>Feature sequence1 48 1595 gene locus_tag LOCUS_00010 48 1595 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246610.1 protein_id gnl|my_center|LOCUS_00010 1600 3405 gene locus_tag LOCUS_00020 1600 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3484 3912 gene locus_tag LOCUS_00030 3484 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5951 3915 gene locus_tag LOCUS_00040 5951 3915 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_00040 7354 6242 gene locus_tag LOCUS_00050 gene lpxB 7354 6242 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_00050 7683 7378 gene locus_tag LOCUS_00060 7683 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964420.1 protein_id gnl|my_center|LOCUS_00060 8422 7643 gene locus_tag LOCUS_00070 gene surE 8422 7643 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_00070 8623 10869 gene locus_tag LOCUS_00080 8623 10869 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_00080 11081 10872 gene locus_tag LOCUS_00090 11081 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10984 11727 gene locus_tag LOCUS_00100 10984 11727 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_00100 12002 12244 gene locus_tag LOCUS_00110 12002 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12241 12540 gene locus_tag LOCUS_00120 12241 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13442 12819 gene locus_tag LOCUS_00130 13442 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14844 13729 gene locus_tag LOCUS_00140 14844 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15281 15036 gene locus_tag LOCUS_00150 15281 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 16653 15421 gene locus_tag LOCUS_00160 gene rodA 16653 15421 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_00160 18602 16671 gene locus_tag LOCUS_00170 gene mrdA 18602 16671 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_00170 19105 18599 gene locus_tag LOCUS_00180 19105 18599 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_00180 19811 19098 gene locus_tag LOCUS_00190 gene mreC 19811 19098 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_00190 21016 19988 gene locus_tag LOCUS_00200 21016 19988 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_00200 22595 21069 gene locus_tag LOCUS_00210 gene purH 22595 21069 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964504.1 protein_id gnl|my_center|LOCUS_00210 22946 24196 gene locus_tag LOCUS_00220 22946 24196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_00220 24413 25729 gene locus_tag LOCUS_00230 24413 25729 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_00230 25815 26732 gene locus_tag LOCUS_00240 25815 26732 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_00240 28903 26804 gene locus_tag LOCUS_00250 28903 26804 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964518.1 protein_id gnl|my_center|LOCUS_00250 30218 29013 gene locus_tag LOCUS_00260 30218 29013 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_00260 30470 30276 gene locus_tag LOCUS_00270 30470 30276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964519.1 protein_id gnl|my_center|LOCUS_00270 31001 30489 gene locus_tag LOCUS_00280 gene lptC 31001 30489 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_00280 32334 31081 gene locus_tag LOCUS_00290 32334 31081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_00290 33061 32327 gene locus_tag LOCUS_00300 33061 32327 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964522.1 protein_id gnl|my_center|LOCUS_00300 33204 33277 gene locus_tag LOCUS_t00010 33204 33277 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 35160 33472 gene locus_tag LOCUS_00310 35160 33472 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_00310 36671 35346 gene locus_tag LOCUS_00320 gene xylA 36671 35346 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_00320 38164 36680 gene locus_tag LOCUS_00330 38164 36680 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_00330 39169 38168 gene locus_tag LOCUS_00340 39169 38168 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107685.1 protein_id gnl|my_center|LOCUS_00340 39312 40343 gene locus_tag LOCUS_00350 39312 40343 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_00350 42146 40449 gene locus_tag LOCUS_00360 42146 40449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764386.1 protein_id gnl|my_center|LOCUS_00360 45414 42226 gene locus_tag LOCUS_00370 45414 42226 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_00370 46905 45433 gene locus_tag LOCUS_00380 46905 45433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 48660 46960 gene locus_tag LOCUS_00390 48660 46960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 50211 48691 gene locus_tag LOCUS_00400 50211 48691 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840505.1 protein_id gnl|my_center|LOCUS_00400 53510 50229 gene locus_tag LOCUS_00410 53510 50229 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_00410 55680 53512 gene locus_tag LOCUS_00420 55680 53512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 58136 56451 gene locus_tag LOCUS_00430 58136 56451 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_00430 59461 58412 gene locus_tag LOCUS_00440 gene galT 59461 58412 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_00440 60631 59465 gene locus_tag LOCUS_00450 gene galK 60631 59465 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_00450 60761 61759 gene locus_tag LOCUS_00460 60761 61759 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766583.1 protein_id gnl|my_center|LOCUS_00460 61830 62123 gene locus_tag LOCUS_00470 61830 62123 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_00470 62129 62494 gene locus_tag LOCUS_00480 62129 62494 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791845.1 protein_id gnl|my_center|LOCUS_00480 62909 62601 gene locus_tag LOCUS_00490 62909 62601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 63447 65483 gene locus_tag LOCUS_00500 63447 65483 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_00500 66261 65572 gene locus_tag LOCUS_00510 66261 65572 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_00510 66549 68096 gene locus_tag LOCUS_00520 66549 68096 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_00520 68190 69179 gene locus_tag LOCUS_00530 68190 69179 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_00530 69341 70222 gene locus_tag LOCUS_00540 69341 70222 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_00540 70243 72654 gene locus_tag LOCUS_00550 70243 72654 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_00550 73019 74686 gene locus_tag LOCUS_00560 gene araB 73019 74686 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095550.1 protein_id gnl|my_center|LOCUS_00560 74697 75395 gene locus_tag LOCUS_00570 74697 75395 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642916.1 protein_id gnl|my_center|LOCUS_00570 75489 76997 gene locus_tag LOCUS_00580 gene araA 75489 76997 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816285.1 protein_id gnl|my_center|LOCUS_00580 77096 78277 gene locus_tag LOCUS_00590 77096 78277 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_00590 78710 79273 gene locus_tag LOCUS_00600 78710 79273 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705937.1 protein_id gnl|my_center|LOCUS_00600 79394 81301 gene locus_tag LOCUS_00610 gene acs 79394 81301 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_00610 81426 83216 gene locus_tag LOCUS_00620 81426 83216 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767002.1 protein_id gnl|my_center|LOCUS_00620 83217 83903 gene locus_tag LOCUS_00630 83217 83903 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_00630 83967 85175 gene