COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2595401 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(522..971) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458506.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene mioC CDS complement(1179..2540) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene mnmE CDS complement(2819..4468) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378235.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene yidC CDS complement(4695..5018) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rnpA CDS complement(5064..5198) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene rpmH CDS complement(5420..6157) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593852.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(6154..6825) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260897.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(6843..8573) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268906.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS complement(8826..9587) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481168.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 9984..11306 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099214.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene dnaA CDS 11378..12478 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673176.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene dnaN CDS 12479..13558 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458661.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene recF CDS 13577..16015 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene gyrB CDS 16389..16826 product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(16915..18180) product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(18362..20443) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458686.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene glyS CDS complement(20446..21369) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174901.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene glyQ CDS 21561..22109 product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 22185..22427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(22482..22730) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143763.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 gene tusA CDS complement(23016..23333) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459084.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene cyaY CDS 23482..23730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 23741..24994 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene lysA CDS 25062..25892 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 gene dapF CDS 25912..26631 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 26621..27556 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene xerC CDS 27604..28332 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899908.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene yigB CDS complement(28403..29017) product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS complement(29053..30090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 30436..30888 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106124.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(30990..31823) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213463.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(31938..32948) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459120.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 33160..33498 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33527..34528 product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478987.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 34540..35037 product cyclin-dependent kinase inhibitor 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262753.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS 35102..36334 product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478994.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene arsJ CDS 36416..37429 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489757.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(37450..37785) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 37941..38315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39122..39754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 39818..40402 product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455144.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(40486..40755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(40760..41362) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene rsmD CDS 41534..42820 product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene ftsY CDS 42841..43515 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene ftsE CDS 43505..44470 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene ftsX CDS 44741..45595 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene rpoH CDS 46024..46347 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene glpE CDS 46407..47255 product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene glpG CDS 47360..47917 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 47923..48780 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262811.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene ubiA CDS complement(48877..51294) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460370.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene plsB CDS 51569..52192 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene lexA CDS 52308..53132 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480879.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 53222..54574 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480864.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene dinF CDS complement(54649..56049) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene sthA CDS 56302..56916 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838364.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene fabR CDS complement(56989..58095) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480873.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene trmA CDS 58531..60342 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228170.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene btuB CDS 60463..61269 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene murI CDS complement(61241..61687) product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480876.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 rRNA 62274..63811 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 tRNA 63881..63957 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 63994..64069 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 rRNA 64367..67251 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 67391..67501 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 tRNA 67536..67612 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(67769..69109) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561723.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene pssA CDS complement(69195..69632) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626026.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 69699..70745 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593527.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene murB CDS 70754..71728 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478002.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene birA CDS complement(71741..72664) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene coaA tRNA 72872..72947 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA 72990..73074 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 73142..73216 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 73231..73306 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 73406..74590 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene tuf CDS 74807..75220 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene secE CDS 75232..75780 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421327.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene nusG CDS 75925..76353 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421326.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene rplK CDS 76360..77064 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rplA CDS 77350..77841 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene rplJ CDS 77899..78267 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421323.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene rplL CDS 78544..82572 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene rpoB CDS 82661..86860 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456484.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene rpoC CDS 87009..87797 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534698.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS 88105..88716 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261706.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS 88736..89530 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(89874..90290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(90455..90787) product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706244.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 91168..91332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(91394..91885) product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497574.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 92073..92864 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene nudC CDS 93137..94204 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene hemE CDS 94380..95762 product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263439.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 95759..96748 product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 96764..97915 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679653.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 97912..99090 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(99074..99649) product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(99686..100627) product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456455.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 100737..101330 product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941132.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 101627..101899 product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene hupA CDS 101994..102725 product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262780.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(102860..104155) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 gene purD CDS complement(104267..105859) product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene purH CDS complement(106086..106289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(106348..107370) product Mal regulon transcriptional regulator MalI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705327.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 107434..108210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(108266..108610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 note possible pseudo, internal stop codon CDS complement(108653..108949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 note possible pseudo, internal stop codon, frameshifted CDS complement(108894..109187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 note possible pseudo, internal stop codon, frameshifted CDS 109376..110161 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172794745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS 110158..110328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 110487..112553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(112667..112963) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462885.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene fis CDS complement(112991..113854) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421284.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene dusB CDS complement(114142..115026) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421283.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene prmA CDS complement(115125..116573) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707115.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene panF CDS complement(116566..116895) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381175.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(117431..118774) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene accC CDS complement(118828..119295) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene accB CDS complement(119400..119855) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 gene aroQ CDS complement(120427..122373) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478589.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene acs CDS complement(122970..123629) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(123629..125515) product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 125789..126934 product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017020187.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 127141..130566 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478571.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS 130578..130829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(131251..132954) product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(132965..133231) product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(133547..134170) product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(134225..135952) product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(136158..136793) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS complement(136916..138805) product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(139023..140324) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262748.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(140464..141909) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224052.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene aspA CDS 142269..142772 product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155652716.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene fxsA CDS complement(143269..143748) product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene trmL CDS complement(143816..145183) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene cpxA CDS complement(145183..145866) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940152.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(145984..146160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 146075..146614 product CpxP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(146673..148001) product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(148780..149430) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(149427..150401) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene rarD CDS 150574..152415 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458577.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene recQ CDS 152418..152723 product DUF3630 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 152951..153661 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015358.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 154667..157492 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene polA CDS complement(157856..157990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS complement(158343..159053) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416925.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene yihA CDS 159087..159854 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478649.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 160084..160734 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 160753..161328 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478647.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene yihI CDS 161383..161871 product DUF2489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478692.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 161931..163352 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene hemN CDS complement(163665..166217) product GGDEF and EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128651.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(166501..167913) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene glnG CDS complement(167975..169063) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene glnL CDS complement(169234..169899) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(170132..171541) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456818.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene glnA CDS 172183..174012 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416970.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene typA CDS 174208..175083 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456793.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 175080..175517 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478645.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene dtd CDS 175542..176465 product bifunctional GNAT family N-acetyltransferase/hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(176587..178605) product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS complement(178818..180452) product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262836.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene pckA CDS complement(180721..181353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(181560..182069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 note possible pseudo, frameshifted CDS complement(182165..183031) product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene hslO CDS complement(183053..183442) product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene hslR CDS 183822..184736 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene gspC CDS 184797..186842 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086028586.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene gspD CDS 186839..188356 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene gspE CDS 188360..189580 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262831.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene gspF CDS 189801..190262 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene gspG CDS 190462..191040 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262829.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene gspH CDS 191027..191392 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262828.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene gspI CDS 191379..192107 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene gspJ CDS 192104..193240 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478666.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene gspK CDS 193206..194645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 194648..195157 product type II secretion system protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458943.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 195169..195927 product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459010.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 195997..196566 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459019.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene nudE CDS 196570..197397 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458987.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene cysQ CDS complement(197545..198132) product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070178.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene nfuA CDS complement(198218..198712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 199012..199806 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489494.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene bioH CDS complement(199991..200752) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648859.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(200861..202423) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263135.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene glpD CDS 202700..203551 product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 203581..205080 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139398.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene glpK CDS complement(205739..206683) product DUF4382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029302595.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(207038..209359) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478620.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 209558..210037 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458979.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene greB CDS 210213..210935 product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene ompR CDS 211100..212428 product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222687.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene envZ CDS complement(212841..214205) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS complement(214604..216685) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459023.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene recG CDS complement(217148..218122) product Kdo(2)-lipid IV(A) acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260986.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(218283..218873) product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene slmA CDS complement(219027..219485) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015570042.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene dut CDS complement(219575..220798) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene coaBC CDS 221076..221750 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene radC CDS 221854..222207 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073079.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 222585..222821 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467944.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene rpmB CDS 222836..223003 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051801.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene rpmG CDS 222972..223331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 223408..224217 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462495.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene mutM CDS complement(224486..224998) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260992.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene coaD CDS complement(224995..226035) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 226201..227205 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(227271..228044) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260994.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(228051..229103) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260995.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 229048..229260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 229301..230029 product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260996.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(230041..231312) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466242.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene waaA CDS complement(231322..232353) product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260999.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene waaF CDS complement(232366..233454) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(233474..234565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(234562..235611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(235639..236619) product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466232.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene lpxM CDS 236809..237891 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074270.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(237873..239102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(239170..240114) product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466230.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rfaD CDS complement(240234..241424) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073055.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(241434..241838) product type II toxin-antitoxin system toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(241831..242262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(242449..243882) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261013.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 244110..245336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 245336..245731 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS 245734..246927 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876000.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 246932..247711 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419153.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 247713..248456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 248466..250940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 251010..251429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 251650..251895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(252709..254604) product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 254744..255715 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 255727..256275 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236728.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 257056..258063 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097849.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 258063..259148 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481408.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene rfbB CDS 259150..260025 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene rfbA CDS 260027..261472 product O7 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060533.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene wzx CDS 261476..262564 product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 262561..263238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 263240..264247 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 264248..265345 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189471990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS 265416..266687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 266684..267565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS 267562..268626 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 268619..269437 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(270119..270655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490290.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 271208..272317 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613991.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(272652..273953) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(273953..274198) product type II toxin-antitoxin system antitoxin HipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296726.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene hipB CDS complement(274460..275080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(275081..276238) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 276833..277282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 277275..279848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 279835..282888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 282885..284186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 284368..285105 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861855.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 285635..286030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 286561..286701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 286788..287036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(287961..288311) product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254750.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene mazF CDS complement(288311..288562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(289127..290149) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027757.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 290309..290707 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 290767..291279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(291312..292370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(292405..292707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(292697..293506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 note possible pseudo, frameshifted CDS complement(293508..293792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 note possible pseudo, frameshifted CDS 294450..295016 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210846.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 295075..295770 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 295782..298178 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 298199..299218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(299398..299862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(300195..300443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(300832..301206) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481539.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 302058..303431 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(303566..304552) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157570.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 304788..306227 product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 306407..307366 product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 307363..308808 product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(309225..311351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(311437..312342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(312575..314764) product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261021.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(314833..315276) product low molecular weight protein-tyrosine-phosphatase Wzb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene wzb CDS complement(315362..316618) product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261018.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 317294..318382 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417117.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene wecA CDS 318493..319659 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 319761..320726 product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261054.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 320944..321213 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490667.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 321203..321538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(321633..322556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(322699..323412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(323406..323663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(323823..324851) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456946.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(325136..326680) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261056.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene gpmM CDS complement(327024..327278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 327166..327621 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 327733..328197 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene secB CDS 328383..329453 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482209.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene gpsA CDS 329646..330467 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456939.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene cysE CDS complement(330601..331950) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106102.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 332244..332534 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 332602..334245 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene groL CDS 334885..335850 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 335919..337652 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044735.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 337712..339340 product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705561.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 339427..340233 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771957.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(340777..341148) product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458677.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 341571..341801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 342348..342593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(342779..343681) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 343873..345573 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626068.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 345632..346771 product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587013.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene lldD CDS 346973..348625 product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(348705..348962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 349145..350623 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071037.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(350708..351235) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482203.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 351513..352493 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(352860..353102) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(353323..354264) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105599.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(354275..355351) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120173.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene epmB CDS 355385..355951 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene efp CDS complement(356400..356762) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001884009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene frdD CDS complement(356773..357156) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071094.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene frdC CDS complement(357158..357904) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(357904..359715) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166592.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene frdA CDS 360124..361092 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene epmA CDS complement(361111..362001) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533894.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(362049..362762) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(362905..363840) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482194.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene asd CDS complement(363951..365003) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456985.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rsgA CDS 365088..365642 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene orn tRNA 365800..365875 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 365916..365992 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 366028..366103 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(366620..367750) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061012950.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene queG CDS 368028..368492 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene tsaE CDS 368618..370210 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 370235..372133 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene mutL CDS 372130..373068 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192300.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene miaA CDS 373426..373704 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262725.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene hfq CDS 373761..375068 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480048.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene hflX CDS 375097..376290 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene hflK CDS 376293..377273 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460668.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene hflC CDS 377363..377548 product DUF2065 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 377684..379000 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(379079..380227) product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262719.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene hmpA CDS 380347..380772 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421144.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene nsrR CDS 380860..383349 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285863.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene rnr CDS 383409..384158 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064143.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene rlmB CDS 384484..384867 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421140.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene rpsF CDS 384875..385177 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene priB CDS 385194..385421 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090472.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rpsR CDS 385460..385912 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480442.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene rplI CDS complement(386088..387236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 387455..388849 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 388925..390019 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106087.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene alr CDS 390044..391390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061030565.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 391658..393310 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261112.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene pgi CDS complement(393432..393959) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056163.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene ppa CDS complement(394174..395187) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene fbp CDS 395516..396874 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479669.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene mpl CDS 396976..397605 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 397807..398814 product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261085.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene thiB CDS 398876..400465 product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479637.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene thiP CDS 400465..401208 product thiamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454663.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene thiQ CDS complement(401233..401871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012535510.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(402212..403627) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 404110..407034 product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene rapA CDS 407175..407912 product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261089.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene rluA CDS 407967..408989 product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056892.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(409010..410017) product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(410241..410711) product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005430583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene argR CDS 411011..411946 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene mdh CDS complement(412084..413055) product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345929.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene ispB CDS 412994..413155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 413351..413662 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene rplU CDS 413684..413941 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417307.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene rpmA CDS 414139..415308 product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene cgtA CDS 415446..416213 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444259.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 416210..416677 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459611.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 416716..417204 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261097.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene folA CDS 417299..417637 product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451084.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(417658..418455) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(418603..419064) product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 419356..422085 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene secA CDS 422215..422613 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821181.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene mutT CDS complement(423035..423235) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene yacG CDS complement(423272..424003) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 gene zapD CDS complement(424048..424671) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 gene coaE CDS complement(424675..425568) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262625.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(425610..426872) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(426907..428595) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957200.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 gene pilB CDS complement(428605..429072) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020333947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(429580..430500) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479699.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene nadC CDS 430778..431326 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene ampD CDS 431772..432539 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462576.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene pdhR CDS 432604..435267 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462566.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene aceE CDS 435347..437230 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462571.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene aceF CDS 437551..438978 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene lpdA CDS complement(439109..439672) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071587.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(439851..440015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(440121..440942) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035032.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(440988..441371) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459620.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene apaG CDS complement(441514..442320) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417325.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene rsmA CDS complement(442324..443352) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene pdxA CDS complement(443345..444607) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459625.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene surA CDS complement(444728..447031) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261100.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene lptD CDS 447239..448084 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546924.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene djlA CDS complement(448231..449949) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(449946..450650) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(450654..451400) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(451823..452257) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070799.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene zntR CDS complement(452333..453580) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460596.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(453577..454302) product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(454352..454822) product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(454815..456017) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261525.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(456029..456727) product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261524.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(456721..459165) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS complement(459174..459890) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479021.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(459883..460335) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479006.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(460420..461967) product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(461951..463672) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(463788..464153) product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(464157..465632) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460589.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(465665..466222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(466222..466479) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(466499..466756) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457487.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(466799..467605) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261515.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(467606..468349) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065604132.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 468559..469626 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 469666..470907 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261511.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(471299..471919) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene leuD CDS complement(471930..473348) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480559.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene leuC CDS complement(473369..474457) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459506.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 gene leuB CDS complement(474591..476141) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064847.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene leuA CDS 476619..477143 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 477148..478206 product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 478479..479444 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140416966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene leuO CDS 480013..481731 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 481733..482227 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene ilvN CDS complement(482698..484110) product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421033.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene pykF CDS 484496..485257 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 485362..487194 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262763.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene glmS CDS complement(487271..487882) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(488129..489388) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(489505..490185) product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421000.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 490453..491970 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447090.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(492080..492847) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262657.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 492968..495862 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455447.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene glnE CDS 495940..497370 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455449.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene hldE CDS complement(497498..498847) product efflux RND transporter outer membrane protein VpoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455451.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene vpoC CDS 499076..499699 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene nudF CDS 499756..500178 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080926.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 500209..501039 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868845.