>Feature sequence01 236 1387 gene locus_tag LOCUS_00010 gene ald 236 1387 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_00010 1398 2795 gene locus_tag LOCUS_00020 1398 2795 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454913.1 protein_id gnl|my_center|LOCUS_00020 2883 3347 gene locus_tag LOCUS_00030 2883 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016683.1 protein_id gnl|my_center|LOCUS_00030 3429 5051 gene locus_tag LOCUS_00040 3429 5051 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016684.1 protein_id gnl|my_center|LOCUS_00040 5052 5930 gene locus_tag LOCUS_00050 5052 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00050 5951 6628 gene locus_tag LOCUS_00060 5951 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626369.1 protein_id gnl|my_center|LOCUS_00060 6629 7216 gene locus_tag LOCUS_00070 6629 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7299 7589 gene locus_tag LOCUS_00080 7299 7589 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_00080 7600 8586 gene locus_tag LOCUS_00090 7600 8586 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016688.1 protein_id gnl|my_center|LOCUS_00090 9789 9031 gene locus_tag LOCUS_00100 9789 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9985 10938 gene locus_tag LOCUS_00110 9985 10938 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898047.1 protein_id gnl|my_center|LOCUS_00110 10971 12035 gene locus_tag LOCUS_00120 10971 12035 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681885.1 protein_id gnl|my_center|LOCUS_00120 12054 13877 gene locus_tag LOCUS_00130 12054 13877 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903384.1 protein_id gnl|my_center|LOCUS_00130 14021 14638 gene locus_tag LOCUS_00140 14021 14638 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903383.1 protein_id gnl|my_center|LOCUS_00140 14731 15864 gene locus_tag LOCUS_00150 14731 15864 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626360.1 protein_id gnl|my_center|LOCUS_00150 15865 16455 gene locus_tag LOCUS_00160 15865 16455 CDS product DUF452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016699.1 protein_id gnl|my_center|LOCUS_00160 16473 17141 gene locus_tag LOCUS_00170 gene bioC 16473 17141 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016700.1 protein_id gnl|my_center|LOCUS_00170 17178 17774 gene locus_tag LOCUS_00180 17178 17774 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_00180 19218 17833 gene locus_tag LOCUS_00190 19218 17833 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016702.1 protein_id gnl|my_center|LOCUS_00190 20411 19248 gene locus_tag LOCUS_00200 gene glgD 20411 19248 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903377.1 protein_id gnl|my_center|LOCUS_00200 21581 20433 gene locus_tag LOCUS_00210 21581 20433 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626354.1 protein_id gnl|my_center|LOCUS_00210 23424 21598 gene locus_tag LOCUS_00220 gene glgB 23424 21598 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367106.1 protein_id gnl|my_center|LOCUS_00220 25907 23463 gene locus_tag LOCUS_00230 25907 23463 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_00230 27417 25897 gene locus_tag LOCUS_00240 gene malQ 27417 25897 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016706.1 protein_id gnl|my_center|LOCUS_00240 28411 27629 gene locus_tag LOCUS_00250 28411 27629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898065.1 protein_id gnl|my_center|LOCUS_00250 29116 28430 gene locus_tag LOCUS_00260 29116 28430 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626351.1 protein_id gnl|my_center|LOCUS_00260 31641 29143 gene locus_tag LOCUS_00270 31641 29143 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016714.1 protein_id gnl|my_center|LOCUS_00270 31802 31653 gene locus_tag LOCUS_00280 31802 31653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32644 31811 gene locus_tag LOCUS_00290 32644 31811 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903362.1 protein_id gnl|my_center|LOCUS_00290 33495 32701 gene locus_tag LOCUS_00300 33495 32701 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494826.1 protein_id gnl|my_center|LOCUS_00300 34370 33507 gene locus_tag LOCUS_00310 34370 33507 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494825.1 protein_id gnl|my_center|LOCUS_00310 36364 34367 gene locus_tag LOCUS_00320 gene aroB 36364 34367 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016717.1 protein_id gnl|my_center|LOCUS_00320 37365 36544 gene locus_tag LOCUS_00330 37365 36544 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494823.1 protein_id gnl|my_center|LOCUS_00330 39039 37384 gene locus_tag LOCUS_00340 gene sppA 39039 37384 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492321.1 protein_id gnl|my_center|LOCUS_00340 39571 39053 gene locus_tag LOCUS_00350 39571 39053 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903679.1 protein_id gnl|my_center|LOCUS_00350 40345 39575 gene locus_tag LOCUS_00360 40345 39575 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898090.1 protein_id gnl|my_center|LOCUS_00360 42183 40471 gene locus_tag LOCUS_00370 gene ggt 42183 40471 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016721.1 protein_id gnl|my_center|LOCUS_00370 43559 42180 gene locus_tag LOCUS_00380 43559 42180 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125141940.1 protein_id gnl|my_center|LOCUS_00380 44521 43814 gene locus_tag LOCUS_00390 44521 43814 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903683.1 protein_id gnl|my_center|LOCUS_00390 46104 44806 gene locus_tag LOCUS_00400 46104 44806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 47029 46244 gene locus_tag LOCUS_00410 47029 46244 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903684.1 protein_id gnl|my_center|LOCUS_00410 48061 47045 gene locus_tag LOCUS_00420 48061 47045 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016723.1 protein_id gnl|my_center|LOCUS_00420 48830 48042 gene locus_tag LOCUS_00430 48830 48042 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016724.1 protein_id gnl|my_center|LOCUS_00430 49092 51638 gene locus_tag LOCUS_00440 49092 51638 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_00440 53533 51731 gene locus_tag LOCUS_00450 gene pepF 53533 51731 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_00450 54027 53548 gene locus_tag LOCUS_00460 54027 53548 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_00460 55265 54042 gene locus_tag LOCUS_00470 55265 54042 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_00470 55708 55325 gene locus_tag LOCUS_00480 55708 55325 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016728.1 protein_id gnl|my_center|LOCUS_00480 56402 55773 gene locus_tag LOCUS_00490 56402 55773 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903694.1 protein_id gnl|my_center|LOCUS_00490 57241 56402 gene locus_tag LOCUS_00500 57241 56402 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903695.1 protein_id gnl|my_center|LOCUS_00500 57424 58155 gene locus_tag LOCUS_00510 57424 58155 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897094.1 protein_id gnl|my_center|LOCUS_00510 58190 58612 gene locus_tag LOCUS_00520 58190 58612 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903698.1 protein_id gnl|my_center|LOCUS_00520 59897 58683 gene locus_tag LOCUS_00530 59897 58683 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_00530 60183 60016 gene locus_tag LOCUS_00540 60183 60016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00540 60683 60300 gene locus_tag LOCUS_00550 60683 60300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903702.1 protein_id gnl|my_center|LOCUS_00550 60789 61457 gene locus_tag LOCUS_00560 60789 61457 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016732.1 protein_id gnl|my_center|LOCUS_00560 61527 61760 gene locus_tag LOCUS_00570 61527 61760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 >Feature sequence02 468 575 gene locus_tag LOCUS_r00010 468 575 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 703 1416 gene locus_tag LOCUS_00580 703 1416 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017120.1 protein_id gnl|my_center|LOCUS_00580 1419 4118 gene locus_tag LOCUS_00590 1419 4118 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 protein_id gnl|my_center|LOCUS_00590 4128 4781 gene locus_tag LOCUS_00600 4128 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00600 4760 5902 gene locus_tag LOCUS_00610 4760 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00610 5912 9313 gene locus_tag LOCUS_00620 gene dnaE 5912 9313 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017116.1 protein_id gnl|my_center|LOCUS_00620 9452 10897 gene locus_tag LOCUS_00630 9452 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 10910 12823 gene locus_tag LOCUS_00640 10910 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 12828 13928 gene locus_tag LOCUS_00650 12828 13928 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_00650 13943 16219 gene locus_tag LOCUS_00660 13943 16219 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_00660 16228 17406 gene locus_tag LOCUS_00670 16228 17406 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_00670 17636 18055 gene locus_tag LOCUS_00680 17636 18055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 18093 18245 gene locus_tag LOCUS_00690 18093 18245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 19951 18401 gene locus_tag LOCUS_00700 gene citF 19951 18401 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017113.1 protein_id gnl|my_center|LOCUS_00700 20844 19954 gene locus_tag LOCUS_00710 gene citE 20844 19954 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_00710 21137 20853 gene locus_tag LOCUS_00720 gene citD 21137 20853 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017111.1 protein_id gnl|my_center|LOCUS_00720 22062 21214 gene locus_tag LOCUS_00730 gene citG 22062 21214 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017110.1 protein_id gnl|my_center|LOCUS_00730 23395 22049 gene locus_tag LOCUS_00740 23395 22049 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_00740 24840 23479 gene locus_tag LOCUS_00750 24840 23479 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902179.1 protein_id gnl|my_center|LOCUS_00750 25086 25589 gene locus_tag LOCUS_00760 gene ybaK 25086 25589 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017107.1 protein_id gnl|my_center|LOCUS_00760 25743 26687 gene locus_tag LOCUS_00770 25743 26687 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494586.1 protein_id gnl|my_center|LOCUS_00770 26946 27608 gene locus_tag LOCUS_00780 26946 27608 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626801.1 protein_id gnl|my_center|LOCUS_00780 27619 27987 gene locus_tag LOCUS_00790 27619 27987 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017105.1 protein_id gnl|my_center|LOCUS_00790 27977 28198 gene locus_tag LOCUS_00800 27977 28198 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898710.1 protein_id gnl|my_center|LOCUS_00800 28173 28829 gene locus_tag LOCUS_00810 28173 28829 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898707.1 protein_id gnl|my_center|LOCUS_00810 29006 29605 gene locus_tag LOCUS_00820 29006 29605 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017103.1 protein_id gnl|my_center|LOCUS_00820 29624 30391 gene locus_tag LOCUS_00830 gene tpiA 29624 30391 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_00830 30409 31503 gene locus_tag LOCUS_00840 gene ychF 30409 31503 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017102.1 protein_id gnl|my_center|LOCUS_00840 31587 31766 gene locus_tag LOCUS_00850 gene rpmF 31587 31766 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890386.1 protein_id gnl|my_center|LOCUS_00850 32971 31955 gene locus_tag LOCUS_00860 32971 31955 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_00860 33813 32968 gene locus_tag LOCUS_00870 gene panC 33813 32968 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_00870 34796 34020 gene locus_tag LOCUS_00880 34796 34020 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898686.1 protein_id gnl|my_center|LOCUS_00880 36007 34943 gene locus_tag LOCUS_00890 gene alr 36007 34943 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016367.1 protein_id gnl|my_center|LOCUS_00890 36607 36083 gene locus_tag LOCUS_00900 36607 36083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902761.1 protein_id gnl|my_center|LOCUS_00900 36820 37734 gene locus_tag LOCUS_00910 gene accD 36820 37734 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902759.1 protein_id gnl|my_center|LOCUS_00910 37745 38686 gene locus_tag LOCUS_00920 37745 38686 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016368.1 protein_id gnl|my_center|LOCUS_00920 38704 39672 gene locus_tag LOCUS_00930 gene pfkA 38704 39672 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041561.1 protein_id gnl|my_center|LOCUS_00930 39693 39989 gene locus_tag LOCUS_00940 39693 39989 CDS product DUF496 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902753.1 protein_id gnl|my_center|LOCUS_00940 40001 40594 gene locus_tag LOCUS_00950 gene recR 40001 40594 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016369.1 protein_id gnl|my_center|LOCUS_00950 40688 41239 gene locus_tag LOCUS_00960 40688 41239 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263481.1 protein_id gnl|my_center|LOCUS_00960 41844 42365 gene locus_tag LOCUS_00970 gene pyrR 41844 42365 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898638.1 protein_id gnl|my_center|LOCUS_00970 42456 43346 gene locus_tag LOCUS_00980 42456 43346 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491861.1 protein_id gnl|my_center|LOCUS_00980 43533 44810 gene locus_tag LOCUS_00990 43533 44810 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_00990 44827 45921 gene locus_tag LOCUS_01000 gene carA 44827 45921 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_01000 46168 49344 gene locus_tag LOCUS_01010 gene carB 46168 49344 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016379.1 protein_id gnl|my_center|LOCUS_01010 49567 50376 gene locus_tag LOCUS_01020 49567 50376 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_01020 50389 51306 gene locus_tag LOCUS_01030 50389 51306 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016381.1 protein_id gnl|my_center|LOCUS_01030 51315 52070 gene locus_tag LOCUS_01040 51315 52070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 52087 52800 gene locus_tag LOCUS_01050 gene pyrF 52087 52800 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016383.1 protein_id gnl|my_center|LOCUS_01050 52790 53665 gene locus_tag LOCUS_01060 52790 53665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 53681 54298 gene locus_tag LOCUS_01070 gene pyrE 53681 54298 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005966861.1 protein_id gnl|my_center|LOCUS_01070 54446 55057 gene locus_tag LOCUS_01080 54446 55057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 55111 56232 gene locus_tag LOCUS_01090 55111 56232 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_01090 56304 56654 gene locus_tag LOCUS_01100 gene rplS 56304 56654 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898626.1 protein_id gnl|my_center|LOCUS_01100 57471 56698 gene locus_tag LOCUS_01110 gene murI 57471 56698 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902800.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence03 900 748 gene locus_tag LOCUS_01120 900 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 2901 1009 gene locus_tag LOCUS_01130 2901 1009 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228260.1 protein_id gnl|my_center|LOCUS_01130 3442 2918 gene locus_tag LOCUS_01140 3442 2918 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642396.1 protein_id gnl|my_center|LOCUS_01140 3585 4163 gene locus_tag LOCUS_01150 3585 4163 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_01150 5160 4213 gene locus_tag LOCUS_01160 5160 4213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_01160 5737 5186 gene locus_tag LOCUS_01170 5737 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 5883 6302 gene locus_tag LOCUS_01180 5883 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948562.1 protein_id gnl|my_center|LOCUS_01180 7199 6369 gene locus_tag LOCUS_01190 7199 6369 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_01190 7826 7221 gene locus_tag LOCUS_01200 7826 7221 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068495.1 protein_id gnl|my_center|LOCUS_01200 8331 7855 gene locus_tag LOCUS_01210 8331 7855 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_01210 8962 8399 gene locus_tag LOCUS_01220 8962 8399 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261995.1 protein_id gnl|my_center|LOCUS_01220 9388 8975 gene locus_tag LOCUS_01230 9388 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 10252 9407 gene locus_tag LOCUS_01240 10252 9407 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263344.1 protein_id gnl|my_center|LOCUS_01240 10583 10266 gene locus_tag LOCUS_01250 10583 10266 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130024.1 protein_id gnl|my_center|LOCUS_01250 12405 10651 gene locus_tag LOCUS_01260 12405 10651 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017171.1 protein_id gnl|my_center|LOCUS_01260 12799 12419 gene locus_tag LOCUS_01270 gene adhR 12799 12419 CDS product aldehyde stress transcriptional regulator AdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398725.1 protein_id gnl|my_center|LOCUS_01270 13311 12796 gene locus_tag LOCUS_01280 13311 12796 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_01280 13481 14356 gene locus_tag LOCUS_01290 13481 14356 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017172.1 protein_id gnl|my_center|LOCUS_01290 14357 14614 gene locus_tag LOCUS_01300 14357 14614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017173.1 protein_id gnl|my_center|LOCUS_01300 14899 14624 gene locus_tag LOCUS_01310 14899 14624 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074049.1 protein_id gnl|my_center|LOCUS_01310 15132 14893 gene locus_tag LOCUS_01320 15132 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 15781 15188 gene locus_tag LOCUS_01330 15781 15188 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017175.1 protein_id gnl|my_center|LOCUS_01330 17105 15783 gene locus_tag LOCUS_01340 17105 15783 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017176.1 protein_id gnl|my_center|LOCUS_01340 17565 17206 gene locus_tag LOCUS_01350 17565 17206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017184.1 protein_id gnl|my_center|LOCUS_01350 18193 17606 gene locus_tag LOCUS_01360 18193 17606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898143.1 protein_id gnl|my_center|LOCUS_01360 19549 18218 gene locus_tag LOCUS_01370 gene mgtE 19549 18218 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898141.1 protein_id gnl|my_center|LOCUS_01370 20699 19578 gene locus_tag LOCUS_01380 gene tgt 20699 19578 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902330.1 protein_id gnl|my_center|LOCUS_01380 22891 20714 gene locus_tag LOCUS_01390 22891 20714 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902331.1 protein_id gnl|my_center|LOCUS_01390 23422 22910 gene locus_tag LOCUS_01400 23422 22910 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902332.1 protein_id gnl|my_center|LOCUS_01400 24450 23653 gene locus_tag LOCUS_01410 24450 23653 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626970.1 protein_id gnl|my_center|LOCUS_01410 25150 24464 gene locus_tag LOCUS_01420 25150 24464 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017188.1 protein_id gnl|my_center|LOCUS_01420 26427 25147 gene locus_tag LOCUS_01430 26427 25147 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_01430 27134 26673 gene locus_tag LOCUS_01440 27134 26673 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902336.1 protein_id gnl|my_center|LOCUS_01440 27999 27148 gene locus_tag LOCUS_01450 27999 27148 CDS product bifunctional 5,10-methylenetetrahydrofolate dehydrogenase/5,10-methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017190.1 protein_id gnl|my_center|LOCUS_01450 28910 27993 gene locus_tag LOCUS_01460 gene fmt 28910 27993 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373209.1 protein_id gnl|my_center|LOCUS_01460 29396 28947 gene locus_tag LOCUS_01470 gene nrdR 29396 28947 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902339.1 protein_id gnl|my_center|LOCUS_01470 29887 29414 gene locus_tag LOCUS_01480 29887 29414 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_01480 30582 29881 gene locus_tag LOCUS_01490 gene recO 30582 29881 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017193.1 protein_id gnl|my_center|LOCUS_01490 31171 30593 gene locus_tag LOCUS_01500 31171 30593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017194.1 protein_id gnl|my_center|LOCUS_01500 32034 31171 gene locus_tag LOCUS_01510 gene mreC 32034 31171 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796804.1 protein_id gnl|my_center|LOCUS_01510 32856 32269 gene locus_tag LOCUS_01520 32856 32269 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_01520 33381 32899 gene locus_tag LOCUS_01530 33381 32899 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902308.1 protein_id gnl|my_center|LOCUS_01530 35038 33404 gene locus_tag LOCUS_01540 35038 33404 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_01540 35174 36073 gene locus_tag LOCUS_01550 35174 36073 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015631.1 protein_id gnl|my_center|LOCUS_01550 36447 36124 gene locus_tag LOCUS_01560 36447 36124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 36724 36545 gene locus_tag LOCUS_01570 36724 36545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 37018 38649 gene locus_tag LOCUS_01580 37018 38649 CDS product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897873.1 protein_id gnl|my_center|LOCUS_01580 39446 38712 gene locus_tag LOCUS_01590 39446 38712 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015633.1 protein_id gnl|my_center|LOCUS_01590 40229 39447 gene locus_tag LOCUS_01600 40229 39447 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015634.1 protein_id gnl|my_center|LOCUS_01600 41029 40226 gene locus_tag LOCUS_01610 41029 40226 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819131.1 protein_id gnl|my_center|LOCUS_01610 41951 41022 gene locus_tag LOCUS_01620 41951 41022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819132.1 protein_id gnl|my_center|LOCUS_01620 43570 41966 gene locus_tag LOCUS_01630 gene nikA 43570 41966 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819133.1 protein_id gnl|my_center|LOCUS_01630 44032 44493 gene locus_tag LOCUS_01640 gene ribE 44032 44493 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902111.1 protein_id gnl|my_center|LOCUS_01640 44495 45604 gene locus_tag LOCUS_01650 gene ribD 44495 45604 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902112.1 protein_id gnl|my_center|LOCUS_01650 45847 46503 gene locus_tag LOCUS_01660 gene ribE 45847 46503 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015638.1 protein_id gnl|my_center|LOCUS_01660 46513 47712 gene locus_tag LOCUS_01670 46513 47712 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015639.1 protein_id gnl|my_center|LOCUS_01670 47985 47779 gene locus_tag LOCUS_01680 47985 47779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 48451 49368 gene locus_tag LOCUS_01690 gene cysK 48451 49368 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948015.1 protein_id gnl|my_center|LOCUS_01690 49406 49942 gene locus_tag LOCUS_01700 gene cysE 49406 49942 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_01700 50088 51002 gene locus_tag LOCUS_01710 gene metA 50088 51002 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254910.1 protein_id gnl|my_center|LOCUS_01710 51027 52367 gene locus_tag LOCUS_01720 51027 52367 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626992.1 protein_id gnl|my_center|LOCUS_01720 52393 53700 gene locus_tag LOCUS_01730 52393 53700 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626992.1 protein_id gnl|my_center|LOCUS_01730 53726 55579 gene locus_tag LOCUS_01740 53726 55579 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058118852.1 protein_id gnl|my_center|LOCUS_01740 55597 57210 gene locus_tag LOCUS_01750 55597 57210 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015644.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence04 183 560 gene locus_tag LOCUS_01760 183 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 1118 1600 gene locus_tag LOCUS_01770 1118 1600 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015980.1 protein_id gnl|my_center|LOCUS_01770 1557 3101 gene locus_tag LOCUS_01780 1557 3101 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015979.1 protein_id gnl|my_center|LOCUS_01780 3098 3820 gene locus_tag LOCUS_01790 3098 3820 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008798583.1 protein_id gnl|my_center|LOCUS_01790 3836 4798 gene locus_tag LOCUS_01800 3836 4798 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904591.1 protein_id gnl|my_center|LOCUS_01800 4811 5221 gene locus_tag LOCUS_01810 4811 5221 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016200.1 protein_id gnl|my_center|LOCUS_01810 5237 5632 gene locus_tag LOCUS_01820 5237 5632 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016200.1 protein_id gnl|my_center|LOCUS_01820 6400 5579 gene locus_tag LOCUS_01830 6400 5579 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015977.1 protein_id gnl|my_center|LOCUS_01830 7508 6678 gene locus_tag LOCUS_01840 7508 6678 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015976.1 protein_id gnl|my_center|LOCUS_01840 8286 7492 gene locus_tag LOCUS_01850 8286 7492 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015975.1 protein_id gnl|my_center|LOCUS_01850 8844 8296 gene locus_tag LOCUS_01860 8844 8296 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015974.1 protein_id gnl|my_center|LOCUS_01860 9361 11169 gene locus_tag LOCUS_01870 9361 11169 CDS product DUF4401 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627168.1 protein_id gnl|my_center|LOCUS_01870 11162 11695 gene locus_tag LOCUS_01880 11162 11695 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903319.1 protein_id gnl|my_center|LOCUS_01880 12882 11740 gene locus_tag LOCUS_01890 12882 11740 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_01890 13189 12869 gene locus_tag LOCUS_01900 13189 12869 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894809.1 protein_id gnl|my_center|LOCUS_01900 13929 13222 gene locus_tag LOCUS_01910 13929 13222 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_01910 14639 13926 gene locus_tag LOCUS_01920 14639 13926 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015967.1 protein_id gnl|my_center|LOCUS_01920 15526 15092 gene locus_tag LOCUS_01930 15526 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903314.1 protein_id gnl|my_center|LOCUS_01930 16185 15532 gene locus_tag LOCUS_01940 16185 15532 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_01940 17137 16187 gene locus_tag LOCUS_01950 17137 16187 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_01950 18482 17124 gene locus_tag LOCUS_01960 gene glmU 18482 17124 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_01960 19149 18493 gene locus_tag LOCUS_01970 19149 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 19551 19787 gene locus_tag LOCUS_01980 19551 19787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 19832 20110 gene locus_tag LOCUS_01990 19832 20110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 21837 20521 gene locus_tag LOCUS_02000 21837 20521 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_02000 23416 22034 gene locus_tag LOCUS_02010 23416 22034 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015962.1 protein_id gnl|my_center|LOCUS_02010 23734 24390 gene locus_tag LOCUS_02020 23734 24390 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627160.1 protein_id gnl|my_center|LOCUS_02020 25689 24520 gene locus_tag LOCUS_02030 25689 24520 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627158.1 protein_id gnl|my_center|LOCUS_02030 25801 27246 gene locus_tag LOCUS_02040 gene creD 25801 27246 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627154.1 protein_id gnl|my_center|LOCUS_02040 29002 27365 gene locus_tag LOCUS_02050 29002 27365 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015958.1 protein_id gnl|my_center|LOCUS_02050 29971 29405 gene locus_tag LOCUS_02060 gene ahpC 29971 29405 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903303.1 protein_id gnl|my_center|LOCUS_02060 30156 30929 gene locus_tag LOCUS_02070 30156 30929 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_02070 30880 31737 gene locus_tag LOCUS_02080 30880 31737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_02080 32930 31842 gene locus_tag LOCUS_02090 32930 31842 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015955.1 protein_id gnl|my_center|LOCUS_02090 33343 33086 gene locus_tag LOCUS_02100 gene rpsO 33343 33086 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_02100 35602 33458 gene locus_tag LOCUS_02110 gene ftsH 35602 33458 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015954.1 protein_id gnl|my_center|LOCUS_02110 36947 35592 gene locus_tag LOCUS_02120 gene tilS 36947 35592 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015953.1 protein_id gnl|my_center|LOCUS_02120 38121 37189 gene locus_tag LOCUS_02130 gene mltG 38121 37189 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015952.1 protein_id gnl|my_center|LOCUS_02130 39717 38131 gene locus_tag LOCUS_02140 39717 38131 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_02140 39914 41128 gene locus_tag LOCUS_02150 39914 41128 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016518.1 protein_id gnl|my_center|LOCUS_02150 41125 41544 gene locus_tag LOCUS_02160 41125 41544 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016519.1 protein_id gnl|my_center|LOCUS_02160 41560 42843 gene locus_tag LOCUS_02170 41560 42843 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_02170 42869 43258 gene locus_tag LOCUS_02180 42869 43258 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067685.1 protein_id gnl|my_center|LOCUS_02180 44233 43298 gene locus_tag LOCUS_02190 44233 43298 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016517.1 protein_id gnl|my_center|LOCUS_02190 44347 47193 gene locus_tag LOCUS_02200 44347 47193 CDS product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015950.1 protein_id gnl|my_center|LOCUS_02200 47279 48118 gene locus_tag LOCUS_02210 47279 48118 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_02210 48224 48601 gene locus_tag LOCUS_02220 48224 48601 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901327.1 protein_id gnl|my_center|LOCUS_02220 49085 49237 gene locus_tag LOCUS_02230 49085 49237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 49478 49323 gene locus_tag LOCUS_02240 49478 49323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 49677 50693 gene locus_tag LOCUS_02250 49677 50693 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064362.1 protein_id gnl|my_center|LOCUS_02250 50767 51270 gene locus_tag LOCUS_02260 50767 51270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 51270 52547 gene locus_tag LOCUS_02270 51270 52547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 52588 53388 gene locus_tag LOCUS_02280 gene iolB 52588 53388 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583016.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence05 704 534 gene locus_tag LOCUS_02290 704 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2454 838 gene locus_tag LOCUS_02300 2454 838 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015853.1 protein_id gnl|my_center|LOCUS_02300 2576 3037 gene locus_tag LOCUS_02310 2576 3037 CDS product FxLYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023036846.1 protein_id gnl|my_center|LOCUS_02310 4500 3277 gene locus_tag LOCUS_02320 4500 3277 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627649.1 protein_id gnl|my_center|LOCUS_02320 5858 4518 gene locus_tag LOCUS_02330 gene dnaB 5858 4518 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903028.1 protein_id gnl|my_center|LOCUS_02330 6318 5869 gene locus_tag LOCUS_02340 gene rplI 6318 5869 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903027.1 protein_id gnl|my_center|LOCUS_02340 7167 6334 gene locus_tag LOCUS_02350 7167 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015856.1 protein_id gnl|my_center|LOCUS_02350 8635 7181 gene locus_tag LOCUS_02360 gene dnaX 8635 7181 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903025.1 protein_id gnl|my_center|LOCUS_02360 10033 8639 gene locus_tag LOCUS_02370 10033 8639 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015857.1 protein_id gnl|my_center|LOCUS_02370 10838 10050 gene locus_tag LOCUS_02380 10838 10050 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894432.1 protein_id gnl|my_center|LOCUS_02380 11287 10844 gene locus_tag LOCUS_02390 11287 10844 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 protein_id gnl|my_center|LOCUS_02390 11909 11298 gene locus_tag LOCUS_02400 11909 11298 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_02400 12316 11939 gene locus_tag LOCUS_02410 12316 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889861.1 protein_id gnl|my_center|LOCUS_02410 15452 12642 gene locus_tag LOCUS_02420 15452 12642 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015862.1 protein_id gnl|my_center|LOCUS_02420 15992 15462 gene locus_tag LOCUS_02430 15992 15462 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903018.1 protein_id gnl|my_center|LOCUS_02430 16705 16289 gene locus_tag LOCUS_02440 16705 16289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02440 17919 16729 gene locus_tag LOCUS_02450 17919 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02450 18040 18813 gene locus_tag LOCUS_02460 18040 18813 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903010.1 protein_id gnl|my_center|LOCUS_02460 19216 19037 gene locus_tag LOCUS_02470 19216 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 19220 19555 gene locus_tag LOCUS_02480 19220 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 19552 20535 gene locus_tag LOCUS_02490 19552 20535 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198481065.1 protein_id gnl|my_center|LOCUS_02490 20498 21316 gene locus_tag LOCUS_02500 20498 21316 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627625.1 protein_id gnl|my_center|LOCUS_02500 21560 22831 gene locus_tag LOCUS_02510 21560 22831 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015873.1 protein_id gnl|my_center|LOCUS_02510 22831 23760 gene locus_tag LOCUS_02520 22831 23760 CDS product 3-oxoacyl-ACP synthase III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015874.1 protein_id gnl|my_center|LOCUS_02520 23907 25211 gene locus_tag LOCUS_02530 gene rph 23907 25211 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015875.1 protein_id gnl|my_center|LOCUS_02530 25460 25879 gene locus_tag LOCUS_02540 25460 25879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367343.1 protein_id gnl|my_center|LOCUS_02540 26012 26428 gene locus_tag LOCUS_02550 gene glmS 26012 26428 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902997.1 protein_id gnl|my_center|LOCUS_02550 26425 27813 gene locus_tag LOCUS_02560 gene glmL 26425 27813 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015877.1 protein_id gnl|my_center|LOCUS_02560 27828 29285 gene locus_tag LOCUS_02570 27828 29285 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902992.1 protein_id gnl|my_center|LOCUS_02570 30457 29330 gene locus_tag LOCUS_02580 30457 29330 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015879.1 protein_id gnl|my_center|LOCUS_02580 31301 30648 gene locus_tag LOCUS_02590 31301 30648 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_02590 31972 31319 gene locus_tag LOCUS_02600 31972 31319 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_02600 33400 32024 gene locus_tag LOCUS_02610 33400 32024 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_02610 34789 33668 gene locus_tag LOCUS_02620 34789 33668 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015879.1 protein_id gnl|my_center|LOCUS_02620 36470 35022 gene locus_tag LOCUS_02630 36470 35022 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015880.1 protein_id gnl|my_center|LOCUS_02630 37231 36608 gene locus_tag LOCUS_02640 37231 36608 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 protein_id gnl|my_center|LOCUS_02640 38044 37253 gene locus_tag LOCUS_02650 38044 37253 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_02650 39600 38044 gene locus_tag LOCUS_02660 39600 38044 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_02660 41063 39600 gene locus_tag LOCUS_02670 41063 39600 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_02670 42081 41065 gene locus_tag LOCUS_02680 42081 41065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_02680 43362 42085 gene locus_tag LOCUS_02690 gene ablA 43362 42085 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_02690 44473 43436 gene locus_tag LOCUS_02700 gene kdd 44473 43436 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_02700 45315 44500 gene locus_tag LOCUS_02710 45315 44500 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_02710 45720 45334 gene locus_tag LOCUS_02720 45720 45334 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_02720 47054 46329 gene locus_tag LOCUS_02730 47054 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627611.1 protein_id gnl|my_center|LOCUS_02730 47797 47078 gene locus_tag LOCUS_02740 47797 47078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627611.1 protein_id gnl|my_center|LOCUS_02740 49393 48290 gene locus_tag LOCUS_02750 gene tnpB 49393 48290 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861290.1 protein_id gnl|my_center|LOCUS_02750 50117 49590 gene locus_tag LOCUS_02760 50117 49590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 51731 50421 gene locus_tag LOCUS_02770 51731 50421 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence06 1442 318 gene locus_tag LOCUS_02780 gene hadC 1442 318 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_02780 2735 1473 gene locus_tag LOCUS_02790 gene hadB 2735 1473 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit HadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888224.1 protein_id gnl|my_center|LOCUS_02790 3547 2765 gene locus_tag LOCUS_02800 gene fldI 3547 2765 CDS product phenyllactyl-CoA dehydratase activase FldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357618.1 protein_id gnl|my_center|LOCUS_02800 4037 3594 gene locus_tag LOCUS_02810 gene mce 4037 3594 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_02810 4250 5734 gene locus_tag LOCUS_02820 4250 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 7361 5799 gene locus_tag LOCUS_02830 7361 5799 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 protein_id gnl|my_center|LOCUS_02830 7521 8414 gene locus_tag LOCUS_02840 7521 8414 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895540.1 protein_id gnl|my_center|LOCUS_02840 8646 8930 gene locus_tag LOCUS_02850 8646 8930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899613.1 protein_id gnl|my_center|LOCUS_02850 9003 9182 gene locus_tag LOCUS_02860 9003 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 9199 9726 gene locus_tag LOCUS_02870 9199 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9740 10015 gene locus_tag LOCUS_02880 9740 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 9969 10271 gene locus_tag LOCUS_02890 9969 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 10285 10551 gene locus_tag LOCUS_02900 10285 10551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 10590 10721 gene locus_tag LOCUS_02910 10590 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 11104 11358 gene locus_tag LOCUS_02920 11104 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 11389 12738 gene locus_tag LOCUS_02930 11389 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 12759 13412 gene locus_tag LOCUS_02940 12759 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 13436 14269 gene locus_tag LOCUS_02950 13436 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 14342 15664 gene locus_tag LOCUS_02960 gene der 14342 15664 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_02960 16084 16809 gene locus_tag LOCUS_02970 16084 16809 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016203.1 protein_id gnl|my_center|LOCUS_02970 16821 18308 gene locus_tag LOCUS_02980 16821 18308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367524.1 protein_id gnl|my_center|LOCUS_02980 18482 21883 gene locus_tag LOCUS_02990 18482 21883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 22172 23128 gene locus_tag LOCUS_03000 22172 23128 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902703.1 protein_id gnl|my_center|LOCUS_03000 23249 23896 gene locus_tag LOCUS_03010 23249 23896 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_03010 23898 24692 gene locus_tag LOCUS_03020 gene minD 23898 24692 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016205.1 protein_id gnl|my_center|LOCUS_03020 24697 24996 gene locus_tag LOCUS_03030 gene minE 24697 24996 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016206.1 protein_id gnl|my_center|LOCUS_03030 25788 25171 gene locus_tag LOCUS_03040 gene ttdB 25788 25171 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703618.1 protein_id gnl|my_center|LOCUS_03040 26687 25788 gene locus_tag LOCUS_03050 gene ttdA 26687 25788 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_03050 27975 26710 gene locus_tag LOCUS_03060 27975 26710 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433394.1 protein_id gnl|my_center|LOCUS_03060 28157 28804 gene locus_tag LOCUS_03070 28157 28804 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703621.1 protein_id gnl|my_center|LOCUS_03070 28841 32047 gene locus_tag LOCUS_03080 28841 32047 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_03080 32636 32292 gene locus_tag LOCUS_03090 32636 32292 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_03090 33901 32636 gene locus_tag LOCUS_03100 33901 32636 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016211.1 protein_id gnl|my_center|LOCUS_03100 35344 33914 gene locus_tag LOCUS_03110 35344 33914 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895612.1 protein_id gnl|my_center|LOCUS_03110 36026 35493 gene locus_tag LOCUS_03120 36026 35493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895614.1 protein_id gnl|my_center|LOCUS_03120 36701 36045 gene locus_tag LOCUS_03130 36701 36045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895614.1 protein_id gnl|my_center|LOCUS_03130 37375 36725 gene locus_tag LOCUS_03140 37375 36725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895614.1 protein_id gnl|my_center|LOCUS_03140 37951 37385 gene locus_tag LOCUS_03150 37951 37385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895614.1 protein_id gnl|my_center|LOCUS_03150 38491 37973 gene locus_tag LOCUS_03160 38491 37973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895614.1 protein_id gnl|my_center|LOCUS_03160 39856 38549 gene locus_tag LOCUS_03170 39856 38549 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627682.1 protein_id gnl|my_center|LOCUS_03170 40018 40671 gene locus_tag LOCUS_03180 40018 40671 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902690.1 protein_id gnl|my_center|LOCUS_03180 40860 41471 gene locus_tag LOCUS_03190 40860 41471 CDS product redoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902689.1 protein_id gnl|my_center|LOCUS_03190 41540 42424 gene locus_tag LOCUS_03200 gene msrB 41540 42424 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842789.1 protein_id gnl|my_center|LOCUS_03200 42455 43243 gene locus_tag LOCUS_03210 42455 43243 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_03210 43227 44885 gene locus_tag LOCUS_03220 43227 44885 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_03220 45654 44974 gene locus_tag LOCUS_03230 45654 44974 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017017.1 protein_id gnl|my_center|LOCUS_03230 47037 45715 gene locus_tag LOCUS_03240 47037 45715 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627867.1 protein_id gnl|my_center|LOCUS_03240 47242 48588 gene locus_tag LOCUS_03250 47242 48588 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902205.