locus_tag LOCUS_00640 83967 85175 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_00640 85657 85181 gene locus_tag LOCUS_00650 85657 85181 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962480.1 protein_id gnl|my_center|LOCUS_00650 85757 86857 gene locus_tag LOCUS_00660 gene mvaD 85757 86857 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_00660 86886 87104 gene locus_tag LOCUS_00670 86886 87104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 87107 87409 gene locus_tag LOCUS_00680 87107 87409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 87423 88361 gene locus_tag LOCUS_00690 87423 88361 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_00690 88363 89283 gene locus_tag LOCUS_00700 88363 89283 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_00700 89553 90461 gene locus_tag LOCUS_00710 89553 90461 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_00710 91499 90519 gene locus_tag LOCUS_00720 91499 90519 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_00720 91898 91578 gene locus_tag LOCUS_00730 91898 91578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 92062 92382 gene locus_tag LOCUS_00740 92062 92382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00740 92379 92930 gene locus_tag LOCUS_00750 92379 92930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00750 95012 93012 gene locus_tag LOCUS_00760 95012 93012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 96383 95073 gene locus_tag LOCUS_00770 96383 95073 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_00770 96664 97077 gene locus_tag LOCUS_00780 96664 97077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 97101 97361 gene locus_tag LOCUS_00790 gene rpmA 97101 97361 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964306.1 protein_id gnl|my_center|LOCUS_00790 99827 97503 gene locus_tag LOCUS_00800 gene metE 99827 97503 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_00800 99984 100445 gene locus_tag LOCUS_00810 99984 100445 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_00810 100498 100710 gene locus_tag LOCUS_00820 100498 100710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 101059 102405 gene locus_tag LOCUS_00830 101059 102405 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_00830 103440 102409 gene locus_tag LOCUS_00840 103440 102409 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_00840 105249 103480 gene locus_tag LOCUS_00850 105249 103480 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962453.1 protein_id gnl|my_center|LOCUS_00850 105505 106536 gene locus_tag LOCUS_00860 105505 106536 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_00860 106590 107033 gene locus_tag LOCUS_00870 106590 107033 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_00870 107835 107053 gene locus_tag LOCUS_00880 107835 107053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 109817 108186 gene locus_tag LOCUS_00890 109817 108186 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_00890 110403 110113 gene locus_tag LOCUS_00900 110403 110113 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_00900 110533 111588 gene locus_tag LOCUS_00910 gene mutY 110533 111588 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_00910 111819 112598 gene locus_tag LOCUS_00920 gene rsmA 111819 112598 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_00920 112588 113940 gene locus_tag LOCUS_00930 gene mgtE 112588 113940 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962248.1 protein_id gnl|my_center|LOCUS_00930 114072 114848 gene locus_tag LOCUS_00940 gene proC 114072 114848 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_00940 115058 115960 gene locus_tag LOCUS_00950 115058 115960 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_00950 116102 116476 gene locus_tag LOCUS_00960 116102 116476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 116503 116886 gene locus_tag LOCUS_00970 116503 116886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 116957 117325 gene locus_tag LOCUS_00980 116957 117325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 119154 117352 gene locus_tag LOCUS_00990 119154 117352 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_00990 119268 120032 gene locus_tag LOCUS_01000 119268 120032 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_01000 120102 121043 gene locus_tag LOCUS_01010 120102 121043 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_01010 121153 121467 gene locus_tag LOCUS_01020 121153 121467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 121457 121798 gene locus_tag LOCUS_01030 121457 121798 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_01030 121801 122838 gene locus_tag LOCUS_01040 121801 122838 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 protein_id gnl|my_center|LOCUS_01040 124623 122974 gene locus_tag LOCUS_01050 124623 122974 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_01050 124829 126061 gene locus_tag LOCUS_01060 gene hflX 124829 126061 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964502.1 protein_id gnl|my_center|LOCUS_01060 126227 128317 gene locus_tag LOCUS_01070 gene prlC 126227 128317 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309824.1 protein_id gnl|my_center|LOCUS_01070 128332 130068 gene locus_tag LOCUS_01080 128332 130068 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141209.1 protein_id gnl|my_center|LOCUS_01080 130475 130194 gene locus_tag LOCUS_01090 gene atpC 130475 130194 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_01090 132059 130548 gene locus_tag LOCUS_01100 gene atpD 132059 130548 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_01100 135192 132304 gene locus_tag LOCUS_01110 135192 132304 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_01110 137244 135397 gene locus_tag LOCUS_01120 gene glmS 137244 135397 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_01120 138863 137253 gene locus_tag LOCUS_01130 138863 137253 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_01130 139693 138887 gene locus_tag LOCUS_01140 139693 138887 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_01140 139801 140649 gene locus_tag LOCUS_01150 gene panC 139801 140649 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962287.1 protein_id gnl|my_center|LOCUS_01150 140664 141014 gene locus_tag LOCUS_01160 140664 141014 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_01160 141269 142420 gene locus_tag LOCUS_01170 141269 142420 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_01170 142420 143781 gene locus_tag LOCUS_01180 gene radA 142420 143781 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_01180 143795 143932 gene locus_tag LOCUS_01190 143795 143932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 144058 144597 gene locus_tag LOCUS_01200 144058 144597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 145646 144606 gene locus_tag LOCUS_01210 gene dinB 145646 144606 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974700.1 protein_id gnl|my_center|LOCUS_01210 148410 146350 gene locus_tag LOCUS_01220 gene rhgW 148410 146350 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_01220 151190 149109 gene locus_tag LOCUS_01230 151190 149109 CDS product site-specific recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207492.1 protein_id gnl|my_center|LOCUS_01230 151285 152778 gene locus_tag LOCUS_01240 151285 152778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 152897 153364 gene locus_tag LOCUS_01250 152897 153364 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_01250 153922 153365 gene locus_tag LOCUS_01260 153922 153365 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962371.1 protein_id gnl|my_center|LOCUS_01260 154428 154006 