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene cpdA CDS 501138..501722 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene yqiA CDS 501870..503756 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene parE CDS 503785..506058 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene parC CDS complement(506184..507059) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(507103..508167) product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490480.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene degS CDS complement(508317..509690) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(509764..510201) product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457173.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene zapG CDS 510376..511479 product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187998.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene zapE CDS 511816..512244 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene rplM CDS 512260..512652 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458217.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rpsI CDS 513179..513772 product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420954.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 gene petA CDS 513772..515040 product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262643.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 515037..515777 product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758871.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 515947..516582 product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene sspA CDS 516585..517103 product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene sspB CDS 517324..518265 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122740.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene metA CDS complement(518349..518969) product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381501.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(519081..519923) product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461204.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene btuF CDS complement(519978..520673) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461186.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 gene mtnN CDS complement(520764..521213) product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480841.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(521331..522800) product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(522793..527337) product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene gltB CDS 527953..529698 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455892.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 529695..532043 product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488721.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 gene arcB CDS complement(532145..532861) product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene arcA CDS 533171..533665 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204903.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 533947..536406 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479590.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene thrA CDS 536408..537391 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene thrB CDS 537388..538677 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479592.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 gene thrC CDS complement(538793..539170) product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614136.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene grcA CDS 539499..540194 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465920.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene ung CDS 540311..540847 product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459058.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(540935..541120) product DUF3545 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459060.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 541821..543248 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882045.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 543347..544123 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487639.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene yaaA CDS complement(544189..545421) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene srmB CDS complement(545739..546446) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488675.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 546737..548059 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479733.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene brnQ CDS complement(548170..548688) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene fldB CDS 548830..549735 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479728.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene xerD CDS 549769..550539 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene dsbC CDS 550539..550868 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419066.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene yqfB CDS 550923..552686 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570155.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene recJ CDS 552945..553907 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261232.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene prfB CDS 554012..555535 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene lysS CDS 555803..557134 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417604.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 557626..557877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249919.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(557990..559024) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488759.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 559235..559543 product DUF6482 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481791.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(559576..560247) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801221.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene mutH CDS 560888..561403 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene rppH CDS 561465..563714 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene ptsP CDS complement(563682..563951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 564134..564985 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135560.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene lgt CDS 564989..565840 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250353.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 565949..566842 product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457134.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene nhaR CDS 566862..567158 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461077.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(567243..567503) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rpsT CDS 567797..569353 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261243.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene murJ CDS 569440..570423 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene ribF CDS 570485..573343 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417642.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene ileS CDS 573361..573864 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071968.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene lspA CDS 574020..574448 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene fkpB CDS 574538..575482 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene ispH CDS 575819..576289 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 576439..576696 product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 576684..576986 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229317.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(577402..578892) product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477897.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 579165..579545 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460271.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 579577..581373 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544192.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(581559..582668) product GNAT family N-acetyltransferase/peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354939.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 582771..584234 product RimK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285013.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(584325..585059) product two-component system response regulator BtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460295.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene btsR CDS complement(585094..586773) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 586972..588045 product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261313.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 588089..589219 product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477896.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene tyrA CDS complement(589307..590446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(590678..592345) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene ettA CDS 592652..594553 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105682.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene sltY CDS 594558..594914 product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250616.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene trpR CDS complement(594895..595443) product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene yjjX CDS complement(595447..596646) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene pheA CDS complement(596899..597234) product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468590.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene raiA CDS complement(597587..598315) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877198.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 598474..599445 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460300.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene rluD CDS 599459..600196 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene pgeF CDS 600307..602880 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene clpB CDS 603089..603772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 rRNA 604304..605841 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 tRNA 605936..606011 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA 606032..606107 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA 606135..606210 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 606252..606327 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 rRNA 606689..609573 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 609713..609823 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 tRNA 609857..609933 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 610003..610079 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 610435..611157 product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070278.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene nfsA CDS complement(611246..611500) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460170.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(611502..612944) product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene yegQ CDS complement(613151..614062) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483046.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene rdgC CDS 614279..614968 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460184.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene phoB CDS 615017..616333 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460158.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene phoR CDS 616342..617301 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(617412..618956) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214489.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene ppx CDS complement(618966..621041) product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460183.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene ppk1 CDS 621270..623537 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460206.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 623568..625235 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935851.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene pstA CDS 625237..626055 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460191.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene pstB CDS 626170..626868 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene phoU CDS complement(626998..627735) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262442.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(627918..628529) product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381738.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 628729..629634 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460156.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 629763..630815 product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482995.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene queA CDS 630903..632054 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene tgt CDS 632158..632493 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene yajC CDS 632567..634417 product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene secD CDS 634427..635377 product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene secF CDS complement(635550..636353) product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene suhB CDS 636531..637268 product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 gene trmJ CDS 637402..637887 product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496331.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 gene iscR CDS 637925..639139 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 639174..639557 product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483070.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene iscU CDS 639729..640052 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene iscA CDS 640294..640809 product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460241.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene hscB CDS 640862..642712 product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460220.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene hscA CDS 642824..643162 product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460237.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene fdx CDS 643189..643386 product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene iscX CDS 643900..645198 product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460223.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene pepB CDS 645274..645702 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162850.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene ndk CDS 645868..646986 product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417927.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 647032..647793 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018640.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene pilW CDS 647783..648751 product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091139.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene rodZ CDS 648759..649880 product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene ispG CDS 649909..651177 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene hisS CDS 651202..651819 product YfgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424767.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 651849..653015 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261368.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene bamB CDS 653251..654747 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene der CDS 655103..655345 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460239.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS complement(655365..656636) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460216.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene xseA CDS 657051..658514 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene guaB CDS 658769..660346 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene guaA CDS 660654..661859 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 662007..662978 product SMEK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964051.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 662965..663189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015758591.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 663180..664898 product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964053.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(664991..666028) product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226858412.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 666114..666341 product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 666354..667349 product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 668165..668539 product conjugal transfer transcriptional regulator TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039733.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene traJ CDS 668557..670296 product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 670533..671306 product P-type conjugative transfer protein TrbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039736.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene trbJ CDS 671309..671506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 671509..672801 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene trbL CDS 672782..673054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 673075..673329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 673516..675036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(675161..675628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(675751..676734) product DUF4917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161327.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 677321..677506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 677666..679159 product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(679538..680740) product tetracycline efflux MFS transporter Tet(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene tet(B) CDS 680821..681423 product tetracycline resistance transcriptional repressor TetR(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene tetR(B) CDS 681602..683095 product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 683291..684010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 684227..685441 product CmlA/FloR family chloramphenicol efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970086.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene cml CDS 685469..685774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 685886..687379 product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS complement(687555..687857) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(687944..688759) product sulfonamide-resistant dihydropteroate synthase Sul2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043260.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 gene sul2 CDS 689313..689477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(689919..691271) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene gdhA CDS 691261..691395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(691505..691804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(691806..692060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(692125..693189) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 693299..694138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 694439..695683 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894643.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(695735..696592) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074451.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 696778..697902 product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 698261..699100 product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 gene fghA CDS 699236..700564 product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 701349..702266 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene cyoA CDS 702282..704330 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483356.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene cyoB CDS 704320..704931 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene cyoC CDS 704931..705257 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 705267..706136 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195157148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene cyoE CDS 706657..707328 product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073392.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 707504..709282 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006513.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(709351..709980) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 710142..712127 product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365759.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(712292..713860) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477479.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene ahpF CDS complement(714040..714597) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395542.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene ahpC CDS complement(714766..715023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(715152..716234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(716246..717040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06360 tmRNA complement(717206..717572) product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(717743..718228) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162689.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene smpB CDS 718377..718811 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420637.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 718840..719148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(719314..719676) product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene bamE CDS complement(719856..721520) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene recN CDS complement(721712..722596) product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742830.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene nadK CDS 722804..723442 product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene grpE CDS 723607..724638 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene mgrA CDS 724954..726864 product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene dnaK CDS 727170..728312 product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene dnaJ CDS complement(728531..728941) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483031.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 729098..729634 product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261326.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 729612..730205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044583186.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 730205..731536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 731526..731924 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455961.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS 732038..733318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055031892.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 733380..733901 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455934.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene tadA CDS complement(733961..734098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(734370..735887) product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261381.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 gene mltF CDS 736235..740131 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene purL CDS 740452..741063 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072802.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS complement(741077..743059) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 743156..743641 product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456579.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 743829..744581 product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(744717..747263) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261385.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 747655..748689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(748744..748932) product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456636.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(748941..749144) product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863662.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(749197..750912) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479053.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(751014..751745) product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261411.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene tsaA CDS 752099..753688 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262003.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 753824..754084 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479047.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(754396..755193) product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene metQ CDS complement(755399..756082) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(756072..757106) product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863666.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene metN CDS 757447..758010 product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene gmhB CDS 758258..759286 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418068.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 759288..760364 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261416.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 760395..762266 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512779.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 762421..763446 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261418.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 763443..764504 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 764542..764934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(765004..765630) product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261421.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 765996..767246 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(767439..767768) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261423.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 768074..768523 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482986.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 gene nrdR CDS 768563..769693 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483035.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene ribD CDS 769702..770361 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483039.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 770404..771513 product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261427.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene ribBA CDS 771721..772188 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005440184.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene ribE CDS 772195..772662 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene nusB CDS 772784..773788 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456036.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene thiL CDS 773810..774328 product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283269.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene pgpA CDS 774345..774692 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261433.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(774780..776663) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483016.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene dxs CDS complement(776687..777571) product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568619.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene ispA CDS complement(777573..777818) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene xseB CDS 778094..779542 product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene thiI CDS 779962..780897 product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105705.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 780936..781568 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 781576..782019 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489963.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 782016..783107 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451600.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rlmM CDS complement(783225..784004) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459149.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene xni CDS complement(784115..785470) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459150.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene ppnN CDS complement(785588..787870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(788078..788962) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene queF CDS 789054..789602 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene syd CDS 789609..790394 product Zn-ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459158.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(790543..790995) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456606.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(790997..791278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956112.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(791312..791626) product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261354.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(791673..792746) product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379749.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 792860..793174 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456758.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 793171..793977 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456757.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene truC CDS complement(794488..794871) product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456756.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(794992..797616) product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146857.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene glnD CDS complement(797789..798667) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene map CDS 799054..799782 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene rpsB CDS 799929..800771 product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene tsf CDS 801047..801781 product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262433.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 gene pyrH CDS 801849..802406 product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene frr CDS 802491..803243 product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180544.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene uppS CDS 803258..804103 product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480977.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 804222..805418 product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456710.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene ispC CDS 805466..806824 product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456697.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene rseP CDS 806879..809308 product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456717.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene bamA CDS 809336..809845 product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794125.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 809858..810877 product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 gene lpxD CDS 811103..811555 product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene fabZ CDS 811567..812355 product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581103.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene lpxA CDS 812429..813643 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480975.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene lpxB CDS 813640..814269 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene rnhB CDS 814378..817857 product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262423.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene dnaE CDS 818038..818997 product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene accA CDS 819129..820544 product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262421.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene tilS CDS 820625..820963 product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420517.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene glnB CDS 821066..821917 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747834.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(822034..823602) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(823846..824628) product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene gloB CDS 824668..825408 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801254.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(825436..825909) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484436.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene rnhA CDS 825966..826712 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene dnaQ CDS complement(826790..829267) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481111.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene fadE CDS 829613..830191 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420499.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene lpcA CDS 830238..831047 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(831360..832016) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457769.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene purN CDS complement(832158..833198) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene purM CDS 833409..834035 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457783.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene upp CDS 834206..835426 product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(835517..836668) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212174.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene yqhD CDS complement(836761..837771) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 837896..838804 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105599.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(838845..839267) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(839292..839879) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457725.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene wrbA CDS complement(839876..840226) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117768.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene arsC CDS complement(840265..841731) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457720.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 841955..842197 product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420485.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 842185..843267 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(843344..843976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(844183..844782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 note possible pseudo, frameshifted CDS complement(844775..845245) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481097.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene bcp CDS complement(845283..845822) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465166.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 846055..846933 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481116.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene dapA CDS 846982..848019 product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262400.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene bamC CDS complement(848120..848374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(848420..849112) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(849112..850245) product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 gene dapE CDS complement(850259..850603) product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457702.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 850944..851237 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(851324..851713) product DUF2956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 851751..852221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 852320..853222 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(853363..853872) product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene crr CDS complement(853925..855649) product phosphoenolpyruvate-protein phosphotransferase PtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489822.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene ptsI CDS complement(855709..855966) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(856256..857224) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489833.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene cysK CDS complement(857458..858219) product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167408.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene cysZ CDS 858567..859523 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157059.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene zipA CDS 859600..861618 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene ligA CDS 862104..863498 product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS 863565..863921 product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 863931..864350 product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027396.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 gene cueR CDS complement(864392..865246) product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(865528..866439) product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478501.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 866557..867129 product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261484.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene yfcE CDS complement(867153..867428) product SelT/SelW/SelH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454560.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(867792..868301) product transmembrane regulator ToxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181145.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene toxS CDS complement(868312..869163) product transcriptional regulator ToxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478489.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene toxR CDS 869386..871311 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478520.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene htpG CDS 871480..872127 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 gene adk CDS 872290..873273 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478510.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene hemH CDS complement(873368..874879) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 875245..875730 product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454588.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 gene rfaH CDS complement(875834..877498) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene asnB CDS complement(877755..879383) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(879483..880697) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013120.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(880699..881835) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478503.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene nagA CDS complement(881848..882651) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene nagB CDS 882924..884480 product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023164.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene nagE CDS 884609..886333 product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454579.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 gene glnS CDS complement(886487..886933) product ferric iron uptake transcriptional regulator FcrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene fcrX CDS complement(887138..887665) product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261496.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene fldA CDS complement(887759..887980) product DUF2788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965050.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(888077..888850) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489819.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 889168..889704 product replication initiation negative regulator SeqA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene seqA CDS 889803..891434 product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene pgm CDS complement(891531..892265) product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 892424..893182 product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061710.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(893272..894561) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455487.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 894951..895343 product succinate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene sdhC CDS 895337..895684 product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238620.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene sdhD CDS 895685..897451 product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455465.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene sdhA CDS 897466..898179 product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 898304..901117 product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455464.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene sucA CDS 901174..902382 product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455502.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene odhB CDS 902527..903693 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048578.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene sucC CDS 903693..904565 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025475.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene sucD CDS 904716..905090 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(905208..907211) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700219.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(907431..908216) product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene znuB CDS complement(908220..909023) product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene znuC CDS 909251..910171 product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene znuA CDS 910181..911446 product murein DD-endopeptidase MepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene mepM CDS complement(911433..911621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 911557..915027 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 915678..915902 product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455496.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 915905..918193 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene feoB CDS complement(918261..918692) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455485.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(919041..920774) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455463.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene argS CDS 920990..921580 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261510.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(921679..922521) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478783.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene purU CDS 922829..924796 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262264.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 924827..925543 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene tsaB CDS 925635..926180 product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478780.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 926185..927066 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478778.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 927205..928893 product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455511.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene fadD CDS 928987..930105 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene rnd CDS complement(930284..930541) product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene minE CDS complement(930543..931355) product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458081.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene minD CDS complement(931582..932244) product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene minC CDS 932526..932801 product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 932829..933863 product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 934014..935168 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706712.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 935180..938332 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 938465..938875 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064295.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(938942..939796) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126770.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene folD tRNA 940049..940125 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(940202..941611) product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706100.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 gene ascB CDS 941819..942703 product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112657.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(942802..944058) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418817.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 944195..945070 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017018211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 945322..946557 product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043405.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 946673..947245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065622549.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 947365..948027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457839.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 948193..948927 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348992.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 948944..950389 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348991.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 950603..951853 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091472.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 952000..952944 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 952941..953825 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185577.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 953879..954985 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 955518..956822 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460612.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 gene tig CDS 957082..957708 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418252.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 gene clpP CDS 957900..959180 product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 gene clpX CDS 959310..961661 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene lon CDS 961919..962191 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 962395..964254 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482527.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene ppiD CDS 964525..964827 product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021449594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(964902..965471) product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482515.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene rrtA CDS 965560..966102 product DTW domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(966125..967492) product anti-phage deoxyguanosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(967510..968103) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene yfbR CDS complement(968164..969378) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456922.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 969712..971028 product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 971025..972809 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078087.