470 3434 3279 gene locus_tag LOCUS_37480 3434 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 3406 4179 gene locus_tag LOCUS_37490 3406 4179 CDS product YqjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409685.1 protein_id gnl|my_center|LOCUS_37490 4316 4819 gene locus_tag LOCUS_37500 gene tpx 4316 4819 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409700.1 protein_id gnl|my_center|LOCUS_37500 5033 4857 gene locus_tag LOCUS_37510 5033 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 6507 5416 gene locus_tag LOCUS_37520 6507 5416 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900437.1 protein_id gnl|my_center|LOCUS_37520 7738 6509 gene locus_tag LOCUS_37530 7738 6509 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900438.1 protein_id gnl|my_center|LOCUS_37530 8711 7755 gene locus_tag LOCUS_37540 8711 7755 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409707.1 protein_id gnl|my_center|LOCUS_37540 8936 10045 gene locus_tag LOCUS_37550 8936 10045 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904740.1 protein_id gnl|my_center|LOCUS_37550 10048 12576 gene locus_tag LOCUS_37560 10048 12576 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409714.1 protein_id gnl|my_center|LOCUS_37560 12599 13669 gene locus_tag LOCUS_37570 gene ephB 12599 13669 CDS product epoxide hydrolase EphB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899091.1 protein_id gnl|my_center|LOCUS_37570 13684 14196 gene locus_tag LOCUS_37580 13684 14196 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409718.1 protein_id gnl|my_center|LOCUS_37580 14193 15269 gene locus_tag LOCUS_37590 14193 15269 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899092.1 protein_id gnl|my_center|LOCUS_37590 15273 16043 gene locus_tag LOCUS_37600 15273 16043 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409775.1 protein_id gnl|my_center|LOCUS_37600 17449 16202 gene locus_tag LOCUS_37610 gene mce3R 17449 16202 CDS product TetR family transcriptional regulator Mce3R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409919.1 protein_id gnl|my_center|LOCUS_37610 17897 17505 gene locus_tag LOCUS_37620 17897 17505 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_37620 18394 19185 gene locus_tag LOCUS_37630 18394 19185 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899101.1 protein_id gnl|my_center|LOCUS_37630 19195 20010 gene locus_tag LOCUS_37640 19195 20010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899102.1 protein_id gnl|my_center|LOCUS_37640 20015 21283 gene locus_tag LOCUS_37650 20015 21283 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900443.1 protein_id gnl|my_center|LOCUS_37650 21280 22308 gene locus_tag LOCUS_37660 21280 22308 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899104.1 protein_id gnl|my_center|LOCUS_37660 22305 23537 gene locus_tag LOCUS_37670 22305 23537 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904746.1 protein_id gnl|my_center|LOCUS_37670 23534 24730 gene locus_tag LOCUS_37680 23534 24730 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899106.1 protein_id gnl|my_center|LOCUS_37680 24727 25866 gene locus_tag LOCUS_37690 gene lprM 24727 25866 CDS product Mce family lipoprotein LprM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899107.1 protein_id gnl|my_center|LOCUS_37690 25867 27321 gene locus_tag LOCUS_37700 25867 27321 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911732.1 protein_id gnl|my_center|LOCUS_37700 27288 27860 gene locus_tag LOCUS_37710 27288 27860 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899109.1 protein_id gnl|my_center|LOCUS_37710 27857 28339 gene locus_tag LOCUS_37720 27857 28339 CDS product Mce associated membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899110.1 protein_id gnl|my_center|LOCUS_37720 28347 28727 gene locus_tag LOCUS_37730 28347 28727 CDS product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899111.1 protein_id gnl|my_center|LOCUS_37730 28742 29374 gene locus_tag LOCUS_37740 28742 29374 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899112.1 protein_id gnl|my_center|LOCUS_37740 29732 29310 gene locus_tag LOCUS_37750 29732 29310 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899113.1 protein_id gnl|my_center|LOCUS_37750 30068 29790 gene locus_tag LOCUS_37760 30068 29790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 30845 30198 gene locus_tag LOCUS_37770 30845 30198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 32453 31131 gene locus_tag LOCUS_37780 32453 31131 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411947.1 protein_id gnl|my_center|LOCUS_37780 33256 32450 gene locus_tag LOCUS_37790 33256 32450 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411946.1 protein_id gnl|my_center|LOCUS_37790 34130 33258 gene locus_tag LOCUS_37800 34130 33258 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411940.1 protein_id gnl|my_center|LOCUS_37800 34164 35681 gene locus_tag LOCUS_37810 34164 35681 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411929.1 protein_id gnl|my_center|LOCUS_37810 35678 37051 gene locus_tag LOCUS_37820 35678 37051 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899270.1 protein_id gnl|my_center|LOCUS_37820 39704 37071 gene locus_tag LOCUS_37830 39704 37071 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227286.1 protein_id gnl|my_center|LOCUS_37830 39922 40374 gene locus_tag LOCUS_37840 39922 40374 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467644.1 protein_id