gene locus_tag LOCUS_01270 154428 154006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_01270 157213 154529 gene locus_tag LOCUS_01280 157213 154529 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_01280 159187 157544 gene locus_tag LOCUS_01290 gene pgi 159187 157544 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962324.1 protein_id gnl|my_center|LOCUS_01290 159587 160795 gene locus_tag LOCUS_01300 gene dcm 159587 160795 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_01300 160796 161905 gene locus_tag LOCUS_01310 160796 161905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 162136 162573 gene locus_tag LOCUS_01320 162136 162573 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_01320 163777 162599 gene locus_tag LOCUS_01330 163777 162599 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_01330 164639 163863 gene locus_tag LOCUS_01340 164639 163863 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_01340 167557 165386 gene locus_tag LOCUS_01350 167557 165386 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_01350 169454 167658 gene locus_tag LOCUS_01360 gene uvrC 169454 167658 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_01360 169624 170214 gene locus_tag LOCUS_01370 169624 170214 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962396.1 protein_id gnl|my_center|LOCUS_01370 170961 170350 gene locus_tag LOCUS_01380 170961 170350 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_01380 171471 171091 gene locus_tag LOCUS_01390 171471 171091 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_01390 174880 171479 gene locus_tag LOCUS_01400 gene ileS 174880 171479 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962393.1 protein_id gnl|my_center|LOCUS_01400 175726 175070 gene locus_tag LOCUS_01410 gene recO 175726 175070 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_01410 178104 175849 gene locus_tag LOCUS_01420 178104 175849 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_01420 179555 178212 gene locus_tag LOCUS_01430 gene gdhA 179555 178212 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_01430 179801 180604 gene locus_tag LOCUS_01440 179801 180604 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962446.1 protein_id gnl|my_center|LOCUS_01440 181168 180683 gene locus_tag LOCUS_01450 181168 180683 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_01450 181218 181574 gene locus_tag LOCUS_01460 181218 181574 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_01460 181567 182466 gene locus_tag LOCUS_01470 181567 182466 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_01470 183699 182488 gene locus_tag LOCUS_01480 183699 182488 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_01480 184837 183794 gene locus_tag LOCUS_01490 184837 183794 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_01490 186011 184947 gene locus_tag LOCUS_01500 186011 184947 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 protein_id gnl|my_center|LOCUS_01500 186275 187621 gene locus_tag LOCUS_01510 gene rseP 186275 187621 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_01510 187761 187835 gene locus_tag LOCUS_t00020 187761 187835 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 188105 189232 gene locus_tag LOCUS_01520 188105 189232 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_01520 189242 189940 gene locus_tag LOCUS_01530 189242 189940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 190379 190666 gene locus_tag LOCUS_01540 190379 190666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 190677 191927 gene locus_tag LOCUS_01550 190677 191927 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 protein_id gnl|my_center|LOCUS_01550 191974 192537 gene locus_tag LOCUS_01560 191974 192537 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_01560 192599 194200 gene locus_tag LOCUS_01570 192599 194200 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227184.1 protein_id gnl|my_center|LOCUS_01570 198357 194410 gene locus_tag LOCUS_01580 198357 194410 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_01580 200100 198664 gene locus_tag LOCUS_01590 200100 198664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 202346 200118 gene locus_tag LOCUS_01600 202346 200118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 204346 202697 gene locus_tag LOCUS_01610 204346 202697 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_01610 207424 204374 gene locus_tag LOCUS_01620 207424 204374 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_01620 209939 207954 gene locus_tag LOCUS_01630 209939 207954 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_01630 213083 209946 gene locus_tag LOCUS_01640 213083 209946 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_01640 214395 213445 gene locus_tag LOCUS_01650 214395 213445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 215408 214416 gene locus_tag LOCUS_01660 215408 214416 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_01660 216749 215436 gene locus_tag LOCUS_01670 216749 215436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 219319 216953 gene locus_tag LOCUS_01680 219319 216953 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_01680 220288 219326 gene locus_tag LOCUS_01690 220288 219326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 222187 220412 gene locus_tag LOCUS_01700 222187 220412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 225147 222838 gene locus_tag LOCUS_01710 225147 222838 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582505.1 protein_id gnl|my_center|LOCUS_01710 226342 225296 gene locus_tag LOCUS_01720 226342 225296 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767048.1 protein_id gnl|my_center|LOCUS_01720 228341 226359 gene locus_tag LOCUS_01730 228341 226359 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_01730 229686 228454 gene locus_tag LOCUS_01740 229686 228454 CDS product DUF4998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108678.1 protein_id gnl|my_center|LOCUS_01740 230906 229701 gene locus_tag LOCUS_01750 230906 229701 CDS product DUF4959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108515.1 protein_id gnl|my_center|LOCUS_01750 232905 230926 gene locus_tag LOCUS_01760 232905 230926 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108516.1 protein_id gnl|my_center|LOCUS_01760 236144 232917 gene locus_tag LOCUS_01770 236144 232917 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767205.1 protein_id gnl|my_center|LOCUS_01770 240730 236696 gene locus_tag LOCUS_01780 240730 236696 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_01780 241267 242625 gene locus_tag LOCUS_01790 241267 242625 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 protein_id gnl|my_center|LOCUS_01790 243027 242746 gene locus_tag LOCUS_01800 243027 242746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 243398 243147 gene locus_tag LOCUS_01810 243398 243147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 244905 243412 gene locus_tag LOCUS_01820 gene glpK 244905 243412 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583206.1 protein_id gnl|my_center|LOCUS_01820 245885 244911 gene locus_tag LOCUS_01830 245885 244911 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330724.1 protein_id gnl|my_center|LOCUS_01830 247402 245897 gene locus_tag LOCUS_01840 gene gguA 247402 245897 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080606.1 protein_id gnl|my_center|LOCUS_01840 247945 247406 gene locus_tag LOCUS_01850 247945 247406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 248977 248042 gene locus_tag LOCUS_01860 248977 248042 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330721.1 protein_id gnl|my_center|LOCUS_01860 