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene menD CDS 972799..973617 product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene menH CDS 973661..974713 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene menC CDS 974720..976117 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173523.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene menE CDS 976304..976477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(976510..977442) product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512732.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(977550..978851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 978993..979868 product Tim44 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495957.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(980046..982187) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene pta CDS complement(982277..983473) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 983800..984249 product terminus macrodomain insulation protein YfbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461479.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene yfbV CDS 984447..985415 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201234.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 985555..986457 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 986454..987248 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620368.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 987589..989142 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493122.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS complement(989222..990160) product tRNA dihydrouridine(16) synthase DusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461533.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene dusC CDS 990363..990989 product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262197.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(991086..991454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(991785..993377) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132255.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene nhaB CDS 993815..994654 product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461531.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene fadR CDS complement(994681..995505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482403.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS 995859..996101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 996157..996501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(996612..998660) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262296.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene metG CDS 998957..1000039 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461600.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene apbC CDS 1000205..1000873 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene udk CDS 1000958..1001506 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706092.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene dcd CDS 1001598..1003778 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(1003846..1004445) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene cobO CDS complement(1004539..1006098) product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(1006366..1009386) product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461594.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rne CDS complement(1009383..1009523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 1010035..1010979 product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene rluC CDS complement(1011055..1011642) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 1011882..1012325 product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene yceD CDS 1012365..1012535 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene rpmF CDS 1012545..1013570 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180565.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene plsX CDS 1013576..1014526 product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490641.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 1014596..1015522 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene fabD CDS 1015583..1016317 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene fabG CDS 1016500..1016733 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene acpP CDS 1016827..1018071 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene fabF CDS 1018178..1018978 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene pabC CDS 1019065..1019997 product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453967.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 gene mltG CDS 1019997..1020641 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991933.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene tmk CDS 1020641..1021600 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453965.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 1021709..1022479 product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262283.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 1022720..1024333 product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene ptsG CDS 1024338..1024805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 1024963..1025466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1025707..1027179) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1027889..1029070 product DUF6363 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137357956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1029282..1030352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(1030465..1031910) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene pyk CDS 1032182..1033396 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1033521..1034273) product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109956.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 1034420..1035487 product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene sohB CDS 1035777..1036619 product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263633.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene focA CDS complement(1036712..1036969) product YciN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418790.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1036950..1037105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 1037274..1039901 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457230.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene topA CDS complement(1040021..1040794) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459884.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1040964..1041938 product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene cysB CDS 1041945..1043168 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1043178..1044293) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene ald CDS 1044448..1044942 product leucine-responsive transcriptional regulator Lrp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene lrp CDS 1045217..1048573 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489025.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 1048615..1049211 product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460060.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene lolA CDS 1049238..1050587 product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482170.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 1050672..1051982 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene serS CDS complement(1052200..1052541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263938.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(1052690..1053259) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263173.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(1053431..1054762) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487357.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene bioA CDS 1054870..1055937 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453785.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene bioB CDS 1055921..1057228 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene bioF CDS 1057221..1058024 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063017.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene bioC CDS 1058021..1058725 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460040.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene bioD CDS complement(1058845..1058997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 1059386..1060252 product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459987.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene htpX CDS complement(1060401..1060571) product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene rsmS CDS complement(1060561..1061124) product primosomal replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(1061205..1061975) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005492537.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(1062010..1064091) product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene dinG CDS 1064177..1064344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 1064719..1065735 product porin OmpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751972.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene ompT CDS 1065811..1066449 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462713.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1066628..1067932 product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS complement(1068043..1068459) product DNA-binding protein H-NS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460020.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS complement(1069224..1069361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1069375..1070832 product tetracycline efflux Na+/H+ antiporter family transporter Tet(35) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene tet(35) CDS 1071275..1072171 product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene hisG CDS 1072178..1073470 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480396.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene hisD CDS 1073489..1074529 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480420.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene hisC CDS 1074581..1075648 product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene hisB CDS 1075648..1076277 product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene hisH CDS 1076332..1077069 product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261650.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene hisA CDS 1077051..1077824 product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459998.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene hisF CDS 1077821..1078480 product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene hisIE CDS 1078923..1079345 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876608.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 1079357..1080433 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532371.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1080450..1081964 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS complement(1082304..1082702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS complement(1082838..1084070) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(1084282..1085004) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene lpxH CDS complement(1085104..1085598) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(1085579..1085785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1085842..1087224 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene cysS CDS 1087331..1087909 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(1088126..1089100) product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457241.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1089104..1090612) product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(1090651..1091439) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476327.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1091585..1092556) product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene cmoB CDS complement(1092631..1093359) product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene cmoA CDS 1093734..1095521 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene aspS CDS 1095638..1096159 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene ruvC CDS 1096270..1096887 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene ruvA CDS 1096903..1097916 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457270.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene ruvB CDS 1098396..1099982 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457265.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene cydA CDS 1099997..1101133 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483614.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene cydB CDS 1102032..1102451 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene ybgC CDS 1102441..1103127 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene tolQ CDS 1103130..1103579 product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929546.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1103581..1104555 product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662244.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene tolA CDS 1104589..1105941 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene tolB CDS 1105978..1106493 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459802.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene pal CDS 1106508..1107290 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483625.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene ybgF CDS 1107431..1108492 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene nadA CDS 1108753..1109445 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842742.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 1109475..1110380 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464610.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene prpB CDS 1110619..1111746 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271319.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene prpC CDS 1111800..1114382 product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477783.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 gene acnD CDS 1114403..1115617 product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene prpF CDS 1115788..1116618 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1116624..1118114) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1118274..1119962) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1120217..1122130 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene speA CDS 1122216..1123151 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998707.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene speB CDS complement(1123324..1124244) product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1124492..1126825) product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481673.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1126956..1127606 product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene elbB CDS 1127713..1128435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 1128532..1128726 product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(1128817..1129728) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481610.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene metR CDS 1129954..1132299 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481651.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene metE CDS complement(1132355..1133146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(1133312..1133749) product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778133.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS 1133911..1134174 product DUF1289 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1134261..1134470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1134721..1134999) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378066.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene rplY CDS complement(1135147..1136163) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene gntR CDS complement(1136264..1137763) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene gndA CDS complement(1137760..1138266) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171665.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(1138321..1139643) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(1139636..1140187) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172862.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(1140262..1141275) product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene dctP CDS complement(1141625..1143415) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489009.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1143596..1144837) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455385.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1145482..1146180 product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene rsuA CDS 1146293..1147483 product Bcr/CflA family multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462380.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1147506..1148150 product DUF2913 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462414.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1148334..1149005 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939696.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1148986..1151439 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462410.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS 1151439..1152563 product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1152750..1153904 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene nhaA CDS 1154334..1154963 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 1155015..1157312 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096995.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1157525..1158727 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261553.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1158909..1159406 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(1159525..1161234) product aspartate:alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483552.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS complement(1161502..1161765) product GrxA family glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809455.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1161878..1162732) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093848.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS complement(1163008..1164654) product putative pyridoxal-dependent aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene panP CDS complement(1164758..1165297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1165491..1166396) product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105795.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1166895..1167488 product TfoX/Sxy family DNA transformation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005366.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1167730..1168284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1168578..1169840 product DUF945 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483545.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1170052..1171134 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene serC CDS complement(1171242..1172963) product cysteine/glutathione ABC transporter ATP-binding protein/permease CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261562.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene cydC CDS complement(1172956..1174740) product cysteine/glutathione ABC transporter permease/ATP-binding protein CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488660.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene cydD CDS complement(1174962..1175924) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene trxB CDS complement(1176184..1177020) product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 1177285..1178631 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262136.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1178640..1179299) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(1179595..1181283) product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1181543..1182262) product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765958.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1182378..1182776 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1182799..1183527 product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1183552..1184094 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005374107.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1184382..1184768 product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666933.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1184860..1185354 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817532.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1185900..1186211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 note possible pseudo, frameshifted CDS 1186160..1186723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 note possible pseudo, frameshifted CDS complement(1186705..1187871) product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1188217..1189215 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene pheS CDS 1189234..1191621 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene pheT CDS 1191706..1192278 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1192461..1194074 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1194640..1194936 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462650.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 gene ihfA CDS 1195047..1195694 product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480776.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1195759..1196934) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262072.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene purT CDS complement(1197110..1198006) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454956.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene cdd CDS complement(1198282..1198968) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266245.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1198968..1199348) product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455074.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1199393..1200817) product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454911.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene sbcB CDS complement(1200939..1201466) product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1201494..1202255 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456110.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1202372..1206334 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483469.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene hrpA CDS 1206665..1207159 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483427.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1207259..1208035 product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1208119..1208655 product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460763.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1208737..1209276 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261942.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1209308..1210792) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991030.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1210938..1211579 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105916.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS 1212201..1212860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1212965..1213447) product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1213450..1214514) product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128805.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS 1214717..1215649 product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1215811..1216284 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457113.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1216473..1217306 product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457108.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1217800..1218048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 1218287..1219075 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209411.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(1219252..1220694) product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863424.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene rsmF CDS complement(1220819..1223455) product MCE family putative adhesion factor MAM7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457104.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene mam7 CDS complement(1223445..1224770) product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(1224790..1226619) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480797.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 1226701..1227162 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911403.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1227322..1227957 product RNA chaperone ProQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419190.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene proQ CDS 1227975..1229981 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650135.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene prc CDS 1230201..1230872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450937.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1231009..1233615 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481930.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene pepN CDS 1234054..1238898 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458266.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 1239013..1240023 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 gene pyrD CDS 1240186..1240728 product cell division protein ZapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863423.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 1241382..1243532 product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene rlmKL CDS 1243570..1243845 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS 1243836..1245767 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 1245787..1247763 product DUF3466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 1247910..1248083 product ribosome modulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494976.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene rmf CDS complement(1248205..1248729) product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene fabA CDS complement(1248793..1250454) product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001965088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 1250689..1251138 product macrodomain Ter protein MatP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene matP CDS 1251289..1251591 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 1251856..1252233 product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010892520.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1252799..1253455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1253547..1254755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1254736..1255809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1255809..1256174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1256177..1257667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1257723..1257965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1258226..1258546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS complement(1258622..1260628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1260644..1260943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 1261196..1261564 product DUF3693 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490072.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1261849..1262232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(1262265..1263683) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868530.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(1263734..1264045) product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422748.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene yciH CDS 1264189..1265157 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263422.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1265194..1266195) product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169444.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1266351..1266992) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455347.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1267179..1269860 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS complement(1269855..1270778) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1271015..1273195 product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1273669..1274685) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene galE CDS 1274805..1275557 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1275564..1275806) product DUF2789 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1275876..1276298) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1276309..1276731) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658156.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1276817..1278460 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479312.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1278574..1279668) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 1279803..1280237 product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261569.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene trxC CDS 1280557..1281609 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261617.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1281775..1282443) product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712470.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene queE CDS complement(1282458..1282817) product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418986.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene queD CDS 1282958..1283137 product DUF2986 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080338.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1283153..1283626) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(1283650..1283979) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044286901.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(1284027..1285772) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098137.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1286230..1286463) product DUF3389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455381.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1286460..1286879) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455359.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1287390..1288088 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753571.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS complement(1288212..1288790) product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261844.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene hutZ CDS complement(1288802..1289311) product heme utilization cystosolic carrier protein HutX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050752171.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene hutX CDS 1289470..1290249 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700188.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 1290286..1290978 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479222.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 1290971..1291387 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597688.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 1291387..1292256 product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS 1292294..1293385 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS 1293385..1294266 product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1294374..1294685 product YfcZ/YiiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488152.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(1294788..1295912) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480805.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 1296218..1296853 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(1296915..1297433) product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480803.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 1297599..1298429 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480808.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene nadE CDS complement(1298506..1299090) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(1299087..1299626) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1299902..1300912 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072115.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene msrP CDS 1300926..1301534 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707719.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene msrQ CDS 1301606..1302397 product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 1302591..1302770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1302836..1303114) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479216.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene ppiC CDS complement(1303227..1303910) product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422992.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1304278..1306002) product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(1306204..1307652) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899954.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene viaA CDS complement(1307665..1309329) product DUF3763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1309482..1310078 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1310089..1311099 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene ltaE CDS 1311237..1311974 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570597.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1312037..1313329) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292936.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(1313377..1313970) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009839.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 1314225..1314440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(1314465..1315130) product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479135.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1315258..1315773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 1315941..1316438 product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1316512..1317369) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263163.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 1317404..1317571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1317678..1317884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1317769..1318395 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482658.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 1318408..1318878 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461979.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1318987..1319574) product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477314.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 1319714..1320127 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423883.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene arfB CDS complement(1320233..1320916) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477356.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene folE CDS 1321152..1322411 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene moeA CDS complement(1322388..1322618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1322504..1323457) product TerC/Alx family metal homeostasis membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074622.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(1323745..1325472) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132206.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 1325712..1327376 product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489275.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1327717..1328523 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene yidA CDS 1328670..1331009 product zinc/cadmium/mercury/lead-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481815.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1331113..1331421 product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463048.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 1331411..1332226 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463046.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(1332445..1333299) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263539.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1333554..1335446 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705322.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 1335536..1336723 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene manA CDS 1336912..1338444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 1338705..1340273 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(1340331..1340507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1340443..1340841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1340981..1342171) product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534931.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1342452..1344314) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154248.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 1344717..1346777 product exoribonuclease II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489296.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene rnb CDS complement(1346891..1347256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1347412..1348233 product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(1348299..1348499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1348631..1348834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1348981..1349550 product PhnA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102406.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(1349612..1350238) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532164.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1350333..1350710) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933880.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1350800..1351273) product DUF2947 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(1351290..1351880) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(1351891..1352487) product ribosomal protein S5-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene rimJ CDS complement(1352487..1354127) product transcriptional regulator TyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483314.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene tyrR CDS complement(1354263..1355333) product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483263.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1355330..1356739) product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483259.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(1356936..1357130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1357316..1358833) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005376905.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1359072..1360496 product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene pabB CDS 1360515..1361150 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 1361405..1362664 product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863436.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1362814..1364175 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1364428..1365417 product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261688.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1365538..1365888) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152368.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1365904..1366509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 1366782..1368182 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458036.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene asnS CDS complement(1368302..1369510) product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366138.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1369688..1370152) product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1370267..1370926) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 1371085..1372275 product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155697526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 1372451..1374604 product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS 1374759..1376693 product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483278.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 1376705..1377436 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262866.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1377577..1379154) product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1379546..1379953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1380205..1380873 product DUF2982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057643027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1380950..1381603) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419041.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1381691..1382032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1382118..1383236) product DUF1513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105987.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(1383238..1384260) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1384290..1385687) product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1385751..1387004) product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101418.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1387230..1387664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1387694..1388302) product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852640.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(1388615..1391254) product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457842.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 gene gyrA CDS 1391609..1392319 product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1392905..1393039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(1393040..1393222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1393476..1395761 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene nrdA CDS 1395905..1397038 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457864.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene nrdB CDS 1397038..1397316 product class I ribonucleotide reductase maintenance protein YfaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483309.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene yfaE CDS complement(1397457..1398209) product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261624.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1398333..1399535) product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261817.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 1399689..1400222 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483182.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 1400319..1401266 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1401386..1401721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(1401828..1402964) product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene nspC CDS complement(1403106..1404350) product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483247.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1404535..1407456) product pyridoxal phosphate-dependent class III aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490729.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 1407411..1407572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1408065..1409864) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070488.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(1410000..1412447) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 tRNA complement(1412856..1412931) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA complement(1412960..1413046) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA complement(1413127..1413202) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA complement(1413226..1413299) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(1413602..1414159) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419911.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene pgsA CDS complement(1414204..1416051) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105992.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene uvrC CDS complement(1416051..1416695) product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005386783.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene uvrY CDS 1417080..1419494 product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489176.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1419691..1420260 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene yeiP CDS 1420359..1420679 product HI1450 family dsDNA-mimic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465080.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(1421128..1422138) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291245.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene rluB CDS 1422513..1422926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1422993..1423613) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(1423754..1424641) product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465084.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1425120..1426757 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030227.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1426768..1427349 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274036.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1427423..1428421 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261662.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene trpD CDS 1428432..1429817 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003291.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene trpCF CDS 1429867..1431057 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481609.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene trpB CDS 1431057..1431878 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene trpA CDS 1432095..1432631 product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481614.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1433004..1433405 product acyl-CoA thioester hydrolase YciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077272.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene yciA CDS 1433545..1433844 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1433853..1434245 product GspS/AspS pilotin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418758.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(1434349..1434558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(1434685..1435620) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1435637..1436344) product TIGR01621 family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459686.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(1436755..1438095) product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1438481..1439935 product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462347.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene cls CDS 1439966..1441156 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478937.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(1441238..1442041) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263642.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1442044..1442763) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(1443027..1445087) product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene betT CDS complement(1445371..1445952) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478903.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS complement(1446083..1446484) product envelope stress response membrane protein PspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462375.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene pspC CDS complement(1446477..1446707) product envelope stress response membrane protein PspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093876.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene pspB CDS complement(1446729..1447397) product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511045.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene pspA CDS 1447580..1448638 product phage shock protein operon transcriptional activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene pspF CDS 1448665..1450287 product peptide ABC transporter substrate-binding protein SapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462340.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene sapA CDS 1450287..1451249 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478933.