gnl|my_center|LOCUS_37840 40533 40889 gene locus_tag LOCUS_37850 40533 40889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 40994 42166 gene locus_tag LOCUS_37860 40994 42166 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728185.1 protein_id gnl|my_center|LOCUS_37860 42346 42729 gene locus_tag LOCUS_37870 42346 42729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 42839 42915 gene locus_tag LOCUS_t00520 42839 42915 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 43175 44998 gene locus_tag LOCUS_37880 43175 44998 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630171.1 protein_id gnl|my_center|LOCUS_37880 >Feature sequence71 309 521 gene locus_tag LOCUS_37890 gene esxN 309 521 CDS product effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015293199.1 protein_id gnl|my_center|LOCUS_37890 1476 1309 gene locus_tag LOCUS_37900 1476 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 2756 1566 gene locus_tag LOCUS_37910 2756 1566 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899601.1 protein_id gnl|my_center|LOCUS_37910 3721 2753 gene locus_tag LOCUS_37920 gene ephA 3721 2753 CDS product epoxide hydrolase EphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899600.1 protein_id gnl|my_center|LOCUS_37920 3783 4232 gene locus_tag LOCUS_37930 3783 4232 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030866702.1 protein_id gnl|my_center|LOCUS_37930 4557 6791 gene locus_tag LOCUS_37940 gene ftsH 4557 6791 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419543.1 protein_id gnl|my_center|LOCUS_37940 6807 7415 gene locus_tag LOCUS_37950 gene folE 6807 7415 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899597.1 protein_id gnl|my_center|LOCUS_37950 7427 8254 gene locus_tag LOCUS_37960 gene folP 7427 8254 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907608.1 protein_id gnl|my_center|LOCUS_37960 8247 8645 gene locus_tag LOCUS_37970 gene folB 8247 8645 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419537.1 protein_id gnl|my_center|LOCUS_37970 8770 9306 gene locus_tag LOCUS_37980 gene folK 8770 9306 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419536.1 protein_id gnl|my_center|LOCUS_37980 9306 9782 gene locus_tag LOCUS_37990 9306 9782 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419535.1 protein_id gnl|my_center|LOCUS_37990 9948 11216 gene locus_tag LOCUS_38000 9948 11216 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419534.1 protein_id gnl|my_center|LOCUS_38000 11313 12224 gene locus_tag LOCUS_38010 11313 12224 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419533.1 protein_id gnl|my_center|LOCUS_38010 12221 13156 gene locus_tag LOCUS_38020 gene panC 12221 13156 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419526.1 protein_id gnl|my_center|LOCUS_38020 13156 13599 gene locus_tag LOCUS_38030 13156 13599 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419523.1 protein_id gnl|my_center|LOCUS_38030 13602 14414 gene locus_tag LOCUS_38040 13602 14414 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419517.1 protein_id gnl|my_center|LOCUS_38040 14499 16067 gene locus_tag LOCUS_38050 gene lysS 14499 16067 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419514.1 protein_id gnl|my_center|LOCUS_38050 16178 16516 gene locus_tag LOCUS_38060 gene lsr2 16178 16516 CDS product iron-regulated nucleoid-associated protein Lsr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419513.1 protein_id gnl|my_center|LOCUS_38060 16815 19295 gene locus_tag LOCUS_38070 gene clpC1 16815 19295 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419511.1 protein_id gnl|my_center|LOCUS_38070 19671 19303 gene locus_tag LOCUS_38080 19671 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 19922 19677 gene locus_tag LOCUS_38090 19922 19677 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_38090 19980 20699 gene locus_tag LOCUS_38100 19980 20699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38100 21162 21587 gene locus_tag LOCUS_38110 21162 21587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38110 22011 21697 gene locus_tag LOCUS_38120 22011 21697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 23313 22141 gene locus_tag LOCUS_38130 23313 22141 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886178.1 protein_id gnl|my_center|LOCUS_38130 23797 23480 gene locus_tag LOCUS_38140 gene mhuD 23797 23480 CDS product mycobilin-forming heme oxygenase MhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419501.1 protein_id gnl|my_center|LOCUS_38140 23812 24585 gene locus_tag LOCUS_38150 23812 24585 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419499.1 protein_id gnl|my_center|LOCUS_38150 24696 26450 gene locus_tag LOCUS_38160 24696 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 27361 26447 gene locus_tag LOCUS_38170 27361 26447 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419495.1 protein_id gnl|my_center|LOCUS_38170 27315 27983 gene locus_tag LOCUS_38180 gene canB 27315 27983 CDS product beta-carbonic anhydrase CanB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419492.1 protein_id gnl|my_center|LOCUS_38180 28067 28888 gene locus_tag LOCUS_38190 28067 28888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419490.1 protein_id gnl|my_center|LOCUS_38190 30091 29024 gene locus_tag LOCUS_38200 gene disA 30091 29024 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950916.1 protein_id gnl|my_center|LOCUS_38200 31544 30120 gene locus_tag LOCUS_38210 gene radA 31544 30120 