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence07 133 300 gene locus_tag LOCUS_03260 133 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 927 460 gene locus_tag LOCUS_03270 927 460 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367229.1 protein_id gnl|my_center|LOCUS_03270 2137 953 gene locus_tag LOCUS_03280 gene dnaJ 2137 953 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016154.1 protein_id gnl|my_center|LOCUS_03280 2698 2186 gene locus_tag LOCUS_03290 2698 2186 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903875.1 protein_id gnl|my_center|LOCUS_03290 3652 2801 gene locus_tag LOCUS_03300 3652 2801 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547285.1 protein_id gnl|my_center|LOCUS_03300 5557 3725 gene locus_tag LOCUS_03310 gene dnaK 5557 3725 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016153.1 protein_id gnl|my_center|LOCUS_03310 6200 5589 gene locus_tag LOCUS_03320 gene grpE 6200 5589 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016151.1 protein_id gnl|my_center|LOCUS_03320 7233 6211 gene locus_tag LOCUS_03330 gene hrcA 7233 6211 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480919.1 protein_id gnl|my_center|LOCUS_03330 7779 7450 gene locus_tag LOCUS_03340 7779 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 9504 7936 gene locus_tag LOCUS_03350 gene rny 9504 7936 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627077.1 protein_id gnl|my_center|LOCUS_03350 9877 9530 gene locus_tag LOCUS_03360 9877 9530 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903963.1 protein_id gnl|my_center|LOCUS_03360 10288 9878 gene locus_tag LOCUS_03370 10288 9878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894582.1 protein_id gnl|my_center|LOCUS_03370 10685 10293 gene locus_tag LOCUS_03380 10685 10293 CDS product membrane lipoprotein lipid attachment site-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490892.1 protein_id gnl|my_center|LOCUS_03380 11643 10732 gene locus_tag LOCUS_03390 gene miaA 11643 10732 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903969.1 protein_id gnl|my_center|LOCUS_03390 12913 11627 gene locus_tag LOCUS_03400 gene obgE 12913 11627 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015918.1 protein_id gnl|my_center|LOCUS_03400 14038 13289 gene locus_tag LOCUS_03410 14038 13289 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_03410 14183 14872 gene locus_tag LOCUS_03420 14183 14872 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_03420 15971 14940 gene locus_tag LOCUS_03430 gene mnmA 15971 14940 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627079.1 protein_id gnl|my_center|LOCUS_03430 16675 15971 gene locus_tag LOCUS_03440 16675 15971 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 protein_id gnl|my_center|LOCUS_03440 17949 16672 gene locus_tag LOCUS_03450 17949 16672 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903982.1 protein_id gnl|my_center|LOCUS_03450 19156 17981 gene locus_tag LOCUS_03460 19156 17981 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903983.1 protein_id gnl|my_center|LOCUS_03460 20206 19271 gene locus_tag LOCUS_03470 20206 19271 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903984.1 protein_id gnl|my_center|LOCUS_03470 22833 20296 gene locus_tag LOCUS_03480 22833 20296 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015924.1 protein_id gnl|my_center|LOCUS_03480 23399 22845 gene locus_tag LOCUS_03490 23399 22845 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 protein_id gnl|my_center|LOCUS_03490 24614 23406 gene locus_tag LOCUS_03500 24614 23406 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015925.1 protein_id gnl|my_center|LOCUS_03500 25145 24630 gene locus_tag LOCUS_03510 25145 24630 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015926.1 protein_id gnl|my_center|LOCUS_03510 27307 25145 gene locus_tag LOCUS_03520 27307 25145 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015927.1 protein_id gnl|my_center|LOCUS_03520 27921 27304 gene locus_tag LOCUS_03530 gene coaE 27921 27304 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_03530 28838 28047 gene locus_tag LOCUS_03540 28838 28047 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681676.1 protein_id gnl|my_center|LOCUS_03540 29322 28855 gene locus_tag LOCUS_03550 29322 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903999.1 protein_id gnl|my_center|LOCUS_03550 30428 29394 gene locus_tag LOCUS_03560 30428 29394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894678.1 protein_id gnl|my_center|LOCUS_03560 31863 30508 gene locus_tag LOCUS_03570 31863 30508 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015935.1 protein_id gnl|my_center|LOCUS_03570 32266 34842 gene locus_tag LOCUS_03580 gene clpB 32266 34842 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627102.1 protein_id gnl|my_center|LOCUS_03580 35467 34949 gene locus_tag LOCUS_03590 35467 34949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903371.1 protein_id gnl|my_center|LOCUS_03590 35635 35498 gene locus_tag LOCUS_03600 35635 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 36511 35732 gene locus_tag LOCUS_03610 36511 35732 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_03610 36832 36590 gene locus_tag LOCUS_03620 36832 36590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666892.1 protein_id gnl|my_center|LOCUS_03620 38190 37243 gene locus_tag LOCUS_03630 38190 37243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 38896 38207 gene locus_tag LOCUS_03640 38896 38207 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904004.1 protein_id gnl|my_center|LOCUS_03640 39126 40763 gene locus_tag LOCUS_03650 39126 40763 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904005.1 protein_id gnl|my_center|LOCUS_03650 40889 42223 gene locus_tag LOCUS_03660 40889 42223 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_03660 43860 42415 gene locus_tag LOCUS_03670 43860 42415 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868884.1 protein_id gnl|my_center|LOCUS_03670 44613 43888 gene locus_tag LOCUS_03680 44613 43888 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_03680 46258 44714 gene locus_tag LOCUS_03690 46258 44714 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_03690 47377 46529 gene locus_tag LOCUS_03700 47377 46529 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424273.1 protein_id gnl|my_center|LOCUS_03700 47731 47625 gene locus_tag LOCUS_r00020 47731 47625 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence08 1001 189 gene locus_tag LOCUS_03710 1001 189 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903764.1 protein_id gnl|my_center|LOCUS_03710 1784 1134 gene locus_tag LOCUS_03720 1784 1134 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492453.1 protein_id gnl|my_center|LOCUS_03720 1874 2470 gene locus_tag LOCUS_03730 1874 2470 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626307.1 protein_id gnl|my_center|LOCUS_03730 2557 3921 gene locus_tag LOCUS_03740 2557 3921 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_03740 4876 3995 gene locus_tag LOCUS_03750 4876 3995 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779466.1 protein_id gnl|my_center|LOCUS_03750 4996 5697 gene locus_tag LOCUS_03760 4996 5697 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900142.1 protein_id gnl|my_center|LOCUS_03760 5709 6944 gene locus_tag LOCUS_03770 5709 6944 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016834.1 protein_id gnl|my_center|LOCUS_03770 6937 7734 gene locus_tag LOCUS_03780 6937 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016833.1 protein_id gnl|my_center|LOCUS_03780 7757 9604 gene locus_tag LOCUS_03790 gene hprK 7757 9604 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901728.1 protein_id gnl|my_center|LOCUS_03790 9618 10583 gene locus_tag LOCUS_03800 9618 10583 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_03800 10670 10966 gene locus_tag LOCUS_03810 10670 10966 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901725.1 protein_id gnl|my_center|LOCUS_03810 11135 12103 gene locus_tag LOCUS_03820 11135 12103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12553 12717 gene locus_tag LOCUS_03830 12553 12717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03830 12736 13011 gene locus_tag LOCUS_03840 12736 13011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03840 13081 13641 gene locus_tag LOCUS_03850 13081 13641 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_03850 13673 14125 gene locus_tag LOCUS_03860 13673 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 15616 14177 gene locus_tag LOCUS_03870 15616 14177 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108360.1 protein_id gnl|my_center|LOCUS_03870 17016 15637 gene locus_tag LOCUS_03880 17016 15637 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230584.1 protein_id gnl|my_center|LOCUS_03880 17853 17287 gene locus_tag LOCUS_03890 17853 17287 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016825.1 protein_id gnl|my_center|LOCUS_03890 19323 17872 gene locus_tag LOCUS_03900 19323 17872 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779465.1 protein_id gnl|my_center|LOCUS_03900 20757 19408 gene locus_tag LOCUS_03910 gene bioA 20757 19408 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896848.1 protein_id gnl|my_center|LOCUS_03910 21715 21056 gene locus_tag LOCUS_03920 gene bioD 21715 21056 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016822.1 protein_id gnl|my_center|LOCUS_03920 22787 21705 gene locus_tag LOCUS_03930 gene bioB 22787 21705 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016821.1 protein_id gnl|my_center|LOCUS_03930 23998 22964 gene locus_tag LOCUS_03940 23998 22964 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842698.1 protein_id gnl|my_center|LOCUS_03940 25545 24037 gene locus_tag LOCUS_03950 25545 24037 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016819.1 protein_id gnl|my_center|LOCUS_03950 25794 26444 gene locus_tag LOCUS_03960 25794 26444 CDS product viroplasmin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016818.1 protein_id gnl|my_center|LOCUS_03960 26456 27154 gene locus_tag LOCUS_03970 26456 27154 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016817.1 protein_id gnl|my_center|LOCUS_03970 27555 27253 gene locus_tag LOCUS_03980 27555 27253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016680.1 protein_id gnl|my_center|LOCUS_03980 28134 27604 gene locus_tag LOCUS_03990 28134 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 28929 28243 gene locus_tag LOCUS_04000 28929 28243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 29767 28952 gene locus_tag LOCUS_04010 29767 28952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 29932 33684 gene locus_tag LOCUS_04020 gene brxC 29932 33684 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065383.1 protein_id gnl|my_center|LOCUS_04020 33963 35075 gene locus_tag LOCUS_04030 33963 35075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 35400 35777 gene locus_tag LOCUS_04040 35400 35777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 35802 39419 gene locus_tag LOCUS_04050 gene pglX 35802 39419 CDS product BREX-1 system adenine-specific DNA-methyltransferase PglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939304.1 protein_id gnl|my_center|LOCUS_04050 39425 40627 gene locus_tag LOCUS_04060 39425 40627 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_04060 40627 44856 gene locus_tag LOCUS_04070 40627 44856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 45028 45306 gene locus_tag LOCUS_04080 45028 45306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 45260 45646 gene locus_tag LOCUS_04090 45260 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04090 45666 45824 gene locus_tag LOCUS_04100 45666 45824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence09 447 917 gene locus_tag LOCUS_04110 447 917 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627048.1 protein_id gnl|my_center|LOCUS_04110 1707 901 gene locus_tag LOCUS_04120 1707 901 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893097.1 protein_id gnl|my_center|LOCUS_04120 1806 2711 gene locus_tag LOCUS_04130 1806 2711 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705118.1 protein_id gnl|my_center|LOCUS_04130 3044 2898 gene locus_tag LOCUS_04140 3044 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3268 3924 gene locus_tag LOCUS_04150 3268 3924 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902260.1 protein_id gnl|my_center|LOCUS_04150 5233 3980 gene locus_tag LOCUS_04160 5233 3980 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897188.1 protein_id gnl|my_center|LOCUS_04160 6715 5408 gene locus_tag LOCUS_04170 6715 5408 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904082.1 protein_id gnl|my_center|LOCUS_04170 7333 6749 gene locus_tag LOCUS_04180 gene rsxA 7333 6749 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_04180 7947 7330 gene locus_tag LOCUS_04190 7947 7330 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904084.1 protein_id gnl|my_center|LOCUS_04190 8480 7947 gene locus_tag LOCUS_04200 8480 7947 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015690.1 protein_id gnl|my_center|LOCUS_04200 9414 8470 gene locus_tag LOCUS_04210 9414 8470 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_04210 10747 9440 gene locus_tag LOCUS_04220 gene rsxC 10747 9440 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480691.1 protein_id gnl|my_center|LOCUS_04220 11397 10822 gene locus_tag LOCUS_04230 gene pth 11397 10822 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015693.1 protein_id gnl|my_center|LOCUS_04230 12278 11541 gene locus_tag LOCUS_04240 gene truA 12278 11541 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627073.1 protein_id gnl|my_center|LOCUS_04240 13586 12510 gene locus_tag LOCUS_04250 13586 12510 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015697.1 protein_id gnl|my_center|LOCUS_04250 13958 13701 gene locus_tag LOCUS_04260 13958 13701 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_04260 14215 13958 gene locus_tag LOCUS_04270 14215 13958 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388479.1 protein_id gnl|my_center|LOCUS_04270 15411 14335 gene locus_tag LOCUS_04280 gene glpQ 15411 14335 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015912.1 protein_id gnl|my_center|LOCUS_04280 16446 15442 gene locus_tag LOCUS_04290 gene lpxD 16446 15442 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903952.1 protein_id gnl|my_center|LOCUS_04290 16944 16471 gene locus_tag LOCUS_04300 16944 16471 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903954.1 protein_id gnl|my_center|LOCUS_04300 19079 16986 gene locus_tag LOCUS_04310 19079 16986 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 protein_id gnl|my_center|LOCUS_04310 23623 19151 gene locus_tag LOCUS_04320 23623 19151 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627076.1 protein_id gnl|my_center|LOCUS_04320 23877 24449 gene locus_tag LOCUS_04330 23877 24449 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015783.1 protein_id gnl|my_center|LOCUS_04330 24531 26621 gene locus_tag LOCUS_04340 gene ligA 24531 26621 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015784.1 protein_id gnl|my_center|LOCUS_04340 26679 29315 gene locus_tag LOCUS_04350 gene secA 26679 29315 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015785.1 protein_id gnl|my_center|LOCUS_04350 29328 30074 gene locus_tag LOCUS_04360 29328 30074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627473.1 protein_id gnl|my_center|LOCUS_04360 30411 31676 gene locus_tag LOCUS_04370 gene serS 30411 31676 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016148.1 protein_id gnl|my_center|LOCUS_04370 31660 32136 gene locus_tag LOCUS_04380 31660 32136 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016147.1 protein_id gnl|my_center|LOCUS_04380 33231 32227 gene locus_tag LOCUS_04390 33231 32227 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897696.1 protein_id gnl|my_center|LOCUS_04390 34777 33329 gene locus_tag LOCUS_04400 gene putP 34777 33329 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016145.1 protein_id gnl|my_center|LOCUS_04400 35467 36228 gene locus_tag LOCUS_04410 35467 36228 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261879.1 protein_id gnl|my_center|LOCUS_04410 36944 36519 gene locus_tag LOCUS_04420 36944 36519 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903884.1 protein_id gnl|my_center|LOCUS_04420 37921 37058 gene locus_tag LOCUS_04430 gene hchA 37921 37058 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207522.1 protein_id gnl|my_center|LOCUS_04430 38507 37944 gene locus_tag LOCUS_04440 38507 37944 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_04440 38715 39377 gene locus_tag LOCUS_04450 38715 39377 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233023.1 protein_id gnl|my_center|LOCUS_04450 39931 39611 gene locus_tag LOCUS_04460 39931 39611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 40965 39931 gene locus_tag LOCUS_04470 40965 39931 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 protein_id gnl|my_center|LOCUS_04470 43225 40958 gene locus_tag LOCUS_04480 43225 40958 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016141.1 protein_id gnl|my_center|LOCUS_04480 43428 43225 gene locus_tag LOCUS_04490 43428 43225 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016140.1 protein_id gnl|my_center|LOCUS_04490 43822 44499 gene locus_tag LOCUS_04500 43822 44499 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918869.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence10 628 320 gene locus_tag LOCUS_04510 628 320 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901839.1 protein_id gnl|my_center|LOCUS_04510 2064 772 gene locus_tag LOCUS_04520 2064 772 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896779.1 protein_id gnl|my_center|LOCUS_04520 2949 2080 gene locus_tag LOCUS_04530 2949 2080 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016843.1 protein_id gnl|my_center|LOCUS_04530 4049 2949 gene locus_tag LOCUS_04540 gene rodA 4049 2949 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 protein_id gnl|my_center|LOCUS_04540 4509 4069 gene locus_tag LOCUS_04550 gene dut 4509 4069 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_04550 5737 4511 gene locus_tag LOCUS_04560 5737 4511 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016846.1 protein_id gnl|my_center|LOCUS_04560 6849 5758 gene locus_tag LOCUS_04570 6849 5758 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016847.1 protein_id gnl|my_center|LOCUS_04570 7928 6849 gene locus_tag LOCUS_04580 7928 6849 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901847.1 protein_id gnl|my_center|LOCUS_04580 8476 7937 gene locus_tag LOCUS_04590 8476 7937 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901848.1 protein_id gnl|my_center|LOCUS_04590 9673 8492 gene locus_tag LOCUS_04600 9673 8492 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016848.1 protein_id gnl|my_center|LOCUS_04600 9848 10444 gene locus_tag LOCUS_04610 9848 10444 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896761.1 protein_id gnl|my_center|LOCUS_04610 10446 10925 gene locus_tag LOCUS_04620 10446 10925 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016850.1 protein_id gnl|my_center|LOCUS_04620 10938 11567 gene locus_tag LOCUS_04630 10938 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494780.1 protein_id gnl|my_center|LOCUS_04630 11656 12564 gene locus_tag LOCUS_04640 11656 12564 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896738.1 protein_id gnl|my_center|LOCUS_04640 12629 13333 gene locus_tag LOCUS_04650 12629 13333 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795197.1 protein_id gnl|my_center|LOCUS_04650 13326 13649 gene locus_tag LOCUS_04660 13326 13649 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016854.1 protein_id gnl|my_center|LOCUS_04660 13925 15103 gene locus_tag LOCUS_04670 13925 15103 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016855.1 protein_id gnl|my_center|LOCUS_04670 15391 16962 gene locus_tag LOCUS_04680 15391 16962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 16977 17822 gene locus_tag LOCUS_04690 16977 17822 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016856.1 protein_id gnl|my_center|LOCUS_04690 17831 18352 gene locus_tag LOCUS_04700 17831 18352 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016056.1 protein_id gnl|my_center|LOCUS_04700 18792 18454 gene locus_tag LOCUS_04710 18792 18454 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_04710 18918 19721 gene locus_tag LOCUS_04720 18918 19721 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263207.1 protein_id gnl|my_center|LOCUS_04720 19766 20515 gene locus_tag LOCUS_04730 19766 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 20668 22137 gene locus_tag LOCUS_04740 20668 22137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209759.1 protein_id gnl|my_center|LOCUS_04740 22890 22162 gene locus_tag LOCUS_04750 22890 22162 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016858.1 protein_id gnl|my_center|LOCUS_04750 23696 22887 gene locus_tag LOCUS_04760 23696 22887 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016859.1 protein_id gnl|my_center|LOCUS_04760 24036 23860 gene locus_tag LOCUS_04770 24036 23860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 24291 24106 gene locus_tag LOCUS_04780 24291 24106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 24269 24823 gene locus_tag LOCUS_04790 24269 24823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 24842 25612 gene locus_tag LOCUS_04800 24842 25612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626226.1 protein_id gnl|my_center|LOCUS_04800 25631 26734 gene locus_tag LOCUS_04810 25631 26734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016862.1 protein_id gnl|my_center|LOCUS_04810 27224 29443 gene locus_tag LOCUS_04820 27224 29443 CDS product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897873.1 protein_id gnl|my_center|LOCUS_04820 29590 29973 gene locus_tag LOCUS_04830 29590 29973 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_04830 29992 30720 gene locus_tag LOCUS_04840 29992 30720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016865.1 protein_id gnl|my_center|LOCUS_04840 30739 31218 gene locus_tag LOCUS_04850 30739 31218 CDS product DUF3601 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016866.1 protein_id gnl|my_center|LOCUS_04850 31235 31729 gene locus_tag LOCUS_04860 31235 31729 CDS product DUF3601 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016867.1 protein_id gnl|my_center|LOCUS_04860 31726 32112 gene locus_tag LOCUS_04870 31726 32112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016868.1 protein_id gnl|my_center|LOCUS_04870 32090 33103 gene locus_tag LOCUS_04880 32090 33103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 34242 33235 gene locus_tag LOCUS_04890 34242 33235 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_04890 34437 34760 gene locus_tag LOCUS_04900 34437 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681645.1 protein_id gnl|my_center|LOCUS_04900 36194 34902 gene locus_tag LOCUS_04910 36194 34902 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_04910 36436 37197 gene locus_tag LOCUS_04920 36436 37197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901876.1 protein_id gnl|my_center|LOCUS_04920 37460 38752 gene locus_tag LOCUS_04930 gene brnQ 37460 38752 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016870.1 protein_id gnl|my_center|LOCUS_04930 39537 38773 gene locus_tag LOCUS_04940 39537 38773 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901878.1 protein_id gnl|my_center|LOCUS_04940 40215 39664 gene locus_tag LOCUS_04950 40215 39664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016871.1 protein_id gnl|my_center|LOCUS_04950 41031 40249 gene locus_tag LOCUS_04960 41031 40249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016872.1 protein_id gnl|my_center|LOCUS_04960 41227 42411 gene locus_tag LOCUS_04970 41227 42411 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_04970 42429 43190 gene locus_tag LOCUS_04980 42429 43190 CDS product DUF3100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016874.1 protein_id gnl|my_center|LOCUS_04980 43192 43638 gene locus_tag LOCUS_04990 43192 43638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492212.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence11 1731 325 gene locus_tag LOCUS_05000 1731 325 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682077.1 protein_id gnl|my_center|LOCUS_05000 2938 1754 gene locus_tag LOCUS_05010 2938 1754 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682078.1 protein_id gnl|my_center|LOCUS_05010 4300 2963 gene locus_tag LOCUS_05020 4300 2963 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626527.1 protein_id gnl|my_center|LOCUS_05020 5518 4325 gene locus_tag LOCUS_05030 5518 4325 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_05030 5749 6465 gene locus_tag LOCUS_05040 5749 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 6475 6852 gene locus_tag LOCUS_05050 6475 6852 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459154.1 protein_id gnl|my_center|LOCUS_05050 6957 7247 gene locus_tag LOCUS_05060 6957 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272212.1 protein_id gnl|my_center|LOCUS_05060 8421 7306 gene locus_tag LOCUS_05070 8421 7306 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_05070 12838 8411 gene locus_tag LOCUS_05080 12838 8411 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626303.1 protein_id gnl|my_center|LOCUS_05080 13653 12907 gene locus_tag LOCUS_05090 gene cobK 13653 12907 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915112.1 protein_id gnl|my_center|LOCUS_05090 14416 13667 gene locus_tag LOCUS_05100 gene cobJ 14416 13667 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_05100 15419 14409 gene locus_tag LOCUS_05110 gene cbiG 15419 14409 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016779.1 protein_id gnl|my_center|LOCUS_05110 16163 15432 gene locus_tag LOCUS_05120 16163 15432 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016780.1 protein_id gnl|my_center|LOCUS_05120 17448 16201 gene locus_tag LOCUS_05130 17448 16201 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016781.1 protein_id gnl|my_center|LOCUS_05130 18239 17538 gene locus_tag LOCUS_05140 18239 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 18779 18240 gene locus_tag LOCUS_05150 18779 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 20058 18805 gene locus_tag LOCUS_05160 20058 18805 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_05160 20911 20153 gene locus_tag LOCUS_05170 gene cobM 20911 20153 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_05170 21612 20890 gene locus_tag LOCUS_05180 gene cobI 21612 20890 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626293.1 protein_id gnl|my_center|LOCUS_05180 22186 21638 gene locus_tag LOCUS_05190 22186 21638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005972821.1 protein_id gnl|my_center|LOCUS_05190 22684 22220 gene locus_tag LOCUS_05200 22684 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016788.1 protein_id gnl|my_center|LOCUS_05200 23576 22725 gene locus_tag LOCUS_05210 23576 22725 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016730.1 protein_id gnl|my_center|LOCUS_05210 24097 23603 gene locus_tag LOCUS_05220 24097 23603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896930.1 protein_id gnl|my_center|LOCUS_05220 25345 24107 gene locus_tag LOCUS_05230 25345 24107 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_05230 26158 25589 gene locus_tag LOCUS_05240 gene cbiT 26158 25589 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901667.1 protein_id gnl|my_center|LOCUS_05240 27146 26181 gene locus_tag LOCUS_05250 27146 26181 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901670.1 protein_id gnl|my_center|LOCUS_05250 27822 27133 gene locus_tag LOCUS_05260 gene cbiE 27822 27133 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016791.1 protein_id gnl|my_center|LOCUS_05260 28903 27776 gene locus_tag LOCUS_05270 gene cbiD 28903 27776 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016792.1 protein_id gnl|my_center|LOCUS_05270 29601 28951 gene locus_tag LOCUS_05280 29601 28951 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626283.1 protein_id gnl|my_center|LOCUS_05280 29849 29625 gene locus_tag LOCUS_05290 29849 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05290 31251 29917 gene locus_tag LOCUS_05300 31251 29917 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901682.1 protein_id gnl|my_center|LOCUS_05300 32346 31267 gene locus_tag LOCUS_05310 32346 31267 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 protein_id gnl|my_center|LOCUS_05310 33314 32343 gene locus_tag LOCUS_05320 gene cbiB 33314 32343 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491348.1 protein_id gnl|my_center|LOCUS_05320 34304 33390 gene locus_tag LOCUS_05330 34304 33390 CDS product DUF4299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016798.1 protein_id gnl|my_center|LOCUS_05330 35818 34328 gene locus_tag LOCUS_05340 35818 34328 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016799.1 protein_id gnl|my_center|LOCUS_05340 36091 37305 gene locus_tag LOCUS_05350 gene xseA 36091 37305 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902942.1 protein_id gnl|my_center|LOCUS_05350 37286 38065 gene locus_tag LOCUS_05360 37286 38065 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367128.1 protein_id gnl|my_center|LOCUS_05360 38090 38944 gene locus_tag LOCUS_05370 gene dprA 38090 38944 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795245.1 protein_id gnl|my_center|LOCUS_05370 39008 42826 gene locus_tag LOCUS_05380 39008 42826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 42844 44106 gene locus_tag LOCUS_05390 gene dcm 42844 44106 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183205.1 protein_id gnl|my_center|LOCUS_05390 44225 45529 gene locus_tag LOCUS_05400 gene trmFO 44225 45529 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016878.1 protein_id gnl|my_center|LOCUS_05400 45536 46408 gene locus_tag LOCUS_05410 45536 46408 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016879.1 protein_id gnl|my_center|LOCUS_05410 46405 47505 gene locus_tag LOCUS_05420 gene yqeH 46405 47505 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016880.1 protein_id gnl|my_center|LOCUS_05420 47507 48013 gene locus_tag LOCUS_05430 47507 48013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902935.1 protein_id gnl|my_center|LOCUS_05430 48033 49067 gene locus_tag LOCUS_05440 gene ftsY 48033 49067 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016881.1 protein_id gnl|my_center|LOCUS_05440 49182 49829 gene locus_tag LOCUS_05450 49182 49829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902933.1 protein_id gnl|my_center|LOCUS_05450 49844 50737 gene locus_tag LOCUS_05460 49844 50737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016882.1 protein_id gnl|my_center|LOCUS_05460 51219 50968 gene locus_tag LOCUS_05470 51219 50968 CDS product glutaredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016883.1 protein_id gnl|my_center|LOCUS_05470 51410 51955 gene locus_tag LOCUS_05480 51410 51955 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902930.1 protein_id gnl|my_center|LOCUS_05480 52205 52639 gene locus_tag LOCUS_05490 52205 52639 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902929.1 protein_id gnl|my_center|LOCUS_05490 52772 53425 gene locus_tag LOCUS_05500 52772 53425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 53557 55251 gene locus_tag LOCUS_05510 53557 55251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016884.1 protein_id gnl|my_center|LOCUS_05510 55682 55473 gene locus_tag LOCUS_05520 55682 55473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902920.1 protein_id gnl|my_center|LOCUS_05520 57500 55809 gene locus_tag LOCUS_05530 gene ggt 57500 55809 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_05530 57717 57992 gene locus_tag LOCUS_05540 57717 57992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902918.1 protein_id gnl|my_center|LOCUS_05540 57989 58585 gene locus_tag LOCUS_05550 57989 58585 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902916.1 protein_id gnl|my_center|LOCUS_05550 58697 58945 gene locus_tag LOCUS_05560 58697 58945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492198.1 protein_id gnl|my_center|LOCUS_05560 59008 59562 gene locus_tag LOCUS_05570 59008 59562 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902912.1 protein_id gnl|my_center|LOCUS_05570 59749 61098 gene locus_tag LOCUS_05580 59749 61098 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016888.1 protein_id gnl|my_center|LOCUS_05580 61125 61997 gene locus_tag LOCUS_05590 gene rapZ 61125 61997 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016889.1 protein_id gnl|my_center|LOCUS_05590 61984 63753 gene locus_tag LOCUS_05600 gene uvrC 61984 63753 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902903.1 protein_id gnl|my_center|LOCUS_05600 63819 65342 gene locus_tag LOCUS_05610 63819 65342 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896598.1 protein_id gnl|my_center|LOCUS_05610 65357 66265 gene locus_tag LOCUS_05620 65357 66265 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480077.1 protein_id gnl|my_center|LOCUS_05620 66302 66730 gene locus_tag LOCUS_05630 66302 66730 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016892.1 protein_id gnl|my_center|LOCUS_05630 67642 66806 gene locus_tag LOCUS_05640 67642 66806 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989683.1 protein_id gnl|my_center|LOCUS_05640 69804 67663 gene locus_tag LOCUS_05650 69804 67663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 69985 71967 gene locus_tag LOCUS_05660 69985 71967 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 protein_id gnl|my_center|LOCUS_05660 72198 74018 gene locus_tag LOCUS_05670 72198 74018 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 protein_id gnl|my_center|LOCUS_05670 74037 74504 gene locus_tag LOCUS_05680 74037 74504 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016919.1 protein_id gnl|my_center|LOCUS_05680 74515 75066 gene locus_tag LOCUS_05690 74515 75066 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016918.1 protein_id gnl|my_center|LOCUS_05690 75758 75210 gene locus_tag LOCUS_05700 75758 75210 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896526.1 protein_id gnl|my_center|LOCUS_05700 75955 78441 gene locus_tag LOCUS_05710 75955 78441 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626185.1 protein_id gnl|my_center|LOCUS_05710 78683 80194 gene locus_tag LOCUS_05720 78683 80194 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902867.1 protein_id gnl|my_center|LOCUS_05720 81911 80328 gene locus_tag LOCUS_05730 gene pckA 81911 80328 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626187.1 protein_id gnl|my_center|LOCUS_05730 82569 82285 gene locus_tag LOCUS_05740 gene rpmA 82569 82285 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 protein_id gnl|my_center|LOCUS_05740 82899 82570 gene locus_tag LOCUS_05750 82899 82570 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_05750 83217 82903 gene locus_tag LOCUS_05760 gene rplU 83217 82903 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 protein_id gnl|my_center|LOCUS_05760 84046 83327 gene locus_tag LOCUS_05770 84046 83327 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016912.1 protein_id gnl|my_center|LOCUS_05770 84445 84065 gene locus_tag LOCUS_05780 84445 84065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 85238 84447 gene locus_tag LOCUS_05790 85238 84447 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626191.1 protein_id gnl|my_center|LOCUS_05790 85928 85371 gene locus_tag LOCUS_05800 85928 85371 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494746.1 protein_id gnl|my_center|LOCUS_05800 86124 87062 gene locus_tag LOCUS_05810 86124 87062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_05810 87062 87874 gene locus_tag