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 1451236..1452123 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 1452123..1453154 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 1453151..1453939 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462331.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1453994..1454641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1454787..1455272) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261687.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1455304..1456716) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418795.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1456896..1457285) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1457365..1458270) product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 1458543..1458782 product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462432.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1458967..1459248) product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 1459451..1459918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1460032..1464522) product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene mukB CDS complement(1464519..1465316) product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene mukE CDS complement(1465297..1466664) product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483103.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene mukF CDS complement(1466684..1467487) product tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene cmoM CDS 1467600..1468397 product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462426.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene elyC CDS 1468620..1469624 product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene purR CDS 1469886..1471031 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462369.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1471212..1471421) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 1471420..1473030 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 1473035..1473694 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462377.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS 1473715..1474380 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262995.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1474367..1474681 product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(1474678..1475475) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1475669..1476085 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460412.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS complement(1476300..1477427) product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1477447..1478049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1478314..1480377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(1480359..1483931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1484049..1484909 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1485206..1485397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1485414..1485986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 note possible pseudo, frameshifted CDS complement(1486014..1486442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1486572..1486847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(1487171..1488067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(1488079..1488993) product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1489186..1489389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1489396..1489599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1489801..1490166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 note possible pseudo, internal stop codon CDS complement(1490179..1492518) product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene rad50 CDS complement(1492484..1493173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1493166..1494212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1494478..1497582) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239259.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1497572..1498264) product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1498257..1499363) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1499374..1501344) product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1501403..1502143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(1502143..1505412) product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1505412..1505909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(1506031..1506912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1506909..1509701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1509695..1510264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1510254..1511531) product Mks condensin complex protein MksB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103378.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene mksB CDS 1511680..1512540 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1512586..1513491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263375.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1513653..1514111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(1514199..1514465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(1514532..1515224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1515368..1515853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(1516116..1516385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1516382..1516879) product DUF2787 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041081.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(1516876..1517373) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068477.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene radC CDS complement(1517504..1518286) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813026.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(1518307..1519179) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263071.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1519190..1520212) product clavaminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975576.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1520390..1521736 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1521884..1522594) product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207067.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS 1522764..1523471 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1523641..1524027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(1524031..1524843) product DUF3944 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014660168.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1525048..1525707) product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS complement(1526132..1526539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 1526620..1526808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(1526956..1527141) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263379.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1528161..1529150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1529187..1530416) product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002768.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 tRNA complement(1530722..1530809) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(1530948..1531388) product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647492.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 1531765..1532340 product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1532466..1533164) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420156.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene pyrF CDS complement(1533227..1534396) product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889971.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene lapB CDS complement(1534409..1534696) product lipopolysaccharide assembly protein LapA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457987.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(1534904..1535191) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005491075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene ihfB CDS complement(1535264..1536934) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene rpsA CDS complement(1537095..1537775) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106010.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene cmk CDS complement(1537997..1539283) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445261.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene aroA CDS 1539403..1540146 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262300.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene aat CDS 1540251..1540943 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1541062..1541280 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene infA CDS complement(1541505..1543769) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495889.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene clpA CDS complement(1543847..1544167) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041728.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene clpS CDS 1544540..1544761 product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190603.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene cspD CDS complement(1544953..1547184) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 1547607..1548320 product 23S rRNA pseudouridine(2457) synthase RluE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098720.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene rluE CDS 1548702..1549844 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262316.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene mnmA CDS 1549942..1550562 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262240.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene hflD CDS 1550621..1551994 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene purB CDS 1552342..1553502 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534254.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 1553692..1554498 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene xthA CDS complement(1554582..1555259) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456275.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1555262..1556011) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456256.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1556072..1556842) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(1557043..1557813) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456207.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 1558552..1560828 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene pflB CDS 1560988..1561728 product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene pflA CDS 1561796..1562296 product YfbU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456271.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1562640..1564574 product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1564666..1565940 product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046688.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1565952..1567517 product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456192.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(1567586..1568011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1568083..1568874) product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1568922..1569215) product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179600.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 1569473..1569652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(1569683..1570747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(1570881..1572344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 1572485..1573639 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1574075..1574407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(1575054..1575809) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene kdsB CDS complement(1575809..1575988) product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350068.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1575969..1576976) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053055813.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene lpxK CDS complement(1576976..1578742) product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052153.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene msbA CDS complement(1578825..1581005) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481856.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1581221..1581730 product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481854.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(1582004..1583242) product lipoprotein-releasing ABC transporter permease subunit LolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene lolE CDS complement(1583245..1583955) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene lolD CDS complement(1584005..1585228) product lipoprotein-releasing ABC transporter permease subunit LolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene lolC CDS 1585679..1589074 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481852.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene mfd CDS 1589180..1589923 product peptidoglycan binding protein CsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263322.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS 1590051..1590590 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186700.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1590673..1591962) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456272.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1592320..1592859) product alpha/beta hydrolase YcfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261770.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene ycfP CDS complement(1593007..1593972) product thiamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481846.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene thiK CDS complement(1593972..1594556) product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456187.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 gene lpoB CDS complement(1594573..1594962) product YcfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418928.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1594959..1596344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1596442..1596792) product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene hinT CDS 1597290..1598453 product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461150.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1598573..1599343) product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene udp CDS complement(1599598..1600014) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1600205..1601749) product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464264.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 1601959..1603143 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303290.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1603257..1604102 product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707055.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 1604224..1605126 product O-acetylserine/cysteine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032711577.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene eamA CDS 1605270..1605701 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 1605987..1606934 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192895.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1606945..1607412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1607697..1608452) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275285.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1608582..1609475 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369250.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1609535..1610581) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS 1610833..1611312 product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481508.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1611480..1612274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1612592..1613848) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1613849..1614247) product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419177.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene umuD CDS complement(1614405..1614947) product YcxB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478450.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 1615235..1615540 product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1615586..1615918) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 1616131..1616997 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042747.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene tesB CDS complement(1617088..1617558) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1617703..1618758 product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1618950..1619564 product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461140.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(1619867..1622980) product vibriobactin export RND transporter permease subunit VexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene vexH CDS complement(1622981..1624042) product multidrug efflux RND transporter periplasmic adaptor subunit VmeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105748.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene vmeE tRNA 1624292..1624376 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 tRNA 1624472..1624556 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 1624655..1624739 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 1624838..1624922 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 1625434..1626957 product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1627104..1628540 product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112635.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1628765..1630090 product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(1630173..1630553) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261860.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(1630703..1631641) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482408.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1632108..1632458) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1632590..1634011) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725314.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1634366..1635328) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817416.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(1635519..1635836) product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1635915..1637237) product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366646.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(1637389..1637694) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174964.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 1637871..1639151 product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020883745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS 1639298..1640209 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1640309..1640962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 1641579..1642784 product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS 1643148..1644152 product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209845.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene galR CDS 1644191..1645435 product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 1645505..1646491 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184032328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1646493..1647359 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1647414..1648511 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene ugpC CDS complement(1648588..1649583) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229210.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1649823..1650848) product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170320148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene oppF CDS complement(1650845..1651819) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419857.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1651842..1652744) product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene oppC CDS complement(1652760..1653680) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene oppB CDS complement(1654270..1655904) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277613.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1656485..1659019 product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482861.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 1659392..1660843 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477274.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(1660938..1661396) product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418591.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 gene moaE CDS complement(1661400..1661645) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005654167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene moaD CDS complement(1661673..1662149) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418586.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 gene moaC CDS complement(1662194..1662706) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509705.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene moaB CDS complement(1662873..1663937) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene moaA CDS 1664279..1665169 product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(1665260..1667290) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482400.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 gene uvrB tRNA 1667932..1668007 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 1668205..1668783 product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene rsxA CDS 1668786..1669385 product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene rsxB CDS 1669399..1671906 product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480818.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene rsxC CDS 1671906..1672958 product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480820.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene rsxD CDS 1672966..1673592 product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene rsxG CDS 1673594..1674343 product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1674389..1675030 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480814.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene nth CDS 1675072..1675488 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480812.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene gloA CDS 1675776..1676426 product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene rnt CDS 1676463..1677782 product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880817.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1677874..1678497) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1678597..1678932) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494473.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 1679346..1679930 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene sodB CDS complement(1680064..1680213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1680212..1680874 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1680994..1683663) product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533913.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene adhE CDS 1684282..1684920 product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1684987..1685832 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1686009..1687124) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262205.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene asd CDS complement(1687282..1688283) product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051797.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene yejK CDS 1688470..1688685 product YejL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 1688727..1690544 product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228449.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 tRNA 1690621..1690697 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 1691190..1691280 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 1691403..1692044 product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene pncA CDS complement(1692061..1692687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(1692703..1693017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1693103..1694074) product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463759.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1694250..1694441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1694724..1696667) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1696764..1697312) product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479533.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(1697446..1699449) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451165.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1699727..1701583 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene sppA CDS 1701721..1702734 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479567.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene ansA CDS complement(1702824..1703111) product DUF1315 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461780.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1703157..1703540) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene msrB CDS 1704017..1705012 product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261571.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene gap CDS 1705200..1706081 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460080.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1706191..1707033 product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460128.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene rlmA CDS complement(1707030..1707794) product endonuclease EndA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071125.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene endA CDS 1707969..1708928 product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1709082..1709519) product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460092.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 1709693..1709941 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340598.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1710039..1710638) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460088.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene recR CDS complement(1710661..1710996) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467102.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1711124..1713286) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460096.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene dnaX CDS complement(1713376..1713921) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene apt CDS complement(1714748..1714867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1715026..1716126) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493238.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1716557..1717432 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762360.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1717517..1718149) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(1718356..1718865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(1718955..1720469) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262246.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene purF CDS complement(1720514..1721008) product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479544.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(1721073..1721681) product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479575.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1721671..1722960) product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460139.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene folC CDS complement(1723066..1723971) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 gene accD CDS complement(1724602..1725390) product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene truA CDS complement(1725492..1727279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1727502..1728515) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082625.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1728572..1729741) product 4-phosphoerythronate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494418.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(1729951..1731174) product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420034.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene fabB CDS 1731675..1733741 product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479475.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene mnmC CDS complement(1733809..1734336) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1734474..1734755) product YfcL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479532.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1734803..1735417) product elongation factor P hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 1735570..1736211 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927463.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1736299..1737384) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479467.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene aroC CDS complement(1737721..1738653) product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene prmB CDS 1738767..1739297 product endonuclease SmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457721.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 gene smrB CDS complement(1739468..1739932) product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708357.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene sixA CDS 1740263..1743091 product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457669.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1743179..1745356) product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479507.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene fadJ CDS complement(1745359..1746696) product acetyl-CoA C-acyltransferase FadI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457699.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene fadI CDS 1747156..1747719 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1747712..1748431 product DUF3379 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457663.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 1748811..1750127 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061938.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(1750231..1751088) product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(1751176..1752411) product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266864.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene ccmI CDS complement(1752408..1752908) product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457737.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(1752905..1753489) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420283.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1753492..1755471) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457778.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1755477..1755962) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457727.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene ccmE CDS complement(1755959..1756165) product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457743.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene ccmD CDS complement(1756165..1756935) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266113.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1757015..1757683) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene ccmB CDS complement(1757684..1758304) product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene ccmA CDS 1758761..1759342 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263593.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 1759339..1760049 product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072075.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1760104..1761054 product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705026.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1761085..1762506 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073251.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene phrB CDS 1762577..1763029 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 1763026..1763769 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705030.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS 1763769..1765022 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155658642.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1765019..1765849 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263588.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1765924..1767189 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263587.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1767254..1767652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(1767681..1768949) product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018208816.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 tRNA 1769173..1769249 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(1769332..1771191) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477482.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1771439..1773556 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 1773644..1774414 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478119.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 1774505..1775437 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000335750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 1775567..1777540 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene fhuB CDS 1777887..1778750 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965820.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1778757..1780460 product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1780847..1781374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1781477..1782844) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469664.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene yegD CDS complement(1782965..1783687) product siderophore ferric iron reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(1783842..1785986) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263609.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1786097..1787071) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705822.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(1787071..1788327) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479628.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1788369..1789073) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484262.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1789085..1789492) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1789489..1790034) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263090.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1790034..1791395) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459330.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1791395..1792249) product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029797603.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1792495..1793922) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene gltX CDS complement(1794503..1795960) product OprD family outer membrane porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704981.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 1796592..1799324 product copper-translocating P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216364821.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene copA CDS 1799532..1800287 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1800284..1800802) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261383.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1800873..1802048) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222055.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1802179..1802670 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968485.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 tRNA complement(1802914..1802990) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 1803189..1803773 product DNA endonuclease SmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481355.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene smrA CDS 1803920..1804996 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481361.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 gene rluF CDS complement(1805011..1805271) product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 gene yoeB CDS complement(1805268..1805519) product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259255.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene yefM CDS complement(1805603..1806715) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1806712..1807656) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482690.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1807656..1808612) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 1808729..1809391 product CerR family C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812253.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 tRNA 1809577..1809663 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 1809720..1809793 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(1809794..1810780) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072930.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1810906..1813065) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167395505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 1813181..1814074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(1814119..1814595) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481362.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene ybaK CDS complement(1814868..1816532) product bifunctional UDP-sugar hydrolase/5'-nucleotidase UshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809002.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene ushA CDS complement(1816715..1817581) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400335.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 gene kdsA CDS complement(1817631..1818446) product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481357.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS complement(1818472..1818852) product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272895.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1818905..1819777) product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 gene prmC CDS complement(1819781..1820869) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456867.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene prfA CDS complement(1820961..1822220) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054219.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 gene hemA CDS 1822448..1823161 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene lolB CDS 1823161..1824078 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105711.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene ispE CDS 1824106..1825050 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113134.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1825221..1825811 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105710.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene pth CDS 1825887..1826978 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418193.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene ychF tRNA 1827289..1827365 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA 1827466..1827550 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA 1827634..1827708 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA 1827823..1827899 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 1828000..1828084 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 1828168..1828242 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 1828351..1828435 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 1828519..1828593 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 1828699..1828783 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 1828867..1828941 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 tRNA 1829146..1829230 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1829397..1830434 product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476185.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1830505..1831686) product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490463.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1831967..1833391 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483497.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene miaB CDS 1833510..1834652 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483495.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 1834668..1835132 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene ybeY CDS 1835244..1836149 product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483493.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene corC CDS 1836185..1837708 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene lnt CDS 1837981..1839453 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218844.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1839569..1839931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1839995..1841365) product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891426.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene dcuC CDS complement(1841594..1842076) product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483489.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 1842215..1844809 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene leuS CDS 1844965..1845654 product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene lptE CDS 1845660..1846694 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261458.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene holA CDS 1846897..1847214 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161137.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 gene rsfS CDS 1847283..1847753 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene rlmH CDS 1847760..1849661 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493014.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene mrdA CDS 1849669..1850784 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483658.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene rodA CDS 1850789..1851574 product septal ring lytic transglycosylase RlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene rlpA CDS 1851729..1852916 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 1853190..1853459 product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418162.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene ybeD CDS 1853622..1854317 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene lipB CDS 1854405..1855370 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042591.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 gene lipA CDS complement(1855561..1856811) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483082.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1856837..1857991) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 gene proB CDS complement(1858166..1858552) product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455997.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene crl CDS complement(1858641..1859885) product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287570.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene frsA CDS complement(1859944..1860219) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1860391..1860855) product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037415.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 gene gpt CDS complement(1860908..1862203) product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890416.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1863070..1864749 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261447.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1864822..1865823) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456663.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene dinB CDS complement(1865993..1867054) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene dinB CDS complement(1867271..1867735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(1868477..1870645) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265516.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(1870726..1871790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1871897..1872499) product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 gene azoR3 CDS 1872653..1874029 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815708.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1874151..1875623) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene ltrA CDS complement(1876409..1876816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1876936..1877451) product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085233.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1877545..1877895) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(1877999..1878538) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817532.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(1878579..1879037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1879142..1879447) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039406410.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 1879592..1880746 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1881165..1881662) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705212.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1881840..1882256) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451209.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(1882411..1883052) product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206488.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1883200..1883835) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105916.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(1883992..1884210) product DUF6500 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530530.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1884307..1884666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1884783..1885460) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1885584..1886738 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(1887157..1887630) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1887758..1888012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112513.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1888051..1888626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1888764..1889399) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1889546..1890088) product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1890234..1890617) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(1890715..1891140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 1891493..1892476 product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1892982..1893767) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482660.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1893790..1894323) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482606.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1894697..1895467) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522540.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1895564..1896322 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815086.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1896809..1897930) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705342.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1898224..1898406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 1899359..1899970 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261706.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 1899990..1900784 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1900984..1901193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(1901294..1901599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1901643..1903025) product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1903019..1903561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1903654..1903860 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1903969..1904511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(1904498..1907281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1907293..1909566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(1909559..1910779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1911076..1911309) product (Na+)-NQR maturation NqrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene nqrM CDS complement(1911322..1912302) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246830.