250001 249030 gene locus_tag LOCUS_01870 250001 249030 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_01870 250827 250006 gene locus_tag LOCUS_01880 250827 250006 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_01880 252253 250835 gene locus_tag LOCUS_01890 252253 250835 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_01890 253034 252270 gene locus_tag LOCUS_01900 253034 252270 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_01900 254711 253305 gene locus_tag LOCUS_01910 254711 253305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 255854 254886 gene locus_tag LOCUS_01920 255854 254886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 257100 255865 gene locus_tag LOCUS_01930 257100 255865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 260319 257437 gene locus_tag LOCUS_01940 260319 257437 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_01940 261504 260446 gene locus_tag LOCUS_01950 261504 260446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 263125 261521 gene locus_tag LOCUS_01960 263125 261521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 266335 263138 gene locus_tag LOCUS_01970 266335 263138 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_01970 267531 266653 gene locus_tag LOCUS_01980 267531 266653 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_01980 267812 268957 gene locus_tag LOCUS_01990 267812 268957 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_01990 268980 270905 gene locus_tag LOCUS_02000 268980 270905 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_02000 270936 272126 gene locus_tag LOCUS_02010 270936 272126 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_02010 272277 273404 gene locus_tag LOCUS_02020 272277 273404 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_02020 273411 274421 gene locus_tag LOCUS_02030 273411 274421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 274428 275660 gene locus_tag LOCUS_02040 274428 275660 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_02040 275670 276956 gene locus_tag LOCUS_02050 275670 276956 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_02050 277853 277002 gene locus_tag LOCUS_02060 277853 277002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 278843 277884 gene locus_tag LOCUS_02070 gene mgrA 278843 277884 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098184.1 protein_id gnl|my_center|LOCUS_02070 281233 278939 gene locus_tag LOCUS_02080 gene bglX 281233 278939 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_02080 282625 281339 gene locus_tag LOCUS_02090 282625 281339 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_02090 283805 282708 gene locus_tag LOCUS_02100 283805 282708 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_02100 284332 285768 gene locus_tag LOCUS_02110 284332 285768 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340179.1 protein_id gnl|my_center|LOCUS_02110 285815 286771 gene locus_tag LOCUS_02120 285815 286771 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_02120 286778 287743 gene locus_tag LOCUS_02130 286778 287743 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888626.1 protein_id gnl|my_center|LOCUS_02130 287925 288143 gene locus_tag LOCUS_02140 287925 288143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962282.1 protein_id gnl|my_center|LOCUS_02140 288085 288243 gene locus_tag LOCUS_02150 288085 288243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 288592 289179 gene locus_tag LOCUS_02160 288592 289179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 290717 289428 gene locus_tag LOCUS_02170 290717 289428 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_02170 291550 290777 gene locus_tag LOCUS_02180 291550 290777 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_02180 292904 291564 gene locus_tag LOCUS_02190 292904 291564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964529.1 protein_id gnl|my_center|LOCUS_02190 294025 293033 gene locus_tag LOCUS_02200 294025 293033 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_02200 295261 294086 gene locus_tag LOCUS_02210 295261 294086 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104341.1 protein_id gnl|my_center|LOCUS_02210 295842 295408 gene locus_tag LOCUS_02220 gene dut 295842 295408 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_02220 297534 296071 gene locus_tag LOCUS_02230 297534 296071 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_02230 297889 299112 gene locus_tag LOCUS_02240 297889 299112 CDS product BNR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767016.1 protein_id gnl|my_center|LOCUS_02240 299112 300272 gene locus_tag LOCUS_02250 299112 300272 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_02250 302015 300345 gene locus_tag LOCUS_02260 302015 300345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 305126 302106 gene locus_tag LOCUS_02270 305126 302106 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_02270 305799 305479 gene locus_tag LOCUS_02280 305799 305479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 306168 305824 gene locus_tag LOCUS_02290 306168 305824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 307096 306287 gene locus_tag LOCUS_02300 gene atpG 307096 306287 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964544.1 protein_id gnl|my_center|LOCUS_02300 308797 307220 gene locus_tag LOCUS_02310 gene atpA 308797 307220 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_02310 309350 308814 gene locus_tag LOCUS_02320 gene atpH 309350 308814 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_02320 309852 309352 gene locus_tag LOCUS_02330 309852 309352 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_02330 310170 309979 gene locus_tag LOCUS_02340 gene atpE 310170 309979 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964548.1 protein_id gnl|my_center|LOCUS_02340 311430 310276 gene locus_tag LOCUS_02350 gene atpB 311430 310276 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_02350 311945 311547 gene locus_tag LOCUS_02360 311945 311547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964551.1 protein_id gnl|my_center|LOCUS_02360 312186 311953 gene locus_tag LOCUS_02370 312186 311953 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964552.1 protein_id gnl|my_center|LOCUS_02370 312559 312152 gene locus_tag LOCUS_02380 312559 312152 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_02380 315328 312563 gene locus_tag LOCUS_02390 315328 312563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_02390 316092 315397 gene locus_tag LOCUS_02400 316092 315397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_02400 317174 316140 gene locus_tag LOCUS_02410 317174 316140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 317733 318785 gene locus_tag LOCUS_02420 317733 318785 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_02420 318954 319610 gene locus_tag LOCUS_02430 318954 319610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 319832 320899 gene locus_tag LOCUS_02440 319832 320899 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_02440 320929 321237 gene locus_tag LOCUS_02450 320929 321237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 322023 321409 gene locus_tag LOCUS_02460 gene nreC 322023 321409 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_02460 323732 322020 gene locus_tag LOCUS_02470 323732 322020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 324198 323818 gene locus_tag LOCUS_02480 324198 323818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 326583 324316 gene locus_tag LOCUS_02490 326583 324316 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962188.1 protein_id gnl|my_center|LOCUS_02490 327291 326683 gene