LOCUS_05820 87062 87874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016908.1 protein_id gnl|my_center|LOCUS_05820 87911 89473 gene locus_tag LOCUS_05830 87911 89473 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626195.1 protein_id gnl|my_center|LOCUS_05830 89486 90265 gene locus_tag LOCUS_05840 89486 90265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_05840 90282 91043 gene locus_tag LOCUS_05850 90282 91043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016905.1 protein_id gnl|my_center|LOCUS_05850 92309 91083 gene locus_tag LOCUS_05860 92309 91083 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902886.1 protein_id gnl|my_center|LOCUS_05860 92830 92333 gene locus_tag LOCUS_05870 92830 92333 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016902.1 protein_id gnl|my_center|LOCUS_05870 93419 92835 gene locus_tag LOCUS_05880 gene ruvA 93419 92835 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902889.1 protein_id gnl|my_center|LOCUS_05880 96257 93423 gene locus_tag LOCUS_05890 gene uvrA 96257 93423 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626200.1 protein_id gnl|my_center|LOCUS_05890 96885 96346 gene locus_tag LOCUS_05900 96885 96346 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016900.1 protein_id gnl|my_center|LOCUS_05900 97474 98556 gene locus_tag LOCUS_05910 97474 98556 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_05910 98577 100952 gene locus_tag LOCUS_05920 98577 100952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 101102 104653 gene locus_tag LOCUS_05930 gene smc 101102 104653 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373219.1 protein_id gnl|my_center|LOCUS_05930 104681 105685 gene locus_tag LOCUS_05940 gene lpxK 104681 105685 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_05940 105691 106458 gene locus_tag LOCUS_05950 105691 106458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016924.1 protein_id gnl|my_center|LOCUS_05950 106455 107036 gene locus_tag LOCUS_05960 gene nadD 106455 107036 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016925.1 protein_id gnl|my_center|LOCUS_05960 108537 107377 gene locus_tag LOCUS_05970 gene nagA 108537 107377 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902854.1 protein_id gnl|my_center|LOCUS_05970 108665 109120 gene locus_tag LOCUS_05980 108665 109120 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492147.1 protein_id gnl|my_center|LOCUS_05980 109262 110146 gene locus_tag LOCUS_05990 109262 110146 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_05990 110465 111208 gene locus_tag LOCUS_06000 gene phnC 110465 111208 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016928.1 protein_id gnl|my_center|LOCUS_06000 111174 112745 gene locus_tag LOCUS_06010 111174 112745 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881896.1 protein_id gnl|my_center|LOCUS_06010 112887 113309 gene locus_tag LOCUS_06020 112887 113309 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367139.1 protein_id gnl|my_center|LOCUS_06020 113745 116669 gene locus_tag LOCUS_06030 113745 116669 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_06030 116671 117888 gene locus_tag LOCUS_06040 116671 117888 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_06040 117900 118814 gene locus_tag LOCUS_06050 117900 118814 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016934.1 protein_id gnl|my_center|LOCUS_06050 118853 119677 gene locus_tag LOCUS_06060 gene nagB 118853 119677 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016935.1 protein_id gnl|my_center|LOCUS_06060 120605 119745 gene locus_tag LOCUS_06070 120605 119745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626164.1 protein_id gnl|my_center|LOCUS_06070 122360 120681 gene locus_tag LOCUS_06080 122360 120681 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016937.1 protein_id gnl|my_center|LOCUS_06080 122593 123600 gene locus_tag LOCUS_06090 gene opp2D 122593 123600 CDS product oligopeptide ABC transporter ATP-binding protein Opp2D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365359.1 protein_id gnl|my_center|LOCUS_06090 123597 124532 gene locus_tag LOCUS_06100 gene opp2F 123597 124532 CDS product oligopeptide ABC transporter ATP-binding protein Opp2F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354942.1 protein_id gnl|my_center|LOCUS_06100 124557 125519 gene locus_tag LOCUS_06110 gene opp2B 124557 125519 CDS product oligopeptide ABC transporter permease Opp2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354943.1 protein_id gnl|my_center|LOCUS_06110 125532 126434 gene locus_tag LOCUS_06120 gene opp2C 125532 126434 CDS product oligopeptide ABC transporter permease Opp2C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365358.1 protein_id gnl|my_center|LOCUS_06120 126458 128290 gene locus_tag LOCUS_06130 gene opp2A 126458 128290 CDS product oligopeptide ABC transporter substrate-binding protein Opp2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378964.1 protein_id gnl|my_center|LOCUS_06130 128323 130143 gene locus_tag LOCUS_06140 128323 130143 CDS product oligopeptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287894.1 protein_id gnl|my_center|LOCUS_06140 131611 130202 gene locus_tag LOCUS_06150 131611 130202 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017170.1 protein_id gnl|my_center|LOCUS_06150 131719 132561 gene locus_tag LOCUS_06160 gene pdxS 131719 132561 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902306.1 protein_id gnl|my_center|LOCUS_06160 133119 132628 gene locus_tag LOCUS_06170 133119 132628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 134421 133138 gene locus_tag LOCUS_06180 134421 133138 CDS product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902828.1 protein_id gnl|my_center|LOCUS_06180 134603 135775 gene locus_tag LOCUS_06190 134603 135775 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016940.1 protein_id gnl|my_center|LOCUS_06190 139331 136101 gene locus_tag LOCUS_06200 139331 136101 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016941.1 protein_id gnl|my_center|LOCUS_06200 142026 139318 gene locus_tag LOCUS_06210 142026 139318 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016942.1 protein_id gnl|my_center|LOCUS_06210 143384 142038 gene locus_tag LOCUS_06220 143384 142038 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_06220 143561 144751 gene locus_tag LOCUS_06230 143561 144751 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016944.1 protein_id gnl|my_center|LOCUS_06230 144770 145099 gene locus_tag LOCUS_06240 144770 145099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016945.1 protein_id gnl|my_center|LOCUS_06240 145115 146365 gene locus_tag LOCUS_06250 145115 146365 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480035.1 protein_id gnl|my_center|LOCUS_06250 146349 148520 gene locus_tag LOCUS_06260 146349 148520 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480034.1 protein_id gnl|my_center|LOCUS_06260 148536 150836 gene locus_tag LOCUS_06270 gene priA 148536 150836 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016948.1 protein_id gnl|my_center|LOCUS_06270 150846 151370 gene locus_tag LOCUS_06280 gene def 150846 151370 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 protein_id gnl|my_center|LOCUS_06280 151363 151674 gene locus_tag LOCUS_06290 151363 151674 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016950.1 protein_id gnl|my_center|LOCUS_06290 151671 152711 gene locus_tag LOCUS_06300 gene glpX 151671 152711 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016951.1 protein_id gnl|my_center|LOCUS_06300 152779 156039 gene locus_tag LOCUS_06310 152779 156039 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016952.1 protein_id gnl|my_center|LOCUS_06310 156274 156897 gene locus_tag LOCUS_06320 156274 156897 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016953.1 protein_id gnl|my_center|LOCUS_06320 156920 157849 gene locus_tag LOCUS_06330 156920 157849 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492176.1 protein_id gnl|my_center|LOCUS_06330 157853 159001 gene locus_tag LOCUS_06340 157853 159001 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_06340 159037 159984 gene locus_tag LOCUS_06350 159037 159984 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_06350 160181 160984 gene locus_tag LOCUS_06360 160181 160984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 161075 162577 gene locus_tag LOCUS_06370 gene mglA 161075 162577 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903113.1 protein_id gnl|my_center|LOCUS_06370 162598 163617 gene locus_tag LOCUS_06380 gene mglC 162598 163617 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016955.1 protein_id gnl|my_center|LOCUS_06380 163954 163667 gene locus_tag LOCUS_06390 163954 163667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 164802 164236 gene locus_tag LOCUS_06400 164802 164236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 165566 165691 gene locus_tag LOCUS_06410 165566 165691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 165713 166045 gene locus_tag LOCUS_06420 165713 166045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 166231 166698 gene locus_tag LOCUS_06430 166231 166698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 167002 168003 gene locus_tag LOCUS_06440 167002 168003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence12 869 510 gene locus_tag LOCUS_06450 869 510 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015938.1 protein_id gnl|my_center|LOCUS_06450 2267 879 gene locus_tag LOCUS_06460 2267 879 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015939.1 protein_id gnl|my_center|LOCUS_06460 5533 2483 gene locus_tag LOCUS_06470 5533 2483 CDS product autotransporter serine protease fusolisin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627120.1 protein_id gnl|my_center|LOCUS_06470 6274 5810 gene locus_tag LOCUS_06480 6274 5810 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901748.1 protein_id gnl|my_center|LOCUS_06480 6646 6392 gene locus_tag LOCUS_06490 6646 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901757.1 protein_id gnl|my_center|LOCUS_06490 7028 9438 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaaaacatttcatgtttaaggttaat 9899 9609 gene locus_tag LOCUS_06500 gene cas2 9899 9609 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082343.1 protein_id gnl|my_center|LOCUS_06500 10910 9912 gene locus_tag LOCUS_06510 gene cas1b 10910 9912 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_06510 11410 10922 gene locus_tag LOCUS_06520 gene cas4 11410 10922 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180703501.1 protein_id gnl|my_center|LOCUS_06520 13945 11420 gene locus_tag LOCUS_06530 13945 11420 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_06530 14841 14065 gene locus_tag LOCUS_06540 14841 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 15809 14844 gene locus_tag LOCUS_06550 15809 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 17584 15809 gene locus_tag LOCUS_06560 17584 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 18342 17599 gene locus_tag LOCUS_06570 18342 17599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 18649 18575 gene locus_tag LOCUS_t00010 18649 18575 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 18774 18691 gene locus_tag LOCUS_t00020 18774 18691 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18862 18787 gene locus_tag LOCUS_t00030 18862 18787 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18942 18867 gene locus_tag LOCUS_t00040 18942 18867 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 19038 18963 gene locus_tag LOCUS_t00050 19038 18963 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19122 19046 gene locus_tag LOCUS_t00060 19122 19046 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20219 19182 gene locus_tag LOCUS_06580 20219 19182 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901762.1 protein_id gnl|my_center|LOCUS_06580 21344 20391 gene locus_tag LOCUS_06590 21344 20391 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_06590 23228 21369 gene locus_tag LOCUS_06600 23228 21369 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932111.1 protein_id gnl|my_center|LOCUS_06600 24269 23238 gene locus_tag LOCUS_06610 24269 23238 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461434.1 protein_id gnl|my_center|LOCUS_06610 25308 24280 gene locus_tag LOCUS_06620 25308 24280 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496656.1 protein_id gnl|my_center|LOCUS_06620 29056 25298 gene locus_tag LOCUS_06630 gene cobN 29056 25298 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496657.1 protein_id gnl|my_center|LOCUS_06630 30168 29056 gene locus_tag LOCUS_06640 30168 29056 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932105.1 protein_id gnl|my_center|LOCUS_06640 30954 30181 gene locus_tag LOCUS_06650 30954 30181 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901765.1 protein_id gnl|my_center|LOCUS_06650 31976 30951 gene locus_tag LOCUS_06660 31976 30951 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901766.1 protein_id gnl|my_center|LOCUS_06660 32851 31979 gene locus_tag LOCUS_06670 32851 31979 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367304.1 protein_id gnl|my_center|LOCUS_06670 35244 33271 gene locus_tag LOCUS_06680 35244 33271 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015947.1 protein_id gnl|my_center|LOCUS_06680 35676 36380 gene locus_tag LOCUS_06690 35676 36380 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287585.1 protein_id gnl|my_center|LOCUS_06690 38203 36470 gene locus_tag LOCUS_06700 38203 36470 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 protein_id gnl|my_center|LOCUS_06700 39274 38246 gene locus_tag LOCUS_06710 39274 38246 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_06710 40257 39289 gene locus_tag LOCUS_06720 40257 39289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 41226 40276 gene locus_tag LOCUS_06730 41226 40276 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_06730 42017 41253 gene locus_tag LOCUS_06740 gene kduD 42017 41253 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482916.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence13 1359 175 gene locus_tag LOCUS_06750 gene tuf 1359 175 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 protein_id gnl|my_center|LOCUS_06750 3528 1447 gene locus_tag LOCUS_06760 gene fusA 3528 1447 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015672.1 protein_id gnl|my_center|LOCUS_06760 4042 3572 gene locus_tag LOCUS_06770 gene rpsG 4042 3572 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888149.1 protein_id gnl|my_center|LOCUS_06770 4437 4069 gene locus_tag LOCUS_06780 gene rpsL 4437 4069 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894529.1 protein_id gnl|my_center|LOCUS_06780 4610 5137 gene locus_tag LOCUS_06790 4610 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6329 5181 gene locus_tag LOCUS_06800 gene fucO 6329 5181 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_06800 7701 6352 gene locus_tag LOCUS_06810 7701 6352 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454077.1 protein_id gnl|my_center|LOCUS_06810 9050 7860 gene locus_tag LOCUS_06820 gene rhmD 9050 7860 CDS product L-rhamnonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427822.1 protein_id gnl|my_center|LOCUS_06820 9960 9064 gene locus_tag LOCUS_06830 gene yagE 9960 9064 CDS product 2-keto-3-deoxygluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095373.1 protein_id gnl|my_center|LOCUS_06830 10723 9977 gene locus_tag LOCUS_06840 10723 9977 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_06840 10920 12503 gene locus_tag LOCUS_06850 10920 12503 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_06850 13272 12736 gene locus_tag LOCUS_06860 13272 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796433.1 protein_id gnl|my_center|LOCUS_06860 14006 13278 gene locus_tag LOCUS_06870 gene pgeF 14006 13278 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015675.1 protein_id gnl|my_center|LOCUS_06870 15010 14006 gene locus_tag LOCUS_06880 gene aroF 15010 14006 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015676.1 protein_id gnl|my_center|LOCUS_06880 15286 15023 gene locus_tag LOCUS_06890 15286 15023 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015677.1 protein_id gnl|my_center|LOCUS_06890 15464 15388 gene locus_tag LOCUS_t00070 15464 15388 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15548 15473 gene locus_tag LOCUS_t00080 15548 15473 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15634 15559 gene locus_tag LOCUS_t00090 15634 15559 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15725 15642 gene locus_tag LOCUS_t00100 15725 15642 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15801 15727 gene locus_tag LOCUS_t00110 15801 15727 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15894 15817 gene locus_tag LOCUS_t00120 15894 15817 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15979 15903 gene locus_tag LOCUS_t00130 15979 15903 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16062 15987 gene locus_tag LOCUS_t00140 16062 15987 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16147 16072 gene locus_tag LOCUS_t00150 16147 16072 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16247 16171 gene locus_tag LOCUS_t00160 16247 16171 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16342 16255 gene locus_tag LOCUS_t00170 16342 16255 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16727 16425 gene locus_tag LOCUS_06900 16727 16425 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015678.1 protein_id gnl|my_center|LOCUS_06900 17608 16739 gene locus_tag LOCUS_06910 17608 16739 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015679.1 protein_id gnl|my_center|LOCUS_06910 18638 17610 gene locus_tag LOCUS_06920 18638 17610 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902246.1 protein_id gnl|my_center|LOCUS_06920 19035 18640 gene locus_tag LOCUS_06930 19035 18640 CDS product mini-ribonuclease 3-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902248.1 protein_id gnl|my_center|LOCUS_06930 20444 19023 gene locus_tag LOCUS_06940 gene cysS 20444 19023 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015680.1 protein_id gnl|my_center|LOCUS_06940 21158 20463 gene locus_tag LOCUS_06950 gene ispD 21158 20463 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015681.1 protein_id gnl|my_center|LOCUS_06950 23470 21134 gene locus_tag LOCUS_06960 23470 21134 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015682.1 protein_id gnl|my_center|LOCUS_06960 23867 25501 gene locus_tag LOCUS_06970 23867 25501 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_06970 26841 25597 gene locus_tag LOCUS_06980 gene gltS 26841 25597 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015836.1 protein_id gnl|my_center|LOCUS_06980 27843 27049 gene locus_tag LOCUS_06990 27843 27049 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903852.1 protein_id gnl|my_center|LOCUS_06990 28333 27914 gene locus_tag LOCUS_07000 28333 27914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897638.1 protein_id gnl|my_center|LOCUS_07000 29229 28351 gene locus_tag LOCUS_07010 29229 28351 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897640.1 protein_id gnl|my_center|LOCUS_07010 30124 29231 gene locus_tag LOCUS_07020 30124 29231 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_07020 31047 30358 gene locus_tag LOCUS_07030 31047 30358 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_07030 31957 31049 gene locus_tag LOCUS_07040 31957 31049 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903857.1 protein_id gnl|my_center|LOCUS_07040 32880 31972 gene locus_tag LOCUS_07050 32880 31972 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015843.1 protein_id gnl|my_center|LOCUS_07050 33378 32890 gene locus_tag LOCUS_07060 33378 32890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842716.1 protein_id gnl|my_center|LOCUS_07060 33905 33726 gene locus_tag LOCUS_07070 33905 33726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 34812 33961 gene locus_tag LOCUS_07080 34812 33961 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897665.1 protein_id gnl|my_center|LOCUS_07080 35753 35058 gene locus_tag LOCUS_07090 35753 35058 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016161.1 protein_id gnl|my_center|LOCUS_07090 36931 35753 gene locus_tag LOCUS_07100 36931 35753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897667.1 protein_id gnl|my_center|LOCUS_07100 37113 37988 gene locus_tag LOCUS_07110 37113 37988 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903868.1 protein_id gnl|my_center|LOCUS_07110 38038 38113 gene locus_tag LOCUS_t00180 38038 38113 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38116 38190 gene locus_tag LOCUS_t00190 38116 38190 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 38210 38294 gene locus_tag LOCUS_t00200 38210 38294 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 38856 38311 gene locus_tag LOCUS_07120 38856 38311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 39338 38853 gene locus_tag LOCUS_07130 39338 38853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 40713 39349 gene locus_tag LOCUS_07140 40713 39349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016159.1 protein_id gnl|my_center|LOCUS_07140 41008 41451 gene locus_tag LOCUS_07150 41008 41451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099990796.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence14 346 98 gene locus_tag LOCUS_07160 346 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015998.1 protein_id gnl|my_center|LOCUS_07160 780 364 gene locus_tag LOCUS_07170 780 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627200.1 protein_id gnl|my_center|LOCUS_07170 1505 819 gene locus_tag LOCUS_07180 1505 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016000.1 protein_id gnl|my_center|LOCUS_07180 1923 1519 gene locus_tag LOCUS_07190 1923 1519 CDS product adhesion protein FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060555389.1 protein_id gnl|my_center|LOCUS_07190 2991 2080 gene locus_tag LOCUS_07200 2991 2080 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902166.1 protein_id gnl|my_center|LOCUS_07200 3884 3057 gene locus_tag LOCUS_07210 3884 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495534.1 protein_id gnl|my_center|LOCUS_07210 4428 4243 gene locus_tag LOCUS_07220 4428 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6791 4473 gene locus_tag LOCUS_07230 6791 4473 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016257.1 protein_id gnl|my_center|LOCUS_07230 7011 6817 gene locus_tag LOCUS_07240 7011 6817 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797412.1 protein_id gnl|my_center|LOCUS_07240 8504 7149 gene locus_tag LOCUS_07250 8504 7149 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627718.1 protein_id gnl|my_center|LOCUS_07250 9875 8517 gene locus_tag LOCUS_07260 gene trkA 9875 8517 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016254.1 protein_id gnl|my_center|LOCUS_07260 10388 9894 gene locus_tag LOCUS_07270 10388 9894 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016253.1 protein_id gnl|my_center|LOCUS_07270 11215 10388 gene locus_tag LOCUS_07280 gene thyA 11215 10388 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016252.1 protein_id gnl|my_center|LOCUS_07280 12933 11293 gene locus_tag LOCUS_07290 12933 11293 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_07290 13437 13165 gene locus_tag LOCUS_07300 13437 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 13558 14478 gene locus_tag LOCUS_07310 13558 14478 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627713.1 protein_id gnl|my_center|LOCUS_07310 14699 15472 gene locus_tag LOCUS_07320 14699 15472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895738.1 protein_id gnl|my_center|LOCUS_07320 15459 16463 gene locus_tag LOCUS_07330 15459 16463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016248.1 protein_id gnl|my_center|LOCUS_07330 16473 17201 gene locus_tag LOCUS_07340 16473 17201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016247.1 protein_id gnl|my_center|LOCUS_07340 17337 17813 gene locus_tag LOCUS_07350 17337 17813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198481168.1 protein_id gnl|my_center|LOCUS_07350 17845 18801 gene locus_tag LOCUS_07360 17845 18801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016245.1 protein_id gnl|my_center|LOCUS_07360 18819 19859 gene locus_tag LOCUS_07370 18819 19859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 20175 20942 gene locus_tag LOCUS_07380 20175 20942 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915720.1 protein_id gnl|my_center|LOCUS_07380 20957 22234 gene locus_tag LOCUS_07390 20957 22234 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016239.1 protein_id gnl|my_center|LOCUS_07390 22300 23298 gene locus_tag LOCUS_07400 gene pdxA 22300 23298 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016238.1 protein_id gnl|my_center|LOCUS_07400 23327 24685 gene locus_tag LOCUS_07410 23327 24685 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016237.1 protein_id gnl|my_center|LOCUS_07410 25661 24747 gene locus_tag LOCUS_07420 25661 24747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 26089 25685 gene locus_tag LOCUS_07430 gene dhaM 26089 25685 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627629.1 protein_id gnl|my_center|LOCUS_07430 26724 26110 gene locus_tag LOCUS_07440 gene dhaL 26724 26110 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015866.1 protein_id gnl|my_center|LOCUS_07440 27825 26839 gene locus_tag LOCUS_07450 gene dhaK 27825 26839 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494451.1 protein_id gnl|my_center|LOCUS_07450 29499 28006 gene locus_tag LOCUS_07460 gene glpK 29499 28006 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_07460 30368 29637 gene locus_tag LOCUS_07470 30368 29637 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894460.1 protein_id gnl|my_center|LOCUS_07470 31933 30539 gene locus_tag LOCUS_07480 31933 30539 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_07480 32890 31949 gene locus_tag LOCUS_07490 32890 31949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 33169 32900 gene locus_tag LOCUS_07500 33169 32900 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382338.1 protein_id gnl|my_center|LOCUS_07500 33896 33186 gene locus_tag LOCUS_07510 33896 33186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 34553 33933 gene locus_tag LOCUS_07520 34553 33933 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_07520 34844 34566 gene locus_tag LOCUS_07530 gene pduJ 34844 34566 CDS product propanediol utilization microcompartment protein PduJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057752.1 protein_id gnl|my_center|LOCUS_07530 35306 34863 gene locus_tag LOCUS_07540 35306 34863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 35718 35341 gene locus_tag LOCUS_07550 35718 35341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 37532 35718 gene locus_tag LOCUS_07560 37532 35718 CDS product diol dehydratase reactivase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836575.1 protein_id gnl|my_center|LOCUS_07560 38070 37555 gene locus_tag LOCUS_07570 gene pduE 38070 37555 CDS product propanediol dehydratase small subunit PduE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090601.1 protein_id gnl|my_center|LOCUS_07570 38764 38084 gene locus_tag LOCUS_07580 38764 38084 CDS product propanediol/glycerol family dehydratase medium subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989693.1 protein_id gnl|my_center|LOCUS_07580 40445 38781 gene locus_tag LOCUS_07590 40445 38781 CDS product propanediol/glycerol family dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008947521.1 protein_id gnl|my_center|LOCUS_07590 41272 40466 gene locus_tag LOCUS_07600 gene pduB 41272 40466 CDS product propanediol utilization microcompartment protein PduB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721551.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence15 2129 1233 gene locus_tag LOCUS_07610 gene era 2129 1233 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016271.1 protein_id gnl|my_center|LOCUS_07610 2888 2133 gene locus_tag LOCUS_07620 2888 2133 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627738.1 protein_id gnl|my_center|LOCUS_07620 4551 2890 gene locus_tag LOCUS_07630 gene recN 4551 2890 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016269.1 protein_id gnl|my_center|LOCUS_07630 5348 4545 gene locus_tag LOCUS_07640 5348 4545 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016268.1 protein_id gnl|my_center|LOCUS_07640 6555 5362 gene locus_tag LOCUS_07650 6555 5362 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492060.1 protein_id gnl|my_center|LOCUS_07650 7489 6542 gene locus_tag LOCUS_07660 7489 6542 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903510.1 protein_id gnl|my_center|LOCUS_07660 8035 7646 gene locus_tag LOCUS_07670 8035 7646 CDS product adhesion protein FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903511.1 protein_id gnl|my_center|LOCUS_07670 8821 8138 gene locus_tag LOCUS_07680 8821 8138 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367505.1 protein_id gnl|my_center|LOCUS_07680 9138 11369 gene locus_tag LOCUS_07690 gene pflB 9138 11369 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903513.1 protein_id gnl|my_center|LOCUS_07690 11656 12387 gene locus_tag LOCUS_07700 gene pflA 11656 12387 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903514.1 protein_id gnl|my_center|LOCUS_07700 12577 12957 gene locus_tag LOCUS_07710 12577 12957 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 protein_id gnl|my_center|LOCUS_07710 12959 13180 gene locus_tag LOCUS_07720 12959 13180 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_07720 13301 15145 gene locus_tag LOCUS_07730 13301 15145 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016265.1 protein_id gnl|my_center|LOCUS_07730 15378 16157 gene locus_tag LOCUS_07740 15378 16157 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_07740 16178 17461 gene locus_tag LOCUS_07750 16178 17461 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986437.1 protein_id gnl|my_center|LOCUS_07750 17678 18475 gene locus_tag LOCUS_07760 17678 18475 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_07760 19805 18585 gene locus_tag LOCUS_07770 19805 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 20799 19843 gene locus_tag LOCUS_07780 20799 19843 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016957.1 protein_id gnl|my_center|LOCUS_07780 22274 21012 gene locus_tag LOCUS_07790 22274 21012 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_07790 23314 22283 gene locus_tag LOCUS_07800 23314 22283 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963413.1 protein_id gnl|my_center|LOCUS_07800 25292 23316 gene locus_tag LOCUS_07810 25292 23316 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_07810 26214 25351 gene locus_tag LOCUS_07820 26214 25351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 26972 26211 gene locus_tag LOCUS_07830 gene panB 26972 26211 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082243.1 protein_id gnl|my_center|LOCUS_07830 30691 27125 gene locus_tag LOCUS_07840 gene nifJ 30691 27125 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_07840 31996 30800 gene locus_tag LOCUS_07850 31996 30800 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 protein_id gnl|my_center|LOCUS_07850 33053 32049 gene locus_tag LOCUS_07860 gene pta 33053 32049 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 protein_id gnl|my_center|LOCUS_07860 34305 33574 gene locus_tag LOCUS_07870 34305 33574 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016971.1 protein_id gnl|my_center|LOCUS_07870 35447 34539 gene locus_tag LOCUS_07880 35447 34539 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439840.1 protein_id gnl|my_center|LOCUS_07880 36727 35471 gene locus_tag LOCUS_07890 36727 35471 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693828.1 protein_id gnl|my_center|LOCUS_07890 38494 36791 gene locus_tag LOCUS_07900 gene ilvD 38494 36791 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496775.1 protein_id gnl|my_center|LOCUS_07900 38831 39610 gene locus_tag LOCUS_07910 38831 39610 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439844.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence16 3193 179 gene locus_tag LOCUS_07920 3193 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4118 3441 gene locus_tag LOCUS_07930 4118 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5132 4224 gene locus_tag LOCUS_07940 5132 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6906 5368 gene locus_tag LOCUS_07950 gene guaA 6906 5368 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017155.1 protein_id gnl|my_center|LOCUS_07950 7628 7131 gene locus_tag LOCUS_07960 7628 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 9523 7646 gene locus_tag LOCUS_07970 9523 7646 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494687.1 protein_id gnl|my_center|LOCUS_07970 10442 9513 gene locus_tag LOCUS_07980 gene pfkB 10442 9513 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898202.1 protein_id gnl|my_center|LOCUS_07980 11444 10707 gene locus_tag LOCUS_07990 11444 10707 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017152.1 protein_id gnl|my_center|LOCUS_07990 11670 11927 gene locus_tag LOCUS_08000 gene rpmB 11670 11927 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898205.1 protein_id gnl|my_center|LOCUS_08000 12231 13238 gene locus_tag LOCUS_08010 12231 13238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 13228 14676 gene locus_tag LOCUS_08020 13228 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 16557 14767 gene locus_tag LOCUS_08030 16557 14767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285918.1 protein_id gnl|my_center|LOCUS_08030 18308 16569 gene locus_tag LOCUS_08040 18308 16569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626891.1 protein_id gnl|my_center|LOCUS_08040 18605 21043 gene locus_tag LOCUS_08050 18605 21043 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626890.1 protein_id gnl|my_center|LOCUS_08050 21070 21852 gene locus_tag LOCUS_08060 21070 21852 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017148.1 protein_id gnl|my_center|LOCUS_08060 21865 22104 gene locus_tag LOCUS_08070 21865 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 22363 22761 gene locus_tag LOCUS_08080 22363 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08080 22758 23495 gene locus_tag LOCUS_08090 22758 23495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08090 23693 24844 gene locus_tag LOCUS_08100 23693 24844 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_08100 25066 25953 gene locus_tag LOCUS_08110 25066 25953 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626888.1 protein_id gnl|my_center|LOCUS_08110 25954 26934 gene locus_tag LOCUS_08120 25954 26934 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_08120 26924 27706 gene locus_tag LOCUS_08130 26924 27706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_08130 27706 28419 gene locus_tag LOCUS_08140 27706 28419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902265.1 protein_id gnl|my_center|LOCUS_08140 28420 28944 gene locus_tag LOCUS_08150 28420 28944 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_08150 29303 29073 gene locus_tag LOCUS_08160 29303 29073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 29555 30325 gene locus_tag LOCUS_08170 29555 30325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 31436 30573 gene locus_tag LOCUS_08180 31436 30573 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490772.1 protein_id gnl|my_center|LOCUS_08180 31609 34611 gene locus_tag LOCUS_08190 31609 34611 CDS product autotransporter serine protease fusolisin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626887.1 protein_id gnl|my_center|LOCUS_08190 35184 37097 gene locus_tag LOCUS_08200 35184 37097 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_08200 37123 38340 gene locus_tag LOCUS_08210 37123 38340 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903248.