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1912541..1913773) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 gene nqrF CDS complement(1913802..1914398) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418136.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene nqrE CDS complement(1914404..1915036) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(1915036..1915806) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(1915796..1917040) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1917044..1918384) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1918775..1919083) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene bolA CDS 1919251..1920414 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456632.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1920419..1920994 product YajG family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456550.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1920994..1921539 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1921672..1923015 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456555.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1923289..1924104 product outer membrane protein OmpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232266.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1924247..1925128 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene panE CDS 1925204..1926433 product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482293.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene csdA CDS complement(1926430..1926861) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene csdE CDS complement(1927106..1927933) product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene tcdA CDS complement(1928212..1929366) product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456533.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene mltA CDS 1929701..1931038 product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482311.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene argA CDS complement(1931122..1931586) product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1931600..1933843) product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971704.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene recD CDS complement(1933849..1937481) product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043027345.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene recB CDS complement(1937825..1941454) product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482351.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene recC CDS 1941607..1942518 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482339.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 1942591..1942893 product YebG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482297.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 1943068..1943664 product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209246.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene satP CDS 1943624..1943830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 1943823..1944854 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261330.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 gene dapD CDS 1945187..1946401 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene pncB CDS 1946565..1947701 product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 1947880..1949241 product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 1949261..1950406 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460822.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 1950749..1951954 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene chrA CDS 1952110..1953804 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456535.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 1953931..1954143 product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417766.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1954690..1956780) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene fusA CDS 1956996..1957685 product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene mtgA CDS complement(1958134..1959516) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417762.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene radA CDS complement(1959846..1960829) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481549.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene serB CDS 1961093..1961698 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349089.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1961985..1962701) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224887.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene deoD CDS complement(1962873..1964093) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS complement(1964121..1965473) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456100.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene deoA CDS complement(1965547..1966320) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417709.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 gene deoC CDS complement(1966870..1968123) product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261272.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(1968345..1969142) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481578.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(1969145..1969303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1969446..1971026) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108381.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene prfC CDS complement(1971214..1971705) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214241.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene rimI CDS complement(1971698..1972138) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456107.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(1972142..1972651) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456061.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(1972851..1973444) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080562613.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 1973578..1974591 product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421327.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 1974605..1975495 product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481567.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(1975837..1976817) product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481586.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene nlpI CDS complement(1977086..1979203) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene pnp CDS complement(1979598..1979867) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene rpsO CDS complement(1980105..1981040) product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene truB CDS complement(1981040..1981468) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456060.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene rbfA CDS complement(1981571..1984261) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481598.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 gene infB CDS complement(1984284..1985771) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 gene nusA CDS complement(1985790..1986245) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 gene rimP tRNA complement(1986569..1986645) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 tRNA complement(1986717..1986801) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(1986832..1987179) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481580.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene secG CDS complement(1987425..1988762) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481562.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene glmM CDS complement(1988901..1989731) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481601.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene folP CDS complement(1989850..1991790) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021447645.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene ftsH CDS complement(1991831..1992460) product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261252.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene rlmE CDS 1992544..1992879 product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene yhbY CDS complement(1993107..1993580) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261251.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene greA CDS complement(1994029..1994205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 1994135..1995187 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482702.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1995297..1996703 product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479070.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene dacB CDS complement(1997130..2000360) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene carB CDS complement(2000376..2001515) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene carA CDS complement(2002077..2002886) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461189.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene dapB CDS complement(2003411..2003764) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417803.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene rplS CDS complement(2003806..2004570) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene trmD CDS complement(2004599..2005129) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061906.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene rimM CDS complement(2005172..2005465) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379962.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene rpsP CDS complement(2005679..2007058) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene ffh CDS 2007477..2008271 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 2008454..2009737 product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2010011..2010529) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene luxS CDS complement(2010564..2011079) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(2011177..2012748) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462538.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene gshA CDS complement(2012901..2015750) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(2015751..2016200) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534270.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(2016210..2017163) product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428698.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 tRNA complement(2017517..2017593) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 tRNA complement(2017628..2017704) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(2017746..2017822) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(2017865..2017941) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(2018021..2018113) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 tRNA complement(2018138..2018214) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(2018298..2018390) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS complement(2018593..2018790) product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene csrA CDS complement(2018794..2018973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(2019236..2021824) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455546.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene alaS CDS complement(2021952..2022371) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455548.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene recX CDS complement(2022542..2023588) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene recA CDS complement(2023702..2024205) product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853811.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene pncC CDS 2024473..2025426 product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 2025548..2027437 product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261721.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 2027604..2030189 product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478546.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene mutS CDS complement(2030524..2031495) product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene rpoS CDS complement(2031600..2032292) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455560.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(2032424..2033050) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002982.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(2033132..2033875) product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478553.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene surE CDS complement(2033907..2034959) product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene truD CDS complement(2034982..2035458) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262539.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene ispF CDS complement(2035474..2036184) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene ispD CDS complement(2036184..2036498) product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263189.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene ftsB CDS complement(2036870..2038171) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene eno CDS complement(2038291..2039928) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210846.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2040129..2040935) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene mazG CDS complement(2041039..2043255) product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490307.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene relA CDS complement(2043312..2044745) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090462.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene rlmD CDS 2044986..2047790 product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene barA CDS complement(2047856..2048236) product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene acpS CDS complement(2048236..2048982) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095364.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene pdxJ CDS complement(2048986..2049717) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene recO CDS complement(2049815..2050819) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene era CDS complement(2050809..2051489) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene rnc CDS complement(2051499..2052398) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460682.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene lepB CDS complement(2052564..2054357) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262550.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene lepA CDS complement(2054505..2054975) product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(2054972..2055946) product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734779.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene rseB CDS complement(2055988..2056581) product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481241.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(2056595..2057173) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457274.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene rpoE CDS 2057643..2059274 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918879.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene nadB CDS complement(2059385..2059714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(2059812..2060072) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458651.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 2060279..2061262 product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481243.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene ygfZ CDS 2061837..2062037 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS complement(2062171..2063382) product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481236.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(2063384..2064574) product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481244.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 gene ubiH CDS complement(2064596..2065165) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS 2065431..2065706 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484120.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 2065940..2066548 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2066627..2067283 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482455.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene rpiA CDS 2067543..2068772 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262564.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene serA CDS complement(2068897..2069598) product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(2069821..2070684) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene mscS CDS complement(2070975..2072051) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene fbaA CDS complement(2072243..2073406) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482432.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(2073639..2074691) product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene epd CDS complement(2074845..2076839) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263520.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene tkt CDS 2077394..2078545 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461723.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene metK CDS 2078799..2079575 product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 2079743..2080240 product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228059.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2080335..2081216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 2081347..2082078 product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461719.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene rsmE CDS 2082145..2083092 product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482451.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene gshB CDS 2083154..2083717 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2083773..2084195 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261217.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ruvX CDS complement(2084212..2084637) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(2084656..2085762) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(2085792..2086829) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350195.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2086855..2087571 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256653.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 2087706..2088524 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene proC CDS 2088564..2089118 product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087263.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2089162..2089443 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482461.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene yggU CDS 2089440..2089880 product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461703.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2089899..2090507 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261211.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2090517..2091686 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482442.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene hemW CDS complement(2091781..2092704) product glutaminase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene glsB CDS complement(2092802..2093521) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005584.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene trmB CDS 2093776..2094831 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890075.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 gene mutY CDS 2094841..2095113 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417551.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2095307..2096443 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene mltC tRNA 2096614..2096689 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 tRNA 2096748..2096823 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00550 tRNA 2096830..2096905 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00560 tRNA 2096959..2097034 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00570 CDS 2097341..2098963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS complement(2099077..2099949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 tRNA 2100276..2100351 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00580 tRNA 2100407..2100482 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00590 tRNA 2100517..2100592 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00600 tRNA 2100631..2100706 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00610 tRNA 2100741..2100816 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00620 CDS complement(2100968..2102398) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477851.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(2102627..2104417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2104386..2105345) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124535.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 tRNA complement(2105617..2105701) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00630 CDS 2105902..2106387 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461101.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2106445..2107518) product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene lptG CDS complement(2107511..2108617) product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene lptF CDS 2108864..2110378 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397172.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene pepA CDS 2110487..2110963 product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106076.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 2111072..2113930 product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416450.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 2114316..2114771 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455908.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS 2114909..2115397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2115435..2116241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455097.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2116336..2116770) product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019331.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rraB CDS 2116998..2118002 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 2118274..2119203 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478824.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene pyrB CDS 2119218..2119679 product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455107.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene pyrI CDS 2119679..2120128 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2120308..2120796 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705960.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 2120796..2122502 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819941.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2122617..2124155) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112615.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2124165..2125349) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2125427..2125867) product multiple antibiotic resistance transcriptional regulator MarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843419.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene marR CDS 2126192..2127145 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947139.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene corA CDS complement(2127309..2128034) product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455109.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2128166..2129422) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410586.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene murA CDS complement(2129504..2129758) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455111.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene ibaG CDS complement(2129774..2130091) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2130091..2130753) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265516.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene mlaC CDS complement(2130771..2131277) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene mlaD CDS complement(2131351..2132160) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455118.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene mlaE CDS complement(2132153..2132953) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083183.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene mlaF CDS 2133247..2134212 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455122.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2134299..2135270 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455124.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 gene kdsD CDS 2135270..2135827 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene kdsC CDS 2135827..2136390 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059348.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene lptC CDS 2136371..2136883 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261182.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene lptA CDS 2136886..2137611 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene lptB CDS 2137878..2139350 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478844.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2139378..2139665 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261180.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene hpf CDS 2139668..2140111 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177163.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene ptsN CDS 2140115..2140999 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468663.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 gene rapZ CDS 2140996..2141271 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135899.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2141440..2142810 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478833.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene mgtE CDS complement(2143097..2144440) product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382645.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene pmbA CDS 2144567..2145088 product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene yjgA CDS complement(2145269..2146717) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461834.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene tldD CDS complement(2146731..2147558) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461832.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2147668..2151630) product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478842.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2151630..2153099) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461826.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 gene rng CDS complement(2153224..2153838) product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261173.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2153897..2154385) product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461823.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 gene mreD CDS complement(2154375..2155256) product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene mreC CDS complement(2155368..2156411) product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381144.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(2156908..2157339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(2157336..2157641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 note possible pseudo, frameshifted CDS complement(2157563..2157895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(2157895..2158626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 note possible pseudo, internal stop codon CDS complement(2158648..2159172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 note possible pseudo, internal stop codon CDS complement(2159194..2159349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS complement(2159367..2161379) product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001924594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene csrD CDS complement(2161830..2162357) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466625.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2162698..2163348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2163578..2164429 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466627.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 gene galU CDS 2164581..2167409 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene uvrA CDS 2167693..2169480 product PglL family O-oligosaccharyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481013.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(2169670..2170791) product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481009.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2171469..2172818 product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102995.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene lysC CDS complement(2173018..2176716) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene metH CDS 2177225..2178571 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106084.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2178690..2178851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2179166..2180353) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene tyrS CDS 2180493..2181779 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2181893..2182234) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420796.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene erpA CDS 2182559..2183848 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479079.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene hemL CDS 2184205..2185290 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461253.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 2185376..2186401 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene rsmC CDS 2186766..2190098 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461251.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2191116..2192798 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880698.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2192975..2193961 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262587.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 2193964..2194989 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646270.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 2194992..2195990 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461267.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2196048..2197049 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461254.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2197176..2198915 product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2198912..2199805 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262591.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 2199842..2201794 product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060994152.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2201860..2204265 product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461246.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2204407..2205819 product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262594.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS 2206077..2206529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2206559..2213617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 2213627..2214202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 2214260..2214598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2214617..2214946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2214968..2215348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2215362..2215715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2216559..2217764 product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459347.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene emrD CDS complement(2217845..2220220) product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480205.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene mrcB CDS complement(2220285..2222798) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480202.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene hrpB CDS 2222870..2223586 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465034.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene sfsA CDS 2223722..2224171 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262608.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene dksA CDS 2224230..2225138 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 gene gluQRS CDS 2225233..2226693 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262610.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene pcnB CDS 2226690..2227175 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978983.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene folK CDS 2227225..2228019 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene panB CDS 2228037..2228912 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 gene panC CDS complement(2229048..2229818) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479696.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2229818..2230756) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262613.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 2230850..2231506 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 gene can CDS complement(2231672..2232202) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479701.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene hpt CDS 2232468..2233076 product transcriptional regulator OpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479697.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 gene opaR CDS complement(2233176..2235773) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480203.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 gene acnB CDS complement(2236087..2238381) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2238482..2239735) product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457676.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2239822..2240727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2240727..2242484) product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2242900..2244132 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167859.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2244273..2245037 product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881444.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 gene uppP CDS complement(2245140..2245622) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465890.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene folK CDS complement(2245619..2245978) product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465889.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 gene folB CDS 2246207..2246812 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene plsY CDS complement(2246895..2247917) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene tsaD CDS 2248146..2248361 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145625.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene rpsU CDS 2248391..2248834 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453780.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2248998..2250761 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262668.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene dnaG CDS 2250879..2252729 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453778.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 gene rpoD tRNA 2252905..2252981 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00640 CDS complement(2253096..2253758) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 gene ribB CDS complement(2254156..2254770) product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261778.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2254972..2255559) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456055.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2255559..2256572) product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463386.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2256818..2257204 product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478180.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2257204..2258334 product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263258.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2258806..2259729) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621097.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene lpxC CDS complement(2259830..2261047) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462806.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene ftsZ CDS complement(2261081..2262358) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene ftsA CDS complement(2262355..2263152) product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608980.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(2263290..2264756) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene murC CDS complement(2264786..2265850) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene murG CDS complement(2265831..2267072) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458190.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene ftsW CDS complement(2267137..2268477) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458170.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene murD CDS complement(2268514..2269596) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene mraY CDS complement(2269593..2270984) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458188.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 gene murF CDS complement(2270981..2272504) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene murE CDS complement(2272517..2274280) product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458172.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2274277..2274597) product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene ftsL CDS complement(2274628..2275578) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458168.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene rsmH CDS complement(2276256..2277278) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816799.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene pgl CDS complement(2277306..2278172) product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458162.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene rsmI CDS 2278234..2280066 product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015481.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 2280029..2280418 product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479720.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 2280422..2281012 product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458175.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS 2281018..2281728 product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105663.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2281806..2282933) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461276.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2282934..2284574) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660927.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2284662..2285675) product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479089.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(2285828..2287045) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2287073..2287411) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene glnK CDS complement(2287593..2287955) product YacL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420832.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 tRNA complement(2288196..2288272) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00650 rRNA complement(2288306..2288416) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(2288557..2291441) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 tRNA complement(2291787..2291862) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00660 tRNA complement(2291904..2291979) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00670 tRNA complement(2292000..2292075) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00680 rRNA complement(2292170..2293707) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 rRNA complement(2294085..2294195) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(2294335..2297219) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 tRNA complement(2297514..2297589) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00690 rRNA complement(2297658..2299195) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(2299831..2300613) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477371.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2300606..2302333) product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455813.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene cysI CDS complement(2302333..2304144) product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2304352..2304582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2304743..2304955) product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455821.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene pspG CDS complement(2305246..2306232) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene dusA CDS 2306370..2306819 product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245564.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 gene zur CDS complement(2306954..2307310) product DUF2799 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419000.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2307408..2307761) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164258.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2307817..2311605) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479640.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(2311605..2313287) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261137.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS 2313540..2314178 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene msrA CDS complement(2314270..2314482) product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454667.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2314800..2315351 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792388.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2315506..2316162 product DUF2796 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479666.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS 2316271..2316993 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS 2316993..2318252 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 2318255..2318791 product DUF3299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479671.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(2318909..2319538) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene cysC CDS complement(2319629..2321353) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454668.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2321378..2322829) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene cysN CDS complement(2322863..2323771) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417374.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene cysD CDS complement(2323851..2324624) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene cobA CDS 2324958..2325422 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611534.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(2325484..2326128) product LysM-like peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454652.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2326305..2326925 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005487177.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2327035..2327499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2327738..2328124) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383141.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene rplQ CDS complement(2328151..2329143) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene rpoA CDS complement(2329168..2329788) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene rpsD CDS complement(2329818..2330207) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303517.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene rpsK CDS complement(2330229..2330585) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450559.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene rpsM CDS complement(2330888..2332222) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481401.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene secY CDS complement(2332243..2332677) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene rplO CDS complement(2332683..2332859) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene rpmD CDS complement(2332867..2333370) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417255.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene rpsE CDS complement(2333385..2333738) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358092.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene rplR CDS complement(2333748..2334281) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455654.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene rplF CDS complement(2334292..2334684) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062614.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 gene rpsH CDS complement(2334714..2335019) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455658.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene rpsN CDS complement(2335037..2335576) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455660.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene rplE CDS complement(2335591..2335905) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417243.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene rplX CDS complement(2335920..2336291) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417241.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene rplN CDS complement(2336457..2336711) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461671.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene rpsQ CDS complement(2336711..2336902) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379576.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene rpmC CDS complement(2336902..2337312) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379577.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene rplP CDS complement(2337324..2338025) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene rpsC CDS complement(2338046..2338378) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387269.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene rplV CDS complement(2338389..2338667) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138114.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene rpsS CDS complement(2338687..2339511) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene rplB CDS complement(2339527..2339829) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398471.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene rplW CDS complement(2339826..2340428) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene rplD CDS complement(2340445..2341074) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene rplC CDS complement(2341088..2341399) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene rpsJ CDS complement(2341960..2343144) product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene tuf CDS complement(2343295..2345391) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene fusA CDS complement(2345542..2346012) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488949.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene rpsG CDS complement(2346128..2346502) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene rpsL CDS complement(2346690..2346971) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481146.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene tusB CDS complement(2346985..2347338) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene tusC CDS complement(2347338..2347742) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458288.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene tusD CDS complement(2347739..2348467) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005438378.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2348705..2349496) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458290.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene fkpA CDS 2349834..2350073 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001890311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(2350177..2350749) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687664.