locus_tag LOCUS_02500 327291 326683 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962186.1 protein_id gnl|my_center|LOCUS_02500 328386 327538 gene locus_tag LOCUS_02510 328386 327538 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_02510 330407 328536 gene locus_tag LOCUS_02520 gene mnmG 330407 328536 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_02520 331074 330655 gene locus_tag LOCUS_02530 gene ybeY 331074 330655 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_02530 333794 331071 gene locus_tag LOCUS_02540 333794 331071 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_02540 334521 336029 gene locus_tag LOCUS_02550 gene gltX 334521 336029 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964585.1 protein_id gnl|my_center|LOCUS_02550 336704 336063 gene locus_tag LOCUS_02560 336704 336063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 336782 337768 gene locus_tag LOCUS_02570 336782 337768 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_02570 338052 337798 gene locus_tag LOCUS_02580 338052 337798 CDS product DUF6327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964583.1 protein_id gnl|my_center|LOCUS_02580 338406 338056 gene locus_tag LOCUS_02590 338406 338056 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964582.1 protein_id gnl|my_center|LOCUS_02590 338798 338427 gene locus_tag LOCUS_02600 338798 338427 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964581.1 protein_id gnl|my_center|LOCUS_02600 341144 339030 gene locus_tag LOCUS_02610 341144 339030 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964580.1 protein_id gnl|my_center|LOCUS_02610 341256 341471 gene locus_tag LOCUS_02620 341256 341471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 341461 341760 gene locus_tag LOCUS_02630 341461 341760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 341763 342122 gene locus_tag LOCUS_02640 gene folB 341763 342122 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_02640 342238 342309 gene locus_tag LOCUS_t00030 342238 342309 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 343057 342392 gene locus_tag LOCUS_02650 343057 342392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 343788 343111 gene locus_tag LOCUS_02660 343788 343111 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_02660 344551 343886 gene locus_tag LOCUS_02670 344551 343886 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964577.1 protein_id gnl|my_center|LOCUS_02670 346814 344640 gene locus_tag LOCUS_02680 gene rnr 346814 344640 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964576.1 protein_id gnl|my_center|LOCUS_02680 347635 348063 gene locus_tag LOCUS_02690 gene rpiB 347635 348063 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_02690 348067 348987 gene locus_tag LOCUS_02700 348067 348987 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964573.1 protein_id gnl|my_center|LOCUS_02700 349423 351285 gene locus_tag LOCUS_02710 349423 351285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 351282 353189 gene locus_tag LOCUS_02720 351282 353189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 353220 353807 gene locus_tag LOCUS_02730 353220 353807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 353909 356032 gene locus_tag LOCUS_02740 353909 356032 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_02740 356728 356090 gene locus_tag LOCUS_02750 356728 356090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 357178 356918 gene locus_tag LOCUS_02760 357178 356918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 357313 357813 gene locus_tag LOCUS_02770 357313 357813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964570.1 protein_id gnl|my_center|LOCUS_02770 357881 359371 gene locus_tag LOCUS_02780 357881 359371 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_02780 359440 360642 gene locus_tag LOCUS_02790 359440 360642 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_02790 360646 361227 gene locus_tag LOCUS_02800 360646 361227 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_02800 361287 362168 gene locus_tag LOCUS_02810 361287 362168 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964568.1 protein_id gnl|my_center|LOCUS_02810 362213 363898 gene locus_tag LOCUS_02820 362213 363898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_02820 364360 365328 gene locus_tag LOCUS_02830 364360 365328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 366530 365325 gene locus_tag LOCUS_02840 366530 365325 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107354.1 protein_id gnl|my_center|LOCUS_02840 367684 366599 gene locus_tag LOCUS_02850 gene wecB 367684 366599 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_02850 369065 367797 gene locus_tag LOCUS_02860 369065 367797 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964561.1 protein_id gnl|my_center|LOCUS_02860 369241 370515 gene locus_tag LOCUS_02870 gene purD 369241 370515 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_02870 370778 370548 gene locus_tag LOCUS_02880 370778 370548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 371337 371756 gene locus_tag LOCUS_02890 371337 371756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 372404 371751 gene locus_tag LOCUS_02900 gene upp 372404 371751 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_02900 372486 373091 gene locus_tag LOCUS_02910 372486 373091 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_02910 373113 374888 gene locus_tag LOCUS_02920 373113 374888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 375083 376084 gene locus_tag LOCUS_02930 375083 376084 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043924886.1 protein_id gnl|my_center|LOCUS_02930 377109 376138 gene locus_tag LOCUS_02940 377109 376138 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_02940 377194 378294 gene locus_tag LOCUS_02950 gene dprA 377194 378294 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_02950 379415 378369 gene locus_tag LOCUS_02960 gene trpS 379415 378369 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_02960 379516 380184 gene locus_tag LOCUS_02970 379516 380184 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_02970 381622 380189 gene locus_tag LOCUS_02980 381622 380189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 382161 381619 gene locus_tag LOCUS_02990 382161 381619 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_02990 382616 382173 gene locus_tag LOCUS_03000 382616 382173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 383810 382782 gene locus_tag LOCUS_03010 gene recA 383810 382782 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_03010 384599 383895 gene locus_tag LOCUS_03020 384599 383895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 385141 384632 gene locus_tag LOCUS_03030 385141 384632 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_03030 385645 385262 gene locus_tag LOCUS_03040 385645 385262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_03040 386798 385650 gene locus_tag LOCUS_03050 386798 385650 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_03050 389976 386890 gene locus_tag LOCUS_03060 389976 386890 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620752.1 protein_id gnl|my_center|LOCUS_03060 391894 390134 gene locus_tag LOCUS_03070 391894 390134 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_03070 392285 391941 gene locus_tag LOCUS_03080 392285 391941 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_03080 394250 392331 gene locus_tag LOCUS_03090 394250 392331 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_03090 395940 394297 gene locus_tag LOCUS_03100 395940 394297 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_03100 