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence17 433 567 gene locus_tag LOCUS_08220 433 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 621 956 gene locus_tag LOCUS_08230 gene rnpA 621 956 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016064.1 protein_id gnl|my_center|LOCUS_08230 965 1213 gene locus_tag LOCUS_08240 gene yidD 965 1213 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_08240 1210 1815 gene locus_tag LOCUS_08250 1210 1815 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903598.1 protein_id gnl|my_center|LOCUS_08250 1817 2566 gene locus_tag LOCUS_08260 1817 2566 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367405.1 protein_id gnl|my_center|LOCUS_08260 2586 3953 gene locus_tag LOCUS_08270 gene mnmE 2586 3953 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_08270 4208 6091 gene locus_tag LOCUS_08280 gene mnmG 4208 6091 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016068.1 protein_id gnl|my_center|LOCUS_08280 6253 7149 gene locus_tag LOCUS_08290 gene nadA 6253 7149 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_08290 7151 8449 gene locus_tag LOCUS_08300 7151 8449 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_08300 8433 9287 gene locus_tag LOCUS_08310 gene nadC 8433 9287 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_08310 9280 9789 gene locus_tag LOCUS_08320 9280 9789 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_08320 10386 9892 gene locus_tag LOCUS_08330 10386 9892 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016073.1 protein_id gnl|my_center|LOCUS_08330 10920 10426 gene locus_tag LOCUS_08340 10920 10426 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 protein_id gnl|my_center|LOCUS_08340 11082 11771 gene locus_tag LOCUS_08350 11082 11771 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_08350 12319 11768 gene locus_tag LOCUS_08360 12319 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016076.1 protein_id gnl|my_center|LOCUS_08360 12500 12619 gene locus_tag LOCUS_08370 12500 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12691 15636 gene locus_tag LOCUS_08380 12691 15636 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016080.1 protein_id gnl|my_center|LOCUS_08380 15815 16114 gene locus_tag LOCUS_08390 15815 16114 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900912.1 protein_id gnl|my_center|LOCUS_08390 16107 16979 gene locus_tag LOCUS_08400 gene ispE 16107 16979 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016081.1 protein_id gnl|my_center|LOCUS_08400 16995 17300 gene locus_tag LOCUS_08410 16995 17300 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016082.1 protein_id gnl|my_center|LOCUS_08410 18719 17412 gene locus_tag LOCUS_08420 18719 17412 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389530.1 protein_id gnl|my_center|LOCUS_08420 19915 18731 gene locus_tag LOCUS_08430 19915 18731 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455004.1 protein_id gnl|my_center|LOCUS_08430 21196 19961 gene locus_tag LOCUS_08440 21196 19961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 21925 21206 gene locus_tag LOCUS_08450 21925 21206 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965838.1 protein_id gnl|my_center|LOCUS_08450 22283 23782 gene locus_tag LOCUS_08460 gene yfcC 22283 23782 CDS product putative basic amino acid antiporter YfcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016083.1 protein_id gnl|my_center|LOCUS_08460 23928 24095 gene locus_tag LOCUS_08470 23928 24095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 24190 24960 gene locus_tag LOCUS_08480 24190 24960 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016054.1 protein_id gnl|my_center|LOCUS_08480 25458 25027 gene locus_tag LOCUS_08490 25458 25027 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903576.1 protein_id gnl|my_center|LOCUS_08490 25604 26080 gene locus_tag LOCUS_08500 25604 26080 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_08500 26093 26791 gene locus_tag LOCUS_08510 26093 26791 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027675.1 protein_id gnl|my_center|LOCUS_08510 27914 27033 gene locus_tag LOCUS_08520 27914 27033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495378.1 protein_id gnl|my_center|LOCUS_08520 28956 27967 gene locus_tag LOCUS_08530 28956 27967 CDS product C45 family autoproteolytic acyltransferase/hydolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016090.1 protein_id gnl|my_center|LOCUS_08530 30074 29067 gene locus_tag LOCUS_08540 gene ilvC 30074 29067 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_08540 30978 30193 gene locus_tag LOCUS_08550 30978 30193 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_08550 31467 30979 gene locus_tag LOCUS_08560 gene ilvN 31467 30979 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_08560 33184 31460 gene locus_tag LOCUS_08570 33184 31460 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_08570 34905 33244 gene locus_tag LOCUS_08580 gene ilvD 34905 33244 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_08580 35258 35118 gene locus_tag LOCUS_08590 35258 35118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence18 <1 540 gene locus_tag LOCUS_08600 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098821.1:ShlB/FhaC/HecB family hemolysin secretion/activation protein 552 8684 gene locus_tag LOCUS_08610 552 8684 CDS product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585689.1 protein_id gnl|my_center|LOCUS_08610 8665 9069 gene locus_tag LOCUS_08620 8665 9069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 9062 9604 gene locus_tag LOCUS_08630 9062 9604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 9645 11318 gene locus_tag LOCUS_08640 9645 11318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 11338 11679 gene locus_tag LOCUS_08650 11338 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 11790 12308 gene locus_tag LOCUS_08660 11790 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 12317 12799 gene locus_tag LOCUS_08670 12317 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 12942 13193 gene locus_tag LOCUS_08680 12942 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 13205 13681 gene locus_tag LOCUS_08690 13205 13681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 13827 14057 gene locus_tag LOCUS_08700 13827 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 14063 14671 gene locus_tag LOCUS_08710 14063 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 14752 15414 gene locus_tag LOCUS_08720 14752 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 15426 15902 gene locus_tag LOCUS_08730 15426 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 16141 16275 gene locus_tag LOCUS_08740 16141 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 16289 16762 gene locus_tag LOCUS_08750 16289 16762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 16957 17781 gene locus_tag LOCUS_08760 gene folK 16957 17781 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_08760 17768 18589 gene locus_tag LOCUS_08770 gene folP 17768 18589 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492526.1 protein_id gnl|my_center|LOCUS_08770 18602 18949 gene locus_tag LOCUS_08780 18602 18949 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 protein_id gnl|my_center|LOCUS_08780 18952 19389 gene locus_tag LOCUS_08790 gene eutP 18952 19389 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904035.1 protein_id gnl|my_center|LOCUS_08790 19379 19957 gene locus_tag LOCUS_08800 19379 19957 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904034.1 protein_id gnl|my_center|LOCUS_08800 19957 21345 gene locus_tag LOCUS_08810 19957 21345 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016123.1 protein_id gnl|my_center|LOCUS_08810 21588 23018 gene locus_tag LOCUS_08820 gene eutA 21588 23018 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016124.1 protein_id gnl|my_center|LOCUS_08820 23046 24413 gene locus_tag LOCUS_08830 23046 24413 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016125.1 protein_id gnl|my_center|LOCUS_08830 24425 25312 gene locus_tag LOCUS_08840 gene eutC 24425 25312 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904029.1 protein_id gnl|my_center|LOCUS_08840 25559 26212 gene locus_tag LOCUS_08850 gene eutL 25559 26212 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016126.1 protein_id gnl|my_center|LOCUS_08850 26223 26681 gene locus_tag LOCUS_08860 26223 26681 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016127.1 protein_id gnl|my_center|LOCUS_08860 26716 27003 gene locus_tag LOCUS_08870 gene eutM 26716 27003 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895463.1 protein_id gnl|my_center|LOCUS_08870 27111 28553 gene locus_tag LOCUS_08880 27111 28553 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016128.1 protein_id gnl|my_center|LOCUS_08880 28578 29345 gene locus_tag LOCUS_08890 28578 29345 CDS product ethanolamine utilization cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016129.1 protein_id gnl|my_center|LOCUS_08890 29413 30000 gene locus_tag LOCUS_08900 29413 30000 CDS product TIGR02536 family ethanolamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842667.1 protein_id gnl|my_center|LOCUS_08900 30002 30250 gene locus_tag LOCUS_08910 30002 30250 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_08910 30264 30614 gene locus_tag LOCUS_08920 30264 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016132.1 protein_id gnl|my_center|LOCUS_08920 30614 31696 gene locus_tag LOCUS_08930 gene eutH 30614 31696 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016133.1 protein_id gnl|my_center|LOCUS_08930 31707 32150 gene locus_tag LOCUS_08940 31707 32150 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904018.1 protein_id gnl|my_center|LOCUS_08940 32175 33293 gene locus_tag LOCUS_08950 32175 33293 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016134.1 protein_id gnl|my_center|LOCUS_08950 33315 34433 gene locus_tag LOCUS_08960 33315 34433 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016135.1 protein_id gnl|my_center|LOCUS_08960 34536 34847 gene locus_tag LOCUS_08970 gene trxA 34536 34847 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016136.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence19 870 250 gene locus_tag LOCUS_08980 870 250 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 protein_id gnl|my_center|LOCUS_08980 2008 857 gene locus_tag LOCUS_08990 gene thiH 2008 857 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_08990 2781 2008 gene locus_tag LOCUS_09000 2781 2008 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_09000 3405 2782 gene locus_tag LOCUS_09010 gene thiF 3405 2782 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897548.1 protein_id gnl|my_center|LOCUS_09010 3602 3408 gene locus_tag LOCUS_09020 gene thiS 3602 3408 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008702803.1 protein_id gnl|my_center|LOCUS_09020 4917 3616 gene locus_tag LOCUS_09030 gene thiC 4917 3616 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015816.1 protein_id gnl|my_center|LOCUS_09030 5555 4935 gene locus_tag LOCUS_09040 gene thiE 5555 4935 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904284.1 protein_id gnl|my_center|LOCUS_09040 6415 5576 gene locus_tag LOCUS_09050 gene thiD 6415 5576 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897554.1 protein_id gnl|my_center|LOCUS_09050 6834 6760 gene locus_tag LOCUS_t00210 6834 6760 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6917 6841 gene locus_tag LOCUS_t00220 6917 6841 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7727 6981 gene locus_tag LOCUS_09060 7727 6981 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015818.1 protein_id gnl|my_center|LOCUS_09060 8285 7728 gene locus_tag LOCUS_09070 8285 7728 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904290.1 protein_id gnl|my_center|LOCUS_09070 9763 8459 gene locus_tag LOCUS_09080 gene eno 9763 8459 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015819.1 protein_id gnl|my_center|LOCUS_09080 11202 9784 gene locus_tag LOCUS_09090 gene pykF 11202 9784 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900019.1 protein_id gnl|my_center|LOCUS_09090 11423 11347 gene locus_tag LOCUS_t00230 11423 11347 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11502 11426 gene locus_tag LOCUS_t00240 11502 11426 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11589 11514 gene locus_tag LOCUS_t00250 11589 11514 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 11687 11604 gene locus_tag LOCUS_t00260 11687 11604 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11778 11703 gene locus_tag LOCUS_t00270 11778 11703 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11863 11787 gene locus_tag LOCUS_t00280 11863 11787 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11947 11872 gene locus_tag LOCUS_t00290 11947 11872 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12027 11953 gene locus_tag LOCUS_t00300 12027 11953 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12109 12034 gene locus_tag LOCUS_t00310 12109 12034 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12188 12113 gene locus_tag LOCUS_t00320 12188 12113 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12313 12240 gene locus_tag LOCUS_t00330 12313 12240 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 12401 12326 gene locus_tag LOCUS_t00340 12401 12326 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12494 12418 gene locus_tag LOCUS_t00350 12494 12418 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 12578 12503 gene locus_tag LOCUS_t00360 12578 12503 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13407 12661 gene locus_tag LOCUS_09100 13407 12661 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015821.1 protein_id gnl|my_center|LOCUS_09100 16051 13568 gene locus_tag LOCUS_09110 16051 13568 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015822.1 protein_id gnl|my_center|LOCUS_09110 16326 16057 gene locus_tag LOCUS_09120 16326 16057 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904300.1 protein_id gnl|my_center|LOCUS_09120 16512 17336 gene locus_tag LOCUS_09130 gene eutJ 16512 17336 CDS product ethanolamine utilization protein EutJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015823.1 protein_id gnl|my_center|LOCUS_09130 17962 17507 gene locus_tag LOCUS_09140 17962 17507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904303.1 protein_id gnl|my_center|LOCUS_09140 18447 17989 gene locus_tag LOCUS_09150 18447 17989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015824.1 protein_id gnl|my_center|LOCUS_09150 18585 19565 gene locus_tag LOCUS_09160 gene rfaE1 18585 19565 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 protein_id gnl|my_center|LOCUS_09160 19559 20041 gene locus_tag LOCUS_09170 gene ispF 19559 20041 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015827.1 protein_id gnl|my_center|LOCUS_09170 20035 21387 gene locus_tag LOCUS_09180 20035 21387 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_09180 21403 21924 gene locus_tag LOCUS_09190 21403 21924 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015829.1 protein_id gnl|my_center|LOCUS_09190 21939 22697 gene locus_tag LOCUS_09200 21939 22697 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015830.1 protein_id gnl|my_center|LOCUS_09200 23151 22762 gene locus_tag LOCUS_09210 23151 22762 CDS product MliC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005973382.1 protein_id gnl|my_center|LOCUS_09210 25117 23390 gene locus_tag LOCUS_09220 gene ptsP 25117 23390 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494171.1 protein_id gnl|my_center|LOCUS_09220 25443 25180 gene locus_tag LOCUS_09230 25443 25180 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888910.1 protein_id gnl|my_center|LOCUS_09230 25661 25900 gene locus_tag LOCUS_09240 25661 25900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903836.1 protein_id gnl|my_center|LOCUS_09240 26211 27341 gene locus_tag LOCUS_09250 26211 27341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015834.1 protein_id gnl|my_center|LOCUS_09250 27328 28182 gene locus_tag LOCUS_09260 27328 28182 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015835.1 protein_id gnl|my_center|LOCUS_09260 28175 28960 gene locus_tag LOCUS_09270 28175 28960 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627435.1 protein_id gnl|my_center|LOCUS_09270 29019 29843 gene locus_tag LOCUS_09280 29019 29843 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903844.1 protein_id gnl|my_center|LOCUS_09280 31438 29990 gene locus_tag LOCUS_09290 31438 29990 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495419.1 protein_id gnl|my_center|LOCUS_09290 31774 31442 gene locus_tag LOCUS_09300 31774 31442 CDS product DUF3870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367287.1 protein_id gnl|my_center|LOCUS_09300 32562 31777 gene locus_tag LOCUS_09310 32562 31777 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_09310 33763 32582 gene locus_tag LOCUS_09320 33763 32582 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015685.1 protein_id gnl|my_center|LOCUS_09320 34875 33784 gene locus_tag LOCUS_09330 34875 33784 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence20 <1 730 gene locus_tag LOCUS_09340 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016474.1:HTH domain-containing protein 1911 802 gene locus_tag LOCUS_09350 1911 802 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016475.1 protein_id gnl|my_center|LOCUS_09350 3255 1930 gene locus_tag LOCUS_09360 gene dsdA 3255 1930 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016476.1 protein_id gnl|my_center|LOCUS_09360 4639 3290 gene locus_tag LOCUS_09370 4639 3290 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901885.1 protein_id gnl|my_center|LOCUS_09370 4897 5517 gene locus_tag LOCUS_09380 4897 5517 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005951587.1 protein_id gnl|my_center|LOCUS_09380 6206 5586 gene locus_tag LOCUS_09390 6206 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016478.1 protein_id gnl|my_center|LOCUS_09390 6558 6298 gene locus_tag LOCUS_09400 6558 6298 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027435.1 protein_id gnl|my_center|LOCUS_09400 6779 6558 gene locus_tag LOCUS_09410 6779 6558 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775256.1 protein_id gnl|my_center|LOCUS_09410 7367 7024 gene locus_tag LOCUS_tm00010 7367 7024 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8282 7542 gene locus_tag LOCUS_09420 8282 7542 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_09420 8428 8892 gene locus_tag LOCUS_09430 8428 8892 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_09430 8985 9701 gene locus_tag LOCUS_09440 8985 9701 CDS product complement resistance protein TraT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367168.1 protein_id gnl|my_center|LOCUS_09440 9738 11426 gene locus_tag LOCUS_09450 9738 11426 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795646.1 protein_id gnl|my_center|LOCUS_09450 11410 12513 gene locus_tag LOCUS_09460 gene hemW 11410 12513 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 protein_id gnl|my_center|LOCUS_09460 12759 13430 gene locus_tag LOCUS_09470 12759 13430 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 protein_id gnl|my_center|LOCUS_09470 13451 13900 gene locus_tag LOCUS_09480 13451 13900 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901900.1 protein_id gnl|my_center|LOCUS_09480 13884 14888 gene locus_tag LOCUS_09490 13884 14888 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016484.1 protein_id gnl|my_center|LOCUS_09490 14975 15889 gene locus_tag LOCUS_09500 14975 15889 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016492.1 protein_id gnl|my_center|LOCUS_09500 15950 16441 gene locus_tag LOCUS_09510 15950 16441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 16438 16614 gene locus_tag LOCUS_09520 16438 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005953029.1 protein_id gnl|my_center|LOCUS_09520 16716 17120 gene locus_tag LOCUS_09530 16716 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 17176 17352 gene locus_tag LOCUS_09540 17176 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005953029.1 protein_id gnl|my_center|LOCUS_09540 17508 18230 gene locus_tag LOCUS_09550 17508 18230 CDS product DUF4253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016498.1 protein_id gnl|my_center|LOCUS_09550 18234 20054 gene locus_tag LOCUS_09560 gene recQ 18234 20054 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898541.1 protein_id gnl|my_center|LOCUS_09560 20051 24901 gene locus_tag LOCUS_09570 20051 24901 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842746.1 protein_id gnl|my_center|LOCUS_09570 25205 27451 gene locus_tag LOCUS_09580 gene pbpC 25205 27451 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495148.1 protein_id gnl|my_center|LOCUS_09580 27455 28624 gene locus_tag LOCUS_09590 27455 28624 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016502.1 protein_id gnl|my_center|LOCUS_09590 28617 29303 gene locus_tag LOCUS_09600 28617 29303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495145.1 protein_id gnl|my_center|LOCUS_09600 29548 30024 gene locus_tag LOCUS_09610 29548 30024 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898546.1 protein_id gnl|my_center|LOCUS_09610 30237 30881 gene locus_tag LOCUS_09620 30237 30881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 30897 31463 gene locus_tag LOCUS_09630 30897 31463 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642721.1 protein_id gnl|my_center|LOCUS_09630 31661 32335 gene locus_tag LOCUS_09640 31661 32335 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 protein_id gnl|my_center|LOCUS_09640 32313 33647 gene locus_tag LOCUS_09650 32313 33647 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901931.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence21 608 153 gene locus_tag LOCUS_09660 608 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016992.1 protein_id gnl|my_center|LOCUS_09660 807 1409 gene locus_tag LOCUS_09670 807 1409 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 protein_id gnl|my_center|LOCUS_09670 1436 2434 gene locus_tag LOCUS_09680 gene ruvB 1436 2434 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903189.1 protein_id gnl|my_center|LOCUS_09680 2431 2862 gene locus_tag LOCUS_09690 2431 2862 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903188.1 protein_id gnl|my_center|LOCUS_09690 2866 3573 gene locus_tag LOCUS_09700 2866 3573 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016991.1 protein_id gnl|my_center|LOCUS_09700 3560 4867 gene locus_tag LOCUS_09710 gene mtaB 3560 4867 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016990.1 protein_id gnl|my_center|LOCUS_09710 4871 5854 gene locus_tag LOCUS_09720 4871 5854 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903185.1 protein_id gnl|my_center|LOCUS_09720 5865 6287 gene locus_tag LOCUS_09730 5865 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903184.1 protein_id gnl|my_center|LOCUS_09730 6277 8250 gene locus_tag LOCUS_09740 gene mrdA 6277 8250 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903183.1 protein_id gnl|my_center|LOCUS_09740 8198 10093 gene locus_tag LOCUS_09750 8198 10093 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896361.1 protein_id gnl|my_center|LOCUS_09750 10109 10408 gene locus_tag LOCUS_09760 gene yhbY 10109 10408 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016989.1 protein_id gnl|my_center|LOCUS_09760 10422 12224 gene locus_tag LOCUS_09770 gene dxs 10422 12224 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903179.1 protein_id gnl|my_center|LOCUS_09770 12208 13032 gene locus_tag LOCUS_09780 12208 13032 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903178.1 protein_id gnl|my_center|LOCUS_09780 13010 13819 gene locus_tag LOCUS_09790 13010 13819 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016988.1 protein_id gnl|my_center|LOCUS_09790 13834 15168 gene locus_tag LOCUS_09800 13834 15168 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494947.1 protein_id gnl|my_center|LOCUS_09800 15179 15856 gene locus_tag LOCUS_09810 gene rsmI 15179 15856 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903175.1 protein_id gnl|my_center|LOCUS_09810 15859 16731 gene locus_tag LOCUS_09820 gene ylqF 15859 16731 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016986.1 protein_id gnl|my_center|LOCUS_09820 16793 17569 gene locus_tag LOCUS_09830 16793 17569 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903173.1 protein_id gnl|my_center|LOCUS_09830 17576 17938 gene locus_tag LOCUS_09840 17576 17938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023037397.1 protein_id gnl|my_center|LOCUS_09840 18128 18934 gene locus_tag LOCUS_09850 18128 18934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896379.1 protein_id gnl|my_center|LOCUS_09850 20230 19178 gene locus_tag LOCUS_09860 gene dinB 20230 19178 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016984.1 protein_id gnl|my_center|LOCUS_09860 20398 21660 gene locus_tag LOCUS_09870 20398 21660 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 protein_id gnl|my_center|LOCUS_09870 21663 22304 gene locus_tag LOCUS_09880 21663 22304 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_09880 22318 23127 gene locus_tag LOCUS_09890 22318 23127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 23146 25134 gene locus_tag LOCUS_09900 23146 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 25144 25851 gene locus_tag LOCUS_09910 25144 25851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09910 26234 25962 gene locus_tag LOCUS_09920 26234 25962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903162.1 protein_id gnl|my_center|LOCUS_09920 27068 26316 gene locus_tag LOCUS_09930 27068 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918333.1 protein_id gnl|my_center|LOCUS_09930 29288 27081 gene locus_tag LOCUS_09940 29288 27081 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016976.1 protein_id gnl|my_center|LOCUS_09940 29678 29292 gene locus_tag LOCUS_09950 29678 29292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896389.1 protein_id gnl|my_center|LOCUS_09950 30185 29688 gene locus_tag LOCUS_09960 30185 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016974.1 protein_id gnl|my_center|LOCUS_09960 31137 30385 gene locus_tag LOCUS_09970 31137 30385 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198479972.1 protein_id gnl|my_center|LOCUS_09970 32334 31153 gene locus_tag LOCUS_09980 32334 31153 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627896.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence22 2232 439 gene locus_tag LOCUS_09990 2232 439 CDS product YadA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897873.1 protein_id gnl|my_center|LOCUS_09990 4134 2428 gene locus_tag LOCUS_10000 4134 2428 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_10000 5379 4141 gene locus_tag LOCUS_10010 gene pepT 5379 4141 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016614.1 protein_id gnl|my_center|LOCUS_10010 6873 5683 gene locus_tag LOCUS_10020 6873 5683 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902445.1 protein_id gnl|my_center|LOCUS_10020 7427 6894 gene locus_tag LOCUS_10030 7427 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902446.1 protein_id gnl|my_center|LOCUS_10030 8129 7443 gene locus_tag LOCUS_10040 gene gpmA 8129 7443 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902448.1 protein_id gnl|my_center|LOCUS_10040 8257 8976 gene locus_tag LOCUS_10050 8257 8976 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_10050 8998 9174 gene locus_tag LOCUS_10060 8998 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 9174 9773 gene locus_tag LOCUS_10070 9174 9773 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_10070 9795 10550 gene locus_tag LOCUS_10080 9795 10550 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099972008.1 protein_id gnl|my_center|LOCUS_10080 10711 11415 gene locus_tag LOCUS_10090 10711 11415 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_10090 11430 11933 gene locus_tag LOCUS_10100 11430 11933 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016609.1 protein_id gnl|my_center|LOCUS_10100 12037 12426 gene locus_tag LOCUS_10110 12037 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 12598 12816 gene locus_tag LOCUS_10120 12598 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10120 12813 13088 gene locus_tag LOCUS_10130 12813 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10130 13920 13201 gene locus_tag LOCUS_10140 13920 13201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944870.1 protein_id gnl|my_center|LOCUS_10140 14627 13845 gene locus_tag LOCUS_10150 14627 13845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460561.1 protein_id gnl|my_center|LOCUS_10150 15552 14602 gene locus_tag LOCUS_10160 15552 14602 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944872.1 protein_id gnl|my_center|LOCUS_10160 16254 15691 gene locus_tag LOCUS_10170 gene efp 16254 15691 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 protein_id gnl|my_center|LOCUS_10170 17306 16254 gene locus_tag LOCUS_10180 gene earP 17306 16254 CDS product elongation factor P maturation arginine rhamnosyltransferase EarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016605.1 protein_id gnl|my_center|LOCUS_10180 17638 17306 gene locus_tag LOCUS_10190 17638 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016604.1 protein_id gnl|my_center|LOCUS_10190 18349 17669 gene locus_tag LOCUS_10200 18349 17669 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016603.1 protein_id gnl|my_center|LOCUS_10200 19212 18349 gene locus_tag LOCUS_10210 19212 18349 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016602.1 protein_id gnl|my_center|LOCUS_10210 20083 19205 gene locus_tag LOCUS_10220 20083 19205 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016601.1 protein_id gnl|my_center|LOCUS_10220 21199 20252 gene locus_tag LOCUS_10230 21199 20252 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016600.1 protein_id gnl|my_center|LOCUS_10230 22854 21202 gene locus_tag LOCUS_10240 22854 21202 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_10240 23422 22892 gene locus_tag LOCUS_10250 23422 22892 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 protein_id gnl|my_center|LOCUS_10250 23916 23419 gene locus_tag LOCUS_10260 23916 23419 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902465.1 protein_id gnl|my_center|LOCUS_10260 25201 23981 gene locus_tag LOCUS_10270 gene coaBC 25201 23981 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016598.1 protein_id gnl|my_center|LOCUS_10270 25904 25218 gene locus_tag LOCUS_10280 25904 25218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016597.1 protein_id gnl|my_center|LOCUS_10280 27440 25971 gene locus_tag LOCUS_10290 gene murJ 27440 25971 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016596.1 protein_id gnl|my_center|LOCUS_10290 28111 27434 gene locus_tag LOCUS_10300 28111 27434 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902469.1 protein_id gnl|my_center|LOCUS_10300 29042 28083 gene locus_tag LOCUS_10310 29042 28083 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016595.1 protein_id gnl|my_center|LOCUS_10310 29956 29057 gene locus_tag LOCUS_10320 gene whiA 29956 29057 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902471.1 protein_id gnl|my_center|LOCUS_10320 30104 30313 gene locus_tag LOCUS_10330 30104 30313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 32982 30247 gene locus_tag LOCUS_10340 gene polA 32982 30247 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016594.1 protein_id gnl|my_center|LOCUS_10340 33211 34401 gene locus_tag LOCUS_10350 33211 34401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794627.1 protein_id gnl|my_center|LOCUS_10350 34454 35626 gene locus_tag LOCUS_10360 34454 35626 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_10360 37239 35686 gene locus_tag LOCUS_10370 37239 35686 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016590.1 protein_id gnl|my_center|LOCUS_10370 38223 37273 gene locus_tag LOCUS_10380 gene secF 38223 37273 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016589.1 protein_id gnl|my_center|LOCUS_10380 39458 38223 gene locus_tag LOCUS_10390 gene secD 39458 38223 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902477.1 protein_id gnl|my_center|LOCUS_10390 39898 39482 gene locus_tag LOCUS_10400 gene ruvX 39898 39482 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902478.1 protein_id gnl|my_center|LOCUS_10400 42524 39921 gene locus_tag LOCUS_10410 gene alaS 42524 39921 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016588.1 protein_id gnl|my_center|LOCUS_10410 43261 42536 gene locus_tag LOCUS_10420 gene lptB 43261 42536 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016586.1 protein_id gnl|my_center|LOCUS_10420 45977 43275 gene locus_tag LOCUS_10430 45977 43275 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794599.1 protein_id gnl|my_center|LOCUS_10430 48603 45970 gene locus_tag LOCUS_10440 gene mutS 48603 45970 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494923.1 protein_id gnl|my_center|LOCUS_10440 49679 48756 gene locus_tag LOCUS_10450 49679 48756 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016583.1 protein_id gnl|my_center|LOCUS_10450 50393 49884 gene locus_tag LOCUS_10460 50393 49884 CDS product DUF5105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367087.1 protein_id gnl|my_center|LOCUS_10460 51857 50454 gene locus_tag LOCUS_10470 51857 50454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902085.1 protein_id gnl|my_center|LOCUS_10470 52021 52314 gene locus_tag LOCUS_10480 52021 52314 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367085.1 protein_id gnl|my_center|LOCUS_10480 52327 53781 gene locus_tag LOCUS_10490 gene panF 52327 53781 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_10490 55676 54090 gene locus_tag LOCUS_10500 55676 54090 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015051728.1 protein_id gnl|my_center|LOCUS_10500 57168 55696 gene locus_tag LOCUS_10510 gene putP 57168 55696 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_10510 58399 57215 gene locus_tag LOCUS_10520 58399 57215 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893427.1 protein_id gnl|my_center|LOCUS_10520 59622 58414 gene locus_tag LOCUS_10530 gene dpaL 59622 58414 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_10530 59937 61652 gene locus_tag LOCUS_10540 59937 61652 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047951.1 protein_id gnl|my_center|LOCUS_10540 62875 61649 gene locus_tag LOCUS_10550 gene rpoN 62875 61649 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170876203.1 protein_id gnl|my_center|LOCUS_10550 64871 63168 gene locus_tag LOCUS_10560 gene hcp 64871 63168 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373133.1 protein_id gnl|my_center|LOCUS_10560 65051 65344 gene locus_tag LOCUS_10570 65051 65344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902080.1 protein_id gnl|my_center|LOCUS_10570 65672 65373 gene locus_tag LOCUS_10580 65672 65373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_10580 67026 65674 gene locus_tag LOCUS_10590 67026 65674 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_10590 68329 67046 gene locus_tag LOCUS_10600 68329 67046 CDS product citrate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389229.1 protein_id gnl|my_center|LOCUS_10600 68646 68969 gene locus_tag LOCUS_10610 68646 68969 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_10610 70197 69016 gene locus_tag LOCUS_10620 70197 69016 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901936.1 protein_id gnl|my_center|LOCUS_10620 71734 70214 gene locus_tag LOCUS_10630 71734 70214 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016506.1 protein_id gnl|my_center|LOCUS_10630 71992 74205 gene locus_tag LOCUS_10640 71992 74205 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898558.1 protein_id gnl|my_center|LOCUS_10640 74216 75049 gene locus_tag LOCUS_10650 gene lpxC 74216 75049 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229301.1 protein_id gnl|my_center|LOCUS_10650 75073 75498 gene locus_tag LOCUS_10660 gene fabZ 75073 75498 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016509.1 protein_id gnl|my_center|LOCUS_10660 75516 76289 gene locus_tag LOCUS_10670 gene lpxA 75516 76289 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 protein_id gnl|my_center|LOCUS_10670 76289 77092 gene locus_tag LOCUS_10680 76289 77092 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016511.1 protein_id gnl|my_center|LOCUS_10680 77102 78172 gene locus_tag LOCUS_10690 gene lpxB 77102 78172 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901943.1 protein_id gnl|my_center|LOCUS_10690 78169 79920 gene locus_tag LOCUS_10700 78169 79920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016512.1 protein_id gnl|my_center|LOCUS_10700 80623 80123 gene locus_tag LOCUS_10710 80623 80123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016514.1 protein_id gnl|my_center|LOCUS_10710 81173 80703 gene locus_tag LOCUS_10720 81173 80703 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898570.1 protein_id gnl|my_center|LOCUS_10720 81299 82009 gene locus_tag LOCUS_10730 81299 82009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016516.1 protein_id gnl|my_center|LOCUS_10730 82818 82114 gene locus_tag LOCUS_10740 82818 82114 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626776.1 protein_id gnl|my_center|LOCUS_10740 83592 82921 gene locus_tag LOCUS_10750 83592 82921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902775.1 protein_id gnl|my_center|LOCUS_10750 84806 83601 gene locus_tag LOCUS_10760 84806 83601 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017091.1 protein_id gnl|my_center|LOCUS_10760 85247 84810 gene locus_tag LOCUS_10770 85247 84810 CDS product DUF4418 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017092.1 protein_id gnl|my_center|LOCUS_10770 85801 85379 gene locus_tag LOCUS_10780 85801 85379 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902778.1 protein_id gnl|my_center|LOCUS_10780 86507 85815 gene locus_tag LOCUS_10790 86507 85815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902779.1 protein_id gnl|my_center|LOCUS_10790 87713 86511 gene locus_tag LOCUS_10800 87713 86511 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017093.1 protein_id gnl|my_center|LOCUS_10800 89003 87723 gene locus_tag LOCUS_10810 89003 87723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494592.1 protein_id gnl|my_center|LOCUS_10810 90292 89006 gene locus_tag LOCUS_10820 90292 89006 CDS product Fe-S-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902782.1 protein_id gnl|my_center|LOCUS_10820 90665 91642 gene locus_tag LOCUS_10830 gene trpS 90665 91642 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_10830 92396 91833 gene locus_tag LOCUS_10840 92396 91833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 93259 92402 gene locus_tag LOCUS_10850 93259 92402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 96215 94689 gene locus_tag LOCUS_10860 gene gltX 96215 94689 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373220.1 protein_id gnl|my_center|LOCUS_10860 96888 96304 gene locus_tag LOCUS_10870 96888 96304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 98500 96845 gene locus_tag LOCUS_10880 98500 96845 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626992.1 protein_id gnl|my_center|LOCUS_10880 99548 98622 gene locus_tag LOCUS_10890 gene prfB 99548 98622 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10890 100144 99776 gene locus_tag LOCUS_10900 gene acpS 100144 99776 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 protein_id gnl|my_center|LOCUS_10900 100899 100141 gene locus_tag LOCUS_10910 100899 100141 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494599.1 protein_id gnl|my_center|LOCUS_10910 101094 101663 gene locus_tag LOCUS_10920 gene yqeK 101094 101663 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016520.1 protein_id gnl|my_center|LOCUS_10920 101678 103789 gene locus_tag LOCUS_10930 gene rnr 101678 103789 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016521.1 protein_id gnl|my_center|LOCUS_10930 103809 104255 gene locus_tag LOCUS_10940 gene smpB 103809 104255 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016522.1 protein_id gnl|my_center|LOCUS_10940 104325 107831 gene locus_tag LOCUS_10950 104325 107831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495458.1 protein_id gnl|my_center|LOCUS_10950 108061 109974 gene locus_tag LOCUS_10960 gene thrS 108061 109974 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 protein_id gnl|my_center|LOCUS_10960 109990 110520 gene locus_tag LOCUS_10970 109990 110520 CDS product DUF4367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367181.1 protein_id gnl|my_center|LOCUS_10970 110729 111937 gene locus_tag LOCUS_10980 110729 111937 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904352.1 protein_id gnl|my_center|LOCUS_10980 112121 113836 gene locus_tag LOCUS_10990 112121 113836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480410.1 protein_id gnl|my_center|LOCUS_10990 113836 115560 gene locus_tag LOCUS_11000 113836 115560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016528.1 protein_id gnl|my_center|LOCUS_11000 115743 117176 gene locus_tag LOCUS_11010 115743 117176 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860810.1 protein_id gnl|my_center|LOCUS_11010 117391 118437 gene locus_tag LOCUS_11020 gene ord 117391 118437 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_11020 118452 118760 gene locus_tag LOCUS_11030 gene ortA 118452 118760 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_11030 118753 120156 gene locus_tag LOCUS_11040 gene ortB 118753 120156 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_11040 120160 120534 gene locus_tag LOCUS_11050 120160 120534 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_11050 120536 122743 gene locus_tag LOCUS_11060 gene oraE 120536 122743 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_11060 122760 124148 gene locus_tag LOCUS_11070 122760 124148 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_11070 124182 125843 gene locus_tag LOCUS_11080 124182 125843 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963689.1 protein_id gnl|my_center|LOCUS_11080 125994 127331 gene locus_tag LOCUS_11090 125994 127331 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948762.1 protein_id gnl|my_center|LOCUS_11090 127351 128421 gene locus_tag LOCUS_11100 gene orr 127351 128421 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_11100 130052 128499 gene locus_tag LOCUS_11110 130052 128499 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 protein_id gnl|my_center|LOCUS_11110 131223 130129 gene locus_tag LOCUS_11120 gene dnaN 131223 130129 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016530.1 protein_id gnl|my_center|LOCUS_11120 132263 131238 gene locus_tag LOCUS_11130 132263 131238 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901986.1 protein_id gnl|my_center|LOCUS_11130 133204 132338 gene locus_tag LOCUS_11140 133204 132338 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626543.1 protein_id gnl|my_center|LOCUS_11140 134828 133524 gene locus_tag LOCUS_11150 134828 133524 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_11150 135049 135702 gene locus_tag LOCUS_11160 135049 135702 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_11160 135840 136787 gene locus_tag LOCUS_11170 135840 136787 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898612.1 protein_id gnl|my_center|LOCUS_11170 138252 136867 gene locus_tag LOCUS_11180 138252 136867 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_11180 139340 138270 gene locus_tag LOCUS_11190 139340 138270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 139738 140487 gene locus_tag LOCUS_11200 139738 140487 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082558.1 protein_id gnl|my_center|LOCUS_11200 141907 140582 gene locus_tag LOCUS_11210 141907 140582 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626527.1 protein_id gnl|my_center|LOCUS_11210 <142989 141973 gene locus_tag LOCUS_11220 <142989 141973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016536.