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene slyD CDS complement(2350891..2351097) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2351154..2352947) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480060.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene kefB CDS complement(2352960..2353604) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480062.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene kefG CDS 2354058..2355965 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480039.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 2355967..2356437 product TIGR02444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278735.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS 2356516..2356731 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586562.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2356841..2357710 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458134.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2357955..2358587 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381432.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene crp CDS complement(2358927..2360132) product aromatic amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455065.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2360360..2361001) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458955.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene pyrE CDS complement(2361125..2361853) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene rph CDS 2362028..2362894 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 2363064..2364410 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 2364630..2366960 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114064.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2367087..2367926) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706321.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene fdhD CDS 2368128..2368754 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515790.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene gmk CDS 2368858..2369130 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene rpoZ CDS 2369155..2371284 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459012.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene spoT CDS complement(2371383..2372186) product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(2372354..2373568) product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(2373798..2374379) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 2374770..2376341 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2376438..2377454) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421081.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene trpS CDS complement(2377604..2378290) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480027.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2378368..2379039) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421083.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene rpe CDS complement(2379524..2380345) product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486862.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2380457..2381863) product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2381999..2383081) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480443.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene aroB CDS complement(2383106..2383624) product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene aroK CDS complement(2383855..2385657) product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788423.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(2385700..2386209) product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792032.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2386206..2386790) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2386790..2387389) product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480484.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2387379..2388389) product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520444.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene pilM CDS 2388701..2391211 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262705.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2391274..2392161) product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465160.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 gene oxyR CDS complement(2392672..2394753) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169471.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2394760..2395614) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816375.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(2395616..2395852) product DUF1656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096914.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(2396180..2398054) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465154.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 gene argH CDS complement(2398250..2399482) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465152.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2399596..2400375) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262712.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 gene argB CDS complement(2400385..2401386) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465147.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene argC CDS 2401689..2402843 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130865.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene argE CDS 2403184..2405847 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 gene ppc CDS complement(2405997..2406884) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465139.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 gene metF CDS complement(2407146..2409557) product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465137.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(2409558..2410724) product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 2411006..2411323 product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796267.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene metJ CDS complement(2411461..2412720) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278588.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2412877..2413095) product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457203.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene rpmE CDS 2413355..2415556 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481427.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene priA CDS 2416242..2417246 product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene cytR CDS 2417400..2417981 product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481405.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene ftsN CDS 2418333..2418851 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208249.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene hslV CDS 2418971..2420308 product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457198.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene hslU CDS 2420688..2421602 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 2421753..2422277 product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene rraA CDS complement(2422369..2422611) product cell division protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007388.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene zapB CDS 2422931..2423938 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene glpX CDS 2424101..2424718 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859357.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 2424770..2426092 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477179.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(2426215..2426637) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458874.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(2426650..2427009) product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133286.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2427206..2427976 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 gene tpiA CDS complement(2428142..2429104) product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460467.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene pfkA CDS complement(2429468..2430367) product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene fieF CDS complement(2430392..2432563) product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480961.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 gene uvrD CDS 2432701..2433009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2433121..2434863 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2435125..2436588) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(2436815..2437285) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(2437430..2437807) product DUF1971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2437888..2439453) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262315.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene norR CDS 2439691..2441277 product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262314.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene norV CDS 2441277..2442452 product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863521.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 gene norW CDS complement(2442737..2443924) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478661.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2444059..2444382) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623073.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 gene uspB CDS complement(2444471..2445001) product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467599.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene ftnA CDS 2445274..2445699 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121736.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene uspA CDS 2445773..2446645 product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262779.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(2446746..2447441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(2447651..2448169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(2448311..2449153) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478714.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2449146..2451320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2451582..2452046 product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene asnC CDS 2452186..2454072 product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS complement(2454285..2455754) product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 2456038..2458236 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067475.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 2458439..2460052 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113373.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(2460620..2461246) product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038077.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 2461355..2462242 product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120877.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2462398..2464452) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 gene prlC CDS 2464633..2465469 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262845.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 2465606..2466961 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478739.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 gene gorA CDS 2467453..2468094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 2468376..2469503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2469619..2470599) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817240.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2470756..2471700) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262868.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2471703..2472680) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262869.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS complement(2472850..2474397) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478744.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(2474513..2476228) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054464.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 tRNA complement(2476916..2476992) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00700 tRNA complement(2477082..2477157) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00710 tRNA complement(2477200..2477276) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00720 tRNA complement(2477466..2477541) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00730 tRNA complement(2477578..2477654) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00740 CDS 2477922..2478332 product cytochrome c5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455203.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2478683..2480698) product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455214.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene rep CDS 2480932..2481426 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478718.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 2481445..2482551 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS 2482566..2485652 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262875.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 2485806..2486060 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000458935.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(2486370..2487854) product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455226.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene ilvC CDS 2488083..2488904 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene ilvY rRNA complement(2488963..2489072) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00130 tRNA complement(2489123..2489198) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00750 rRNA complement(2489288..2489398) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00140 rRNA complement(2489538..2492422) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00150 CDS complement(2492443..2492622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 tRNA complement(2492729..2492804) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00760 rRNA complement(2492899..2494436) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00160 CDS complement(2494966..2495682) product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459134.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene fre CDS complement(2495695..2495964) product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459133.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2495965..2497830) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005489172.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene ubiD CDS complement(2497946..2498956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480957.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2499078..2500337) product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene rho CDS complement(2500544..2500870) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458583.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene trxA CDS 2500984..2502312 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458582.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene rhlB CDS 2502331..2503824 product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076046.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 gene gppA CDS complement(2503921..2504958) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene hemB CDS 2505170..2505934 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 CDS complement(2506022..2506777) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459771.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene tatC CDS complement(2506845..2507285) product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459621.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene tatB CDS complement(2507289..2507552) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508969.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene tatA CDS complement(2507610..2509253) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478626.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene ubiB CDS complement(2509250..2509855) product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(2509865..2510656) product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene ubiE CDS complement(2510698..2512212) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478725.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 gene rmuC CDS 2512304..2513224 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478651.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(2513225..2513623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2513802..2515583 product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260919.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2515682..2516794) product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465071.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene thiH CDS complement(2516800..2517615) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS complement(2517620..2517823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(2517860..2518618) product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene thiF CDS complement(2518645..2519871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2519864..2521828) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260913.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 gene thiC CDS complement(2522115..2523485) product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 tRNA complement(2523834..2523910) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00770 rRNA complement(2523944..2524054) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00170 rRNA complement(2524194..2527078) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00180 tRNA complement(2527424..2527499) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00780 tRNA complement(2527541..2527616) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00790 tRNA complement(2527637..2527712) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00800 rRNA complement(2527807..2529344) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00190 CDS complement(2529864..2530385) product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465051.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene hemG CDS complement(2530386..2531843) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(2531892..2532512) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465047.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 2532726..2534891 product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481023.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene fadB CDS 2534916..2536082 product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458696.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene fadA CDS complement(2536178..2538718) product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459083.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 2538970..2539911 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459122.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene hemC CDS 2539918..2540673 product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459101.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2540666..2541766 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478990.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 2541766..2542944 product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478975.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 tRNA complement(2543501..2543591) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00810 rRNA complement(2543657..2543767) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00200 rRNA complement(2543907..2546791) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00210 tRNA complement(2547106..2547181) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00820 tRNA complement(2547218..2547294) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00830 rRNA complement(2547364..2548901) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00220 CDS 2549456..2549995 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461433.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(2550007..2550270) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076442.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(2550273..2551100) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461457.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 gene aroE CDS complement(2551134..2552048) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene hemF CDS complement(2552057..2552638) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 2552846..2553331 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005394016.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene purE CDS 2553337..2554473 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461432.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(2554541..2555161) product topoisomerase DNA-binding C4 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461441.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(2555200..2555673) product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979769.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2555698..2556882) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262883.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene dprA CDS complement(2556879..2557988) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262884.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2558119..2558631 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 gene def CDS 2558662..2559651 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene fmt CDS 2559736..2561016 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 gene rsmB CDS 2561104..2562480 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461427.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene trkA CDS 2562498..2563943 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481183.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(2564032..2564688) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461458.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(2564801..2565586) product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461450.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 2566051..2566317 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461387.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2566501..2567883 product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481163.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene ccoG CDS 2567936..2568937 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106139.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 2568990..2569589 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(2569656..2570561) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(2570657..2572180) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521788.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2572653..2574299 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461385.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene ilvG CDS 2574299..2574553 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378958.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene ilvM CDS 2574574..2575512 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262896.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 2575596..2577437 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481171.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene ilvD CDS 2577444..2578994 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481158.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene ilvA CDS 2579126..2580025 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687190.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene murQ CDS complement(2580065..2580964) product DNA-binding transcriptional activator PunR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465352.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene punR CDS 2581107..2582294 product purine nucleoside transporter PunC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868544.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene punC CDS complement(2582402..2583760) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421582.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene glmU CDS complement(2583985..2584404) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421584.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(2584458..2585861) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481178.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene atpD CDS complement(2585915..2586781) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457304.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 gene atpG CDS complement(2586893..2588434) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457301.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene atpA CDS complement(2588448..2588978) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481164.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene atpH CDS complement(2588994..2589464) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene atpF CDS complement(2589514..2589756) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene atpE CDS complement(2589803..2590579) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene atpB CDS complement(2590592..2590939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2591104..2591988) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458443.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2592063..2592845) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458453.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(2592856..2593509) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene rsmG CDS complement(2593506..2595401) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481156.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene mnmG sequence2 source 1..953456 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1455..3431 product DUF3346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093519.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(3521..3958) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 4631..4828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026548.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 4992..5201 product DUF3283 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477463.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 5313..6035 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421967.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(6131..6463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(6572..7966) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460902.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 8029..8916 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460892.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 9170..10849 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 10851..11114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 11124..12101 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS complement(12236..13141) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074323.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(13174..14571) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818594.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(14641..15864) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene gltS CDS 16214..16438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS 16569..17192 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478872.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 17228..18199 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722599.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(18183..18899) product murein tripeptide amidase MpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220315.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene mpaA CDS 19072..20688 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464821.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 20890..22071 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(22142..22390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421716.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(22540..23751) product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477289.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene choV CDS complement(23754..24599) product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene choW CDS complement(24673..25620) product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463665.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(25671..27371) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477133.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene betA CDS complement(27460..28920) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477313.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene betB CDS complement(28942..29544) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477071.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene betI CDS complement(29826..31769) product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461725.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 31882..32880 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153529.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(32817..33575) product iron chelate ABC transporter ATP-binding protein VctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615308.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene vctC CDS complement(33578..34621) product iron chelate uptake ABC transporter permease subunit VctG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154099.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene vctG CDS complement(34611..35549) product iron chelate uptake ABC transporter permease subunit VctD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735136.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene vctD CDS complement(35566..36528) product iron chelate ABC transporter substrate-binding protein VctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842240.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene vctP CDS complement(36630..37064) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133920.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 37200..37628 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035519.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(37799..39085) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS complement(39099..39674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS complement(39858..40880) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087282.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(41301..41570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459922.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 41807..42640 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453767.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 42888..43382 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480144.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 43405..43944 product DUF2937 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082681.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS 43941..44372 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122034607.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 44575..44958 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751797.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 45214..46074 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(46185..49064) product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478418.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene gcvP CDS complement(49234..49614) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene gcvH CDS 50060..50686 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065611683.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 50926..52287 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 52330..53463 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263531.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene gcvT CDS 53685..56555 product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 56559..57140 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 57972..58247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 58244..59641 product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene hxsB CDS 59634..60752 product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457560.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene hxsC CDS 60749..61282 product His-Xaa-Ser repeat protein HxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene hxsA CDS 61339..61635 product TIGR03982 family His-Xaa-Ser system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106272.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 61638..62873 product His-Xaa-Ser system-associated MauG-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(63108..63626) product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481682.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 63745..64659 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481635.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS complement(64866..66206) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167297427.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 66368..67255 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478191.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 67270..68052 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861417.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 68622..68954 product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261944.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 69063..69470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(69577..70251) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872931.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene yjjG CDS complement(70262..70753) product MarR family transcriptional regulator CosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494763.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene cosR CDS complement(70871..71872) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene proX CDS complement(71947..72954) product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477761.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene proX CDS complement(73132..74244) product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464578.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene proW CDS complement(74250..75437) product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464644.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene proV CDS complement(75940..79101) product glycosyl hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479129.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS complement(79559..79843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 note possible pseudo, frameshifted CDS 80449..82035 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 82202..82486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(82571..83599) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480191.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene pyrC CDS 83785..85002 product YcbX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151654796.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 85053..85847 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(85899..86819) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206550.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(87027..88058) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(88076..89065) product DUF1852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(89303..91507) product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522123.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene katG CDS 91858..93051 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479020.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS complement(93140..94219) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990827.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS 94407..95459 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 95461..96246 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065320.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS 96281..97519 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420953.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(97524..97793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23930 note possible pseudo, frameshifted CDS complement(97894..98034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(98054..98539) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261941.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(98543..98950) product ribosome recycling factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143309.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS complement(98969..99412) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464169.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 gene soxR CDS complement(99480..100385) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529752.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 100524..101303 product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268115.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 101383..101826 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073195.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 101947..103107 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464060.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 103343..103699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 103701..104102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(104227..104886) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263898.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(104889..105935) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263897.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(105926..106762) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263896.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(106749..107555) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479865.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(107642..108445) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479833.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(108578..109630) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479781.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS 109928..110572 product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479878.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS complement(110638..111780) product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(111800..113107) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566798.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(113104..113622) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091409.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS complement(113698..114684) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358408.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS complement(114959..115762) product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209108.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 gene rhaS CDS complement(115978..116802) product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene rhaD CDS complement(116851..117165) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619496.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 gene rhaM CDS complement(117189..118448) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602491.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 gene rhaA CDS complement(118460..119917) product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209105.1 transl_table 11 codon_start 1 locus_tag LOCUS_24190 gene rhaB CDS complement(120168..121055) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303675.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene garR CDS complement(121069..121842) product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058209.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 gene garL CDS complement(121856..122821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 122847..123434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(123374..123841) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(123848..124897) product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064423.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(124930..126063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 126347..127027 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243745.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(127118..129355) product exopolygalacturonate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482823.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(129431..130147) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482845.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(130422..131603) product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482890.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS complement(131665..133428) product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482859.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(133788..134411) product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460834.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS complement(134442..135371) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482884.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 CDS complement(135765..136403) product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166458.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS complement(136485..136808) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(136842..137603) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene kduD CDS 137875..138669 product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460804.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 gene kdgR CDS 138806..140668 product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482867.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS 140675..141406 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482923.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS 141507..142385 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054352.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 CDS 142653..143552 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462012.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS complement(143639..146239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 146238..146420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS complement(146455..147180) product oligogalacturonate-specific porin KdgM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098578.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 147652..148536 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 148539..149453 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098571.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 149471..150607 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098572.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 gene ugpC CDS 150630..151910 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170166.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS 152080..153126 product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS 153153..154781 product pectate disaccharide-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210831.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS 154786..156198 product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 156411..157952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS 158091..158936 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(158887..159669) product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(159756..161282) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482723.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS 161562..161750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS complement(162742..163836) product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103986.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(163997..164527) product MltR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468084.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(164625..165773) product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480503.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(165851..167812) product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480508.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(168503..169378) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159137.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 CDS 169673..170749 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000281.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS 170761..171528 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082944.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS 171521..172327 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966629.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(172426..172674) product DUF3297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460424.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS complement(172961..173461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(173502..175463) product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096766.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(175792..176307) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS complement(176323..177033) product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(177127..177549) product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467110.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS 177834..179528 product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460432.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS 179531..180247 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460645.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS 180362..181879 product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477429.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene araA CDS 181987..182934 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066347.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene tal CDS 183019..183843 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278836.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 183866..184702 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene araC CDS 184702..184977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 184967..185323 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS 185418..186077 product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 CDS 186103..186549 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093235.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(186552..187547) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(187557..188021) product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462762.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 188132..188692 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478241.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(188826..189221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(189218..190309) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482303.1 transl_table 11 codon_start 1 locus_tag LOCUS_24850 gene galM CDS complement(190367..191317) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(191411..192817) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095593.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 193058..193468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 193775..194614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 note possible pseudo, frameshifted CDS complement(194546..196753) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464845.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS complement(196756..198144) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071265.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS 198466..212709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 213077..215788 product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024699236.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS 215811..216686 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463757.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 gene cobA CDS 216782..217414 product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480250.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 217685..219085 product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 219144..220151 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480283.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS 220197..221132 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463767.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS 221143..223764 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463769.