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419487.1 protein_id gnl|my_center|LOCUS_38210 32170 31601 gene locus_tag LOCUS_38220 32170 31601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900715.1 protein_id gnl|my_center|LOCUS_38220 32474 32962 gene locus_tag LOCUS_38230 gene carD 32474 32962 CDS product RNA polymerase-binding transcription factor CarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419482.1 protein_id gnl|my_center|LOCUS_38230 32980 33663 gene locus_tag LOCUS_38240 gene ispD 32980 33663 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419436.1 protein_id gnl|my_center|LOCUS_38240 33660 34139 gene locus_tag LOCUS_38250 gene ispF 33660 34139 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419432.1 protein_id gnl|my_center|LOCUS_38250 34200 35627 gene locus_tag LOCUS_38260 gene cysS 34200 35627 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900108.1 protein_id gnl|my_center|LOCUS_38260 35590 36549 gene locus_tag LOCUS_38270 gene rlmB 35590 36549 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900107.1 protein_id gnl|my_center|LOCUS_38270 37535 36615 gene locus_tag LOCUS_38280 37535 36615 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901674.1 protein_id gnl|my_center|LOCUS_38280 38286 37561 gene locus_tag LOCUS_38290 38286 37561 CDS product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900105.1 protein_id gnl|my_center|LOCUS_38290 38492 39532 gene locus_tag LOCUS_38300 38492 39532 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419400.1 protein_id gnl|my_center|LOCUS_38300 40369 39704 gene locus_tag LOCUS_38310 gene kstR 40369 39704 CDS product cholesterol catabolism transcriptional regulator KstR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878540.1 protein_id gnl|my_center|LOCUS_38310 40588 42720 gene locus_tag LOCUS_38320 40588 42720 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419394.1 protein_id gnl|my_center|LOCUS_38320 43348 42818 gene locus_tag LOCUS_38330 43348 42818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419389.1 protein_id gnl|my_center|LOCUS_38330 44470 43394 gene locus_tag LOCUS_38340 gene kshB 44470 43394 CDS product 3-ketosteroid-9-alpha-hydroxylase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900102.1 protein_id gnl|my_center|LOCUS_38340 44632 45816 gene locus_tag LOCUS_38350 gene hsaA 44632 45816 CDS product flavin-dependent monooxygenase oxygenase subunit HsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419383.1 protein_id gnl|my_center|LOCUS_38350 45829 46710 gene locus_tag LOCUS_38360 45829 46710 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419381.1 protein_id gnl|my_center|LOCUS_38360 46707 47609 gene locus_tag LOCUS_38370 gene hsaC 46707 47609 CDS product iron-dependent extradiol dioxygenase HsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419378.1 protein_id gnl|my_center|LOCUS_38370 47612 48175 gene locus_tag LOCUS_38380 gene hsaB 47612 48175 CDS product flavin-dependent monooxygenase reductase subunit HsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419374.1 protein_id gnl|my_center|LOCUS_38380 48555 49163 gene locus_tag LOCUS_38390 48555 49163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 50859 49201 gene locus_tag LOCUS_38400 50859 49201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 51259 52164 gene locus_tag LOCUS_38410 51259 52164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077888.1 protein_id gnl|my_center|LOCUS_38410 52164 53030 gene locus_tag LOCUS_38420 52164 53030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085987.1 protein_id gnl|my_center|LOCUS_38420 53034 53999 gene locus_tag LOCUS_38430 53034 53999 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085986.1 protein_id gnl|my_center|LOCUS_38430 54005 55006 gene locus_tag LOCUS_38440 54005 55006 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085985.1 protein_id gnl|my_center|LOCUS_38440 55003 56010 gene locus_tag LOCUS_38450 55003 56010 CDS product MCE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077892.1 protein_id gnl|my_center|LOCUS_38450 56012 57148 gene locus_tag LOCUS_38460 56012 57148 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077894.1 protein_id gnl|my_center|LOCUS_38460 57145 58197 gene locus_tag LOCUS_38470 57145 58197 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071126.1 protein_id gnl|my_center|LOCUS_38470 58194 59165 gene locus_tag LOCUS_38480 58194 59165 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094759.1 protein_id gnl|my_center|LOCUS_38480 59176 59832 gene locus_tag LOCUS_38490 59176 59832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 60411 60686 gene locus_tag LOCUS_38500 60411 60686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 60610 61125 gene locus_tag LOCUS_38510 60610 61125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 61212 62063 gene locus_tag LOCUS_38520 gene nat 61212 62063 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419364.1 protein_id gnl|my_center|LOCUS_38520 63194 62028 gene locus_tag LOCUS_38530 63194 62028 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419356.1 protein_id gnl|my_center|LOCUS_38530 64147 63191 gene locus_tag LOCUS_38540 64147 63191 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419352.1 protein_id gnl|my_center|LOCUS_38540 65103 64141 gene locus_tag LOCUS_38550 65103 64141 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950910.1 protein_id gnl|my_center|LOCUS_38550 66233 65100 gene locus_tag LOCUS_38560 66233 65100 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419346.1 protein_id gnl|my_center|LOCUS_38560 67763 66234 gene locus_tag LOCUS_38570 gene fadD3 67763 66234 CDS product 3-((3aS,4S,7aS)-7a-methyl-1,5-dioxo-octahydro-1H-inden-4-yl)propanoate--CoA ligase FadD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900098.1 protein_id gnl|my_center|LOCUS_38570 67811 68959 gene locus_tag LOCUS_38580 67811 68959 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419340.1 protein_id gnl|my_center|LOCUS_38580 68956 69744 gene locus_tag LOCUS_38590 68956 69744 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900097.1 protein_id gnl|my_center|LOCUS_38590 71134 69776 gene locus_tag LOCUS_38600 71134 69776 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419334.