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence23 137 592 gene locus_tag LOCUS_11230 137 592 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016670.1 protein_id gnl|my_center|LOCUS_11230 696 1424 gene locus_tag LOCUS_11240 696 1424 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214510.1 protein_id gnl|my_center|LOCUS_11240 1435 2388 gene locus_tag LOCUS_11250 1435 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2633 4126 gene locus_tag LOCUS_11260 2633 4126 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895085.1 protein_id gnl|my_center|LOCUS_11260 4136 5041 gene locus_tag LOCUS_11270 4136 5041 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016040.1 protein_id gnl|my_center|LOCUS_11270 5162 5392 gene locus_tag LOCUS_11280 5162 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5713 5483 gene locus_tag LOCUS_11290 5713 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6034 7932 gene locus_tag LOCUS_11300 6034 7932 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903085.1 protein_id gnl|my_center|LOCUS_11300 8268 9785 gene locus_tag LOCUS_11310 8268 9785 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895105.1 protein_id gnl|my_center|LOCUS_11310 10281 9868 gene locus_tag LOCUS_11320 10281 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 10455 10694 gene locus_tag LOCUS_11330 10455 10694 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567888.1 protein_id gnl|my_center|LOCUS_11330 10724 11452 gene locus_tag LOCUS_11340 10724 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 11821 12987 gene locus_tag LOCUS_11350 11821 12987 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_11350 13001 14533 gene locus_tag LOCUS_11360 13001 14533 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016044.1 protein_id gnl|my_center|LOCUS_11360 14533 15522 gene locus_tag LOCUS_11370 gene galE 14533 15522 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016045.1 protein_id gnl|my_center|LOCUS_11370 16082 15582 gene locus_tag LOCUS_11380 16082 15582 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016052.1 protein_id gnl|my_center|LOCUS_11380 16847 16110 gene locus_tag LOCUS_11390 16847 16110 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016054.1 protein_id gnl|my_center|LOCUS_11390 17598 16876 gene locus_tag LOCUS_11400 17598 16876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 18418 17687 gene locus_tag LOCUS_11410 18418 17687 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627258.1 protein_id gnl|my_center|LOCUS_11410 20833 18437 gene locus_tag LOCUS_11420 gene pheT 20833 18437 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_11420 21863 20847 gene locus_tag LOCUS_11430 gene pheS 21863 20847 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895121.1 protein_id gnl|my_center|LOCUS_11430 22348 21887 gene locus_tag LOCUS_11440 22348 21887 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_11440 24796 22361 gene locus_tag LOCUS_11450 gene gyrA 24796 22361 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903616.1 protein_id gnl|my_center|LOCUS_11450 26731 24824 gene locus_tag LOCUS_11460 gene gyrB 26731 24824 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895130.1 protein_id gnl|my_center|LOCUS_11460 27240 26968 gene locus_tag LOCUS_11470 27240 26968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903612.1 protein_id gnl|my_center|LOCUS_11470 28327 27218 gene locus_tag LOCUS_11480 28327 27218 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016062.1 protein_id gnl|my_center|LOCUS_11480 28557 28342 gene locus_tag LOCUS_11490 gene yaaA 28557 28342 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903607.1 protein_id gnl|my_center|LOCUS_11490 30519 28606 gene locus_tag LOCUS_11500 30519 28606 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016063.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence24 2712 124 gene locus_tag LOCUS_11510 2712 124 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016840.1 protein_id gnl|my_center|LOCUS_11510 3021 3797 gene locus_tag LOCUS_11520 3021 3797 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_11520 3813 4652 gene locus_tag LOCUS_11530 3813 4652 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_11530 5464 4844 gene locus_tag LOCUS_11540 5464 4844 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016771.1 protein_id gnl|my_center|LOCUS_11540 6836 5448 gene locus_tag LOCUS_11550 6836 5448 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016770.1 protein_id gnl|my_center|LOCUS_11550 7030 8769 gene locus_tag LOCUS_11560 gene ggt 7030 8769 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016769.1 protein_id gnl|my_center|LOCUS_11560 8789 9322 gene locus_tag LOCUS_11570 8789 9322 CDS product DUF6305 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016768.1 protein_id gnl|my_center|LOCUS_11570 9436 10707 gene locus_tag LOCUS_11580 9436 10707 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016767.1 protein_id gnl|my_center|LOCUS_11580 10724 10870 gene locus_tag LOCUS_11590 10724 10870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10883 12019 gene locus_tag LOCUS_11600 10883 12019 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779464.1 protein_id gnl|my_center|LOCUS_11600 12108 13256 gene locus_tag LOCUS_11610 gene pgsB 12108 13256 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903746.1 protein_id gnl|my_center|LOCUS_11610 13246 13686 gene locus_tag LOCUS_11620 gene pgsC 13246 13686 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903745.1 protein_id gnl|my_center|LOCUS_11620 13746 14840 gene locus_tag LOCUS_11630 gene pgsW 13746 14840 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795016.1 protein_id gnl|my_center|LOCUS_11630 15908 14835 gene locus_tag LOCUS_11640 gene aroC 15908 14835 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016764.1 protein_id gnl|my_center|LOCUS_11640 17154 15889 gene locus_tag LOCUS_11650 gene aroA 17154 15889 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896990.1 protein_id gnl|my_center|LOCUS_11650 17651 17166 gene locus_tag LOCUS_11660 17651 17166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795010.1 protein_id gnl|my_center|LOCUS_11660 17794 18411 gene locus_tag LOCUS_11670 17794 18411 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016761.1 protein_id gnl|my_center|LOCUS_11670 18398 18862 gene locus_tag LOCUS_11680 gene rfaE2 18398 18862 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_11680 18875 19336 gene locus_tag LOCUS_11690 gene tsaE 18875 19336 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903737.1 protein_id gnl|my_center|LOCUS_11690 19317 19961 gene locus_tag LOCUS_11700 gene tsaB 19317 19961 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016759.1 protein_id gnl|my_center|LOCUS_11700 20152 22170 gene locus_tag LOCUS_11710 20152 22170 CDS product DUF262 and DUF1524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094324403.1 protein_id gnl|my_center|LOCUS_11710 22173 22832 gene locus_tag LOCUS_11720 22173 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016758.1 protein_id gnl|my_center|LOCUS_11720 23678 22899 gene locus_tag LOCUS_11730 23678 22899 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016757.1 protein_id gnl|my_center|LOCUS_11730 24419 23691 gene locus_tag LOCUS_11740 24419 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903732.1 protein_id gnl|my_center|LOCUS_11740 25432 24635 gene locus_tag LOCUS_11750 25432 24635 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779463.1 protein_id gnl|my_center|LOCUS_11750 25587 27026 gene locus_tag LOCUS_11760 gene cls 25587 27026 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016755.1 protein_id gnl|my_center|LOCUS_11760 27038 27982 gene locus_tag LOCUS_11770 27038 27982 CDS product phosphotransferase enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016754.1 protein_id gnl|my_center|LOCUS_11770 28180 29133 gene locus_tag LOCUS_11780 28180 29133 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897037.1 protein_id gnl|my_center|LOCUS_11780 29146 30066 gene locus_tag LOCUS_11790 29146 30066 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016752.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence25 251 1150 gene locus_tag LOCUS_11800 251 1150 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171082.1 protein_id gnl|my_center|LOCUS_11800 1287 2195 gene locus_tag LOCUS_11810 1287 2195 CDS product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765893.1 protein_id gnl|my_center|LOCUS_11810 2205 3329 gene locus_tag LOCUS_11820 2205 3329 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 protein_id gnl|my_center|LOCUS_11820 3340 4500 gene locus_tag LOCUS_11830 3340 4500 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017013.1 protein_id gnl|my_center|LOCUS_11830 5645 4608 gene locus_tag LOCUS_11840 5645 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5843 6694 gene locus_tag LOCUS_11850 5843 6694 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017011.1 protein_id gnl|my_center|LOCUS_11850 6702 7421 gene locus_tag LOCUS_11860 6702 7421 CDS product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017009.1 protein_id gnl|my_center|LOCUS_11860 7423 8616 gene locus_tag LOCUS_11870 7423 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 9401 8694 gene locus_tag LOCUS_11880 9401 8694 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627875.1 protein_id gnl|my_center|LOCUS_11880 10027 9602 gene locus_tag LOCUS_11890 10027 9602 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681342.1 protein_id gnl|my_center|LOCUS_11890 11382 10300 gene locus_tag LOCUS_11900 11382 10300 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202735.1 protein_id gnl|my_center|LOCUS_11900 12357 11485 gene locus_tag LOCUS_11910 12357 11485 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 protein_id gnl|my_center|LOCUS_11910 12758 13321 gene locus_tag LOCUS_11920 12758 13321 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722981.1 protein_id gnl|my_center|LOCUS_11920 13394 14962 gene locus_tag LOCUS_11930 13394 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 15569 15042 gene locus_tag LOCUS_11940 15569 15042 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896302.1 protein_id gnl|my_center|LOCUS_11940 15678 16019 gene locus_tag LOCUS_11950 15678 16019 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902357.1 protein_id gnl|my_center|LOCUS_11950 16110 17576 gene locus_tag LOCUS_11960 gene guaB 16110 17576 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017001.1 protein_id gnl|my_center|LOCUS_11960 17592 18335 gene locus_tag LOCUS_11970 17592 18335 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902355.1 protein_id gnl|my_center|LOCUS_11970 18319 18759 gene locus_tag LOCUS_11980 18319 18759 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902354.1 protein_id gnl|my_center|LOCUS_11980 18854 19534 gene locus_tag LOCUS_11990 18854 19534 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016997.1 protein_id gnl|my_center|LOCUS_11990 19534 20991 gene locus_tag LOCUS_12000 19534 20991 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016996.1 protein_id gnl|my_center|LOCUS_12000 20981 21817 gene locus_tag LOCUS_12010 gene kdsA 20981 21817 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_12010 21965 23593 gene locus_tag LOCUS_12020 21965 23593 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 protein_id gnl|my_center|LOCUS_12020 23619 24584 gene locus_tag LOCUS_12030 23619 24584 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049518049.1 protein_id gnl|my_center|LOCUS_12030 24610 25137 gene locus_tag LOCUS_12040 24610 25137 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_12040 25289 25134 gene locus_tag LOCUS_12050 25289 25134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 26626 25706 gene locus_tag LOCUS_12060 gene cysK 26626 25706 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367266.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence26 483 2207 gene locus_tag LOCUS_12070 483 2207 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627326.1 protein_id gnl|my_center|LOCUS_12070 2347 2715 gene locus_tag LOCUS_12080 2347 2715 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903552.1 protein_id gnl|my_center|LOCUS_12080 2717 3991 gene locus_tag LOCUS_12090 gene brnQ 2717 3991 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016106.1 protein_id gnl|my_center|LOCUS_12090 4005 5213 gene locus_tag LOCUS_12100 gene tyrS 4005 5213 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 protein_id gnl|my_center|LOCUS_12100 5347 5853 gene locus_tag LOCUS_12110 5347 5853 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895379.1 protein_id gnl|my_center|LOCUS_12110 5876 6361 gene locus_tag LOCUS_12120 5876 6361 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016109.1 protein_id gnl|my_center|LOCUS_12120 6549 7193 gene locus_tag LOCUS_12130 gene nth 6549 7193 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_12130 7281 8474 gene locus_tag LOCUS_12140 gene nifS 7281 8474 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016111.1 protein_id gnl|my_center|LOCUS_12140 8510 8896 gene locus_tag LOCUS_12150 gene nifU 8510 8896 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796962.1 protein_id gnl|my_center|LOCUS_12150 8982 10256 gene locus_tag LOCUS_12160 8982 10256 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895391.1 protein_id gnl|my_center|LOCUS_12160 10275 11765 gene locus_tag LOCUS_12170 10275 11765 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016113.1 protein_id gnl|my_center|LOCUS_12170 11861 12250 gene locus_tag LOCUS_12180 11861 12250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 12318 12821 gene locus_tag LOCUS_12190 12318 12821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 13154 13327 gene locus_tag LOCUS_12200 13154 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12200 13758 15296 gene locus_tag LOCUS_12210 13758 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 15458 16828 gene locus_tag LOCUS_12220 15458 16828 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267877.1 protein_id gnl|my_center|LOCUS_12220 16828 17187 gene locus_tag LOCUS_12230 16828 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 17174 18433 gene locus_tag LOCUS_12240 17174 18433 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_12240 18439 18903 gene locus_tag LOCUS_12250 18439 18903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 18904 20268 gene locus_tag LOCUS_12260 18904 20268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 20438 21379 gene locus_tag LOCUS_12270 20438 21379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 21363 22184 gene locus_tag LOCUS_12280 21363 22184 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence27 1952 612 gene locus_tag LOCUS_12290 1952 612 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016193.1 protein_id gnl|my_center|LOCUS_12290 3094 2045 gene locus_tag LOCUS_12300 gene disA 3094 2045 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016189.1 protein_id gnl|my_center|LOCUS_12300 4469 3087 gene locus_tag LOCUS_12310 gene radA 4469 3087 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016188.1 protein_id gnl|my_center|LOCUS_12310 4971 4474 gene locus_tag LOCUS_12320 gene coaD 4971 4474 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016187.1 protein_id gnl|my_center|LOCUS_12320 6358 4973 gene locus_tag LOCUS_12330 6358 4973 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016185.1 protein_id gnl|my_center|LOCUS_12330 7379 6333 gene locus_tag LOCUS_12340 7379 6333 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016184.1 protein_id gnl|my_center|LOCUS_12340 8070 7366 gene locus_tag LOCUS_12350 gene rnc 8070 7366 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797266.1 protein_id gnl|my_center|LOCUS_12350 9327 8086 gene locus_tag LOCUS_12360 gene fabF 9327 8086 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016182.1 protein_id gnl|my_center|LOCUS_12360 9707 9480 gene locus_tag LOCUS_12370 gene acpP 9707 9480 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_12370 10675 9776 gene locus_tag LOCUS_12380 gene fabD 10675 9776 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016181.1 protein_id gnl|my_center|LOCUS_12380 11699 10713 gene locus_tag LOCUS_12390 11699 10713 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016180.1 protein_id gnl|my_center|LOCUS_12390 12697 11702 gene locus_tag LOCUS_12400 gene plsX 12697 11702 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016179.1 protein_id gnl|my_center|LOCUS_12400 13828 12929 gene locus_tag LOCUS_12410 13828 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 21747 13813 gene locus_tag LOCUS_12420 21747 13813 CDS product hemagglutinin repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585689.1 protein_id gnl|my_center|LOCUS_12420 <22298 21759 gene locus_tag LOCUS_12430 <22298 21759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098821.1:ShlB/FhaC/HecB family hemolysin secretion/activation protein >Feature sequence28 1069 134 gene locus_tag LOCUS_12440 1069 134 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100868.1 protein_id gnl|my_center|LOCUS_12440 1151 1528 gene locus_tag LOCUS_12450 1151 1528 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966792.1 protein_id gnl|my_center|LOCUS_12450 1603 2751 gene locus_tag LOCUS_12460 1603 2751 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_12460 3548 3006 gene locus_tag LOCUS_12470 3548 3006 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901617.1 protein_id gnl|my_center|LOCUS_12470 3828 4871 gene locus_tag LOCUS_12480 3828 4871 CDS product C4-dicarboxylate TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491570.1 protein_id gnl|my_center|LOCUS_12480 5032 5502 gene locus_tag LOCUS_12490 5032 5502 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896258.1 protein_id gnl|my_center|LOCUS_12490 5517 6803 gene locus_tag LOCUS_12500 5517 6803 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902212.1 protein_id gnl|my_center|LOCUS_12500 6852 7646 gene locus_tag LOCUS_12510 6852 7646 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_12510 7846 8049 gene locus_tag LOCUS_12520 7846 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367258.1 protein_id gnl|my_center|LOCUS_12520 8448 10457 gene locus_tag LOCUS_12530 8448 10457 CDS product transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895632.1 protein_id gnl|my_center|LOCUS_12530 10581 10907 gene locus_tag LOCUS_12540 10581 10907 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367483.1 protein_id gnl|my_center|LOCUS_12540 10945 11349 gene locus_tag LOCUS_12550 10945 11349 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902663.1 protein_id gnl|my_center|LOCUS_12550 11364 12491 gene locus_tag LOCUS_12560 11364 12491 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_12560 12604 13569 gene locus_tag LOCUS_12570 gene gctA 12604 13569 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_12570 13572 14375 gene locus_tag LOCUS_12580 gene gctB 13572 14375 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_12580 14391 16145 gene locus_tag LOCUS_12590 14391 16145 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_12590 16286 17521 gene locus_tag LOCUS_12600 16286 17521 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902653.1 protein_id gnl|my_center|LOCUS_12600 17553 18347 gene locus_tag LOCUS_12610 17553 18347 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902652.1 protein_id gnl|my_center|LOCUS_12610 18418 19746 gene locus_tag LOCUS_12620 18418 19746 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016225.1 protein_id gnl|my_center|LOCUS_12620 19768 20916 gene locus_tag LOCUS_12630 19768 20916 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 protein_id gnl|my_center|LOCUS_12630 20926 21519 gene locus_tag LOCUS_12640 20926 21519 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902649.1 protein_id gnl|my_center|LOCUS_12640 21763 22002 gene locus_tag LOCUS_12650 21763 22002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence29 462 88 gene locus_tag LOCUS_12660 462 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2033 615 gene locus_tag LOCUS_12670 2033 615 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797259.1 protein_id gnl|my_center|LOCUS_12670 3259 2171 gene locus_tag LOCUS_12680 gene ftsZ 3259 2171 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902285.1 protein_id gnl|my_center|LOCUS_12680 4607 3282 gene locus_tag LOCUS_12690 gene ftsA 4607 3282 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902286.1 protein_id gnl|my_center|LOCUS_12690 5311 4604 gene locus_tag LOCUS_12700 5311 4604 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898188.1 protein_id gnl|my_center|LOCUS_12700 6187 5324 gene locus_tag LOCUS_12710 6187 5324 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480619.1 protein_id gnl|my_center|LOCUS_12710 7045 6200 gene locus_tag LOCUS_12720 gene murB 7045 6200 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898186.1 protein_id gnl|my_center|LOCUS_12720 8424 7042 gene locus_tag LOCUS_12730 gene murC 8424 7042 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626924.1 protein_id gnl|my_center|LOCUS_12730 9493 8429 gene locus_tag LOCUS_12740 gene murG 9493 8429 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626926.1 protein_id gnl|my_center|LOCUS_12740 10799 9501 gene locus_tag LOCUS_12750 gene murD 10799 9501 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597345.1 protein_id gnl|my_center|LOCUS_12750 11884 10799 gene locus_tag LOCUS_12760 gene mraY 11884 10799 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902299.1 protein_id gnl|my_center|LOCUS_12760 13728 11899 gene locus_tag LOCUS_12770 gene gmhB 13728 11899 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797249.1 protein_id gnl|my_center|LOCUS_12770 14989 14012 gene locus_tag LOCUS_12780 14989 14012 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705465.1 protein_id gnl|my_center|LOCUS_12780 15125 15487 gene locus_tag LOCUS_12790 15125 15487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 16131 15493 gene locus_tag LOCUS_12800 16131 15493 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211251.1 protein_id gnl|my_center|LOCUS_12800 16687 16229 gene locus_tag LOCUS_12810 16687 16229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 17814 16705 gene locus_tag LOCUS_12820 17814 16705 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_12820 18522 17977 gene locus_tag LOCUS_12830 18522 17977 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_12830 18978 18538 gene locus_tag LOCUS_12840 18978 18538 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642289.1 protein_id gnl|my_center|LOCUS_12840 19942 19079 gene locus_tag LOCUS_12850 19942 19079 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989461.1 protein_id gnl|my_center|LOCUS_12850 21329 19959 gene locus_tag LOCUS_12860 21329 19959 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence30 298 747 gene locus_tag LOCUS_12870 298 747 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015995.1 protein_id gnl|my_center|LOCUS_12870 835 1263 gene locus_tag LOCUS_12880 835 1263 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_12880 1528 1680 gene locus_tag LOCUS_12890 gene rpmG 1528 1680 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904076.1 protein_id gnl|my_center|LOCUS_12890 1708 1783 gene locus_tag LOCUS_t00370 1708 1783 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1812 1988 gene locus_tag LOCUS_12900 gene secE 1812 1988 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904075.1 protein_id gnl|my_center|LOCUS_12900 1985 2566 gene locus_tag LOCUS_12910 gene nusG 1985 2566 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904074.1 protein_id gnl|my_center|LOCUS_12910 2601 3026 gene locus_tag LOCUS_12920 gene rplK 2601 3026 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894933.1 protein_id gnl|my_center|LOCUS_12920 3087 3794 gene locus_tag LOCUS_12930 gene rplA 3087 3794 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015994.1 protein_id gnl|my_center|LOCUS_12930 3950 4462 gene locus_tag LOCUS_12940 gene rplJ 3950 4462 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904072.1 protein_id gnl|my_center|LOCUS_12940 4511 4876 gene locus_tag LOCUS_12950 gene rplL 4511 4876 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005889295.1 protein_id gnl|my_center|LOCUS_12950 5295 8849 gene locus_tag LOCUS_12960 gene rpoB 5295 8849 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015993.1 protein_id gnl|my_center|LOCUS_12960 8885 12844 gene locus_tag LOCUS_12970 gene rpoC 8885 12844 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904068.1 protein_id gnl|my_center|LOCUS_12970 12944 13822 gene locus_tag LOCUS_12980 12944 13822 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015992.1 protein_id gnl|my_center|LOCUS_12980 13835 14392 gene locus_tag LOCUS_12990 gene gmk 13835 14392 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_12990 14394 14615 gene locus_tag LOCUS_13000 14394 14615 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894911.1 protein_id gnl|my_center|LOCUS_13000 14599 15615 gene locus_tag LOCUS_13010 14599 15615 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894909.1 protein_id gnl|my_center|LOCUS_13010 15692 17713 gene locus_tag LOCUS_13020 15692 17713 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015989.1 protein_id gnl|my_center|LOCUS_13020 18183 17854 gene locus_tag LOCUS_13030 18183 17854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 18426 18268 gene locus_tag LOCUS_13040 18426 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13040 18468 18890 gene locus_tag LOCUS_13050 18468 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 18976 20829 gene locus_tag LOCUS_13060 18976 20829 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904062.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence31 1286 723 gene locus_tag LOCUS_13070 1286 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896139.1 protein_id gnl|my_center|LOCUS_13070 2078 1302 gene locus_tag LOCUS_13080 2078 1302 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_13080 2899 2075 gene locus_tag LOCUS_13090 2899 2075 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017062.1 protein_id gnl|my_center|LOCUS_13090 4171 2915 gene locus_tag LOCUS_13100 gene rpoD 4171 2915 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796886.1 protein_id gnl|my_center|LOCUS_13100 6012 4201 gene locus_tag LOCUS_13110 gene dnaG 6012 4201 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017064.1 protein_id gnl|my_center|LOCUS_13110 7769 6078 gene locus_tag LOCUS_13120 7769 6078 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627831.1 protein_id gnl|my_center|LOCUS_13120 9183 7798 gene locus_tag LOCUS_13130 9183 7798 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896128.1 protein_id gnl|my_center|LOCUS_13130 10292 9273 gene locus_tag LOCUS_13140 10292 9273 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017067.1 protein_id gnl|my_center|LOCUS_13140 10970 10293 gene locus_tag LOCUS_13150 10970 10293 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017068.1 protein_id gnl|my_center|LOCUS_13150 12121 10958 gene locus_tag LOCUS_13160 gene dxr 12121 10958 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373191.1 protein_id gnl|my_center|LOCUS_13160 13036 12143 gene locus_tag LOCUS_13170 13036 12143 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017070.1 protein_id gnl|my_center|LOCUS_13170 13721 13029 gene locus_tag LOCUS_13180 13721 13029 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_13180 14757 13864 gene locus_tag LOCUS_13190 14757 13864 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017072.1 protein_id gnl|my_center|LOCUS_13190 14971 14759 gene locus_tag LOCUS_13200 gene xseB 14971 14759 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899316.1 protein_id gnl|my_center|LOCUS_13200 15562 15014 gene locus_tag LOCUS_13210 gene rsmD 15562 15014 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_13210 16612 15575 gene locus_tag LOCUS_13220 gene queA 16612 15575 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627822.1 protein_id gnl|my_center|LOCUS_13220 17717 16587 gene locus_tag LOCUS_13230 gene prmC 17717 16587 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495074.1 protein_id gnl|my_center|LOCUS_13230 18790 17717 gene locus_tag LOCUS_13240 gene prfA 18790 17717 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796873.1 protein_id gnl|my_center|LOCUS_13240 19248 18814 gene locus_tag LOCUS_13250 19248 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495076.1 protein_id gnl|my_center|LOCUS_13250 20281 19253 gene locus_tag LOCUS_13260 20281 19253 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491986.1 protein_id gnl|my_center|LOCUS_13260 20658 20377 gene locus_tag LOCUS_13270 gene yajC 20658 20377 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017079.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence32 6594 232 gene locus_tag LOCUS_13280 6594 232 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155282710.1 protein_id gnl|my_center|LOCUS_13280 8152 6965 gene locus_tag LOCUS_13290 8152 6965 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016002.1 protein_id gnl|my_center|LOCUS_13290 8372 9718 gene locus_tag LOCUS_13300 8372 9718 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016003.1 protein_id gnl|my_center|LOCUS_13300 10321 9767 gene locus_tag LOCUS_13310 10321 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796956.1 protein_id gnl|my_center|LOCUS_13310 10649 11407 gene locus_tag LOCUS_13320 10649 11407 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016102.1 protein_id gnl|my_center|LOCUS_13320 12442 11681 gene locus_tag LOCUS_13330 12442 11681 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_13330 13095 12655 gene locus_tag LOCUS_13340 gene aroQ 13095 12655 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903558.1 protein_id gnl|my_center|LOCUS_13340 13879 13076 gene locus_tag LOCUS_13350 13879 13076 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627323.1 protein_id gnl|my_center|LOCUS_13350 14133 13876 gene locus_tag LOCUS_13360 14133 13876 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895255.1 protein_id gnl|my_center|LOCUS_13360 14644 14099 gene locus_tag LOCUS_13370 14644 14099 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367407.1 protein_id gnl|my_center|LOCUS_13370 14758 16011 gene locus_tag LOCUS_13380 14758 16011 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903562.1 protein_id gnl|my_center|LOCUS_13380 16090 16278 gene locus_tag LOCUS_13390 16090 16278 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005891429.1 protein_id gnl|my_center|LOCUS_13390 16290 17675 gene locus_tag LOCUS_13400 gene asnS 16290 17675 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016098.1 protein_id gnl|my_center|LOCUS_13400 17687 18238 gene locus_tag LOCUS_13410 gene rnmV 17687 18238 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016097.1 protein_id gnl|my_center|LOCUS_13410 18431 18718 gene locus_tag LOCUS_13420 18431 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016096.1 protein_id gnl|my_center|LOCUS_13420 18924 19070 gene locus_tag LOCUS_13430 18924 19070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 19070 19636 gene locus_tag LOCUS_13440 19070 19636 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence33 2230 926 gene locus_tag LOCUS_13450 2230 926 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_13450 2377 2781 gene locus_tag LOCUS_13460 2377 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901689.1 protein_id gnl|my_center|LOCUS_13460 2797 3051 gene locus_tag LOCUS_13470 2797 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016801.1 protein_id gnl|my_center|LOCUS_13470 4421 3141 gene locus_tag LOCUS_13480 gene purD 4421 3141 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016802.1 protein_id gnl|my_center|LOCUS_13480 5951 4437 gene locus_tag LOCUS_13490 gene purH 5951 4437 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016803.1 protein_id gnl|my_center|LOCUS_13490 6784 5975 gene locus_tag LOCUS_13500 6784 5975 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016805.1 protein_id gnl|my_center|LOCUS_13500 7372 6821 gene locus_tag LOCUS_13510 7372 6821 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016806.1 protein_id gnl|my_center|LOCUS_13510 8379 7360 gene locus_tag LOCUS_13520 gene purM 8379 7360 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016807.1 protein_id gnl|my_center|LOCUS_13520 9744 8395 gene locus_tag LOCUS_13530 gene purF 9744 8395 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016808.1 protein_id gnl|my_center|LOCUS_13530 10493 9780 gene locus_tag LOCUS_13540 10493 9780 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016809.1 protein_id gnl|my_center|LOCUS_13540 11182 10709 gene locus_tag LOCUS_13550 gene purE 11182 10709 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016810.1 protein_id gnl|my_center|LOCUS_13550 14932 11195 gene locus_tag LOCUS_13560 14932 11195 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494805.1 protein_id gnl|my_center|LOCUS_13560 15386 16171 gene locus_tag LOCUS_13570 gene pssA 15386 16171 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016812.1 protein_id gnl|my_center|LOCUS_13570 16177 17253 gene locus_tag LOCUS_13580 16177 17253 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_13580 17257 18708 gene locus_tag LOCUS_13590 17257 18708 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_13590 20009 18783 gene locus_tag LOCUS_13600 20009 18783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914987.1 protein_id gnl|my_center|LOCUS_13600 20668 20006 gene locus_tag LOCUS_13610 20668 20006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903416.1 protein_id gnl|my_center|LOCUS_13610 21849 20698 gene locus_tag LOCUS_13620 21849 20698 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898025.1 protein_id gnl|my_center|LOCUS_13620 23157 21862 gene locus_tag LOCUS_13630 23157 21862 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494851.1 protein_id gnl|my_center|LOCUS_13630 24090 23236 gene locus_tag LOCUS_13640 24090 23236 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016676.1 protein_id gnl|my_center|LOCUS_13640 26031 24226 gene locus_tag LOCUS_13650 gene hflX 26031 24226 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016675.1 protein_id gnl|my_center|LOCUS_13650 26570 26052 gene locus_tag LOCUS_13660 26570 26052 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903422.1 protein_id gnl|my_center|LOCUS_13660 27559 26672 gene locus_tag LOCUS_13670 27559 26672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480275.1 protein_id gnl|my_center|LOCUS_13670 29041 27662 gene locus_tag LOCUS_13680 29041 27662 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016673.1 protein_id gnl|my_center|LOCUS_13680 36591 29215 gene locus_tag LOCUS_13690 36591 29215 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895630.1 protein_id gnl|my_center|LOCUS_13690 37195 36611 gene locus_tag LOCUS_13700 37195 36611 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627726.1 protein_id gnl|my_center|LOCUS_13700 38672 37320 gene locus_tag LOCUS_13710 38672 37320 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_13710 40692 38686 gene locus_tag LOCUS_13720 40692 38686 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016672.1 protein_id gnl|my_center|LOCUS_13720 40991 40842 gene locus_tag LOCUS_13730 40991 40842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 43179 41032 gene locus_tag LOCUS_13740 gene feoB 43179 41032 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_13740 43434 43201 gene locus_tag LOCUS_13750 43434 43201 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_13750 43684 43466 gene locus_tag LOCUS_13760 43684 43466 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_13760 44162 44437 gene locus_tag LOCUS_13770 44162 44437 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898015.1 protein_id gnl|my_center|LOCUS_13770 45250 44468 gene locus_tag LOCUS_13780 45250 44468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815083.1 protein_id gnl|my_center|LOCUS_13780 46308 45250 gene locus_tag LOCUS_13790 46308 45250 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815086.1 protein_id gnl|my_center|LOCUS_13790 47846 46320 gene locus_tag LOCUS_13800 47846 46320 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815088.1 protein_id gnl|my_center|LOCUS_13800 48302 47874 gene locus_tag LOCUS_13810 48302 47874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 49495 48542 gene locus_tag LOCUS_13820 49495 48542 CDS product DUF4299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016666.1 protein_id gnl|my_center|LOCUS_13820 50530 49508 gene locus_tag LOCUS_13830 50530 49508 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016665.1 protein_id gnl|my_center|LOCUS_13830 50993 50541 gene locus_tag LOCUS_13840 gene trmL 50993 50541 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_13840 51644 51021 gene locus_tag LOCUS_13850 51644 51021 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_13850 51755 52492 gene locus_tag LOCUS_13860 gene kdsB 51755 52492 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_13860 52509 54086 gene locus_tag LOCUS_13870 52509 54086 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779462.1 protein_id gnl|my_center|LOCUS_13870 54099 54842 gene locus_tag LOCUS_13880 54099 54842 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626384.1 protein_id gnl|my_center|LOCUS_13880 55014 55511 gene locus_tag LOCUS_13890 55014 55511 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903104.1 protein_id gnl|my_center|LOCUS_13890 55670 56326 gene locus_tag LOCUS_13900 55670 56326 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016660.1 protein_id gnl|my_center|LOCUS_13900 56344 57855 gene locus_tag LOCUS_13910 gene msrAB 56344 57855 CDS product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626387.1 protein_id gnl|my_center|LOCUS_13910 58497 59207 gene locus_tag LOCUS_13920 58497 59207 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_13920 59200 59928 gene locus_tag LOCUS_13930 59200 59928 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016658.1 protein_id gnl|my_center|LOCUS_13930 59958 60686 gene locus_tag LOCUS_13940 59958 60686 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_13940 60780 62675 gene locus_tag LOCUS_13950 60780 62675 CDS product glycogen-debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016656.1 protein_id gnl|my_center|LOCUS_13950 64678 62741 gene locus_tag LOCUS_13960 64678 62741 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016655.1 protein_id gnl|my_center|LOCUS_13960 67458 64903 gene locus_tag LOCUS_13970 gene ppdK 67458 64903 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016653.1 protein_id gnl|my_center|LOCUS_13970 68066 67470 gene locus_tag LOCUS_13980 68066 67470 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016652.1 protein_id gnl|my_center|LOCUS_13980 70370 68349 gene locus_tag LOCUS_13990 70370 68349 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016651.1 protein_id gnl|my_center|LOCUS_13990 71924 70389 gene locus_tag LOCUS_14000 gene hutH 71924 70389 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_14000 72281 73399 gene locus_tag LOCUS_14010 72281 73399 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897979.1 protein_id gnl|my_center|LOCUS_14010 73417 74259 gene locus_tag LOCUS_14020 73417 74259 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903458.1 protein_id gnl|my_center|LOCUS_14020 74345 74764 gene locus_tag LOCUS_14030 74345 74764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903459.1 protein_id gnl|my_center|LOCUS_14030 76064 74889 gene locus_tag LOCUS_14040 76064 74889 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903460.1 protein_id gnl|my_center|LOCUS_14040 76877 76089 gene locus_tag LOCUS_14050 76877 76089 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903461.1 protein_id gnl|my_center|LOCUS_14050 78044 76899 gene locus_tag LOCUS_14060 78044 76899 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_14060 78249 78980 gene locus_tag LOCUS_14070 78249 78980 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903463.1 protein_id gnl|my_center|LOCUS_14070 78992 79750 gene locus_tag LOCUS_14080 78992 79750 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367097.1 protein_id gnl|my_center|LOCUS_14080 79771 80262 gene locus_tag