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene nirB CDS 223767..224090 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463771.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene nirD CDS complement(224169..225272) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263351.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS 225387..226382 product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529115.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 gene nagZ CDS 226744..227766 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477206.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 CDS 228201..228746 product diaminobutyrate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477699.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 gene ectA CDS 228859..230124 product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464458.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 gene ectB CDS 230466..230852 product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464385.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 230997..232502 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464554.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 CDS complement(232578..233165) product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 233297..233533 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(233566..234207) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797768.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 234284..234436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(234542..235003) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423235.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(235003..235590) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(235587..236054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992651.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(236224..237105) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 CDS complement(237237..237920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS 238080..239696 product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818222.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(239816..241087) product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911675.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 gene yjeH CDS complement(241094..242050) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190395680.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS 242264..243136 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468574.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS 243221..243502 product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588948.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS 243757..244311 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228982.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(244448..245575) product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261387.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(245562..246467) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene rimK CDS complement(246494..246901) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660269.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS complement(247542..248447) product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279365.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene cysM CDS 248655..249656 product thiosulfate ABC transporter substrate-binding protein CysP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079835.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene cysP CDS 249735..250604 product sulfate/thiosulfate ABC transporter permease CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531810.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene cysT CDS 250614..251498 product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951362.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 gene cysW CDS 251495..252625 product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027776.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(252879..253553) product arginine ABC transporter permease ArtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662924.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene artM CDS complement(253550..254149) product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483395.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene artQ CDS complement(254281..255015) product arginine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483358.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(255100..255828) product arginine ABC transporter ATP-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483352.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene artP CDS complement(256507..257862) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087209.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(258061..258414) product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521222.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene uraH CDS 258878..259798 product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765316.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene puuE CDS 259890..260405 product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene uraD CDS 260500..261033 product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415815.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 261187..262467 product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS complement(262592..262945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS 262911..263159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(263229..263348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 263381..263593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 note possible pseudo, internal stop codon CDS 263618..263995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25450 note possible pseudo, internal stop codon CDS 264247..264486 product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014761069.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS complement(264614..264796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS complement(265175..266983) product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235491.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 267124..267948 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816130.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS 267979..269361 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162538.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(269755..273087) product pullulanase-type alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819303.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 gene pulA CDS complement(273373..274371) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113297.1 transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 274631..275725 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422011.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 275731..278190 product trimethylamine-N-oxide reductase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459941.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(278280..280742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(280955..282091) product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244221.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(282219..283472) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974638.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 283777..284949 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419406.1 transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(285032..285601) product maltose acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026426.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 285754..286842 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462714.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 tRNA 287063..287137 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00840 CDS complement(287462..287776) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312387.1 transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 288316..288984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS complement(289103..291019) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(291025..291738) product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263954.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS complement(291719..292318) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477806.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(292328..293641) product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464216.1 transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(293849..296194) product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464845.1 transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS complement(296194..298134) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263953.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(298243..299640) product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071265.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 300148..312651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 312949..313863 product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477146.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 314092..316179 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036583.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS 316260..317159 product Fe(3+) dicitrate ABC transporter substrate-binding protein FecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879153.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene fecB CDS 317159..318157 product iron-dicitrate ABC transporter permease FecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125187.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene fecC CDS 318154..319116 product Fe(3+) dicitrate ABC transporter permease subunit FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684852.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene fecD CDS 319120..319887 product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene fecE CDS 320292..321686 product cyclic diguanylate phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097072.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(321787..321942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(322063..323556) product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 gene uxaA CDS complement(323604..325019) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210410.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 gene uxaC CDS 325257..326027 product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406487.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene exuR CDS 326344..326859 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 326869..328227 product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 328276..329241 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 329355..330872 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 330889..331947 product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene uxuA CDS complement(332063..332617) product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005497706.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(332711..333688) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074162.1 transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS 333807..335012 product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074161.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS 335136..335546 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS 335574..335858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 335980..336558 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071583.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 336663..337502 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 gene sseA CDS 337534..337953 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969632.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 338074..339471 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196504.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 CDS complement(339590..341983) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479906.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene ppsA CDS 342213..343046 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 CDS 343274..344035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS complement(344064..344516) product PACE efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261924.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 344734..345912 product benzoate/H(+) symporter BenE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625958.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(345982..347301) product SidA/IucD/PvdA family monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263062.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS complement(347369..349759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(349753..350157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS complement(350204..351379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS 351550..353298 product NIS family aerobactin synthetase IucC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015709.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 gene iucC CDS 353459..354226 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060992044.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS 354267..355205 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263057.1 transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS 355206..357227 product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105063662.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 gene fhuB CDS 357475..359697 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263063.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 359878..361065 product ectoine hydrolase DoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969329.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 gene doeA CDS 361143..361604 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525883.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 361827..363374 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969339.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 363426..364826 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969340.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(364918..366081) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 366409..367071 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263280.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 367086..368453 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479004.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 368544..368942 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705879.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 368960..369358 product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262690.1 transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS 369483..369644 product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262271.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 369787..370497 product phosphonate utilization transcriptional regulator PhnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200476.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 gene phnR CDS 370621..371076 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464022.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS 371183..372040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263914.1 transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS 372052..372795 product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461994.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 372792..373103 product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461993.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(373224..374345) product DUF3541 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262454.1 transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 374567..375310 product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451265.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(375358..376269) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263291.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 376416..377612 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422512.1 transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 377636..378670 product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 gene tdh CDS complement(378855..380078) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097284.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(380054..380239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(380349..380876) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261155.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(380879..381079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(381079..381675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS complement(381686..382012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS complement(382009..382371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS complement(382374..382814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS complement(382983..383321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(383382..384200) product DUF2303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081287.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(384250..384645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 385002..385277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(385252..385419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(385755..386252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(386264..386929) product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856967.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 387035..387265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 387291..387746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS 387743..387931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 387978..388130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 388130..388684 product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153268.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 388675..389631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 389624..390295 product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211727.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 390292..390603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 390596..390883 product DUF4406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266130.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS 391038..391226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS 391220..392248 product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360050.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS 392391..392942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(392957..393691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS 393796..394161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 394262..394657 product antiterminator Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170273.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 394632..395240 product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061070701.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 395230..395706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 395749..396084 product HP1 family phage holin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072874.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS 396194..396706 product DUF1441 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389340.1 transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS 396700..398832 product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507029.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS 398823..399038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096320.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 399035..400555 product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096321.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 400485..402545 product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081097245.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 402619..402969 product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097055.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS 402972..403319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 403285..403899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 403896..404432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26710 CDS 404419..405066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS 405066..405548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 405576..405791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS 405832..406170 product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038106.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 406170..407063 product baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS 407060..407773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 407777..410575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26780 CDS 410633..412099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 CDS 412099..412614 product phage major tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS 412683..412973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS 413079..414869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26820 CDS 414869..415273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 415248..415454 product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868175.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS 415445..416446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS complement(416501..416791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(416881..417492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS 417849..418070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS complement(418218..419069) product IS5-like element ISVpa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021706804.1 transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 420049..421419 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261789.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 gene sbcD CDS 421416..425204 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261790.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 425263..425877 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461913.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 426128..426316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263276.1 transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS 426787..428082 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(428183..428857) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(429092..431905) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454869.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS complement(432011..433822) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262096.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS complement(433822..434448) product DUF2760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454971.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 434758..435288 product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108807.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(435379..436755) product L-cystine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480760.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(437258..437881) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072049.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 CDS 438058..438537 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284194.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS 438594..440063 product bifunctional NUDIX hydrolase/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493156.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS 440060..440752 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477815.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 gene queC CDS complement(440862..441212) product DUF2750 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041073.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS complement(441328..442587) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477750.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 CDS 443037..443309 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486991.1 transl_table 11 codon_start 1 locus_tag LOCUS_27070 gene yccX CDS complement(443304..443633) product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005377396.1 transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS complement(443831..444490) product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262111.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS complement(444669..445547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(445791..446540) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS complement(446575..447672) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105885.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS complement(447689..448903) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481996.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(448985..450007) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457119.1 transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 450500..451435 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268683.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS 451590..452636 product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167426.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 452770..453783 product vitamin B12 ABC transporter permease BtuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454796.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 gene btuC CDS 453767..454516 product vitamin B12 ABC transporter ATP-binding protein BtuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621843.1 transl_table 11 codon_start 1 locus_tag LOCUS_27180 gene btuD CDS complement(454513..454662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS complement(454935..455510) product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454856.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS complement(455670..456938) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571083.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 457075..457971 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263794.1 transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(458021..459097) product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769528.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene alr CDS complement(459090..460349) product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972918.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 460671..461003 product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS complement(461048..462067) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104456.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS complement(462072..462893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27270 CDS 463278..465383 product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265693.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 465534..466079 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071839.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 466287..466661 product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164080.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 466785..467561 product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263481.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 467837..468091 product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483180.1 transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 468084..468353 product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS complement(468469..469869) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263052.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 gene dbpA CDS complement(469888..470115) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423709.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(470159..470728) product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 470838..471359 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096712.1 transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS complement(471439..472041) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101303.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 472192..472803 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780723.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(472920..473705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 473847..474788 product zinc transporter ZntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394861.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 CDS complement(474825..475613) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262002.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 475910..476809 product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263201.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene thiD CDS 476802..477647 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482853.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 477662..478441 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482930.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 CDS 478454..479440 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 CDS 479791..480594 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482855.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene thiM CDS 480581..481252 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263207.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 gene thiE CDS complement(481271..482170) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483368.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS complement(482341..483645) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 484138..485787 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477808.1 transl_table 11 codon_start 1 locus_tag LOCUS_27510 tRNA complement(485933..486009) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00850 tRNA complement(486251..486327) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00860 CDS complement(486457..486990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS complement(487000..487605) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453897.1 transl_table 11 codon_start 1 locus_tag LOCUS_27530 gene mobA CDS complement(487987..488640) product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211848.1 transl_table 11 codon_start 1 locus_tag LOCUS_27540 gene hxpB CDS 488829..489686 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454987.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(489775..491148) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483441.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(491305..491502) product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243592.1 transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(491823..492698) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455078.1 transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(492821..493288) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958712.1 transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 493528..494451 product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262000.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 gene nagK CDS complement(494631..494903) product DUF2960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124575.1 transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(494918..495805) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(495807..498155) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262113.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS 498462..499172 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105862.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 gene cobB CDS complement(499257..500303) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261916.1 transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(500674..501459) product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419249.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 gene potC CDS complement(501459..502313) product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457403.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 gene potB CDS complement(502320..503459) product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495030.1 transl_table 11 codon_start 1 locus_tag LOCUS_27680 gene potA CDS 503717..504565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457395.1 transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS 504562..505353 product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549540.1 transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS 505353..506021 product DUF2987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005495024.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 506120..507013 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477636.1 transl_table 11 codon_start 1 locus_tag LOCUS_27720 gene ttcA CDS complement(507115..508053) product universal stress protein UspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477675.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 gene uspE CDS complement(508277..509023) product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477663.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(509117..509788) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477632.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(509778..509993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(510007..512391) product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457369.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(512401..512880) product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240593.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(512957..513955) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206863.1 transl_table 11 codon_start 1 locus_tag LOCUS_27790 gene ccoP CDS complement(513955..514131) product CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351115.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(514142..514759) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097777.1 transl_table 11 codon_start 1 locus_tag LOCUS_27810 gene ccoO CDS complement(514771..516201) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076726.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 gene ccoN CDS 516435..516848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457383.1 transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(517083..517412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS 517649..518410 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704089.1 transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(518797..519144) product DUF413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016350309.1 transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS 519345..520181 product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423718.1 transl_table 11 codon_start 1 locus_tag LOCUS_27870 gene hdfR CDS 520283..520459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(520543..520698) product YoaH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459082.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(520713..521573) product DUF2861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(521598..522254) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479407.1 transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(522229..523644) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479337.1 transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(523889..525274) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461042.1 transl_table 11 codon_start 1 locus_tag LOCUS_27930 gene pntB CDS complement(525284..526837) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422759.1 transl_table 11 codon_start 1 locus_tag LOCUS_27940 gene pntA CDS complement(527165..527440) product HlyU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460998.1 transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS complement(527542..528525) product Solitary outer membrane autotransporter beta-barrel domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263364.1 transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 528642..530093 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479031.1 transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 530212..530670 product DUF3069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461031.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(530759..531154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 note possible pseudo, frameshifted CDS complement(531187..531378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 note possible pseudo, frameshifted CDS 531450..531689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 note possible pseudo, frameshifted CDS 531707..532018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 note possible pseudo, frameshifted CDS complement(532322..533017) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263461.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS complement(533038..533634) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097816.1 transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(533727..534455) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662263.1 transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS complement(534494..534790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(534933..535466) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28070 gene mog CDS complement(535566..535850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(535995..538025) product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482128.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 538170..539222 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482132.1 transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 539289..539588 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212657.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS complement(539663..541414) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123692.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS complement(541418..542641) product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(542699..543553) product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949103.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(543546..543704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(544128..545234) product molybdenum ABC transporter ATP-binding protein ModC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005533.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 gene modC CDS complement(545231..545944) product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene modB CDS complement(545984..546748) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479390.1 transl_table 11 codon_start 1 locus_tag LOCUS_28180 gene modA CDS complement(546859..547641) product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS complement(547649..549175) product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863633.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(549221..549604) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027458.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(549701..550411) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263173.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(550477..551664) product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460937.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(551870..552340) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106209.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 gene nrdG CDS complement(552508..554646) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802773.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene nrdD CDS 554915..555811 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479310.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 CDS complement(555907..557370) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175437.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(557787..560270) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645916.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 CDS complement(560267..560989) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194969.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 560988..561626 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263852.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene tesA CDS 561856..563055 product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455363.1 transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 563288..564937 product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479764.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 565048..565551 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263044.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(565576..566739) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705471.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(566839..567345) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095920.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 567581..568000 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911632.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 gene rbsD CDS 568028..569533 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene rbsA CDS 569530..570516 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463702.1 transl_table 11 codon_start 1 locus_tag LOCUS_28380 gene rbsC CDS 570586..571470 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463703.1 transl_table 11 codon_start 1 locus_tag LOCUS_28390 gene rbsB CDS 571608..572528 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038380.1 transl_table 11 codon_start 1 locus_tag LOCUS_28400 gene rbsK CDS 572555..573574 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 573624..574724 product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454860.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 gene rlmF CDS complement(574839..575894) product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263273.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 gene aroG CDS complement(576121..576552) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207360.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(576722..577273) product DUF3833 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073243.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(577283..577798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(578389..578598) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(578903..579919) product lipoate--protein ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706765.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 580109..581446 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 581623..582159 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706248.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 582357..582905 product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422431.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene speG CDS complement(582981..584291) product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477163.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 584612..585562 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263519.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 gene tal CDS complement(585691..585939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS complement(585860..586510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 586904..587848 product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454328.1 transl_table 11 codon_start 1 locus_tag LOCUS_28560 gene ylqF CDS complement(587999..589000) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610709.1 transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 589668..591125 product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107451.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 gene clcA CDS 591409..592629 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005484151.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS 592870..593091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 593187..594251 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104025753.1 transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(594754..596955) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070791.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 gene malQ CDS 597325..600045 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480178.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene malT CDS 600247..600603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 CDS 600890..602692 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072047.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene ggt CDS 602898..603986 product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481291.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 604004..604810 product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035524.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 gene dkgB CDS complement(604910..605815) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089308.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS 605960..607024 product tartrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089310.1 transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 607108..608403 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(608519..609409) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene malG CDS complement(609421..610998) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106507.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene malF CDS complement(611290..612468) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786217.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 gene malE CDS 612962..614071 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463102.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 gene malK CDS 614414..615400 product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869089.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS 615445..616041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 616054..617562 product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869091.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS complement(617506..617694) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS 617860..619392 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703393.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 619403..620092 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970287.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 620153..621091 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 621473..622735 product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458362.1 transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 622848..624233 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479245.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(624370..624657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(624802..625197) product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464146.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(625220..625834) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176953.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 625985..626917 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477131.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS complement(626999..627775) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419848.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 CDS complement(627840..628958) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108967.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene hisC CDS 629139..630050 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446327.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(630072..630602) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481267.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(630826..631176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187740.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS complement(631905..633380) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464136.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 633809..635197 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153658.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(635339..635728) product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074233.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS complement(635852..637078) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074232.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS complement(637071..637745) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074231.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 637862..639154 product DUF5666 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074230.