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38600 71421 71095 gene locus_tag LOCUS_38610 71421 71095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38610 73297 71642 gene locus_tag LOCUS_38620 73297 71642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 73623 74225 gene locus_tag LOCUS_38630 gene kstR2 73623 74225 CDS product TetR family transcriptional regulator KstR2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419329.1 protein_id gnl|my_center|LOCUS_38630 74306 75466 gene locus_tag LOCUS_38640 74306 75466 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419328.1 protein_id gnl|my_center|LOCUS_38640 75707 76120 gene locus_tag LOCUS_38650 75707 76120 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003911071.1 protein_id gnl|my_center|LOCUS_38650 76232 77101 gene locus_tag LOCUS_38660 76232 77101 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419327.1 protein_id gnl|my_center|LOCUS_38660 79193 77172 gene locus_tag LOCUS_38670 79193 77172 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419325.1 protein_id gnl|my_center|LOCUS_38670 80291 79224 gene locus_tag LOCUS_38680 80291 79224 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419324.1 protein_id gnl|my_center|LOCUS_38680 81138 80389 gene locus_tag LOCUS_38690 81138 80389 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419321.1 protein_id gnl|my_center|LOCUS_38690 82016 81135 gene locus_tag LOCUS_38700 82016 81135 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419318.1 protein_id gnl|my_center|LOCUS_38700 82756 82013 gene locus_tag LOCUS_38710 82756 82013 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419315.1 protein_id gnl|my_center|LOCUS_38710 82824 83600 gene locus_tag LOCUS_38720 82824 83600 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419313.1 protein_id gnl|my_center|LOCUS_38720 83615 84526 gene locus_tag LOCUS_38730 83615 84526 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900711.1 protein_id gnl|my_center|LOCUS_38730 85082 84615 gene locus_tag LOCUS_38740 gene ddn 85082 84615 CDS product deazaflavin-dependent nitroreductase Ddn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419309.1 protein_id gnl|my_center|LOCUS_38740 86702 85527 gene locus_tag LOCUS_38750 86702 85527 CDS product steroid 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419307.1 protein_id gnl|my_center|LOCUS_38750 86863 88140 gene locus_tag LOCUS_38760 gene cyp125 86863 88140 CDS product steroid C26-monooxygenase Cyp125 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419304.1 protein_id gnl|my_center|LOCUS_38760 88140 89171 gene locus_tag LOCUS_38770 gene fadE28 88140 89171 CDS product acyl-CoA dehydrogenase FadE28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419299.1 protein_id gnl|my_center|LOCUS_38770 89156 90319 gene locus_tag LOCUS_38780 89156 90319 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419296.1 protein_id gnl|my_center|LOCUS_38780 90316 91260 gene locus_tag LOCUS_38790 gene chsH2 90316 91260 CDS product 3-oxo-23,24-bisnorchol-4,17(20)-dien-22-oyl-CoA hydratase subunit alpha ChsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419293.1 protein_id gnl|my_center|LOCUS_38790 91257 91658 gene locus_tag LOCUS_38800 gene chsH1 91257 91658 CDS product 3-oxo-23,24-bisnorchol-4,17(20)-dien-22-oyl-CoA hydratase subunit beta ChsH1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419290.1 protein_id gnl|my_center|LOCUS_38800 91658 92827 gene locus_tag LOCUS_38810 91658 92827 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 protein_id gnl|my_center|LOCUS_38810 93274 92843 gene locus_tag LOCUS_38820 93274 92843 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410811.1 protein_id gnl|my_center|LOCUS_38820 93573 93271 gene locus_tag LOCUS_38830 93573 93271 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410814.1 protein_id gnl|my_center|LOCUS_38830 94450 93587 gene locus_tag LOCUS_38840 94450 93587 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419285.1 protein_id gnl|my_center|LOCUS_38840 96152 94452 gene locus_tag LOCUS_38850 gene kstD 96152 94452 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419253.1 protein_id gnl|my_center|LOCUS_38850 96226 97011 gene locus_tag LOCUS_38860 96226 97011 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419252.1 protein_id gnl|my_center|LOCUS_38860 97046 97957 gene locus_tag LOCUS_38870 97046 97957 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419251.1 protein_id gnl|my_center|LOCUS_38870 97954 98994 gene locus_tag LOCUS_38880 gene dmpG 97954 98994 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419250.1 protein_id gnl|my_center|LOCUS_38880 99093 100841 gene locus_tag LOCUS_38890 99093 100841 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900088.1 protein_id