LOCUS_14090 79771 80262 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903465.1 protein_id gnl|my_center|LOCUS_14090 80281 81168 gene locus_tag LOCUS_14100 80281 81168 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 protein_id gnl|my_center|LOCUS_14100 81177 82403 gene locus_tag LOCUS_14110 81177 82403 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_14110 82432 84234 gene locus_tag LOCUS_14120 gene lepA 82432 84234 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897958.1 protein_id gnl|my_center|LOCUS_14120 85275 84292 gene locus_tag LOCUS_14130 gene asnA 85275 84292 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903470.1 protein_id gnl|my_center|LOCUS_14130 86726 85350 gene locus_tag LOCUS_14140 86726 85350 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_14140 87697 86753 gene locus_tag LOCUS_14150 87697 86753 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133519.1 protein_id gnl|my_center|LOCUS_14150 88536 87718 gene locus_tag LOCUS_14160 88536 87718 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_14160 88699 90057 gene locus_tag LOCUS_14170 88699 90057 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_14170 91422 90133 gene locus_tag LOCUS_14180 91422 90133 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016643.1 protein_id gnl|my_center|LOCUS_14180 92357 91542 gene locus_tag LOCUS_14190 92357 91542 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794746.1 protein_id gnl|my_center|LOCUS_14190 92938 92429 gene locus_tag LOCUS_14200 92938 92429 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016640.1 protein_id gnl|my_center|LOCUS_14200 94170 92935 gene locus_tag LOCUS_14210 94170 92935 CDS product coproporphyrinogen-III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016639.1 protein_id gnl|my_center|LOCUS_14210 95035 94259 gene locus_tag LOCUS_14220 95035 94259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016638.1 protein_id gnl|my_center|LOCUS_14220 96000 95035 gene locus_tag LOCUS_14230 96000 95035 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903477.1 protein_id gnl|my_center|LOCUS_14230 98183 96015 gene locus_tag LOCUS_14240 98183 96015 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023036708.1 protein_id gnl|my_center|LOCUS_14240 99142 98252 gene locus_tag LOCUS_14250 99142 98252 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626402.1 protein_id gnl|my_center|LOCUS_14250 99781 99371 gene locus_tag LOCUS_14260 gene mscL 99781 99371 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_14260 100928 99840 gene locus_tag LOCUS_14270 gene mnmA 100928 99840 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016634.1 protein_id gnl|my_center|LOCUS_14270 101563 100940 gene locus_tag LOCUS_14280 101563 100940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 101681 102037 gene locus_tag LOCUS_14290 101681 102037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903484.1 protein_id gnl|my_center|LOCUS_14290 102935 102165 gene locus_tag LOCUS_14300 102935 102165 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903485.1 protein_id gnl|my_center|LOCUS_14300 103194 104003 gene locus_tag LOCUS_14310 103194 104003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903486.1 protein_id gnl|my_center|LOCUS_14310 104005 104583 gene locus_tag LOCUS_14320 104005 104583 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903487.1 protein_id gnl|my_center|LOCUS_14320 104601 105647 gene locus_tag LOCUS_14330 104601 105647 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367094.1 protein_id gnl|my_center|LOCUS_14330 105665 106210 gene locus_tag LOCUS_14340 gene scpB 105665 106210 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903489.1 protein_id gnl|my_center|LOCUS_14340 106200 106904 gene locus_tag LOCUS_14350 106200 106904 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903490.1 protein_id gnl|my_center|LOCUS_14350 106913 107203 gene locus_tag LOCUS_14360 gene gatC 106913 107203 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903491.1 protein_id gnl|my_center|LOCUS_14360 107212 108666 gene locus_tag LOCUS_14370 gene gatA 107212 108666 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903492.1 protein_id gnl|my_center|LOCUS_14370 108681 110126 gene locus_tag LOCUS_14380 gene gatB 108681 110126 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016630.1 protein_id gnl|my_center|LOCUS_14380 110289 110107 gene locus_tag LOCUS_14390 110289 110107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 110420 111367 gene locus_tag LOCUS_14400 gene pip 110420 111367 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016629.1 protein_id gnl|my_center|LOCUS_14400 111392 112402 gene locus_tag LOCUS_14410 111392 112402 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902407.1 protein_id gnl|my_center|LOCUS_14410 112418 113143 gene locus_tag LOCUS_14420 112418 113143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016628.1 protein_id gnl|my_center|LOCUS_14420 113161 114390 gene locus_tag LOCUS_14430 113161 114390 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367093.1 protein_id gnl|my_center|LOCUS_14430 114496 115845 gene locus_tag LOCUS_14440 114496 115845 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367092.1 protein_id gnl|my_center|LOCUS_14440 115842 116357 gene locus_tag LOCUS_14450 115842 116357 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016625.1 protein_id gnl|my_center|LOCUS_14450 116864 116376 gene locus_tag LOCUS_14460 gene ybeY 116864 116376 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016624.1 protein_id gnl|my_center|LOCUS_14460 118957 116882 gene locus_tag LOCUS_14470 118957 116882 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626410.1 protein_id gnl|my_center|LOCUS_14470 121437 118975 gene locus_tag LOCUS_14480 121437 118975 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480299.1 protein_id gnl|my_center|LOCUS_14480 121929 121459 gene locus_tag LOCUS_14490 121929 121459 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016620.1 protein_id gnl|my_center|LOCUS_14490 122291 123256 gene locus_tag LOCUS_14500 gene ftcD 122291 123256 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016619.1 protein_id gnl|my_center|LOCUS_14500 123791 123982 gene locus_tag LOCUS_14510 123791 123982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 124165 125406 gene locus_tag LOCUS_14520 gene hutI 124165 125406 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016618.1 protein_id gnl|my_center|LOCUS_14520 125428 126066 gene locus_tag LOCUS_14530 125428 126066 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902437.1 protein_id gnl|my_center|LOCUS_14530 126388 126122 gene locus_tag LOCUS_14540 126388 126122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 127203 126655 gene locus_tag LOCUS_14550 127203 126655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14550 128799 127483 gene locus_tag LOCUS_14560 128799 127483 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_14560 129929 128799 gene locus_tag LOCUS_14570 129929 128799 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_14570 130026 131483 gene locus_tag LOCUS_14580 gene thrC 130026 131483 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_14580 131471 132355 gene locus_tag LOCUS_14590 gene thrB 131471 132355 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_14590 132336 133427 gene locus_tag LOCUS_14600 gene asd 132336 133427 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_14600 133447 133776 gene locus_tag LOCUS_14610 133447 133776 CDS product DUF1904 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016617.1 protein_id gnl|my_center|LOCUS_14610 133778 134581 gene locus_tag LOCUS_14620 133778 134581 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016616.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence34 592 2127 gene locus_tag LOCUS_14630 592 2127 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_14630 2209 3135 gene locus_tag LOCUS_14640 2209 3135 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_14640 3148 4017 gene locus_tag LOCUS_14650 3148 4017 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_14650 4036 5043 gene locus_tag LOCUS_14660 4036 5043 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_14660 5036 6010 gene locus_tag LOCUS_14670 5036 6010 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_14670 12721 6083 gene locus_tag LOCUS_14680 12721 6083 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155282710.1 protein_id gnl|my_center|LOCUS_14680 13750 12773 gene locus_tag LOCUS_14690 13750 12773 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779459.1 protein_id gnl|my_center|LOCUS_14690 14710 13760 gene locus_tag LOCUS_14700 14710 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155282994.1 protein_id gnl|my_center|LOCUS_14700 17029 14711 gene locus_tag LOCUS_14710 gene pelG 17029 14711 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902578.1 protein_id gnl|my_center|LOCUS_14710 18452 17031 gene locus_tag LOCUS_14720 gene pelF 18452 17031 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016350.1 protein_id gnl|my_center|LOCUS_14720 19158 18460 gene locus_tag LOCUS_14730 19158 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence35 1943 396 gene locus_tag LOCUS_14740 1943 396 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480816.1 protein_id gnl|my_center|LOCUS_14740 2832 2023 gene locus_tag LOCUS_14750 2832 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842660.1 protein_id gnl|my_center|LOCUS_14750 4285 3113 gene locus_tag LOCUS_14760 4285 3113 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016028.1 protein_id gnl|my_center|LOCUS_14760 4856 4278 gene locus_tag LOCUS_14770 4856 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842662.1 protein_id gnl|my_center|LOCUS_14770 5367 4804 gene locus_tag LOCUS_14780 5367 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895049.1 protein_id gnl|my_center|LOCUS_14780 5782 5369 gene locus_tag LOCUS_14790 5782 5369 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895052.1 protein_id gnl|my_center|LOCUS_14790 6454 5951 gene locus_tag LOCUS_14800 6454 5951 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016032.1 protein_id gnl|my_center|LOCUS_14800 6915 6439 gene locus_tag LOCUS_14810 6915 6439 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491830.1 protein_id gnl|my_center|LOCUS_14810 8166 7126 gene locus_tag LOCUS_14820 8166 7126 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016034.1 protein_id gnl|my_center|LOCUS_14820 9407 8163 gene locus_tag LOCUS_14830 9407 8163 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016035.1 protein_id gnl|my_center|LOCUS_14830 9935 9753 gene locus_tag LOCUS_14840 9935 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895068.1 protein_id gnl|my_center|LOCUS_14840 10426 9935 gene locus_tag LOCUS_14850 10426 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14850 10737 11606 gene locus_tag LOCUS_14860 10737 11606 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_14860 11688 12179 gene locus_tag LOCUS_14870 11688 12179 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_14870 12220 12894 gene locus_tag LOCUS_14880 12220 12894 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_14880 14092 13067 gene locus_tag LOCUS_14890 14092 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 14966 14109 gene locus_tag LOCUS_14900 14966 14109 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288523.1 protein_id gnl|my_center|LOCUS_14900 15756 14968 gene locus_tag LOCUS_14910 15756 14968 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288522.1 protein_id gnl|my_center|LOCUS_14910 16504 15767 gene locus_tag LOCUS_14920 16504 15767 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_14920 17395 16535 gene locus_tag LOCUS_14930 17395 16535 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101921.1 protein_id gnl|my_center|LOCUS_14930 18047 17499 gene locus_tag LOCUS_14940 18047 17499 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence36 158 1780 gene locus_tag LOCUS_14950 158 1780 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_14950 4504 1841 gene locus_tag LOCUS_14960 4504 1841 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015981.1 protein_id gnl|my_center|LOCUS_14960 5224 4640 gene locus_tag LOCUS_14970 gene yihA 5224 4640 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894870.1 protein_id gnl|my_center|LOCUS_14970 7546 5240 gene locus_tag LOCUS_14980 gene lon 7546 5240 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015983.1 protein_id gnl|my_center|LOCUS_14980 8840 7569 gene locus_tag LOCUS_14990 gene clpX 8840 7569 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015984.1 protein_id gnl|my_center|LOCUS_14990 9433 8852 gene locus_tag LOCUS_15000 gene clpP 9433 8852 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894880.1 protein_id gnl|my_center|LOCUS_15000 11109 9730 gene locus_tag LOCUS_15010 gene tig 11109 9730 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015985.1 protein_id gnl|my_center|LOCUS_15010 12790 11126 gene locus_tag LOCUS_15020 gene recJ 12790 11126 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367291.1 protein_id gnl|my_center|LOCUS_15020 13161 12799 gene locus_tag LOCUS_15030 gene rbfA 13161 12799 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903343.1 protein_id gnl|my_center|LOCUS_15030 15390 13177 gene locus_tag LOCUS_15040 gene infB 15390 13177 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894893.1 protein_id gnl|my_center|LOCUS_15040 15935 15405 gene locus_tag LOCUS_15050 15935 15405 CDS product DUF448 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903345.1 protein_id gnl|my_center|LOCUS_15050 17004 15928 gene locus_tag LOCUS_15060 gene nusA 17004 15928 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903346.1 protein_id gnl|my_center|LOCUS_15060 17502 17032 gene locus_tag LOCUS_15070 17502 17032 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 protein_id gnl|my_center|LOCUS_15070 17773 17666 gene locus_tag LOCUS_r00030 17773 17666 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence37 811 170 gene locus_tag LOCUS_15080 811 170 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810396.1 protein_id gnl|my_center|LOCUS_15080 969 1964 gene locus_tag LOCUS_15090 969 1964 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_15090 1976 3166 gene locus_tag LOCUS_15100 gene gltS 1976 3166 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392508.1 protein_id gnl|my_center|LOCUS_15100 3211 4236 gene locus_tag LOCUS_15110 3211 4236 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937322.1 protein_id gnl|my_center|LOCUS_15110 4251 4742 gene locus_tag LOCUS_15120 4251 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4739 6049 gene locus_tag LOCUS_15130 4739 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6774 6106 gene locus_tag LOCUS_15140 6774 6106 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017137.1 protein_id gnl|my_center|LOCUS_15140 8153 6783 gene locus_tag LOCUS_15150 8153 6783 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017136.1 protein_id gnl|my_center|LOCUS_15150 8331 9488 gene locus_tag LOCUS_15160 8331 9488 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_15160 9501 10796 gene locus_tag LOCUS_15170 9501 10796 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626870.1 protein_id gnl|my_center|LOCUS_15170 10827 11876 gene locus_tag LOCUS_15180 10827 11876 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_15180 11891 13045 gene locus_tag LOCUS_15190 gene mtnK 11891 13045 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017133.1 protein_id gnl|my_center|LOCUS_15190 14313 13099 gene locus_tag LOCUS_15200 gene ilvA 14313 13099 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_15200 15971 14577 gene locus_tag LOCUS_15210 15971 14577 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 protein_id gnl|my_center|LOCUS_15210 17165 15993 gene locus_tag LOCUS_15220 17165 15993 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868916.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence38 <1 1207 gene locus_tag LOCUS_15230 <1 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016733.1:spore photoproduct lyase 1539 2255 gene locus_tag LOCUS_15240 1539 2255 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 protein_id gnl|my_center|LOCUS_15240 2262 3044 gene locus_tag LOCUS_15250 2262 3044 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016735.1 protein_id gnl|my_center|LOCUS_15250 3054 3641 gene locus_tag LOCUS_15260 3054 3641 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016736.1 protein_id gnl|my_center|LOCUS_15260 3634 4176 gene locus_tag LOCUS_15270 3634 4176 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627936.1 protein_id gnl|my_center|LOCUS_15270 4185 5156 gene locus_tag LOCUS_15280 4185 5156 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016738.1 protein_id gnl|my_center|LOCUS_15280 5166 6749 gene locus_tag LOCUS_15290 5166 6749 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016739.1 protein_id gnl|my_center|LOCUS_15290 6826 7098 gene locus_tag LOCUS_15300 6826 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7479 7156 gene locus_tag LOCUS_15310 7479 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147387007.1 protein_id gnl|my_center|LOCUS_15310 8507 7500 gene locus_tag LOCUS_15320 8507 7500 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_15320 9385 8696 gene locus_tag LOCUS_15330 9385 8696 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016742.1 protein_id gnl|my_center|LOCUS_15330 10304 9378 gene locus_tag LOCUS_15340 gene ricT 10304 9378 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903716.1 protein_id gnl|my_center|LOCUS_15340 11046 10318 gene locus_tag LOCUS_15350 gene radC 11046 10318 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_15350 12120 11056 gene locus_tag LOCUS_15360 gene cobT 12120 11056 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016744.1 protein_id gnl|my_center|LOCUS_15360 12710 12135 gene locus_tag LOCUS_15370 12710 12135 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903719.1 protein_id gnl|my_center|LOCUS_15370 13553 12723 gene locus_tag LOCUS_15380 gene cobS 13553 12723 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_15380 14129 13566 gene locus_tag LOCUS_15390 gene cobU 14129 13566 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016746.1 protein_id gnl|my_center|LOCUS_15390 14932 14192 gene locus_tag LOCUS_15400 14932 14192 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016747.1 protein_id gnl|my_center|LOCUS_15400 15441 14947 gene locus_tag LOCUS_15410 15441 14947 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016748.1 protein_id gnl|my_center|LOCUS_15410 15941 15471 gene locus_tag LOCUS_15420 15941 15471 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903724.1 protein_id gnl|my_center|LOCUS_15420 16042 17043 gene locus_tag LOCUS_15430 16042 17043 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626320.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence39 1000 455 gene locus_tag LOCUS_15440 gene raiA 1000 455 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016408.1 protein_id gnl|my_center|LOCUS_15440 2043 1072 gene locus_tag LOCUS_15450 gene hemB 2043 1072 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016407.1 protein_id gnl|my_center|LOCUS_15450 2942 2055 gene locus_tag LOCUS_15460 2942 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495555.1 protein_id gnl|my_center|LOCUS_15460 3327 2962 gene locus_tag LOCUS_15470 3327 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4150 3329 gene locus_tag LOCUS_15480 4150 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016405.1 protein_id gnl|my_center|LOCUS_15480 5785 4379 gene locus_tag LOCUS_15490 5785 4379 CDS product putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797038.1 protein_id gnl|my_center|LOCUS_15490 6451 5912 gene locus_tag LOCUS_15500 6451 5912 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016402.1 protein_id gnl|my_center|LOCUS_15500 8297 6822 gene locus_tag LOCUS_15510 8297 6822 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903237.1 protein_id gnl|my_center|LOCUS_15510 10167 8413 gene locus_tag LOCUS_15520 10167 8413 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016401.1 protein_id gnl|my_center|LOCUS_15520 12120 10297 gene locus_tag LOCUS_15530 gene glmS 12120 10297 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016400.1 protein_id gnl|my_center|LOCUS_15530 12510 12424 gene locus_tag LOCUS_t00380 12510 12424 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12595 12519 gene locus_tag LOCUS_t00390 12595 12519 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12731 12655 gene locus_tag LOCUS_t00400 12731 12655 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12953 13726 gene locus_tag LOCUS_15540 12953 13726 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016390.1 protein_id gnl|my_center|LOCUS_15540 13741 14928 gene locus_tag LOCUS_15550 13741 14928 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016389.1 protein_id gnl|my_center|LOCUS_15550 14942 15691 gene locus_tag LOCUS_15560 gene pxpB 14942 15691 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_15560 15684 16754 gene locus_tag LOCUS_15570 15684 16754 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence40 245 2413 gene locus_tag LOCUS_15580 245 2413 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895431.1 protein_id gnl|my_center|LOCUS_15580 2433 4850 gene locus_tag LOCUS_15590 2433 4850 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367423.1 protein_id gnl|my_center|LOCUS_15590 4847 7651 gene locus_tag LOCUS_15600 gene ileS 4847 7651 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903528.1 protein_id gnl|my_center|LOCUS_15600 7660 8118 gene locus_tag LOCUS_15610 gene lspA 7660 8118 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895436.1 protein_id gnl|my_center|LOCUS_15610 8122 8994 gene locus_tag LOCUS_15620 gene glyQ 8122 8994 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903526.1 protein_id gnl|my_center|LOCUS_15620 9303 11363 gene locus_tag LOCUS_15630 gene glyS 9303 11363 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016119.1 protein_id gnl|my_center|LOCUS_15630 11374 11925 gene locus_tag LOCUS_15640 gene folE 11374 11925 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895440.1 protein_id gnl|my_center|LOCUS_15640 12032 13000 gene locus_tag LOCUS_15650 12032 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079007.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence41 118 1995 gene locus_tag LOCUS_15660 118 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2112 3140 gene locus_tag LOCUS_15670 2112 3140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 protein_id gnl|my_center|LOCUS_15670 3147 5408 gene locus_tag LOCUS_15680 3147 5408 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 protein_id gnl|my_center|LOCUS_15680 5495 8011 gene locus_tag LOCUS_15690 gene pglZ 5495 8011 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_15690 8020 10035 gene locus_tag LOCUS_15700 gene brxL 8020 10035 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_15700 10052 10636 gene locus_tag LOCUS_15710 10052 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 10658 11206 gene locus_tag LOCUS_15720 10658 11206 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065384.1 protein_id gnl|my_center|LOCUS_15720 11238 12650 gene locus_tag LOCUS_15730 11238 12650 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860810.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence42 6952 260 gene locus_tag LOCUS_15740 6952 260 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627026.1 protein_id gnl|my_center|LOCUS_15740 7219 7488 gene locus_tag LOCUS_15750 7219 7488 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017121.1 protein_id gnl|my_center|LOCUS_15750 7912 7649 gene locus_tag LOCUS_15760 gene rpsP 7912 7649 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903282.1 protein_id gnl|my_center|LOCUS_15760 9293 7959 gene locus_tag LOCUS_15770 gene ffh 9293 7959 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903281.1 protein_id gnl|my_center|LOCUS_15770 9615 9304 gene locus_tag LOCUS_15780 9615 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 protein_id gnl|my_center|LOCUS_15780 9979 9680 gene locus_tag LOCUS_15790 9979 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903279.1 protein_id gnl|my_center|LOCUS_15790 10208 11122 gene locus_tag LOCUS_15800 gene glsA 10208 11122 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903278.1 protein_id gnl|my_center|LOCUS_15800 11173 12588 gene locus_tag LOCUS_15810 11173 12588 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903277.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence43 1500 391 gene locus_tag LOCUS_15820 1500 391 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016135.1 protein_id gnl|my_center|LOCUS_15820 1625 3496 gene locus_tag LOCUS_15830 1625 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3501 4172 gene locus_tag LOCUS_15840 3501 4172 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 protein_id gnl|my_center|LOCUS_15840 4184 4996 gene locus_tag LOCUS_15850 4184 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 9091 5141 gene locus_tag LOCUS_15860 9091 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 9186 9374 gene locus_tag LOCUS_15870 9186 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 12166 9692 gene locus_tag LOCUS_15880 12166 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence44 347 183 gene locus_tag LOCUS_15890 347 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 2199 334 gene locus_tag LOCUS_15900 2199 334 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 protein_id gnl|my_center|LOCUS_15900 3058 2168 gene locus_tag LOCUS_15910 3058 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016346.1 protein_id gnl|my_center|LOCUS_15910 3429 4403 gene locus_tag LOCUS_15920 gene galE 3429 4403 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902584.1 protein_id gnl|my_center|LOCUS_15920 6113 4467 gene locus_tag LOCUS_15930 6113 4467 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896074.1 protein_id gnl|my_center|LOCUS_15930 7215 6103 gene locus_tag LOCUS_15940 7215 6103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902588.1 protein_id gnl|my_center|LOCUS_15940 8262 7231 gene locus_tag LOCUS_15950 8262 7231 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_15950 10977 8419 gene locus_tag LOCUS_15960 gene recJ 10977 8419 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016344.1 protein_id gnl|my_center|LOCUS_15960 11164 12282 gene locus_tag LOCUS_15970 gene lepB 11164 12282 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491539.1 protein_id gnl|my_center|LOCUS_15970 12374 12805 gene locus_tag LOCUS_15980 gene rimI 12374 12805 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902598.1 protein_id gnl|my_center|LOCUS_15980 12798 14231 gene locus_tag LOCUS_15990 gene purB 12798 14231 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016341.1 protein_id gnl|my_center|LOCUS_15990 14486 15004 gene locus_tag LOCUS_16000 14486 15004 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902602.1 protein_id gnl|my_center|LOCUS_16000 15026 16384 gene locus_tag LOCUS_16010 gene glmM 15026 16384 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902604.1 protein_id gnl|my_center|LOCUS_16010 16721 16518 gene locus_tag LOCUS_16020 16721 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 16675 16932 gene locus_tag LOCUS_16030 16675 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 16964 17749 gene locus_tag LOCUS_16040 gene atpB 16964 17749 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_16040 17787 18056 gene locus_tag LOCUS_16050 gene atpE 17787 18056 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_16050 18097 18588 gene locus_tag LOCUS_16060 gene atpF 18097 18588 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902611.1 protein_id gnl|my_center|LOCUS_16060 18585 19109 gene locus_tag LOCUS_16070 gene atpH 18585 19109 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 protein_id gnl|my_center|LOCUS_16070 19134 20636 gene locus_tag LOCUS_16080 gene atpA 19134 20636 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 protein_id gnl|my_center|LOCUS_16080 20647 21495 gene locus_tag LOCUS_16090 gene atpG 20647 21495 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016336.1 protein_id gnl|my_center|LOCUS_16090 21524 22912 gene locus_tag LOCUS_16100 gene atpD 21524 22912 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016335.1 protein_id gnl|my_center|LOCUS_16100 22922 23326 gene locus_tag LOCUS_16110 gene atpC 22922 23326 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016334.1 protein_id gnl|my_center|LOCUS_16110 23347 23718 gene locus_tag LOCUS_16120 23347 23718 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_16120 23995 25146 gene locus_tag LOCUS_16130 gene metK 23995 25146 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016332.1 protein_id gnl|my_center|LOCUS_16130 25160 25537 gene locus_tag LOCUS_16140 25160 25537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 26641 25727 gene locus_tag LOCUS_16150 gene ilvE 26641 25727 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_16150 27775 26900 gene locus_tag LOCUS_16160 27775 26900 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627801.1 protein_id gnl|my_center|LOCUS_16160 27864 27940 gene locus_tag LOCUS_t00410 27864 27940 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29326 27944 gene locus_tag LOCUS_16170 gene nhaC 29326 27944 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896009.1 protein_id gnl|my_center|LOCUS_16170 30059 29604 gene locus_tag LOCUS_16180 gene dtd 30059 29604 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373094.1 protein_id gnl|my_center|LOCUS_16180 30173 31678 gene locus_tag LOCUS_16190 30173 31678 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 protein_id gnl|my_center|LOCUS_16190 31740 32642 gene locus_tag LOCUS_16200 31740 32642 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016325.1 protein_id gnl|my_center|LOCUS_16200 32623 33021 gene locus_tag LOCUS_16210 32623 33021 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016324.1 protein_id gnl|my_center|LOCUS_16210 33047 34141 gene locus_tag LOCUS_16220 33047 34141 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627795.1 protein_id gnl|my_center|LOCUS_16220 34138 35277 gene locus_tag LOCUS_16230 34138 35277 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016322.1 protein_id gnl|my_center|LOCUS_16230 35261 35920 gene locus_tag LOCUS_16240 35261 35920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627794.1 protein_id gnl|my_center|LOCUS_16240 35975 36478 gene locus_tag LOCUS_16250 35975 36478 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902631.1 protein_id gnl|my_center|LOCUS_16250 36518 37819 gene locus_tag LOCUS_16260 36518 37819 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016320.1 protein_id gnl|my_center|LOCUS_16260 37925 39235 gene locus_tag LOCUS_16270 37925 39235 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016319.1 protein_id gnl|my_center|LOCUS_16270 39893 39438 gene locus_tag LOCUS_16280 39893 39438 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902636.1 protein_id gnl|my_center|LOCUS_16280 40056 40376 gene locus_tag LOCUS_16290 40056 40376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902637.1 protein_id gnl|my_center|LOCUS_16290 40546 41748 gene locus_tag LOCUS_16300 40546 41748 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902638.1 protein_id gnl|my_center|LOCUS_16300 41791 42339 gene locus_tag LOCUS_16310 41791 42339 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627789.1 protein_id gnl|my_center|LOCUS_16310 42430 43680 gene locus_tag LOCUS_16320 42430 43680 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016314.1 protein_id gnl|my_center|LOCUS_16320 43689 44249 gene locus_tag LOCUS_16330 43689 44249 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016313.1 protein_id gnl|my_center|LOCUS_16330 44266 45321 gene locus_tag LOCUS_16340 gene corA 44266 45321 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901598.1 protein_id gnl|my_center|LOCUS_16340 46334 45360 gene locus_tag LOCUS_16350 46334 45360 CDS product DUF2262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901600.1 protein_id gnl|my_center|LOCUS_16350 46885 46484 gene locus_tag LOCUS_16360 gene rpsI 46885 46484 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901602.1 protein_id gnl|my_center|LOCUS_16360 47335 46901 gene locus_tag LOCUS_16370 gene rplM 47335 46901 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901604.1 protein_id gnl|my_center|LOCUS_16370 47824 49176 gene locus_tag LOCUS_16380 47824 49176 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899369.1 protein_id gnl|my_center|LOCUS_16380 49802 50227 gene locus_tag LOCUS_16390 gene infC 49802 50227 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901608.1 protein_id gnl|my_center|LOCUS_16390 50305 50511 gene locus_tag LOCUS_16400 gene rpmI 50305 50511 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005893833.1 protein_id gnl|my_center|LOCUS_16400 50538 50888 gene locus_tag LOCUS_16410 gene rplT 50538 50888 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901611.1 protein_id gnl|my_center|LOCUS_16410 50935 51018 gene locus_tag LOCUS_t00420 50935 51018 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 51042 51131 gene locus_tag LOCUS_t00430 51042 51131 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 52340 51453 gene locus_tag LOCUS_16420 52340 51453 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901613.1 protein_id gnl|my_center|LOCUS_16420 54323 52500 gene locus_tag LOCUS_16430 gene htpG 54323 52500 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016311.1 protein_id gnl|my_center|LOCUS_16430 56022 54505 gene locus_tag LOCUS_16440 gene garD 56022 54505 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246362.1 protein_id gnl|my_center|LOCUS_16440 56155 57048 gene locus_tag LOCUS_16450 56155 57048 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832366.1 protein_id gnl|my_center|LOCUS_16450 57233 58624 gene locus_tag LOCUS_16460 57233 58624 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392249.1 protein_id gnl|my_center|LOCUS_16460 58653 59540 gene locus_tag LOCUS_16470 gene garR 58653 59540 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369560.1 protein_id gnl|my_center|LOCUS_16470 59630 60958 gene locus_tag LOCUS_16480 59630 60958 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185933582.1 protein_id gnl|my_center|LOCUS_16480 60984 61883 gene locus_tag LOCUS_16490 gene dapA 60984 61883 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169452.1 protein_id gnl|my_center|LOCUS_16490 61894 62736 gene locus_tag LOCUS_16500 61894 62736 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459863.1 protein_id gnl|my_center|LOCUS_16500 63831 62740 gene locus_tag LOCUS_16510 63831 62740 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776693.1 protein_id gnl|my_center|LOCUS_16510 63984 65114 gene locus_tag LOCUS_16520 63984 65114 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 protein_id gnl|my_center|LOCUS_16520 66413 65163 gene locus_tag LOCUS_16530 66413 65163 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_16530 68043 66424 gene locus_tag LOCUS_16540 68043 66424 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627741.1 protein_id gnl|my_center|LOCUS_16540 68920 68051 gene locus_tag LOCUS_16550 68920 68051 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016276.1 protein_id gnl|my_center|LOCUS_16550 70291 68933 gene locus_tag LOCUS_16560 gene pepV 70291 68933 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 protein_id gnl|my_center|LOCUS_16560 71065 70310 gene locus_tag LOCUS_16570 71065 70310 CDS product MlaA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895829.1 protein_id gnl|my_center|LOCUS_16570 72338 71055 gene locus_tag LOCUS_16580 72338 71055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904381.1 protein_id gnl|my_center|LOCUS_16580 76700 72351 gene locus_tag LOCUS_16590 76700 72351 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627746.1 protein_id gnl|my_center|LOCUS_16590 77481 76918 gene locus_tag LOCUS_16600 77481 76918 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 protein_id gnl|my_center|LOCUS_16600 78207 77491 gene locus_tag LOCUS_16610 gene trmD 78207 77491 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016280.1 protein_id gnl|my_center|LOCUS_16610 78725 78204 gene locus_tag LOCUS_16620 gene rimM 78725 78204 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904385.1 protein_id gnl|my_center|LOCUS_16620 78973 78734 gene locus_tag LOCUS_16630 78973 78734 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899450.1 protein_id gnl|my_center|LOCUS_16630 79227 78985 gene locus_tag LOCUS_16640 79227 78985 CDS product DUF4911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016281.1 protein_id gnl|my_center|LOCUS_16640 80030 79236 gene locus_tag LOCUS_16650 gene rsmA 80030 79236 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016282.1 protein_id gnl|my_center|LOCUS_16650 80567 80040 gene locus_tag LOCUS_16660 gene hpt 80567 80040 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_16660 80782 81594 gene locus_tag LOCUS_16670 80782 81594 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_16670 81619 82548 gene locus_tag LOCUS_16680 81619 82548 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016289.1 protein_id gnl|my_center|LOCUS_16680 83382 82615 gene locus_tag LOCUS_16690 83382 82615 CDS product DUF695 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016290.1 protein_id gnl|my_center|LOCUS_16690 84286 83414 gene locus_tag LOCUS_16700 84286 83414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 84909 84304 gene locus_tag LOCUS_16710 84909 84304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681642.1 protein_id gnl|my_center|LOCUS_16710 85040 86263 gene locus_tag LOCUS_16720 85040 86263 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016291.1 protein_id gnl|my_center|LOCUS_16720 86275 87516 gene locus_tag LOCUS_16730 gene hisS 86275 87516 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016292.1 protein_id gnl|my_center|LOCUS_16730 87535 89313 gene locus_tag LOCUS_16740 gene aspS 87535 89313 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016293.1 protein_id gnl|my_center|LOCUS_16740 89800 91434 gene locus_tag LOCUS_16750 89800 91434 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461189.1 protein_id gnl|my_center|LOCUS_16750 91468 92445 gene locus_tag LOCUS_16760 91468 92445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461188.1 protein_id gnl|my_center|LOCUS_16760 92435 93295 gene locus_tag LOCUS_16770 92435 93295 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461187.1 protein_id gnl|my_center|LOCUS_16770 93300 94130 gene locus_tag LOCUS_16780 93300 94130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461569.1 protein_id gnl|my_center|LOCUS_16780 94160 94774 gene locus_tag LOCUS_16790 94160 94774 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810358.1 protein_id gnl|my_center|LOCUS_16790 94809 95843 gene locus_tag LOCUS_16800 94809 95843 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495008.1 protein_id gnl|my_center|LOCUS_16800 95854 96900 gene locus_tag LOCUS_16810 95854 96900 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016295.1 protein_id gnl|my_center|LOCUS_16810 96903 97667 gene locus_tag LOCUS_16820 96903 97667 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901785.1 protein_id gnl|my_center|LOCUS_16820 97687 98517 gene locus_tag LOCUS_16830 97687 98517 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016296.1 protein_id gnl|my_center|LOCUS_16830 98520 100178 gene locus_tag LOCUS_16840 98520 100178 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627758.1 protein_id gnl|my_center|LOCUS_16840 100201 101253 gene locus_tag LOCUS_16850 100201 101253 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495003.1 protein_id gnl|my_center|LOCUS_16850 101270 102265 gene locus_tag LOCUS_16860 101270 102265 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627760.1 protein_id gnl|my_center|LOCUS_16860 102268 103047 gene locus_tag LOCUS_16870 102268 103047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367330.1 protein_id gnl|my_center|LOCUS_16870 103179 104231 gene locus_tag LOCUS_16880 103179 104231 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016300.1 protein_id gnl|my_center|LOCUS_16880 104443 106125 gene locus_tag LOCUS_16890 104443 106125 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_16890 106141 107211 gene locus_tag LOCUS_16900 106141 107211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_16900 107418 109052 gene locus_tag LOCUS_16910 107418 109052 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_16910 109903 109100 gene locus_tag LOCUS_16920 109903 109100 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903764.1 protein_id gnl|my_center|LOCUS_16920 110265 112451 gene locus_tag LOCUS_16930 gene nrdD 110265 112451 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016303.1 protein_id gnl|my_center|LOCUS_16930 112456 112962 gene locus_tag LOCUS_16940 gene nrdG 112456 112962 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_16940 113087 114394 gene locus_tag LOCUS_16950 gene rsmB 113087 114394 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016304.1 protein_id gnl|my_center|LOCUS_16950 114388 115029 gene locus_tag LOCUS_16960 114388 115029 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016305.1 protein_id gnl|my_center|LOCUS_16960 115051 115440 gene locus_tag LOCUS_16970 115051 115440 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_16970 117049 115589 gene locus_tag LOCUS_16980 gene nhaC 117049 115589 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017141.1 protein_id gnl|my_center|LOCUS_16980 118603 117230 gene locus_tag LOCUS_16990 118603 117230 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893260.1 protein_id gnl|my_center|LOCUS_16990 120618 118615 gene locus_tag LOCUS_17000 120618 118615 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861320.1 protein_id gnl|my_center|LOCUS_17000 121128 122468 gene locus_tag LOCUS_17010 121128 122468 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263484.1 protein_id gnl|my_center|LOCUS_17010 122465 122782 gene locus_tag LOCUS_17020 122465 122782 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966669.1 protein_id gnl|my_center|LOCUS_17020 123036 124214 gene locus_tag LOCUS_17030 123036 124214 CDS product MacA family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951265.1 protein_id gnl|my_center|LOCUS_17030 124229 126190 gene locus_tag LOCUS_17040 124229 126190 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002247530.1 protein_id gnl|my_center|LOCUS_17040 >Feature sequence45 168 821 gene locus_tag LOCUS_17050 168 821 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016232.1 protein_id gnl|my_center|LOCUS_17050 818 1681 gene locus_tag LOCUS_17060 818 1681 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902127.1 protein_id gnl|my_center|LOCUS_17060 2415 1693 gene locus_tag LOCUS_17070 2415 1693 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 protein_id gnl|my_center|LOCUS_17070 4084 2408 gene locus_tag LOCUS_17080 4084 2408 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627701.1 protein_id gnl|my_center|LOCUS_17080 4348 5772 gene locus_tag LOCUS_17090 4348 5772 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902130.1 protein_id gnl|my_center|LOCUS_17090 5898 6125 gene locus_tag LOCUS_17100 5898 6125 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016226.1 protein_id gnl|my_center|LOCUS_17100 6122 6394 gene locus_tag LOCUS_17110 6122 6394 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_17110 6406 7752 gene locus_tag LOCUS_17120 6406 7752 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 protein_id gnl|my_center|LOCUS_17120 8004 9185 gene locus_tag LOCUS_17130 8004 9185 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495539.1 protein_id gnl|my_center|LOCUS_17130 9537 11528 gene locus_tag LOCUS_17140 gene uvrB 9537 11528 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016236.