396192 397076 gene locus_tag LOCUS_03110 396192 397076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 397123 398199 gene locus_tag LOCUS_03120 397123 398199 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_03120 398196 398885 gene locus_tag LOCUS_03130 398196 398885 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_03130 399218 399970 gene locus_tag LOCUS_03140 399218 399970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 400060 400749 gene locus_tag LOCUS_03150 400060 400749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 400828 401448 gene locus_tag LOCUS_03160 400828 401448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 402235 401567 gene locus_tag LOCUS_03170 402235 401567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 402748 402401 gene locus_tag LOCUS_03180 402748 402401 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393652.1 protein_id gnl|my_center|LOCUS_03180 402968 402738 gene locus_tag LOCUS_03190 402968 402738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 403253 404440 gene locus_tag LOCUS_03200 403253 404440 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962199.1 protein_id gnl|my_center|LOCUS_03200 404551 406563 gene locus_tag LOCUS_03210 404551 406563 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_03210 406773 407426 gene locus_tag LOCUS_03220 406773 407426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 407458 408432 gene locus_tag LOCUS_03230 407458 408432 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_03230 408429 408878 gene locus_tag LOCUS_03240 408429 408878 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_03240 410524 408887 gene locus_tag LOCUS_03250 410524 408887 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_03250 411164 410772 gene locus_tag LOCUS_03260 gene rnpA 411164 410772 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_03260 411288 412022 gene locus_tag LOCUS_03270 411288 412022 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_03270 412080 413066 gene locus_tag LOCUS_03280 412080 413066 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_03280 413182 413835 gene locus_tag LOCUS_03290 413182 413835 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_03290 414621 413875 gene locus_tag LOCUS_03300 414621 413875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 415093 414695 gene locus_tag LOCUS_03310 415093 414695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962736.1 protein_id gnl|my_center|LOCUS_03310 415984 415208 gene locus_tag LOCUS_03320 415984 415208 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_03320 417588 416161 gene locus_tag LOCUS_03330 417588 416161 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_03330 418260 417703 gene locus_tag LOCUS_03340 418260 417703 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_03340 419349 418336 gene locus_tag LOCUS_03350 gene hemH 419349 418336 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_03350 420404 419538 gene locus_tag LOCUS_03360 420404 419538 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_03360 421082 420543 gene locus_tag LOCUS_03370 421082 420543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 421428 421099 gene locus_tag LOCUS_03380 421428 421099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 421633 422022 gene locus_tag LOCUS_03390 421633 422022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 422056 422895 gene locus_tag LOCUS_03400 422056 422895 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_03400 423020 423448 gene locus_tag LOCUS_03410 423020 423448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 423467 424054 gene locus_tag LOCUS_03420 423467 424054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 424382 425686 gene locus_tag LOCUS_03430 gene hemA 424382 425686 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_03430 425741 426667 gene locus_tag LOCUS_03440 gene hemC 425741 426667 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_03440 426719 427126 gene locus_tag LOCUS_03450 426719 427126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 427169 427834 gene locus_tag LOCUS_03460 427169 427834 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_03460 427893 428921 gene locus_tag LOCUS_03470 gene hemE 427893 428921 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_03470 429279 430181 gene locus_tag LOCUS_03480 gene hemF 429279 430181 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_03480 432101 430224 gene locus_tag LOCUS_03490 432101 430224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 432595 432110 gene locus_tag LOCUS_03500 432595 432110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 432898 433896 gene locus_tag LOCUS_03510 gene hemB 432898 433896 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962216.1 protein_id gnl|my_center|LOCUS_03510 433901 434296 gene locus_tag LOCUS_03520 433901 434296 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962215.1 protein_id gnl|my_center|LOCUS_03520 435153 434446 gene locus_tag LOCUS_03530 435153 434446 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_03530 435240 436115 gene locus_tag LOCUS_03540 435240 436115 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095817.1 protein_id gnl|my_center|LOCUS_03540 437370 436183 gene locus_tag LOCUS_03550 437370 436183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 437608 438078 gene locus_tag LOCUS_03560 437608 438078 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962214.1 protein_id gnl|my_center|LOCUS_03560 438202 438915 gene locus_tag LOCUS_03570 438202 438915 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_03570 439098 440486 gene locus_tag LOCUS_03580 439098 440486 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962212.1 protein_id gnl|my_center|LOCUS_03580 440629 441087 gene locus_tag LOCUS_03590 440629 441087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 441284 442885 gene locus_tag LOCUS_03600 gene fumA 441284 442885 CDS product class I fumarate hydratase FumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167385.1 protein_id gnl|my_center|LOCUS_03600 442970 443845 gene locus_tag LOCUS_03610 442970 443845 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080646.1 protein_id gnl|my_center|LOCUS_03610 443848 444102 gene locus_tag LOCUS_03620 443848 444102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 444492 444142 gene locus_tag LOCUS_03630 444492 444142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_03630 445055 444507 gene locus_tag LOCUS_03640 gene bstA 445055 444507 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_03640 446587 445055 gene locus_tag LOCUS_03650 446587 445055 CDS product bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_03650 446770 447102 gene locus_tag LOCUS_03660 gene ssb 446770 447102 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_03660 447368 447168 gene locus_tag LOCUS_03670 447368 447168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 448010 447492 gene locus_tag LOCUS_03680 gene ftnA 448010 447492 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693978.1 protein_id gnl|my_center|LOCUS_03680 449420 448167 gene locus_tag LOCUS_03690 449420 448167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 450264 449578 gene locus_tag LOCUS_03700 450264 449578 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_03700 451079 450264 gene locus_tag LOCUS_03710 451079 450264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_03710 451970 451083 gene locus_tag LOCUS_03720 451970 451083 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_03720 454049 451989 gene locus_tag LOCUS_03730 gene metG 454049 451989 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962236.1 protein_id