gnl|my_center|LOCUS_38890 100982 102121 gene locus_tag LOCUS_38900 100982 102121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900087.1 protein_id gnl|my_center|LOCUS_38900 102124 102906 gene locus_tag LOCUS_38910 102124 102906 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419223.1 protein_id gnl|my_center|LOCUS_38910 102906 104060 gene locus_tag LOCUS_38920 102906 104060 CDS product TLR2-mediated response inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419222.1 protein_id gnl|my_center|LOCUS_38920 104147 106093 gene locus_tag LOCUS_38930 104147 106093 CDS product PPE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906993.1 protein_id gnl|my_center|LOCUS_38930 106554 106105 gene locus_tag LOCUS_38940 106554 106105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419215.1 protein_id gnl|my_center|LOCUS_38940 107720 106560 gene locus_tag LOCUS_38950 gene kshA 107720 106560 CDS product 3-ketosteroid-9-alpha-hydroxylase subunit KshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419211.1 protein_id gnl|my_center|LOCUS_38950 107835 108359 gene locus_tag LOCUS_38960 107835 108359 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419208.1 protein_id gnl|my_center|LOCUS_38960 109311 108442 gene locus_tag LOCUS_38970 109311 108442 CDS product TIGR03619 family F420-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228576.1 protein_id gnl|my_center|LOCUS_38970 110492 109308 gene locus_tag LOCUS_38980 110492 109308 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901662.1 protein_id gnl|my_center|LOCUS_38980 111556 110492 gene locus_tag LOCUS_38990 111556 110492 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419199.1 protein_id gnl|my_center|LOCUS_38990 112493 111570 gene locus_tag LOCUS_39000 112493 111570 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886176.1 protein_id gnl|my_center|LOCUS_39000 112609 113640 gene locus_tag LOCUS_39010 112609 113640 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900084.1 protein_id gnl|my_center|LOCUS_39010 114579 113860 gene locus_tag LOCUS_39020 114579 113860 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419190.1 protein_id gnl|my_center|LOCUS_39020 114608 115810 gene locus_tag LOCUS_39030 gene cyp142 114608 115810 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900082.1 protein_id gnl|my_center|LOCUS_39030 116688 115849 gene locus_tag LOCUS_39040 116688 115849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419184.1 protein_id gnl|my_center|LOCUS_39040 117598 116786 gene locus_tag LOCUS_39050 117598 116786 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419179.1 protein_id gnl|my_center|LOCUS_39050 117660 119303 gene locus_tag LOCUS_39060 117660 119303 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901660.1 protein_id gnl|my_center|LOCUS_39060 >Feature sequence72 246 845 gene locus_tag LOCUS_39070 246 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 1244 1894 gene locus_tag LOCUS_39080 1244 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900450.1 protein_id gnl|my_center|LOCUS_39080 2636 2022 gene locus_tag LOCUS_39090 2636 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3262 2633 gene locus_tag LOCUS_39100 gene tenA 3262 2633 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256691.1 protein_id gnl|my_center|LOCUS_39100 3599 3213 gene locus_tag LOCUS_39110 3599 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39110 5556 4192 gene locus_tag LOCUS_39120 5556 4192 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405897.1 protein_id gnl|my_center|LOCUS_39120 6476 6210 gene locus_tag LOCUS_39130 6476 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 7121 8068 gene locus_tag LOCUS_39140 7121 8068 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729936.1 protein_id gnl|my_center|LOCUS_39140 9983 8166 gene locus_tag LOCUS_39150 9983 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 10733 10119 gene locus_tag LOCUS_39160 10733 10119 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728158.1 protein_id gnl|my_center|LOCUS_39160 10847 11782 gene locus_tag LOCUS_39170 10847 11782 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728159.1 protein_id gnl|my_center|LOCUS_39170 11775 12953 gene locus_tag LOCUS_39180 11775 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728160.1 protein_id gnl|my_center|LOCUS_39180 13832 12957 gene locus_tag LOCUS_39190 13832 12957 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418777.1 protein_id gnl|my_center|LOCUS_39190 14199 14483 gene locus_tag LOCUS_39200 14199 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 14525 17653 gene locus_tag LOCUS_39210 14525 17653 CDS product patatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886170.1 protein_id gnl|my_center|LOCUS_39210 18316 17666 gene locus_tag LOCUS_39220 18316 17666 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418922.1 protein_id gnl|my_center|LOCUS_39220 18896 18546 gene locus_tag LOCUS_39230 18896 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 19334 20059 gene locus_tag LOCUS_39240 19334 20059 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410019.1 protein_id gnl|my_center|LOCUS_39240 20749 20171 gene locus_tag LOCUS_39250 20749 20171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 21639 20968 gene locus_tag LOCUS_39260 21639 20968 CDS product LppP/LprE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418931.1 protein_id gnl|my_center|LOCUS_39260 21964 23433 gene locus_tag LOCUS_39270 21964 23433 