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence46 266 11209 gene locus_tag LOCUS_17150 266 11209 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898194.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence47 1650 337 gene locus_tag LOCUS_17160 1650 337 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437552.1 protein_id gnl|my_center|LOCUS_17160 3229 1673 gene locus_tag LOCUS_17170 3229 1673 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626662.1 protein_id gnl|my_center|LOCUS_17170 4029 3244 gene locus_tag LOCUS_17180 4029 3244 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373316.1 protein_id gnl|my_center|LOCUS_17180 4350 4751 gene locus_tag LOCUS_17190 gene hxlR 4350 4751 CDS product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 protein_id gnl|my_center|LOCUS_17190 5254 4877 gene locus_tag LOCUS_17200 5254 4877 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016038.1 protein_id gnl|my_center|LOCUS_17200 5397 6170 gene locus_tag LOCUS_17210 5397 6170 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016037.1 protein_id gnl|my_center|LOCUS_17210 7192 6266 gene locus_tag LOCUS_17220 7192 6266 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 protein_id gnl|my_center|LOCUS_17220 7924 7211 gene locus_tag LOCUS_17230 7924 7211 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050488755.1 protein_id gnl|my_center|LOCUS_17230 8424 7921 gene locus_tag LOCUS_17240 8424 7921 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_17240 8632 8859 gene locus_tag LOCUS_17250 8632 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8852 9799 gene locus_tag LOCUS_17260 8852 9799 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_17260 9808 10362 gene locus_tag LOCUS_17270 9808 10362 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789913.1 protein_id gnl|my_center|LOCUS_17270 10389 11084 gene locus_tag LOCUS_17280 10389 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 11114 11491 gene locus_tag LOCUS_17290 11114 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence48 1019 582 gene locus_tag LOCUS_17300 1019 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 1285 1103 gene locus_tag LOCUS_17310 1285 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 1452 1294 gene locus_tag LOCUS_17320 1452 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2058 1489 gene locus_tag LOCUS_17330 2058 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3271 2102 gene locus_tag LOCUS_17340 3271 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17340 4106 3597 gene locus_tag LOCUS_17350 4106 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4280 4134 gene locus_tag LOCUS_17360 4280 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4728 4342 gene locus_tag LOCUS_17370 4728 4342 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_17370 5033 4809 gene locus_tag LOCUS_17380 5033 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 5965 5051 gene locus_tag LOCUS_17390 5965 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 6421 5978 gene locus_tag LOCUS_17400 6421 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6966 6439 gene locus_tag LOCUS_17410 6966 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 8098 7391 gene locus_tag LOCUS_17420 gene deoD 8098 7391 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898215.1 protein_id gnl|my_center|LOCUS_17420 9304 8144 gene locus_tag LOCUS_17430 9304 8144 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803026.1 protein_id gnl|my_center|LOCUS_17430 9529 9454 gene locus_tag LOCUS_t00440 9529 9454 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence49 216 1283 gene locus_tag LOCUS_17440 216 1283 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016016.1 protein_id gnl|my_center|LOCUS_17440 1295 1828 gene locus_tag LOCUS_17450 1295 1828 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_17450 2192 3619 gene locus_tag LOCUS_17460 gene nhaC 2192 3619 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016021.1 protein_id gnl|my_center|LOCUS_17460 4691 3849 gene locus_tag LOCUS_17470 4691 3849 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016022.1 protein_id gnl|my_center|LOCUS_17470 5104 5631 gene locus_tag LOCUS_17480 5104 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 6475 5699 gene locus_tag LOCUS_17490 6475 5699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901801.1 protein_id gnl|my_center|LOCUS_17490 7311 6478 gene locus_tag LOCUS_17500 7311 6478 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 protein_id gnl|my_center|LOCUS_17500 8453 7524 gene locus_tag LOCUS_17510 8453 7524 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495574.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence50 133 636 gene locus_tag LOCUS_17520 133 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 649 1941 gene locus_tag LOCUS_17530 649 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1955 2977 gene locus_tag LOCUS_17540 1955 2977 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974962.1 protein_id gnl|my_center|LOCUS_17540 2998 3864 gene locus_tag LOCUS_17550 gene aroE 2998 3864 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289627.1 protein_id gnl|my_center|LOCUS_17550 3904 5088 gene locus_tag LOCUS_17560 3904 5088 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089188.1 protein_id gnl|my_center|LOCUS_17560 5093 5914 gene locus_tag LOCUS_17570 5093 5914 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084082.1 protein_id gnl|my_center|LOCUS_17570 5930 6886 gene locus_tag LOCUS_17580 5930 6886 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_17580 6941 7795 gene locus_tag LOCUS_17590 gene prpB 6941 7795 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_17590 7869 8027 gene locus_tag LOCUS_17600 7869 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence51 280 1794 gene locus_tag LOCUS_17610 280 1794 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016264.1 protein_id gnl|my_center|LOCUS_17610 1934 2743 gene locus_tag LOCUS_17620 1934 2743 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016356.1 protein_id gnl|my_center|LOCUS_17620 2804 3697 gene locus_tag LOCUS_17630 2804 3697 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016357.1 protein_id gnl|my_center|LOCUS_17630 3708 5510 gene locus_tag LOCUS_17640 3708 5510 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016358.1 protein_id gnl|my_center|LOCUS_17640 5507 6247 gene locus_tag LOCUS_17650 5507 6247 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016359.1 protein_id gnl|my_center|LOCUS_17650 6263 7240 gene locus_tag LOCUS_17660 6263 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 7244 8107 gene locus_tag LOCUS_17670 7244 8107 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902565.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence52 130 1392 gene locus_tag LOCUS_17680 130 1392 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895440.1 protein_id gnl|my_center|LOCUS_17680 1410 2801 gene locus_tag LOCUS_17690 1410 2801 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903012.1 protein_id gnl|my_center|LOCUS_17690 3314 2841 gene locus_tag LOCUS_17700 3314 2841 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015852.1 protein_id gnl|my_center|LOCUS_17700 3886 3377 gene locus_tag LOCUS_17710 3886 3377 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015851.1 protein_id gnl|my_center|LOCUS_17710 5789 4107 gene locus_tag LOCUS_17720 5789 4107 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491245.1 protein_id gnl|my_center|LOCUS_17720 7524 5767 gene locus_tag LOCUS_17730 7524 5767 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015848.1 protein_id gnl|my_center|LOCUS_17730 >Feature sequence53 712 209 gene locus_tag LOCUS_17740 712 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016008.1 protein_id gnl|my_center|LOCUS_17740 901 1365 gene locus_tag LOCUS_17750 901 1365 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016009.1 protein_id gnl|my_center|LOCUS_17750 1316 1741 gene locus_tag LOCUS_17760 1316 1741 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023038164.1 protein_id gnl|my_center|LOCUS_17760 2225 1764 gene locus_tag LOCUS_17770 2225 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2866 2306 gene locus_tag LOCUS_17780 2866 2306 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894981.1 protein_id gnl|my_center|LOCUS_17780 4344 2887 gene locus_tag LOCUS_17790 4344 2887 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894984.1 protein_id gnl|my_center|LOCUS_17790 5734 4379 gene locus_tag LOCUS_17800 5734 4379 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 protein_id gnl|my_center|LOCUS_17800 7336 5861 gene locus_tag LOCUS_17810 7336 5861 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016014.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence54 746 150 gene locus_tag LOCUS_17820 746 150 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_17820 1049 1291 gene locus_tag LOCUS_17830 1049 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 1275 1556 gene locus_tag LOCUS_17840 1275 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1912 2454 gene locus_tag LOCUS_17850 1912 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 2692 2871 gene locus_tag LOCUS_17860 2692 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3677 3135 gene locus_tag LOCUS_17870 3677 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016228.1 protein_id gnl|my_center|LOCUS_17870 4205 3699 gene locus_tag LOCUS_17880 4205 3699 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_17880 4787 4215 gene locus_tag LOCUS_17890 gene ruvC 4787 4215 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_17890 5566 4787 gene locus_tag LOCUS_17900 5566 4787 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 protein_id gnl|my_center|LOCUS_17900 6414 5662 gene locus_tag LOCUS_17910 6414 5662 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016231.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence55 <1 668 gene locus_tag LOCUS_17920 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627026.1:autotransporter-associated N-terminal domain-containing protein 1770 886 gene locus_tag LOCUS_17930 1770 886 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_17930 2208 1789 gene locus_tag LOCUS_17940 2208 1789 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015665.1 protein_id gnl|my_center|LOCUS_17940 2460 3929 gene locus_tag LOCUS_17950 gene nagE 2460 3929 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015664.1 protein_id gnl|my_center|LOCUS_17950 4068 6134 gene locus_tag LOCUS_17960 gene fusA 4068 6134 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_17960 6358 7785 gene locus_tag LOCUS_17970 6358 7785 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_17970 7812 8948 gene locus_tag LOCUS_17980 7812 8948 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903799.1 protein_id gnl|my_center|LOCUS_17980 8958 9737 gene locus_tag LOCUS_17990 8958 9737 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015659.1 protein_id gnl|my_center|LOCUS_17990 9750 10718 gene locus_tag LOCUS_18000 9750 10718 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015658.1 protein_id gnl|my_center|LOCUS_18000 10966 11349 gene locus_tag LOCUS_18010 10966 11349 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015657.1 protein_id gnl|my_center|LOCUS_18010 11342 12073 gene locus_tag LOCUS_18020 11342 12073 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894493.1 protein_id gnl|my_center|LOCUS_18020 13259 12285 gene locus_tag LOCUS_18030 13259 12285 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_18030 14037 13252 gene locus_tag LOCUS_18040 14037 13252 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_18040 15623 14049 gene locus_tag LOCUS_18050 15623 14049 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_18050 16503 15673 gene locus_tag LOCUS_18060 16503 15673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_18060 17442 16504 gene locus_tag LOCUS_18070 17442 16504 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_18070 18304 17726 gene locus_tag LOCUS_18080 18304 17726 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612657.1 protein_id gnl|my_center|LOCUS_18080 19529 18288 gene locus_tag LOCUS_18090 19529 18288 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703830.1 protein_id gnl|my_center|LOCUS_18090 19669 20940 gene locus_tag LOCUS_18100 gene murA 19669 20940 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015649.1 protein_id gnl|my_center|LOCUS_18100 20950 21654 gene locus_tag LOCUS_18110 gene rlmB 20950 21654 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015648.1 protein_id gnl|my_center|LOCUS_18110 21665 22276 gene locus_tag LOCUS_18120 21665 22276 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015647.1 protein_id gnl|my_center|LOCUS_18120 22289 24868 gene locus_tag LOCUS_18130 gene leuS 22289 24868 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015646.1 protein_id gnl|my_center|LOCUS_18130 24886 25080 gene locus_tag LOCUS_18140 24886 25080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 25804 25232 gene locus_tag LOCUS_18150 gene frr 25804 25232 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904126.1 protein_id gnl|my_center|LOCUS_18150 26559 25840 gene locus_tag LOCUS_18160 gene pyrH 26559 25840 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_18160 27517 26624 gene locus_tag LOCUS_18170 gene tsf 27517 26624 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015713.1 protein_id gnl|my_center|LOCUS_18170 28295 27552 gene locus_tag LOCUS_18180 gene rpsB 28295 27552 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904120.1 protein_id gnl|my_center|LOCUS_18180 28586 28954 gene locus_tag LOCUS_18190 28586 28954 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 protein_id gnl|my_center|LOCUS_18190 28972 29565 gene locus_tag LOCUS_18200 gene amaP 28972 29565 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229291.1 protein_id gnl|my_center|LOCUS_18200 29565 29789 gene locus_tag LOCUS_18210 29565 29789 CDS product DUF2273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904114.1 protein_id gnl|my_center|LOCUS_18210 29794 30267 gene locus_tag LOCUS_18220 gene nusB 29794 30267 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904113.1 protein_id gnl|my_center|LOCUS_18220 30421 30296 gene locus_tag LOCUS_18230 30421 30296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 31047 30496 gene locus_tag LOCUS_18240 31047 30496 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015710.1 protein_id gnl|my_center|LOCUS_18240 31128 32624 gene locus_tag LOCUS_18250 31128 32624 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015709.1 protein_id gnl|my_center|LOCUS_18250 32931 33881 gene locus_tag LOCUS_18260 32931 33881 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015708.1 protein_id gnl|my_center|LOCUS_18260 33884 35293 gene locus_tag LOCUS_18270 33884 35293 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015707.1 protein_id gnl|my_center|LOCUS_18270 35328 35855 gene locus_tag LOCUS_18280 35328 35855 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495314.1 protein_id gnl|my_center|LOCUS_18280 35855 36712 gene locus_tag LOCUS_18290 35855 36712 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015705.1 protein_id gnl|my_center|LOCUS_18290 37005 36754 gene locus_tag LOCUS_18300 37005 36754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 37126 37917 gene locus_tag LOCUS_18310 37126 37917 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_18310 37898 38830 gene locus_tag LOCUS_18320 gene prmA 37898 38830 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029493681.1 protein_id gnl|my_center|LOCUS_18320 38887 39543 gene locus_tag LOCUS_18330 gene cmk 38887 39543 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 protein_id gnl|my_center|LOCUS_18330 39572 41494 gene locus_tag LOCUS_18340 gene trmB 39572 41494 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015702.1 protein_id gnl|my_center|LOCUS_18340 41504 42781 gene locus_tag LOCUS_18350 41504 42781 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 protein_id gnl|my_center|LOCUS_18350 43022 45214 gene locus_tag LOCUS_18360 43022 45214 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897225.1 protein_id gnl|my_center|LOCUS_18360 45198 45668 gene locus_tag LOCUS_18370 45198 45668 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015698.1 protein_id gnl|my_center|LOCUS_18370 46343 45756 gene locus_tag LOCUS_18380 46343 45756 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015911.1 protein_id gnl|my_center|LOCUS_18380 47853 46417 gene locus_tag LOCUS_18390 47853 46417 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015910.1 protein_id gnl|my_center|LOCUS_18390 48115 52668 gene locus_tag LOCUS_18400 48115 52668 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495085.1 protein_id gnl|my_center|LOCUS_18400 53146 52787 gene locus_tag LOCUS_18410 53146 52787 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171487421.1 protein_id gnl|my_center|LOCUS_18410 53320 55755 gene locus_tag LOCUS_18420 53320 55755 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015907.1 protein_id gnl|my_center|LOCUS_18420 55872 56357 gene locus_tag LOCUS_18430 55872 56357 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_18430 56367 57020 gene locus_tag LOCUS_18440 56367 57020 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903942.1 protein_id gnl|my_center|LOCUS_18440 58241 57249 gene locus_tag LOCUS_18450 58241 57249 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_18450 58535 59791 gene locus_tag LOCUS_18460 58535 59791 CDS product DUF3798 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897188.1 protein_id gnl|my_center|LOCUS_18460 59944 61527 gene locus_tag LOCUS_18470 59944 61527 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015905.1 protein_id gnl|my_center|LOCUS_18470 61529 62548 gene locus_tag LOCUS_18480 61529 62548 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903357.1 protein_id gnl|my_center|LOCUS_18480 62541 63626 gene locus_tag LOCUS_18490 62541 63626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627593.1 protein_id gnl|my_center|LOCUS_18490 63642 63971 gene locus_tag LOCUS_18500 63642 63971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903355.1 protein_id gnl|my_center|LOCUS_18500 64076 64783 gene locus_tag LOCUS_18510 64076 64783 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627595.1 protein_id gnl|my_center|LOCUS_18510 65303 64815 gene locus_tag LOCUS_18520 65303 64815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 65684 65319 gene locus_tag LOCUS_18530 65684 65319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 65883 66605 gene locus_tag LOCUS_18540 65883 66605 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_18540 66894 67070 gene locus_tag LOCUS_18550 66894 67070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903350.1 protein_id gnl|my_center|LOCUS_18550 67194 67463 gene locus_tag LOCUS_18560 67194 67463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 67633 68814 gene locus_tag LOCUS_18570 67633 68814 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015738.1 protein_id gnl|my_center|LOCUS_18570 69251 68898 gene locus_tag LOCUS_18580 69251 68898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015737.1 protein_id gnl|my_center|LOCUS_18580 69632 69261 gene locus_tag LOCUS_18590 69632 69261 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897347.1 protein_id gnl|my_center|LOCUS_18590 69960 69625 gene locus_tag LOCUS_18600 69960 69625 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015735.1 protein_id gnl|my_center|LOCUS_18600 70359 71108 gene locus_tag LOCUS_18610 70359 71108 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904156.1 protein_id gnl|my_center|LOCUS_18610 71431 73500 gene locus_tag LOCUS_18620 gene recG 71431 73500 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015732.1 protein_id gnl|my_center|LOCUS_18620 73879 75585 gene locus_tag LOCUS_18630 73879 75585 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015730.1 protein_id gnl|my_center|LOCUS_18630 75684 75968 gene locus_tag LOCUS_18640 gene rpsF 75684 75968 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023040534.1 protein_id gnl|my_center|LOCUS_18640 76013 76231 gene locus_tag LOCUS_18650 gene rpsR 76013 76231 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005891822.1 protein_id gnl|my_center|LOCUS_18650 76555 77358 gene locus_tag LOCUS_18660 76555 77358 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_18660 79038 77461 gene locus_tag LOCUS_18670 79038 77461 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005916172.1 protein_id gnl|my_center|LOCUS_18670 79459 80796 gene locus_tag LOCUS_18680 79459 80796 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_18680 80898 82394 gene locus_tag LOCUS_18690 80898 82394 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015726.1 protein_id gnl|my_center|LOCUS_18690 82475 82708 gene locus_tag LOCUS_18700 82475 82708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 82695 82976 gene locus_tag LOCUS_18710 82695 82976 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679713.1 protein_id gnl|my_center|LOCUS_18710 83089 84000 gene locus_tag LOCUS_18720 83089 84000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106894843.1 protein_id gnl|my_center|LOCUS_18720 83997 84758 gene locus_tag LOCUS_18730 83997 84758 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062685931.1 protein_id gnl|my_center|LOCUS_18730 84761 85549 gene locus_tag LOCUS_18740 84761 85549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015723.1 protein_id gnl|my_center|LOCUS_18740 85559 86329 gene locus_tag LOCUS_18750 85559 86329 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015722.1 protein_id gnl|my_center|LOCUS_18750 86868 86422 gene locus_tag LOCUS_18760 86868 86422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897310.1 protein_id gnl|my_center|LOCUS_18760 87090 87401 gene locus_tag LOCUS_18770 gene rpsJ 87090 87401 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897308.1 protein_id gnl|my_center|LOCUS_18770 87547 88182 gene locus_tag LOCUS_18780 gene rplC 87547 88182 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015720.1 protein_id gnl|my_center|LOCUS_18780 88202 88831 gene locus_tag LOCUS_18790 gene rplD 88202 88831 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904141.1 protein_id gnl|my_center|LOCUS_18790 88831 89118 gene locus_tag LOCUS_18800 gene rplW 88831 89118 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015719.1 protein_id gnl|my_center|LOCUS_18800 89162 89992 gene locus_tag LOCUS_18810 gene rplB 89162 89992 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904139.1 protein_id gnl|my_center|LOCUS_18810 90017 90292 gene locus_tag LOCUS_18820 gene rpsS 90017 90292 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897301.1 protein_id gnl|my_center|LOCUS_18820 90326 90661 gene locus_tag LOCUS_18830 gene rplV 90326 90661 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897300.1 protein_id gnl|my_center|LOCUS_18830 90680 91339 gene locus_tag LOCUS_18840 gene rpsC 90680 91339 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892367.1 protein_id gnl|my_center|LOCUS_18840 91342 91773 gene locus_tag LOCUS_18850 gene rplP 91342 91773 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904138.1 protein_id gnl|my_center|LOCUS_18850 91773 91955 gene locus_tag LOCUS_18860 gene rpmC 91773 91955 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015718.1 protein_id gnl|my_center|LOCUS_18860 91991 92242 gene locus_tag LOCUS_18870 gene rpsQ 91991 92242 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904137.1 protein_id gnl|my_center|LOCUS_18870 92271 92639 gene locus_tag LOCUS_18880 gene rplN 92271 92639 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904136.1 protein_id gnl|my_center|LOCUS_18880 92664 93005 gene locus_tag LOCUS_18890 gene rplX 92664 93005 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897291.1 protein_id gnl|my_center|LOCUS_18890 93024 93575 gene locus_tag LOCUS_18900 gene rplE 93024 93575 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892302.1 protein_id gnl|my_center|LOCUS_18900 93596 93883 gene locus_tag LOCUS_18910 gene rpsN 93596 93883 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015715.1 protein_id gnl|my_center|LOCUS_18910 93912 94310 gene locus_tag LOCUS_18920 gene rpsH 93912 94310 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 protein_id gnl|my_center|LOCUS_18920 94335 94868 gene locus_tag LOCUS_18930 gene rplF 94335 94868 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904134.1 protein_id gnl|my_center|LOCUS_18930 94895 95263 gene locus_tag LOCUS_18940 gene rplR 94895 95263 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 protein_id gnl|my_center|LOCUS_18940 95287 95781 gene locus_tag LOCUS_18950 gene rpsE 95287 95781 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015714.1 protein_id gnl|my_center|LOCUS_18950 95794 95979 gene locus_tag LOCUS_18960 gene rpmD 95794 95979 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892817.1 protein_id gnl|my_center|LOCUS_18960 95979 96458 gene locus_tag LOCUS_18970 gene rplO 95979 96458 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899800.1 protein_id gnl|my_center|LOCUS_18970 96482 97762 gene locus_tag LOCUS_18980 gene secY 96482 97762 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904128.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence56 >Feature sequence57 2454 166 gene locus_tag LOCUS_18990 2454 166 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593938.1 protein_id gnl|my_center|LOCUS_18990 3715 2465 gene locus_tag LOCUS_19000 3715 2465 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_19000 4858 3737 gene locus_tag LOCUS_19010 4858 3737 CDS product 2-methylaconitate cis-trans isomerase PrpF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967865.1 protein_id gnl|my_center|LOCUS_19010 5032 5958 gene locus_tag LOCUS_19020 5032 5958 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964364.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence58 213 599 gene locus_tag LOCUS_19030 213 599 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015657.1 protein_id gnl|my_center|LOCUS_19030 592 1293 gene locus_tag LOCUS_19040 592 1293 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894493.1 protein_id gnl|my_center|LOCUS_19040 4588 1343 gene locus_tag LOCUS_19050 4588 1343 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005974395.1 protein_id gnl|my_center|LOCUS_19050 5640 4885 gene locus_tag LOCUS_19060 gene metF 5640 4885 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence59 452 264 gene locus_tag LOCUS_19070 452 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1321 467 gene locus_tag LOCUS_19080 1321 467 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_19080 2299 1349 gene locus_tag LOCUS_19090 2299 1349 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075549536.1 protein_id gnl|my_center|LOCUS_19090 3258 2329 gene locus_tag LOCUS_19100 3258 2329 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005133519.1 protein_id gnl|my_center|LOCUS_19100 4071 3286 gene locus_tag LOCUS_19110 4071 3286 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114771.1 protein_id gnl|my_center|LOCUS_19110 4439 4092 gene locus_tag LOCUS_19120 4439 4092 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878703.1 protein_id gnl|my_center|LOCUS_19120 4752 5177 gene locus_tag LOCUS_19130 4752 5177 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence60 1010 828 gene locus_tag LOCUS_19140 1010 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 2613 979 gene locus_tag LOCUS_19150 2613 979 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903107.1 protein_id gnl|my_center|LOCUS_19150 3361 2771 gene locus_tag LOCUS_19160 3361 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903106.1 protein_id gnl|my_center|LOCUS_19160 3539 4258 gene locus_tag LOCUS_19170 3539 4258 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016025.1 protein_id gnl|my_center|LOCUS_19170 4814 4332 gene locus_tag LOCUS_19180 4814 4332 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903104.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence61 2012 210 gene locus_tag LOCUS_19190 gene ilvB 2012 210 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_19190 3443 2031 gene locus_tag LOCUS_19200 3443 2031 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458967.1 protein_id gnl|my_center|LOCUS_19200 3729 4616 gene locus_tag LOCUS_19210 3729 4616 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989491.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence62 1631 204 gene locus_tag LOCUS_19220 1631 204 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903253.1 protein_id gnl|my_center|LOCUS_19220 1746 2933 gene locus_tag LOCUS_19230 gene megL 1746 2933 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_19230 3094 4431 gene locus_tag LOCUS_19240 3094 4431 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017139.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence63 1053 181 gene locus_tag LOCUS_19250 1053 181 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_19250 1903 1148 gene locus_tag LOCUS_19260 1903 1148 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_19260 2580 1900 gene locus_tag LOCUS_19270 2580 1900 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_19270 3220 2561 gene locus_tag LOCUS_19280 3220 2561 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272759.1 protein_id gnl|my_center|LOCUS_19280 4151 3456 gene locus_tag LOCUS_19290 4151 3456 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence64 573 1307 gene locus_tag LOCUS_19300 573 1307 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682266.1 protein_id gnl|my_center|LOCUS_19300 1314 2678 gene locus_tag LOCUS_19310 1314 2678 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005970668.1 protein_id gnl|my_center|LOCUS_19310 4070 2793 gene locus_tag LOCUS_19320 4070 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence65 <3888 3335 gene locus_tag LOCUS_19330 <3888 3335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627726.1:OmpA family protein >Feature sequence66 865 398 gene locus_tag LOCUS_19340 865 398 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626611.1 protein_id gnl|my_center|LOCUS_19340 2150 1125 gene locus_tag LOCUS_19350 gene tsaD 2150 1125 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016472.1 protein_id gnl|my_center|LOCUS_19350 2707 2147 gene locus_tag LOCUS_19360 2707 2147 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032881713.1 protein_id gnl|my_center|LOCUS_19360 3830 2691 gene locus_tag LOCUS_19370 gene recA 3830 2691 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373114.1 protein_id gnl|my_center|LOCUS_19370 4845 3835 gene locus_tag LOCUS_19380 4845 3835 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_19380 5443 4847 gene locus_tag LOCUS_19390 5443 4847 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016468.1 protein_id gnl|my_center|LOCUS_19390 6464 5436 gene locus_tag LOCUS_19400 6464 5436 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_19400 7480 6461 gene locus_tag LOCUS_19410 7480 6461 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495222.1 protein_id gnl|my_center|LOCUS_19410 8249 7470 gene locus_tag LOCUS_19420 8249 7470 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 protein_id gnl|my_center|LOCUS_19420 9353 8268 gene locus_tag LOCUS_19430 9353 8268 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 protein_id gnl|my_center|LOCUS_19430 9766 11070 gene locus_tag LOCUS_19440 gene hemL 9766 11070 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016463.1 protein_id gnl|my_center|LOCUS_19440 11060 11518 gene locus_tag LOCUS_19450 11060 11518 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016462.1 protein_id gnl|my_center|LOCUS_19450 12473 11595 gene locus_tag LOCUS_19460 12473 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 12850 12626 gene locus_tag LOCUS_19470 gene secG 12850 12626 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904328.1 protein_id gnl|my_center|LOCUS_19470 12994 13578 gene locus_tag LOCUS_19480 gene plsY 12994 13578 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_19480 13596 14741 gene locus_tag LOCUS_19490 gene dnaN 13596 14741 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904330.1 protein_id gnl|my_center|LOCUS_19490 15350 14772 gene locus_tag LOCUS_19500 15350 14772 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904331.1 protein_id gnl|my_center|LOCUS_19500 15951 15415 gene locus_tag LOCUS_19510 15951 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904332.1 protein_id gnl|my_center|LOCUS_19510 16109 17146 gene locus_tag LOCUS_19520 16109 17146 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016459.1 protein_id gnl|my_center|LOCUS_19520 17173 18228 gene locus_tag LOCUS_19530 17173 18228 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016458.1 protein_id gnl|my_center|LOCUS_19530 18482 18282 gene locus_tag LOCUS_19540 18482 18282 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900759.1 protein_id gnl|my_center|LOCUS_19540 18911 20041 gene locus_tag LOCUS_19550 18911 20041 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016455.1 protein_id gnl|my_center|LOCUS_19550 20076 21107 gene locus_tag LOCUS_19560 gene rlmN 20076 21107 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016454.1 protein_id gnl|my_center|LOCUS_19560 21111 23369 gene locus_tag LOCUS_19570 21111 23369 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898410.1 protein_id gnl|my_center|LOCUS_19570 23371 26124 gene locus_tag LOCUS_19580 23371 26124 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016452.1 protein_id gnl|my_center|LOCUS_19580 26121 27287 gene locus_tag LOCUS_19590 26121 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 27277 30042 gene locus_tag LOCUS_19600 27277 30042 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016450.1 protein_id gnl|my_center|LOCUS_19600 30051 30719 gene locus_tag LOCUS_19610 30051 30719 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016449.1 protein_id gnl|my_center|LOCUS_19610 30712 31329 gene locus_tag LOCUS_19620 30712 31329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016448.1 protein_id gnl|my_center|LOCUS_19620 31338 32387 gene locus_tag LOCUS_19630 31338 32387 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016447.1 protein_id gnl|my_center|LOCUS_19630 32519 32803 gene locus_tag LOCUS_19640 32519 32803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19640 33118 34542 gene locus_tag LOCUS_19650 33118 34542 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626657.1 protein_id gnl|my_center|LOCUS_19650 34550 35623 gene locus_tag LOCUS_19660 34550 35623 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016444.1 protein_id gnl|my_center|LOCUS_19660 35620 38688 gene locus_tag LOCUS_19670 35620 38688 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016443.1 protein_id gnl|my_center|LOCUS_19670 38868 39296 gene locus_tag LOCUS_19680 38868 39296 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904351.1 protein_id gnl|my_center|LOCUS_19680 39516 40727 gene locus_tag LOCUS_19690 39516 40727 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904352.1 protein_id gnl|my_center|LOCUS_19690 41787 40783 gene locus_tag LOCUS_19700 41787 40783 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_19700 41914 42756 gene locus_tag LOCUS_19710 41914 42756 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016439.1 protein_id gnl|my_center|LOCUS_19710 43058 44767 gene locus_tag LOCUS_19720 gene argS 43058 44767 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_19720 44863 45750 gene locus_tag LOCUS_19730 44863 45750 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903649.1 protein_id gnl|my_center|LOCUS_19730 45765 46349 gene locus_tag LOCUS_19740 gene gmhA 45765 46349 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_19740 46700 49051 gene locus_tag LOCUS_19750 46700 49051 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903647.1 protein_id gnl|my_center|LOCUS_19750 49432 50880 gene locus_tag LOCUS_19760 49432 50880 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_19760 51003 51800 gene locus_tag LOCUS_19770 51003 51800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 52413 54662 gene locus_tag LOCUS_19780 52413 54662 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898381.1 protein_id gnl|my_center|LOCUS_19780 54686 59338 gene locus_tag LOCUS_19790 54686 59338 