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(639229..639639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS complement(639761..640459) product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(640464..641009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS 640981..641895 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354569.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(641951..643027) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 gene arsB CDS complement(643101..643436) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070872.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(643599..644441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(644438..645469) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104025753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 646022..646555 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482606.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS 646581..647363 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482660.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(647856..648419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 note possible pseudo, frameshifted CDS complement(648659..649702) product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463577.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(650005..650238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS complement(650410..650946) product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263448.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 651336..653705 product fatty acid cis/trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021451094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 653846..654301 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454351.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 654692..655651 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265913.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene ytfQ CDS 655846..657393 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205794.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS 657390..658436 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301928.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS 658433..659434 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596015.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 gene yjfF CDS 659621..660484 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384907.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 660481..660633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 660716..660970 product DUF2999 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395194.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(661053..662120) product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263681.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(662208..663878) product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263680.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 gene hcp CDS complement(664068..665624) product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263679.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 gene norR CDS 665826..667028 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312302.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS complement(667225..669372) product DNA helicase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001917927.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 gene helD CDS 669642..671834 product YccS family putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454352.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 gene yccS CDS complement(671871..672806) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS complement(672803..673507) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065610322.1 transl_table 11 codon_start 1 locus_tag LOCUS_29290 gene pxpB CDS 673667..674311 product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549393.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS 674512..676149 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095612.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene cueO CDS complement(676238..677968) product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206169.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS complement(678004..679479) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102868.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS 679724..680731 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479808.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(680734..681084) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477812.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS complement(681144..681542) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247362.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(681577..682191) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261923.1 transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 682235..683104 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211898.1 transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 683165..683284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS complement(683292..684104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 684082..684318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29410 CDS complement(684657..685601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263040.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(686001..687053) product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478421.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(687197..688555) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114680.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 gene guaD CDS complement(688614..689456) product xanthine dehydrogenase accessory protein XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083344.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene xdhC CDS complement(689613..692033) product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 gene xdhB CDS complement(692026..693513) product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene xdhA CDS complement(693786..694991) product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261794.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(695401..696024) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087183.1 transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(696171..697583) product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174956.1 transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(697619..698530) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817415.1 transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(698570..699478) product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732924.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(699548..700825) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 701160..703157 product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080058.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS complement(703308..704483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS complement(704599..705900) product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174960.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(706294..707301) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014529376.1 transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(707483..708565) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242400.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(708578..709819) product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(709831..710424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(710428..711357) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(711359..712231) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(712733..713629) product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(713675..714451) product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087181.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 gene hyi CDS complement(714523..716298) product glyoxylate carboligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527189.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene gcl CDS complement(716429..716674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS 716718..718352 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483026.1 transl_table 11 codon_start 1 locus_tag LOCUS_29670 gene aceB CDS 718485..718913 product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083199.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 719037..719771 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083340.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 720033..720317 product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483196.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 720314..720592 product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483280.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 720617..720796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS complement(720829..721125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(721635..722801) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067546.1 transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(723252..724235) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480142.1 transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 724575..725000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS complement(725142..726158) product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368452.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 gene astE CDS complement(726167..727510) product N-succinylarginine dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207787.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene astB CDS complement(727568..729037) product succinylglutamate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207788.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 gene astD CDS complement(729037..730089) product arginine N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212031.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 gene astA CDS complement(730622..731653) product DUF2955 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073763.1 transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS complement(731666..732724) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073764.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS complement(732810..733268) product transcriptional regulator SlyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073765.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 gene slyA CDS 733599..735914 product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973588.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 736294..737298 product arabinose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460652.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 737379..738938 product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460653.1 transl_table 11 codon_start 1 locus_tag LOCUS_29860 gene araG CDS 738942..739925 product L-arabinose ABC transporter permease AraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477508.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 gene araH CDS complement(739980..740306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 740206..740769 product manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318883.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 gene mntP CDS complement(740849..742249) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(742254..744251) product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481460.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(744251..745369) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005384341.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS 745737..746744 product C4-dicarboxylate TRAP substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105525.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene dctP CDS 746766..747449 product C4-dicarboxylate TRAP transporter small permease protein DctQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105527.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 gene dctQ CDS 747452..748735 product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 gene dctM CDS complement(748816..749169) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 gene rplT CDS complement(749211..749405) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419080.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 gene rpmI CDS complement(749542..749955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS complement(750097..752022) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261833.1 transl_table 11 codon_start 1 locus_tag LOCUS_29990 gene thrS CDS 752624..752929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496359.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 753043..753759 product DUF3581 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 754006..754968 product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263347.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(755126..758224) product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462645.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 758508..759194 product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462644.1 transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS 759367..759552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493165.1 transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(759642..760340) product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 gene aqpZ CDS 760702..761112 product SulA-like leucine-rich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462595.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 761377..762480 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462603.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(762567..762782) product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005375557.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(762880..763083) product chromosome segregation ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462979.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS 763374..764330 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462975.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 764327..765322 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263513.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 765315..765989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 765982..766944 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135747.1 transl_table 11 codon_start 1 locus_tag LOCUS_30140 CDS 766937..768973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 768994..770733 product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106518.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 770912..771910 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456547.1 transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(771979..773226) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215759.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(773408..775471) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209897.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(775490..776719) product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209898.1 transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS complement(776735..777577) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097215.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS complement(777590..778900) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209900.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(778961..780199) product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209901.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 780486..781607 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209902.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(782018..782707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30250 note possible pseudo, frameshifted CDS complement(783036..783806) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073994.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS 784154..785446 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309553.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 785608..786558 product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972348.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(786645..787784) product galactose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 gene galM CDS complement(787781..788947) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 gene galK CDS complement(789110..790195) product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263234.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS complement(790231..791247) product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482282.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 gene galE CDS complement(791492..793468) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178336.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 gene cpdB CDS complement(793657..794496) product DUF6279 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477260.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 CDS 794588..795520 product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490846.1 transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 795563..796078 product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005653606.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 796153..796530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS 796605..797150 product copper-binding periplasmic metallochaperone CueP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047148.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 gene cueP CDS 797326..797727 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972640.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(797793..798302) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 CDS complement(798306..799250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30410 CDS 799315..799851 product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235700187.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS 799933..800355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS 800392..800649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 CDS 800758..801117 product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072730.1 transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS complement(801476..802384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 CDS complement(802535..803449) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263160.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 803769..805208 product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479559.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene nhaC CDS complement(805353..805676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(805992..806519) product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206183.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(806696..807079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 807110..807427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(807483..808136) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073706.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 CDS 808519..811662 product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072729.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS complement(811959..814334) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478132.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 814590..815246 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 815461..818304 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188699.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 818315..818941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS complement(818982..819596) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071857.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(819606..820853) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462916.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(820953..822236) product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106286.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(822550..823182) product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261400.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 gene ureG CDS complement(823218..823922) product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418029.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(823929..824510) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206087.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 CDS complement(824601..825080) product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098769.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 gene ureE CDS complement(825505..827247) product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186033.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 gene ureC CDS complement(827329..827664) product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206082.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS complement(827674..827976) product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418034.1 transl_table 11 codon_start 1 locus_tag LOCUS_30680 gene ureA CDS complement(828303..829202) product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261404.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 829532..829909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(829936..830802) product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 gene mscS CDS complement(831049..831744) product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 gene urtE CDS complement(831747..832610) product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269028.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 gene urtD CDS complement(832607..833818) product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976303.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 gene urtC CDS complement(833828..835411) product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398880.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene urtB CDS complement(835547..836851) product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969811.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 gene urtA CDS 837167..838561 product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823241.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS complement(838571..839446) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705524.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 839623..840459 product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS complement(840727..842169) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263108.1 transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS complement(842169..842846) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS complement(842872..843249) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682922.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(843277..844923) product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263106.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS 845107..845895 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262312.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS complement(846021..847289) product DUF4056 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105812.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 CDS complement(847300..848301) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419381.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 CDS complement(848301..849452) product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454985.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 CDS complement(849456..850535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455036.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 CDS 850974..852017 product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965256.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 gene pstS CDS 852216..853172 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371940.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 gene pstC CDS 853172..854059 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene pstA CDS 854066..854935 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene pstB CDS 855187..856008 product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462954.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 856104..857069 product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462956.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 gene pstC CDS 857069..857956 product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478161.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene pstA CDS 858056..858805 product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462960.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene pstB CDS complement(859105..859728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(859703..859873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS complement(860169..860867) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064384.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(860956..861591) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477224.1 transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(861640..863382) product nitrate/nitrite two-component system sensor histidine kinase NarQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113593383.1 transl_table 11 codon_start 1 locus_tag LOCUS_31010 gene narQ CDS 863681..864166 product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene napF CDS 864208..864483 product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463501.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 864542..867034 product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784576.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 gene napA CDS 867120..867599 product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262390.1 transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 867665..868240 product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420448.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 868269..868406 product TIGR02808 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420446.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 CDS 868584..869339 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389976.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 CDS complement(869425..869958) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218952.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 870121..872703 product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480247.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene nirB CDS 872703..873065 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460996.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene nirD CDS 873222..874034 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 gene nirC CDS 874168..874923 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261472.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene cobA CDS complement(875053..875244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS complement(875258..875509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(875699..876019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(876023..876682) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025631.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 CDS complement(876700..876876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 877175..877492 product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453573.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 877647..878333 product DUF2057 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462713.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 CDS complement(878455..879789) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005499754.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS complement(879862..880860) product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454171.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 gene cra CDS 881144..882277 product fused PTS fructose transporter subunit IIA/HPr protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478424.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 gene fruB CDS 882287..883240 product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263760.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 gene pfkB CDS 883258..884988 product PTS fructose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478462.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene fruA CDS 885171..886820 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS complement(886822..887379) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057558311.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 887561..888907 product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261927.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(889055..890593) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 CDS complement(890699..891295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070674.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(891398..892441) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482743.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 gene cyoE CDS complement(892470..893732) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS complement(893744..894346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074208.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(894343..895188) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074207.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 895217..895447 product DUF2909 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482739.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS complement(895502..896419) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482671.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(896512..897102) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(897128..898777) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482647.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 gene ctaD CDS complement(898774..900051) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106288.1 transl_table 11 codon_start 1 locus_tag LOCUS_31390 gene coxB CDS 900408..901247 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 transl_table 11 codon_start 1 locus_tag LOCUS_31400 gene kduI CDS 901286..902275 product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567704.1 transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 902335..902847 product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091409.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 902866..904170 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378953.1 transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 904290..905075 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190404.1 transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS complement(905135..906337) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 906476..907357 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072431.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 907660..908898 product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458382.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene sstT CDS 909110..910645 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746573.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 910645..911607 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161523.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 911604..912392 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766243.1 transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS 912396..913802 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882878.1 transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 913969..914517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(914642..914941) product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(914938..915180) product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(915342..916727) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098348.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS complement(916756..917184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31560 CDS 917343..918605 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958074.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 918602..919294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS 919478..920332 product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477118.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene yghU CDS complement(920468..920824) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462888.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS complement(920971..921444) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711545.1 transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(921639..922517) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419994.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS 923004..924686 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098430.1 transl_table 11 codon_start 1 locus_tag LOCUS_31630 gene leuA CDS complement(924683..925459) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098431.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(925975..927180) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206912.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(927256..927921) product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 CDS complement(928406..929668) product DUF1479 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168797.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS 929954..930694 product DNA-binding transcriptional regulator YciT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463954.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(930700..932352) product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478677.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(932599..932835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 932952..934076 product polyamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707797.1 transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 934168..935319 product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707795.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 gene potA CDS 935367..936332 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017409743.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 936342..937184 product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707793.1 transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(937267..937680) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene rnk CDS complement(937762..937950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 938173..938532 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073262.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 gene raiA CDS complement(938629..939522) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090576.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(939633..940238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS complement(940353..940697) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418869.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 gene yajD CDS complement(940983..941192) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(941573..943066) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene putP CDS complement(943227..943940) product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233685.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(943952..947179) product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477456.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 gene putA CDS complement(947367..948155) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468852.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(948284..948922) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365910.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 gene pdxH CDS complement(949042..951153) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464868.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(951259..952233) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464865.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(952233..953456) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 sequence3 source 1..118436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 96..317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS 241..441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 535..1521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS 1656..2168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS 2296..3639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS 3650..5161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263984.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 5172..6377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 6379..7104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS 7104..8864 product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263987.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS 8864..9937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS 10023..10535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS 10560..11102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 11104..12030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 12132..13430 product trypsin-like serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263993.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS 13567..14079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 14149..14436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 14576..15124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS 15287..15535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS 15538..15771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 15782..16156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32090 CDS 16171..16572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 16575..17255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 17266..18129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS 18130..19602 product TIGR03752 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166082.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS 19673..19975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 CDS 19972..22794 product conjugative transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095177.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 22787..23059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32160 CDS 23072..23350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS complement(23611..24813) product IS256-like element ISSod4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005054087.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS complement(25032..26015) product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 26827..27258 product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 gene arr CDS 27381..27854 product trimethoprim-resistant dihydrofolate reductase DfrA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777555.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 gene dfrA1 CDS 27968..28753 product ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206317.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene aadA1 CDS 28826..29194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS 29319..29678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893665.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS 30395..31867 product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138832.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 gene ltrA CDS complement(32249..32461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 32460..33014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 33087..33563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 33560..34648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 34664..34831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 34953..35273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32310 CDS complement(35335..35808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS 35986..37353 product integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946721.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS 37366..39003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(39080..39244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(39252..39473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32360 CDS 40521..40958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 40963..41100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS 41361..42725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 42800..43087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 43243..43911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 43982..44245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS 44283..44411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 CDS 44695..45021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 45113..45370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 45505..47100 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185669181.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS complement(47478..48461) product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072111.1 transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS 48993..49649 product Qnr family pentapeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261921.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 49811..50134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 50283..50681 product FosA/FosA2 family fosfomycin resistance glutathione transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418600.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene fosA CDS 50827..51369 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464345.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(51423..51602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS 51578..51757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS 52044..53150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS 53234..54349 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS 54415..56283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS 56588..56830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32570 CDS 56868..57935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32580 CDS 58003..59160 product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113001.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 59219..60049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32600 CDS complement(60084..60635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 60835..61479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS complement(61509..62303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS complement(62674..63036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32640 CDS complement(63056..63340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 63550..63915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS complement(63899..64153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 64589..66592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 66924..67856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS 67853..68134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS 68140..68358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS 68982..69848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 70518..70928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 70943..71932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 71942..72757 product TIGR03759 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734461.1 transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 72766..73350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 73347..73943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS 74011..74616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS 74651..74845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 74945..75136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 75150..75350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 75372..75503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 75916..76590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS 76672..76857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 CDS 76932..77246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS 77541..78131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS 78131..78382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS 78471..78959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS 79052..79546 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263378.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 gene radC CDS 79620..80084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 80162..80587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 81094..81924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS 82003..82329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS complement(82549..83220) product class A beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261730.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene bla CDS complement(83925..84380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32950 CDS complement(84393..85574) product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074352.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 CDS 85858..86451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS 86565..89543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 89659..90363 product IS6-like element IS26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313567.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS complement(90397..90831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS complement(90853..91962) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842109.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 gene frmA CDS complement(92057..93241) product tetracycline efflux MFS transporter Tet(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089068.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene tet(B) CDS 93337..93993 product tetracycline resistance transcriptional repressor TetR(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001322387.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene tetR(B) CDS 94005..94709 product IS6-like element IS26 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313567.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 95341..96078 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001366550.1 transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 96075..96299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743213.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS 96510..98003 product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 98199..98918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 99135..100349 product CmlA/FloR family chloramphenicol efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970086.1 transl_table 11 codon_start 1 locus_tag LOCUS_33090 gene cml CDS 100377..100682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS 100794..102287 product IS91-like element ISVsa3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120888.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS complement(102463..102765) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251875.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(102852..103667) product sulfonamide-resistant dihydropteroate synthase Sul2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043260.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 gene sul2 CDS 104040..104330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 note possible pseudo, frameshifted CDS 104462..105193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 note possible pseudo, frameshifted CDS complement(105241..106236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS complement(107069..107461) product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074353.1 transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(107552..107839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(107910..108065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(108062..108337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(108510..109508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 repeat_region 109649..109887 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaccgataaattgtccagagtta CDS 110809..112980 product type IV conjugative transfer system coupling protein TraD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283927.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 gene traD CDS 112980..113339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS complement(113524..113766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 114102..114308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS 114404..114694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33260 CDS 114749..116032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33270 CDS complement(116089..117132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(117132..118436) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074409.1 transl_table 11 codon_start 1 locus_tag LOCUS_33290