gnl|my_center|LOCUS_03730 454373 455782 gene locus_tag LOCUS_03740 454373 455782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 455786 457096 gene locus_tag LOCUS_03750 455786 457096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 457175 457807 gene locus_tag LOCUS_03760 457175 457807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 457794 458492 gene locus_tag LOCUS_03770 457794 458492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 459847 458612 gene locus_tag LOCUS_03780 459847 458612 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_03780 460299 461513 gene locus_tag LOCUS_03790 460299 461513 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_03790 461525 461959 gene locus_tag LOCUS_03800 461525 461959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 461959 462378 gene locus_tag LOCUS_03810 461959 462378 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_03810 462572 462874 gene locus_tag LOCUS_03820 462572 462874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03820 462930 463253 gene locus_tag LOCUS_03830 462930 463253 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_03830 463322 463831 gene locus_tag LOCUS_03840 463322 463831 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_03840 463902 464840 gene locus_tag LOCUS_03850 463902 464840 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_03850 464883 465548 gene locus_tag LOCUS_03860 464883 465548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962367.1 protein_id gnl|my_center|LOCUS_03860 465541 468906 gene locus_tag LOCUS_03870 gene mfd 465541 468906 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_03870 468988 470085 gene locus_tag LOCUS_03880 468988 470085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 471771 470248 gene locus_tag LOCUS_03890 471771 470248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 471933 472862 gene locus_tag LOCUS_03900 471933 472862 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_03900 472965 473723 gene locus_tag LOCUS_03910 472965 473723 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_03910 474500 473784 gene locus_tag LOCUS_03920 474500 473784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 476706 474601 gene locus_tag LOCUS_03930 476706 474601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 477510 476854 gene locus_tag LOCUS_03940 477510 476854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 478066 477707 gene locus_tag LOCUS_03950 478066 477707 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_03950 478506 478129 gene locus_tag LOCUS_03960 478506 478129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 479024 478548 gene locus_tag LOCUS_03970 479024 478548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 480020 479076 gene locus_tag LOCUS_03980 480020 479076 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_03980 482045 480081 gene locus_tag LOCUS_03990 482045 480081 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962880.1 protein_id gnl|my_center|LOCUS_03990 483531 482116 gene locus_tag LOCUS_04000 483531 482116 CDS product DUF5689 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964329.1 protein_id gnl|my_center|LOCUS_04000 486338 483561 gene locus_tag LOCUS_04010 486338 483561 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_04010 486472 487575 gene locus_tag LOCUS_04020 486472 487575 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_04020 487744 489297 gene locus_tag LOCUS_04030 487744 489297 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_04030 489551 489369 gene locus_tag LOCUS_04040 489551 489369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 489972 489490 gene locus_tag LOCUS_04050 489972 489490 CDS product OmpA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962318.1 protein_id gnl|my_center|LOCUS_04050 490735 490010 gene locus_tag LOCUS_04060 490735 490010 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_04060 491963 490818 gene locus_tag LOCUS_04070 491963 490818 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038509176.1 protein_id gnl|my_center|LOCUS_04070 492331 492008 gene locus_tag LOCUS_04080 492331 492008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 492516 492319 gene locus_tag LOCUS_04090 492516 492319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 492942 493943 gene locus_tag LOCUS_04100 492942 493943 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_04100 494013 494876 gene locus_tag LOCUS_04110 494013 494876 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_04110 494897 496552 gene locus_tag LOCUS_04120 494897 496552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_04120 496552 497553 gene locus_tag LOCUS_04130 496552 497553 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_04130 497714 497995 gene locus_tag LOCUS_04140 497714 497995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04140 498060 499097 gene locus_tag LOCUS_04150 498060 499097 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_04150 499097 499840 gene locus_tag LOCUS_04160 499097 499840 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_04160 499938 501695 gene locus_tag LOCUS_04170 499938 501695 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099968.1 protein_id gnl|my_center|LOCUS_04170 501749 501949 gene locus_tag LOCUS_04180 501749 501949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 501999 502742 gene locus_tag LOCUS_04190 501999 502742 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_04190 502971 505247 gene locus_tag LOCUS_04200 502971 505247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 505250 505447 gene locus_tag LOCUS_04210 505250 505447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 506014 505511 gene locus_tag LOCUS_04220 506014 505511 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 protein_id gnl|my_center|LOCUS_04220 506181 506510 gene locus_tag LOCUS_04230 506181 506510 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_04230 506529 507977 gene locus_tag LOCUS_04240 gene sufB 506529 507977 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_04240 508010 508762 gene locus_tag LOCUS_04250 gene sufC 508010 508762 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_04250 508839 509228 gene locus_tag LOCUS_04260 508839 509228 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_04260 509271 510590 gene locus_tag LOCUS_04270 gene sufD 509271 510590 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_04270 510719 511315 gene locus_tag LOCUS_04280 510719 511315 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_04280 511490 513451 gene locus_tag LOCUS_04290 511490 513451 CDS product biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962279.1 protein_id gnl|my_center|LOCUS_04290 513575 514423 gene locus_tag LOCUS_04300 513575 514423 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_04300 514534 515106 gene locus_tag LOCUS_04310 gene gmk 514534 515106 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962519.1 protein_id gnl|my_center|LOCUS_04310 515215 515796 gene locus_tag LOCUS_04320 gene nadD 515215 515796 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962322.1 protein_id gnl|my_center|LOCUS_04320 521249 515841 gene locus_tag LOCUS_04330 521249 515841 CDS product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463281.1 protein_id gnl|my_center|LOCUS_04330 522453 521251 gene locus_tag LOCUS_04340 522453 521251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 523524 522628 gene locus_tag LOCUS_04350 523524 522628 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962922.1 protein_id gnl|my_center|LOCUS_04350 523611 524375 gene locus_tag LOCUS_04360 523611 524375 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100427.1 protein_id