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898379.1 protein_id gnl|my_center|LOCUS_19790 59684 59463 gene locus_tag LOCUS_19800 59684 59463 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016430.1 protein_id gnl|my_center|LOCUS_19800 61026 59818 gene locus_tag LOCUS_19810 61026 59818 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903642.1 protein_id gnl|my_center|LOCUS_19810 61808 61089 gene locus_tag LOCUS_19820 gene fabG 61808 61089 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898376.1 protein_id gnl|my_center|LOCUS_19820 62191 62475 gene locus_tag LOCUS_19830 62191 62475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071742188.1 protein_id gnl|my_center|LOCUS_19830 62685 63761 gene locus_tag LOCUS_19840 62685 63761 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016427.1 protein_id gnl|my_center|LOCUS_19840 63765 64547 gene locus_tag LOCUS_19850 63765 64547 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903636.1 protein_id gnl|my_center|LOCUS_19850 64573 65439 gene locus_tag LOCUS_19860 gene lgt 64573 65439 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016426.1 protein_id gnl|my_center|LOCUS_19860 66309 65515 gene locus_tag LOCUS_19870 gene murI 66309 65515 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902800.1 protein_id gnl|my_center|LOCUS_19870 67585 66398 gene locus_tag LOCUS_19880 gene gltS 67585 66398 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_19880 69092 67815 gene locus_tag LOCUS_19890 69092 67815 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797013.1 protein_id gnl|my_center|LOCUS_19890 69479 70489 gene locus_tag LOCUS_19900 69479 70489 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016424.1 protein_id gnl|my_center|LOCUS_19900 71540 70752 gene locus_tag LOCUS_19910 71540 70752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898362.1 protein_id gnl|my_center|LOCUS_19910 72459 71836 gene locus_tag LOCUS_19920 gene upp 72459 71836 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032884835.1 protein_id gnl|my_center|LOCUS_19920 72763 72518 gene locus_tag LOCUS_19930 72763 72518 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902388.1 protein_id gnl|my_center|LOCUS_19930 73284 72886 gene locus_tag LOCUS_19940 73284 72886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902390.1 protein_id gnl|my_center|LOCUS_19940 73610 73302 gene locus_tag LOCUS_19950 73610 73302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902392.1 protein_id gnl|my_center|LOCUS_19950 74062 73613 gene locus_tag LOCUS_19960 74062 73613 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902394.1 protein_id gnl|my_center|LOCUS_19960 75179 74118 gene locus_tag LOCUS_19970 gene ispG 75179 74118 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_19970 76341 75226 gene locus_tag LOCUS_19980 76341 75226 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898353.1 protein_id gnl|my_center|LOCUS_19980 77609 76368 gene locus_tag LOCUS_19990 gene rho 77609 76368 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016419.1 protein_id gnl|my_center|LOCUS_19990 78939 77632 gene locus_tag LOCUS_20000 gene miaB 78939 77632 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016418.1 protein_id gnl|my_center|LOCUS_20000 82137 79123 gene locus_tag LOCUS_20010 82137 79123 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211493461.1 protein_id gnl|my_center|LOCUS_20010 82815 82246 gene locus_tag LOCUS_20020 82815 82246 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902402.1 protein_id gnl|my_center|LOCUS_20020 82993 83496 gene locus_tag LOCUS_20030 82993 83496 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902403.1 protein_id gnl|my_center|LOCUS_20030 85203 83665 gene locus_tag LOCUS_20040 85203 83665 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903217.1 protein_id gnl|my_center|LOCUS_20040 86225 85533 gene locus_tag LOCUS_20050 86225 85533 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016414.1 protein_id gnl|my_center|LOCUS_20050 86581 86225 gene locus_tag LOCUS_20060 86581 86225 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016413.1 protein_id gnl|my_center|LOCUS_20060 88155 86674 gene locus_tag LOCUS_20070 gene lysS 88155 86674 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016412.1 protein_id gnl|my_center|LOCUS_20070 89422 88178 gene locus_tag LOCUS_20080 89422 88178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626693.1 protein_id gnl|my_center|LOCUS_20080 89771 89370 gene locus_tag LOCUS_20090 89771 89370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903226.1 protein_id gnl|my_center|LOCUS_20090 90320 89853 gene locus_tag LOCUS_20100 90320 89853 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016410.1 protein_id gnl|my_center|LOCUS_20100 92313 90331 gene locus_tag LOCUS_20110 gene mutL 92313 90331 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495553.1 protein_id gnl|my_center|LOCUS_20110 92908 92459 gene locus_tag LOCUS_20120 92908 92459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 93653 92913 gene locus_tag LOCUS_20130 93653 92913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944870.1 protein_id gnl|my_center|LOCUS_20130 94360 93578 gene locus_tag LOCUS_20140 94360 93578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460561.1 protein_id gnl|my_center|LOCUS_20140 95324 94335 gene locus_tag LOCUS_20150 95324 94335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944872.1 protein_id gnl|my_center|LOCUS_20150 95454 96080 gene locus_tag LOCUS_20160 95454 96080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20160 >Feature sequence67 223 675 gene locus_tag LOCUS_20170 223 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 691 1296 gene locus_tag LOCUS_20180 691 1296 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_20180 1299 2642 gene locus_tag LOCUS_20190 1299 2642 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438549.1 protein_id gnl|my_center|LOCUS_20190 3496 2723 gene locus_tag LOCUS_20200 3496 2723 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence68 3582 16 gene locus_tag LOCUS_20210 gene nifJ 3582 16 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626879.1 protein_id gnl|my_center|LOCUS_20210 >Feature sequence69 >Feature sequence70 673 1857 gene locus_tag LOCUS_20220 673 1857 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582490.1 protein_id gnl|my_center|LOCUS_20220 1902 3263 gene locus_tag LOCUS_20230 1902 3263 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence71 1588 128 gene locus_tag LOCUS_20240 1588 128 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_20240 2273 1620 gene locus_tag LOCUS_20250 gene aroD 2273 1620 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence72 >Feature sequence73 >Feature sequence74 536 249 gene locus_tag LOCUS_20260 536 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016096.1 protein_id gnl|my_center|LOCUS_20260 920 744 gene locus_tag LOCUS_20270 920 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1149 937 gene locus_tag LOCUS_20280 1149 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 <2196 1236 gene locus_tag LOCUS_20290 <2196 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897221.1:RNA-guided endonuclease TnpB family protein >Feature sequence75 >Feature sequence76 >Feature sequence77 273 2099 gene locus_tag LOCUS_20300 273 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 3357 2164 gene locus_tag LOCUS_20310 gene trpB 3357 2164 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016308.1 protein_id gnl|my_center|LOCUS_20310 3749 4852 gene locus_tag LOCUS_20320 3749 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4864 5775 gene locus_tag LOCUS_20330 4864 5775 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_20330 5833 6087 gene locus_tag LOCUS_20340 gene mazE 5833 6087 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581940.1 protein_id gnl|my_center|LOCUS_20340 6081 6413 gene locus_tag LOCUS_20350 gene mazF 6081 6413 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240418.1 protein_id gnl|my_center|LOCUS_20350 6927 6421 gene locus_tag LOCUS_20360 gene citX 6927 6421 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016309.1 protein_id gnl|my_center|LOCUS_20360 7978 6941 gene locus_tag LOCUS_20370 gene citC 7978 6941 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016310.1 protein_id gnl|my_center|LOCUS_20370 8842 7988 gene locus_tag LOCUS_20380 8842 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 9123 9425 gene locus_tag LOCUS_20390 gene citD 9123 9425 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566181.1 protein_id gnl|my_center|LOCUS_20390 9422 10333 gene locus_tag LOCUS_20400 gene citE 9422 10333 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_20400 10346 11905 gene locus_tag LOCUS_20410 gene citF 10346 11905 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355996.1 protein_id gnl|my_center|LOCUS_20410 11992 13245 gene locus_tag LOCUS_20420 11992 13245 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_20420 13266 14309 gene locus_tag LOCUS_20430 13266 14309 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963413.1 protein_id gnl|my_center|LOCUS_20430 14419 14871 gene locus_tag LOCUS_20440 14419 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 14882 15475 gene locus_tag LOCUS_20450 14882 15475 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017022.1 protein_id gnl|my_center|LOCUS_20450 16966 15662 gene locus_tag LOCUS_20460 16966 15662 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494970.1 protein_id gnl|my_center|LOCUS_20460 17643 16963 gene locus_tag LOCUS_20470 17643 16963 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491567.1 protein_id gnl|my_center|LOCUS_20470 17962 18681 gene locus_tag LOCUS_20480 17962 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 18703 18969 gene locus_tag LOCUS_20490 18703 18969 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087215.1 protein_id gnl|my_center|LOCUS_20490 18972 20519 gene locus_tag LOCUS_20500 18972 20519 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017024.1 protein_id gnl|my_center|LOCUS_20500 20524 21558 gene locus_tag LOCUS_20510 20524 21558 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_20510 21560 22897 gene locus_tag LOCUS_20520 21560 22897 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_20520 22881 24020 gene locus_tag LOCUS_20530 22881 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 24129 25688 gene locus_tag LOCUS_20540 24129 25688 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017024.1 protein_id gnl|my_center|LOCUS_20540 26578 25757 gene locus_tag LOCUS_20550 26578 25757 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896244.1 protein_id gnl|my_center|LOCUS_20550 26745 27209 gene locus_tag LOCUS_20560 26745 27209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779470.1 protein_id gnl|my_center|LOCUS_20560 27369 28007 gene locus_tag LOCUS_20570 27369 28007 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367249.1 protein_id gnl|my_center|LOCUS_20570 29069 28185 gene locus_tag LOCUS_20580 gene galU 29069 28185 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899251.1 protein_id gnl|my_center|LOCUS_20580 29701 29081 gene locus_tag LOCUS_20590 29701 29081 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903934.1 protein_id gnl|my_center|LOCUS_20590 31640 29730 gene locus_tag LOCUS_20600 gene metG 31640 29730 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017027.1 protein_id gnl|my_center|LOCUS_20600 32509 31883 gene locus_tag LOCUS_20610 32509 31883 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_20610 32973 32623 gene locus_tag LOCUS_20620 32973 32623 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008797059.1 protein_id gnl|my_center|LOCUS_20620 34775 33039 gene locus_tag LOCUS_20630 gene sppA 34775 33039 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627854.1 protein_id gnl|my_center|LOCUS_20630 34972 35607 gene locus_tag LOCUS_20640 34972 35607 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903928.1 protein_id gnl|my_center|LOCUS_20640 35628 36905 gene locus_tag LOCUS_20650 35628 36905 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627853.1 protein_id gnl|my_center|LOCUS_20650 37122 38243 gene locus_tag LOCUS_20660 37122 38243 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017032.1 protein_id gnl|my_center|LOCUS_20660 38243 41311 gene locus_tag LOCUS_20670 38243 41311 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017033.1 protein_id gnl|my_center|LOCUS_20670 41304 41717 gene locus_tag LOCUS_20680 41304 41717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627851.1 protein_id gnl|my_center|LOCUS_20680 41844 43253 gene locus_tag LOCUS_20690 41844 43253 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_20690 43253 43837 gene locus_tag LOCUS_20700 43253 43837 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_20700 45384 43924 gene locus_tag LOCUS_20710 45384 43924 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017035.1 protein_id gnl|my_center|LOCUS_20710 45884 45456 gene locus_tag LOCUS_20720 45884 45456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 46135 47241 gene locus_tag LOCUS_20730 46135 47241 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_20730 49421 47304 gene locus_tag LOCUS_20740 49421 47304 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_20740 49970 49545 gene locus_tag LOCUS_20750 49970 49545 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627847.1 protein_id gnl|my_center|LOCUS_20750 51323 50343 gene locus_tag LOCUS_20760 51323 50343 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017037.1 protein_id gnl|my_center|LOCUS_20760 52950 51748 gene locus_tag LOCUS_20770 gene dpaL 52950 51748 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812104.1 protein_id gnl|my_center|LOCUS_20770 54118 52961 gene locus_tag LOCUS_20780 54118 52961 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532460.1 protein_id gnl|my_center|LOCUS_20780 55505 54132 gene locus_tag LOCUS_20790 55505 54132 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868919.1 protein_id gnl|my_center|LOCUS_20790 56761 55538 gene locus_tag LOCUS_20800 56761 55538 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532461.1 protein_id gnl|my_center|LOCUS_20800 56924 57841 gene locus_tag LOCUS_20810 56924 57841 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_20810 57852 59588 gene locus_tag LOCUS_20820 57852 59588 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017038.1 protein_id gnl|my_center|LOCUS_20820 59606 60568 gene locus_tag LOCUS_20830 59606 60568 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903919.1 protein_id gnl|my_center|LOCUS_20830 60995 60645 gene locus_tag LOCUS_20840 gene rplQ 60995 60645 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903918.1 protein_id gnl|my_center|LOCUS_20840 62003 61023 gene locus_tag LOCUS_20850 62003 61023 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041516.1 protein_id gnl|my_center|LOCUS_20850 62619 62032 gene locus_tag LOCUS_20860 gene rpsD 62619 62032 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_20860 63048 62659 gene locus_tag LOCUS_20870 gene rpsK 63048 62659 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903915.1 protein_id gnl|my_center|LOCUS_20870 63449 63093 gene locus_tag LOCUS_20880 gene rpsM 63449 63093 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903912.1 protein_id gnl|my_center|LOCUS_20880 63999 63778 gene locus_tag LOCUS_20890 gene infA 63999 63778 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899265.1 protein_id gnl|my_center|LOCUS_20890 65598 64066 gene locus_tag LOCUS_20900 65598 64066 CDS product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017041.1 protein_id gnl|my_center|LOCUS_20900 67163 65628 gene locus_tag LOCUS_20910 67163 65628 CDS product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627842.1 protein_id gnl|my_center|LOCUS_20910 68663 67257 gene locus_tag LOCUS_20920 68663 67257 CDS product DKNYY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627842.1 protein_id gnl|my_center|LOCUS_20920 69235 68681 gene locus_tag LOCUS_20930 69235 68681 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_20930 69883 69425 gene locus_tag LOCUS_20940 69883 69425 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627840.1 protein_id gnl|my_center|LOCUS_20940 70449 69892 gene locus_tag LOCUS_20950 70449 69892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495053.1 protein_id gnl|my_center|LOCUS_20950 71243 70479 gene locus_tag LOCUS_20960 gene map 71243 70479 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017049.1 protein_id gnl|my_center|LOCUS_20960 71963 71337 gene locus_tag LOCUS_20970 71963 71337 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017050.1 protein_id gnl|my_center|LOCUS_20970 72969 72040 gene locus_tag LOCUS_20980 72969 72040 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017051.1 protein_id gnl|my_center|LOCUS_20980 73158 74777 gene locus_tag LOCUS_20990 73158 74777 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902507.1 protein_id gnl|my_center|LOCUS_20990 74855 75073 gene locus_tag LOCUS_21000 74855 75073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902509.1 protein_id gnl|my_center|LOCUS_21000 75710 75132 gene locus_tag LOCUS_21010 75710 75132 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902512.1 protein_id gnl|my_center|LOCUS_21010 76192 75725 gene locus_tag LOCUS_21020 76192 75725 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902513.1 protein_id gnl|my_center|LOCUS_21020 76353 77021 gene locus_tag LOCUS_21030 76353 77021 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896158.1 protein_id gnl|my_center|LOCUS_21030 77192 78892 gene locus_tag LOCUS_21040 77192 78892 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017054.1 protein_id gnl|my_center|LOCUS_21040 78896 79495 gene locus_tag LOCUS_21050 78896 79495 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902517.1 protein_id gnl|my_center|LOCUS_21050 79497 80300 gene locus_tag LOCUS_21060 79497 80300 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495060.1 protein_id gnl|my_center|LOCUS_21060 80374 80568 gene locus_tag LOCUS_21070 80374 80568 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902519.1 protein_id gnl|my_center|LOCUS_21070 80790 80599 gene locus_tag LOCUS_21080 80790 80599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 81558 80887 gene locus_tag LOCUS_21090 81558 80887 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_21090 81660 82661 gene locus_tag LOCUS_21100 81660 82661 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705074.1 protein_id gnl|my_center|LOCUS_21100 82704 84020 gene locus_tag LOCUS_21110 82704 84020 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851832.1 protein_id gnl|my_center|LOCUS_21110 84840 84061 gene locus_tag LOCUS_21120 84840 84061 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491969.1 protein_id gnl|my_center|LOCUS_21120 85238 84849 gene locus_tag LOCUS_21130 85238 84849 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902525.1 protein_id gnl|my_center|LOCUS_21130 85849 85241 gene locus_tag LOCUS_21140 85849 85241 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_21140 86004 87428 gene locus_tag LOCUS_21150 86004 87428 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017059.1 protein_id gnl|my_center|LOCUS_21150 88006 87494 gene locus_tag LOCUS_21160 88006 87494 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence78 1 510 gene locus_tag LOCUS_21170 1 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21170 >Feature sequence79 >Feature sequence80 >Feature sequence81 >Feature sequence82 <1002 1 gene locus_tag LOCUS_21180 <1002 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003418888.1:acyl-CoA dehydrogenase >Feature sequence83 <1 832 gene locus_tag LOCUS_21190 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010680900.1:IS110 family transposase >Feature sequence84 >Feature sequence85 1704 190 gene locus_tag LOCUS_21200 1704 190 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005946978.1 protein_id gnl|my_center|LOCUS_21200 2974 1772 gene locus_tag LOCUS_21210 2974 1772 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005946979.1 protein_id gnl|my_center|LOCUS_21210 3275 4465 gene locus_tag LOCUS_21220 3275 4465 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015808.1 protein_id gnl|my_center|LOCUS_21220 4501 5382 gene locus_tag LOCUS_21230 4501 5382 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_21230 5585 6391 gene locus_tag LOCUS_21240 5585 6391 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904265.1 protein_id gnl|my_center|LOCUS_21240 6636 6962 gene locus_tag LOCUS_21250 6636 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015807.1 protein_id gnl|my_center|LOCUS_21250 6949 8865 gene locus_tag LOCUS_21260 6949 8865 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015806.1 protein_id gnl|my_center|LOCUS_21260 8992 9474 gene locus_tag LOCUS_21270 8992 9474 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904262.1 protein_id gnl|my_center|LOCUS_21270 9490 10041 gene locus_tag LOCUS_21280 9490 10041 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015805.1 protein_id gnl|my_center|LOCUS_21280 10053 11054 gene locus_tag LOCUS_21290 10053 11054 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367215.1 protein_id gnl|my_center|LOCUS_21290 11047 11355 gene locus_tag LOCUS_21300 11047 11355 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367214.1 protein_id gnl|my_center|LOCUS_21300 11373 13142 gene locus_tag LOCUS_21310 11373 13142 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_21310 13135 14511 gene locus_tag LOCUS_21320 13135 14511 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015800.1 protein_id gnl|my_center|LOCUS_21320 14522 15157 gene locus_tag LOCUS_21330 14522 15157 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015799.1 protein_id gnl|my_center|LOCUS_21330 15297 16931 gene locus_tag LOCUS_21340 15297 16931 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_21340 16960 17751 gene locus_tag LOCUS_21350 16960 17751 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015798.1 protein_id gnl|my_center|LOCUS_21350 18075 18686 gene locus_tag LOCUS_21360 18075 18686 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015797.1 protein_id gnl|my_center|LOCUS_21360 18670 20022 gene locus_tag LOCUS_21370 gene pabB 18670 20022 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015796.1 protein_id gnl|my_center|LOCUS_21370 20016 20753 gene locus_tag LOCUS_21380 20016 20753 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015795.1 protein_id gnl|my_center|LOCUS_21380 20725 21369 gene locus_tag LOCUS_21390 gene pcp 20725 21369 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015794.1 protein_id gnl|my_center|LOCUS_21390 21684 23249 gene locus_tag LOCUS_21400 21684 23249 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015793.1 protein_id gnl|my_center|LOCUS_21400 23493 24866 gene locus_tag LOCUS_21410 23493 24866 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015792.1 protein_id gnl|my_center|LOCUS_21410 24881 26227 gene locus_tag LOCUS_21420 24881 26227 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015791.1 protein_id gnl|my_center|LOCUS_21420 26242 26898 gene locus_tag LOCUS_21430 26242 26898 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904246.1 protein_id gnl|my_center|LOCUS_21430 26907 28808 gene locus_tag LOCUS_21440 gene mnmG 26907 28808 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015790.1 protein_id gnl|my_center|LOCUS_21440 28810 29508 gene locus_tag LOCUS_21450 gene rsmG 28810 29508 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015789.1 protein_id gnl|my_center|LOCUS_21450 30985 29642 gene locus_tag LOCUS_21460 30985 29642 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399688.1 protein_id gnl|my_center|LOCUS_21460 31506 31087 gene locus_tag LOCUS_21470 31506 31087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21470 32361 31507 gene locus_tag LOCUS_21480 32361 31507 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_21480 32947 32354 gene locus_tag LOCUS_21490 32947 32354 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775601.1 protein_id gnl|my_center|LOCUS_21490 34672 33314 gene locus_tag LOCUS_21500 gene rlmD 34672 33314 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495280.1 protein_id gnl|my_center|LOCUS_21500 34931 34674 gene locus_tag LOCUS_21510 34931 34674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897415.1 protein_id gnl|my_center|LOCUS_21510 35877 34933 gene locus_tag LOCUS_21520 gene rsmH 35877 34933 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015778.1 protein_id gnl|my_center|LOCUS_21520 36294 36019 gene locus_tag LOCUS_21530 36294 36019 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904218.1 protein_id gnl|my_center|LOCUS_21530 36871 36308 gene locus_tag LOCUS_21540 gene pgsA 36871 36308 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_21540 38985 36886 gene locus_tag LOCUS_21550 gene pnp 38985 36886 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627490.1 protein_id gnl|my_center|LOCUS_21550 40068 39091 gene locus_tag LOCUS_21560 40068 39091 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897407.1 protein_id gnl|my_center|LOCUS_21560 40954 40190 gene locus_tag LOCUS_21570 40954 40190 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015775.1 protein_id gnl|my_center|LOCUS_21570 43251 40966 gene locus_tag LOCUS_21580 gene fplA 43251 40966 CDS product autotransporter phospholipase A1 FplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015773.1 protein_id gnl|my_center|LOCUS_21580 43443 44441 gene locus_tag LOCUS_21590 gene rfaD 43443 44441 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_21590 44461 45276 gene locus_tag LOCUS_21600 44461 45276 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627503.1 protein_id gnl|my_center|LOCUS_21600 45345 45923 gene locus_tag LOCUS_21610 gene rfbC 45345 45923 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032842710.1 protein_id gnl|my_center|LOCUS_21610 45933 46829 gene locus_tag LOCUS_21620 gene rfbD 45933 46829 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015768.1 protein_id gnl|my_center|LOCUS_21620 46841 47839 gene locus_tag LOCUS_21630 46841 47839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015767.1 protein_id gnl|my_center|LOCUS_21630 47855 49666 gene locus_tag LOCUS_21640 47855 49666 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627506.1 protein_id gnl|my_center|LOCUS_21640 49670 50257 gene locus_tag LOCUS_21650 49670 50257 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_21650 50276 51487 gene locus_tag LOCUS_21660 50276 51487 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609547.1 protein_id gnl|my_center|LOCUS_21660 51489 52787 gene locus_tag LOCUS_21670 51489 52787 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_21670 52790 53980 gene locus_tag LOCUS_21680 52790 53980 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_21680 53990 54868 gene locus_tag LOCUS_21690 gene lpxD 53990 54868 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206984.1 protein_id gnl|my_center|LOCUS_21690 54877 56103 gene locus_tag LOCUS_21700 54877 56103 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 protein_id gnl|my_center|LOCUS_21700 56096 57193 gene locus_tag LOCUS_21710 56096 57193 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_21710 57209 58273 gene locus_tag LOCUS_21720 57209 58273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 58280 59392 gene locus_tag LOCUS_21730 gene wecB 58280 59392 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_21730 59389 60369 gene locus_tag LOCUS_21740 59389 60369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 60418 61605 gene locus_tag LOCUS_21750 60418 61605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 61625 62488 gene locus_tag LOCUS_21760 gene rfbA 61625 62488 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_21760 62507 63973 gene locus_tag LOCUS_21770 62507 63973 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_21770 64217 64032 gene locus_tag LOCUS_21780 64217 64032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 64451 65335 gene locus_tag LOCUS_21790 64451 65335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 65762 66961 gene locus_tag LOCUS_21800 65762 66961 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015738.1 protein_id gnl|my_center|LOCUS_21800 66994 68373 gene locus_tag LOCUS_21810 66994 68373 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964872.1 protein_id gnl|my_center|LOCUS_21810 68389 69801 gene locus_tag LOCUS_21820 68389 69801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 70652 70005 gene locus_tag LOCUS_21830 70652 70005 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 protein_id gnl|my_center|LOCUS_21830 70978 71157 gene locus_tag LOCUS_21840 70978 71157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902951.1 protein_id gnl|my_center|LOCUS_21840 71292 71705 gene locus_tag LOCUS_21850 71292 71705 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015893.1 protein_id gnl|my_center|LOCUS_21850 72411 71833 gene locus_tag LOCUS_21860 72411 71833 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015892.1 protein_id gnl|my_center|LOCUS_21860 73837 72494 gene locus_tag LOCUS_21870 73837 72494 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047747.1 protein_id gnl|my_center|LOCUS_21870 75513 73855 gene locus_tag LOCUS_21880 gene ilvD 75513 73855 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461126.1 protein_id gnl|my_center|LOCUS_21880 75728 76672 gene locus_tag LOCUS_21890 75728 76672 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963420.1 protein_id gnl|my_center|LOCUS_21890 76990 76718 gene locus_tag LOCUS_21900 gene rpsT 76990 76718 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_21900 77436 77137 gene locus_tag LOCUS_21910 77436 77137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902955.1 protein_id gnl|my_center|LOCUS_21910 77579 78055 gene locus_tag LOCUS_21920 77579 78055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 78078 78680 gene locus_tag LOCUS_21930 78078 78680 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015891.1 protein_id gnl|my_center|LOCUS_21930 78742 79236 gene locus_tag LOCUS_21940 78742 79236 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015890.1 protein_id gnl|my_center|LOCUS_21940 79240 79683 gene locus_tag LOCUS_21950 gene rpiB 79240 79683 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 protein_id gnl|my_center|LOCUS_21950 79695 80033 gene locus_tag LOCUS_21960 79695 80033 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902960.1 protein_id gnl|my_center|LOCUS_21960 80045 80341 gene locus_tag LOCUS_21970 80045 80341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897149.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence86 759 130 gene locus_tag LOCUS_21980 759 130 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935982.1 protein_id gnl|my_center|LOCUS_21980 2269 947 gene locus_tag LOCUS_21990 2269 947 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048183.1 protein_id gnl|my_center|LOCUS_21990 3923 2298 gene locus_tag LOCUS_22000 3923 2298 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016576.1 protein_id gnl|my_center|LOCUS_22000 4602 3925 gene locus_tag LOCUS_22010 4602 3925 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902078.1 protein_id gnl|my_center|LOCUS_22010 5193 4615 gene locus_tag LOCUS_22020 gene rpe 5193 4615 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_22020 5950 5255 gene locus_tag LOCUS_22030 gene rsgA 5950 5255 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627939.1 protein_id gnl|my_center|LOCUS_22030 6779 6183 gene locus_tag LOCUS_22040 6779 6183 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902075.1 protein_id gnl|my_center|LOCUS_22040 8207 7047 gene locus_tag LOCUS_22050 8207 7047 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143185615.1 protein_id gnl|my_center|LOCUS_22050 8419 8691 gene locus_tag LOCUS_22060 8419 8691 CDS product molecular chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902067.1 protein_id gnl|my_center|LOCUS_22060 8710 10329 gene locus_tag LOCUS_22070 gene groL 8710 10329 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016573.1 protein_id gnl|my_center|LOCUS_22070 11511 10663 gene locus_tag LOCUS_22080 11511 10663 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016572.1 protein_id gnl|my_center|LOCUS_22080 12001 11537 gene locus_tag LOCUS_22090 12001 11537 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016571.1 protein_id gnl|my_center|LOCUS_22090 13195 12200 gene locus_tag LOCUS_22100 13195 12200 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_22100 14067 13216 gene locus_tag LOCUS_22110 14067 13216 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546337.1 protein_id gnl|my_center|LOCUS_22110 15022 14246 gene locus_tag LOCUS_22120 gene ygiD 15022 14246 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_22120 17203 15533 gene locus_tag LOCUS_22130 17203 15533 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_22130 18145 17330 gene locus_tag LOCUS_22140 18145 17330 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221834.1 protein_id gnl|my_center|LOCUS_22140 19204 18161 gene locus_tag LOCUS_22150 19204 18161 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081212.1 protein_id gnl|my_center|LOCUS_22150 20097 19201 gene locus_tag LOCUS_22160 20097 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 21870 20194 gene locus_tag LOCUS_22170 21870 20194 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_22170 22952 21885 gene locus_tag LOCUS_22180 22952 21885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 23602 23036 gene locus_tag LOCUS_22190 23602 23036 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_22190 24744 23851 gene locus_tag LOCUS_22200 24744 23851 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_22200 25798 24746 gene locus_tag LOCUS_22210 25798 24746 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_22210 26034 26885 gene locus_tag LOCUS_22220 26034 26885 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_22220 28134 27019 gene locus_tag LOCUS_22230 28134 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681624.1 protein_id gnl|my_center|LOCUS_22230 29182 28325 gene locus_tag LOCUS_22240 29182 28325 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902061.1 protein_id gnl|my_center|LOCUS_22240 30096 29179 gene locus_tag LOCUS_22250 30096 29179 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902060.1 protein_id gnl|my_center|LOCUS_22250 31029 30346 gene locus_tag LOCUS_22260 31029 30346 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902059.1 protein_id gnl|my_center|LOCUS_22260 31978 31052 gene locus_tag LOCUS_22270 31978 31052 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900598.1 protein_id gnl|my_center|LOCUS_22270 32326 32739 gene locus_tag LOCUS_22280 32326 32739 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_22280 32845 34197 gene locus_tag LOCUS_22290 32845 34197 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_22290 34522 34271 gene locus_tag LOCUS_22300 34522 34271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 35939 34512 gene locus_tag LOCUS_22310 35939 34512 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_22310 37326 36022 gene locus_tag LOCUS_22320 37326 36022 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901990.1 protein_id gnl|my_center|LOCUS_22320 37606 37301 gene locus_tag LOCUS_22330 37606 37301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 39079 37628 gene locus_tag LOCUS_22340 gene abfD 39079 37628 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_22340 40787 39384 gene locus_tag LOCUS_22350 40787 39384 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810284.1 protein_id gnl|my_center|LOCUS_22350 42291 41143 gene locus_tag LOCUS_22360 42291 41143 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902053.1 protein_id gnl|my_center|LOCUS_22360 42793 42338 gene locus_tag LOCUS_22370 42793 42338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915403.1 protein_id gnl|my_center|LOCUS_22370 43834 42878 gene locus_tag LOCUS_22380 gene hutG 43834 42878 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902051.1 protein_id gnl|my_center|LOCUS_22380 44258 43851 gene locus_tag LOCUS_22390 44258 43851 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897742.1 protein_id gnl|my_center|LOCUS_22390 44650 45657 gene locus_tag LOCUS_22400 44650 45657 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 protein_id gnl|my_center|LOCUS_22400 45647 46348 gene locus_tag LOCUS_22410 45647 46348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_22410 46362 47147 gene locus_tag LOCUS_22420 46362 47147 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_22420 47765 47244 gene locus_tag LOCUS_22430 47765 47244 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902046.1 protein_id gnl|my_center|LOCUS_22430 48301 47924 gene locus_tag LOCUS_22440 48301 47924 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902045.1 protein_id gnl|my_center|LOCUS_22440 48675 48316 gene locus_tag LOCUS_22450 48675 48316 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495498.1 protein_id gnl|my_center|LOCUS_22450 49925 48729 gene locus_tag LOCUS_22460 49925 48729 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902043.1 protein_id gnl|my_center|LOCUS_22460 51080 50073 gene locus_tag LOCUS_22470 gene gap 51080 50073 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_22470 52127 51261 gene locus_tag LOCUS_22480 52127 51261 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902040.1 protein_id gnl|my_center|LOCUS_22480 52349 53773 gene locus_tag LOCUS_22490 gene nhaC 52349 53773 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016559.1 protein_id gnl|my_center|LOCUS_22490 53773 55401 gene locus_tag LOCUS_22500 53773 55401 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_22500 55429 56958 gene locus_tag LOCUS_22510 55429 56958 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016557.1 protein_id gnl|my_center|LOCUS_22510 56975 58105 gene locus_tag LOCUS_22520 56975 58105 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902035.1 protein_id gnl|my_center|LOCUS_22520 58228 59220 gene locus_tag LOCUS_22530 gene hemA 58228 59220 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016556.1 protein_id gnl|my_center|LOCUS_22530 59260 59871 gene locus_tag LOCUS_22540 59260 59871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22540 59945 61027 gene locus_tag LOCUS_22550 59945 61027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22550 61024 63687 gene locus_tag LOCUS_22560 61024 63687 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_22560 63706 64614 gene locus_tag LOCUS_22570 gene hemC 63706 64614 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016555.1 protein_id gnl|my_center|LOCUS_22570 64625 66082 gene locus_tag LOCUS_22580 gene cobA 64625 66082 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016554.1 protein_id gnl|my_center|LOCUS_22580 66119 66778 gene locus_tag LOCUS_22590 66119 66778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 66796 67233 gene locus_tag LOCUS_22600 66796 67233 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016553.1 protein_id gnl|my_center|LOCUS_22600 67603 68079 gene locus_tag LOCUS_22610 67603 68079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 68382 69017 gene locus_tag LOCUS_22620 68382 69017 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016551.1 protein_id gnl|my_center|LOCUS_22620 69037 69918 gene locus_tag LOCUS_22630 69037 69918 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016550.1 protein_id gnl|my_center|LOCUS_22630 70098 71075 gene locus_tag LOCUS_22640 70098 71075 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495516.1 protein_id gnl|my_center|LOCUS_22640 71505 71149 gene locus_tag LOCUS_22650 71505 71149 CDS product DUF1353 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008799559.1 protein_id gnl|my_center|LOCUS_22650 71801 72664 gene locus_tag LOCUS_22660 gene truB 71801 72664 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_22660 72687 74504 gene locus_tag LOCUS_22670 gene typA 72687 74504 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016545.1 protein_id gnl|my_center|LOCUS_22670 74592 75569 gene locus_tag LOCUS_22680 74592 75569 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_22680