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900866.1 protein_id gnl|my_center|LOCUS_39270 23883 23479 gene locus_tag LOCUS_39280 23883 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 24455 23985 gene locus_tag LOCUS_39290 24455 23985 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899952.1 protein_id gnl|my_center|LOCUS_39290 24762 24439 gene locus_tag LOCUS_39300 24762 24439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 25621 24788 gene locus_tag LOCUS_39310 25621 24788 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900075.1 protein_id gnl|my_center|LOCUS_39310 26671 25730 gene locus_tag LOCUS_39320 26671 25730 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104400.1 protein_id gnl|my_center|LOCUS_39320 26795 27289 gene locus_tag LOCUS_39330 26795 27289 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418942.1 protein_id gnl|my_center|LOCUS_39330 28547 27261 gene locus_tag LOCUS_39340 28547 27261 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410039.1 protein_id gnl|my_center|LOCUS_39340 28803 29105 gene locus_tag LOCUS_39350 28803 29105 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418948.1 protein_id gnl|my_center|LOCUS_39350 29349 30827 gene locus_tag LOCUS_39360 29349 30827 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908787.1 protein_id gnl|my_center|LOCUS_39360 30915 31493 gene locus_tag LOCUS_39370 30915 31493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418954.1 protein_id gnl|my_center|LOCUS_39370 31981 31490 gene locus_tag LOCUS_39380 31981 31490 CDS product Mce associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418958.1 protein_id gnl|my_center|LOCUS_39380 32712 31981 gene locus_tag LOCUS_39390 32712 31981 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418960.1 protein_id gnl|my_center|LOCUS_39390 34394 32709 gene locus_tag LOCUS_39400 34394 32709 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418963.1 protein_id gnl|my_center|LOCUS_39400 35559 34405 gene locus_tag LOCUS_39410 gene lprN 35559 34405 CDS product Mce family lipoprotein LprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418964.1 protein_id gnl|my_center|LOCUS_39410 36971 35556 gene locus_tag LOCUS_39420 36971 35556 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418966.1 protein_id gnl|my_center|LOCUS_39420 38029 36968 gene locus_tag LOCUS_39430 38029 36968 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418967.1 protein_id gnl|my_center|LOCUS_39430 39071 38019 gene locus_tag LOCUS_39440 39071 38019 CDS product virulence factor Mce family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418972.1 protein_id gnl|my_center|LOCUS_39440 40273 39071 gene locus_tag LOCUS_39450 gene mce4A 40273 39071 CDS product virulence factor Mce4A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418979.1 protein_id gnl|my_center|LOCUS_39450 41124 40282 gene locus_tag LOCUS_39460 41124 40282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418983.1 protein_id gnl|my_center|LOCUS_39460 41937 41173 gene locus_tag LOCUS_39470 41937 41173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418986.1 protein_id gnl|my_center|LOCUS_39470 43089 42175 gene locus_tag LOCUS_39480 43089 42175 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418990.1 protein_id gnl|my_center|LOCUS_39480 43304 43113 gene locus_tag LOCUS_39490 43304 43113 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418993.1 protein_id gnl|my_center|LOCUS_39490 43456 44637 gene locus_tag LOCUS_39500 43456 44637 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_39500 44661 45758 gene locus_tag LOCUS_39510 44661 45758 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950903.1 protein_id gnl|my_center|LOCUS_39510 45772 47280 gene locus_tag LOCUS_39520 gene fadD17 45772 47280 CDS product long-chain-fatty-acid--CoA ligase FadD17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901655.1 protein_id gnl|my_center|LOCUS_39520 47449 51648 gene locus_tag LOCUS_39530 47449 51648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39530 53311 51767 gene locus_tag LOCUS_39540 53311 51767 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900872.1 protein_id gnl|my_center|LOCUS_39540 54144 53308 gene locus_tag LOCUS_39550 54144 53308 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_39550 55916 54792 gene locus_tag LOCUS_39560 55916 54792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence73 454 759 gene locus_tag LOCUS_39570 454 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 805 1110 gene locus_tag LOCUS_39580 805 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 1340 1807 gene locus_tag LOCUS_39590 1340 1807 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090395.1 protein_id gnl|my_center|LOCUS_39590 2157 1804 gene locus_tag LOCUS_39600 2157 1804 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900347.1 protein_id gnl|my_center|LOCUS_39600 3313 2168 gene locus_tag LOCUS_39610 3313 2168 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407571.1 protein_id gnl|my_center|LOCUS_39610 3808 3332 gene locus_tag LOCUS_39620 3808 3332 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407562.1 protein_id gnl|my_center|LOCUS_39620 3782 4669 gene locus_tag LOCUS_39630 3782 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902086.1 protein_id gnl|my_center|LOCUS_39630 5690 4635 gene locus_tag LOCUS_39640 5690 4635 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407559.1 protein_id gnl|my_center|LOCUS_39640 6506 5697 gene locus_tag LOCUS_39650 gene inhA 6506 5697 CDS product NADH-dependent enoyl-ACP reductase InhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407553.1 protein_id gnl|my_center|LOCUS_39650 7211 6519 gene locus_tag LOCUS_39660 7211 6519 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908549.1 protein_id gnl|my_center|LOCUS_39660 8377 7370 gene locus_tag LOCUS_39670 8377 7370 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407530.1 protein_id gnl|my_center|LOCUS_39670 9327 8374 gene locus_tag LOCUS_39680 9327 8374 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_39680 10427 9324 gene locus_tag LOCUS_39690 10427 9324 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407527.1 protein_id gnl|my_center|LOCUS_39690 11315 10575 gene locus_tag LOCUS_39700 gene ripB 11315 10575 CDS product NlpC/P60 family peptidoglycan endopeptidase RipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407525.1 protein_id gnl|my_center|LOCUS_39700 12741 11326 gene locus_tag LOCUS_39710 gene ripA 12741 11326 CDS product NlpC/P60 family peptidoglycan endopeptidase RipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407523.1 protein_id gnl|my_center|LOCUS_39710 13534 12968 gene locus_tag LOCUS_39720 13534 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407520.1 protein_id gnl|my_center|LOCUS_39720 13728 16544 gene locus_tag LOCUS_39730 gene acn 13728 16544 CDS product iron-regulated aconitate hydratase Acn inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898889.1 protein_id gnl|my_center|LOCUS_39730 16555 17118 gene locus_tag LOCUS_39740 16555 17118 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407514.1 protein_id gnl|my_center|LOCUS_39740 17377 17186 gene locus_tag LOCUS_39750 17377 17186 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407511.1 protein_id gnl|my_center|LOCUS_39750 19097 17475 gene locus_tag LOCUS_39760 19097 17475 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407507.1 protein_id gnl|my_center|LOCUS_39760 19922 19119 gene locus_tag LOCUS_39770 19922 19119 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407504.1 protein_id gnl|my_center|LOCUS_39770 20311 19961 gene locus_tag LOCUS_39780 gene trxA 20311 19961 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407501.1 protein_id gnl|my_center|LOCUS_39780 20720 20358 gene locus_tag LOCUS_39790 20720 20358 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900345.1 protein_id gnl|my_center|LOCUS_39790 22703 20736 gene locus_tag LOCUS_39800 gene ctpD 22703 20736 CDS product cobalt-translocating P-type ATPase CtpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900344.1 protein_id gnl|my_center|LOCUS_39800 22957 24069 gene locus_tag LOCUS_39810 22957 24069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 24176 26005 gene locus_tag LOCUS_39820 24176 26005 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900343.1 protein_id gnl|my_center|LOCUS_39820 26447 26100 gene locus_tag LOCUS_39830 26447 26100 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407492.1 protein_id gnl|my_center|LOCUS_39830 26904 26422 gene locus_tag LOCUS_39840 26904 26422 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407491.1 protein_id gnl|my_center|LOCUS_39840 28160 26907 gene locus_tag LOCUS_39850 28160 26907 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407490.1 protein_id gnl|my_center|LOCUS_39850 28939 28163 gene locus_tag LOCUS_39860 gene sufC 28939 28163 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407489.1 protein_id gnl|my_center|LOCUS_39860 30087 28936 gene locus_tag LOCUS_39870 gene sufD 30087 28936 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407487.1 protein_id gnl|my_center|LOCUS_39870 33812 30141 gene locus_tag LOCUS_39880 33812 30141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 34543 33809 gene locus_tag LOCUS_39890 gene sufR 34543 33809 CDS product suf operon transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003902080.1 protein_id gnl|my_center|LOCUS_39890 34647 36353 gene locus_tag LOCUS_39900 gene mptB 34647 36353 CDS product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407479.1 protein_id gnl|my_center|LOCUS_39900 36350 37291 gene locus_tag LOCUS_39910 36350 37291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407477.1 protein_id gnl|my_center|LOCUS_39910 37288 38079 gene locus_tag LOCUS_39920 37288 38079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407475.1 protein_id gnl|my_center|LOCUS_39920 38142 39056 gene locus_tag LOCUS_39930 38142 39056 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407466.1 protein_id gnl|my_center|LOCUS_39930 39875 39006 gene locus_tag LOCUS_39940 39875 39006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900341.1 protein_id gnl|my_center|LOCUS_39940 39874 40875 gene locus_tag LOCUS_39950 39874 40875 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407462.1 protein_id gnl|my_center|LOCUS_39950 41832 40906 gene locus_tag LOCUS_39960 41832 40906 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898882.1 protein_id gnl|my_center|LOCUS_39960 42050 44149 gene locus_tag LOCUS_39970 gene tkt 42050 44149 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407451.1 protein_id gnl|my_center|LOCUS_39970 44166 45284 gene locus_tag LOCUS_39980 gene tal 44166 45284 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407447.1 protein_id gnl|my_center|LOCUS_39980 45281 46825 gene locus_tag LOCUS_39990 gene zwf 45281 46825 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407443.1 protein_id gnl|my_center|LOCUS_39990 46923 47834 gene locus_tag LOCUS_40000 gene opcA 46923 47834 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407437.1 protein_id gnl|my_center|LOCUS_40000 47831 48574 gene locus_tag LOCUS_40010 gene pgl 47831 48574 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407433.1 protein_id gnl|my_center|LOCUS_40010 50483 48672 gene locus_tag LOCUS_40020 50483 48672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40020 50419 50676 gene locus_tag LOCUS_40030 50419 50676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 53995 50654 gene locus_tag LOCUS_40040 53995 50654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40040 54330 53992 gene locus_tag LOCUS_40050 54330 53992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40050 57617 54351 gene locus_tag LOCUS_40060 57617 54351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40060 57995 58342 gene locus_tag LOCUS_40070 57995 58342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898881.1 protein_id gnl|my_center|LOCUS_40070 58497 58339 gene locus_tag LOCUS_40080 58497 58339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40080 58860 58504 gene locus_tag LOCUS_40090 58860 58504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40090 59631 59233 gene locus_tag LOCUS_40100 59631 59233 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403246.1 protein_id gnl|my_center|LOCUS_40100 59888 59628 gene locus_tag LOCUS_40110 59888 59628 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403244.1 protein_id gnl|my_center|LOCUS_40110 59943 60176 gene locus_tag LOCUS_40120 gene secG 59943 60176 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407407.1 protein_id gnl|my_center|LOCUS_40120 60977 60192 gene locus_tag LOCUS_40130 gene tpiA 60977 60192 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407398.1 protein_id gnl|my_center|LOCUS_40130 62212 60974 gene locus_tag LOCUS_40140 62212 60974 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900339.1 protein_id gnl|my_center|LOCUS_40140 63244 62225 gene locus_tag LOCUS_40150 gene gap 63244 62225 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407390.1 protein_id gnl|my_center|LOCUS_40150 63599 64498 gene locus_tag LOCUS_40160 63599 64498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 64764 64901 gene locus_tag LOCUS_40170 64764 64901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 65290 66003 gene locus_tag LOCUS_40180 65290 66003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 67345 66530 gene locus_tag LOCUS_40190 gene ldtMt3 67345 66530 CDS product L,D-transpeptidase LdtMt3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407384.1 protein_id gnl|my_center|LOCUS_40190 68936 67509 gene locus_tag LOCUS_40200 68936 67509 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407382.1 protein_id gnl|my_center|LOCUS_40200 70630 68933 gene locus_tag LOCUS_40210 70630 68933 CDS product DUF3556 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407380.1 protein_id gnl|my_center|LOCUS_40210 71133 70558 gene locus_tag LOCUS_40220 71133 70558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 73005 71155 gene locus_tag LOCUS_40230 73005 71155 CDS product esterase PE16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407378.1 protein_id gnl|my_center|LOCUS_40230 73144 73947 gene locus_tag LOCUS_40240 73144 73947 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_40240 73951 75585 gene locus_tag LOCUS_40250 gene fadD12 73951 75585 CDS product acyl-CoA ligase FadD12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898876.1 protein_id gnl|my_center|LOCUS_40250 75582 76862 gene locus_tag LOCUS_40260 75582 76862 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407371.1 protein_id gnl|my_center|LOCUS_40260 78255 76870 gene locus_tag LOCUS_40270 78255 76870 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407366.1 protein_id gnl|my_center|LOCUS_40270 79269 78292 gene locus_tag LOCUS_40280 gene whiA 79269 78292 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901156.1 protein_id gnl|my_center|LOCUS_40280 80280 79282 gene locus_tag LOCUS_40290 gene cuvA 80280 79282 CDS product carbon utilization/virulence protein CuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407352.1 protein_id gnl|my_center|LOCUS_40290 81182 80277 gene locus_tag LOCUS_40300 gene rapZ 81182 80277 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898873.1 protein_id gnl|my_center|LOCUS_40300 83122 81179 gene locus_tag LOCUS_40310 gene uvrC 83122 81179 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407347.1 protein_id gnl|my_center|LOCUS_40310 83649 83173 gene locus_tag LOCUS_40320 83649 83173 CDS product lectin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407345.1 protein_id gnl|my_center|LOCUS_40320 >Feature sequence74 >Feature sequence75 >Feature sequence76 >Feature sequence77 >Feature sequence78 1697 552 gene locus_tag LOCUS_40330 gene embR 1697 552 CDS product response regulator transcription factor EmbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406553.1 protein_id gnl|my_center|LOCUS_40330 2651 1941 gene locus_tag LOCUS_40340 2651 1941 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898800.1 protein_id gnl|my_center|LOCUS_40340 3326 2961 gene locus_tag LOCUS_40350 3326 2961 CDS product DUF4189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406558.1 protein_id gnl|my_center|LOCUS_40350 4086 3355 gene locus_tag LOCUS_40360 gene lprA 4086 3355 CDS product TLR2 agonist LprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406562.1 protein_id gnl|my_center|LOCUS_40360