gnl|my_center|LOCUS_04360 524379 525536 gene locus_tag LOCUS_04370 524379 525536 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 protein_id gnl|my_center|LOCUS_04370 525910 526905 gene locus_tag LOCUS_04380 525910 526905 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962320.1 protein_id gnl|my_center|LOCUS_04380 527388 526981 gene locus_tag LOCUS_04390 527388 526981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_04390 528462 527437 gene locus_tag LOCUS_04400 gene pheS 528462 527437 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962303.1 protein_id gnl|my_center|LOCUS_04400 528924 528568 gene locus_tag LOCUS_04410 528924 528568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_04410 530322 529171 gene locus_tag LOCUS_04420 530322 529171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 531473 530382 gene locus_tag LOCUS_04430 531473 530382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 534032 531492 gene locus_tag LOCUS_04440 534032 531492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 536030 534282 gene locus_tag LOCUS_04450 536030 534282 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_04450 536661 536035 gene locus_tag LOCUS_04460 536661 536035 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_04460 536960 537814 gene locus_tag LOCUS_04470 536960 537814 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_04470 537901 539043 gene locus_tag LOCUS_04480 537901 539043 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_04480 539784 539578 gene locus_tag LOCUS_04490 539784 539578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 539741 540388 gene locus_tag LOCUS_04500 539741 540388 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_04500 540777 540460 gene locus_tag LOCUS_04510 540777 540460 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_04510 541095 540856 gene locus_tag LOCUS_04520 541095 540856 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_04520 542257 541130 gene locus_tag LOCUS_04530 542257 541130 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963780.1 protein_id gnl|my_center|LOCUS_04530 542990 542655 gene locus_tag LOCUS_04540 542990 542655 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_04540 543627 542995 gene locus_tag LOCUS_04550 543627 542995 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_04550 544315 543638 gene locus_tag LOCUS_04560 gene trmB 544315 543638 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_04560 544904 544428 gene locus_tag LOCUS_04570 544904 544428 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_04570 545188 549330 gene locus_tag LOCUS_04580 545188 549330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 550270 549488 gene locus_tag LOCUS_04590 550270 549488 CDS product DUF3050 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_04590 551535 550357 gene locus_tag LOCUS_04600 551535 550357 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_04600 552186 551731 gene locus_tag LOCUS_04610 552186 551731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 553012 552299 gene locus_tag LOCUS_04620 553012 552299 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_04620 553595 553068 gene locus_tag LOCUS_04630 gene rimM 553595 553068 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_04630 554174 553611 gene locus_tag LOCUS_04640 554174 553611 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_04640 554403 555098 gene locus_tag LOCUS_04650 554403 555098 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_04650 555644 555093 gene locus_tag LOCUS_04660 555644 555093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_04660 557240 555765 gene locus_tag LOCUS_04670 gene rpoN 557240 555765 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_04670 558754 557321 gene locus_tag LOCUS_04680 gene asnS 558754 557321 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_04680 558993 559427 gene locus_tag LOCUS_04690 558993 559427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 559433 561859 gene locus_tag LOCUS_04700 559433 561859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 561866 563569 gene locus_tag LOCUS_04710 561866 563569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 564526 563615 gene locus_tag LOCUS_04720 564526 563615 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797826.1 protein_id gnl|my_center|LOCUS_04720 564670 564885 gene locus_tag LOCUS_04730 564670 564885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 564933 565187 gene locus_tag LOCUS_04740 564933 565187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 567939 565321 gene locus_tag LOCUS_04750 567939 565321 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085500226.1 protein_id gnl|my_center|LOCUS_04750 570795 568378 gene locus_tag LOCUS_04760 570795 568378 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_04760 570980 573247 gene locus_tag LOCUS_04770 570980 573247 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962610.1 protein_id gnl|my_center|LOCUS_04770 573871 573308 gene locus_tag LOCUS_04780 gene frr 573871 573308 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962605.1 protein_id gnl|my_center|LOCUS_04780 574669 573962 gene locus_tag LOCUS_04790 gene pyrH 574669 573962 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_04790 575153 574818 gene locus_tag LOCUS_04800 575153 574818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 575293 575129 gene locus_tag LOCUS_04810 575293 575129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 576586 575894 gene locus_tag LOCUS_04820 gene truB 576586 575894 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_04820 577383 576586 gene locus_tag LOCUS_04830 577383 576586 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_04830 577694 577455 gene locus_tag LOCUS_04840 577694 577455 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_04840 578608 577733 gene locus_tag LOCUS_04850 578608 577733 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_04850 578772 581816 gene locus_tag LOCUS_04860 gene leuS 578772 581816 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964452.1 protein_id gnl|my_center|LOCUS_04860 582068 582865 gene locus_tag LOCUS_04870 582068 582865 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_04870 583698 582949 gene locus_tag LOCUS_04880 583698 582949 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_04880 584383 583712 gene locus_tag LOCUS_04890 584383 583712 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_04890 584683 585408 gene locus_tag LOCUS_04900 584683 585408 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_04900 585430 586770 gene locus_tag LOCUS_04910 585430 586770 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_04910 586776 587306 gene locus_tag LOCUS_04920 586776 587306 CDS product DUF4296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962340.1 protein_id gnl|my_center|LOCUS_04920 588303 587314 gene locus_tag LOCUS_04930 588303 587314 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_04930 588418 589710 gene locus_tag LOCUS_04940 gene tyrS 588418 589710 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962338.1 protein_id gnl|my_center|LOCUS_04940 590396 589833 gene locus_tag LOCUS_04950 gene gldD 590396 589833 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_04950 591699 590404 gene locus_tag LOCUS_04960 591699 590404 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_04960 592211 591723 gene locus_tag LOCUS_04970 gene ssb 592211 591723 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963776.1 protein_id gnl|my_center|LOCUS_04970 592863 592552 gene locus_tag LOCUS_04980 592863 592552 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_04980 594676 592937 gene locus_tag LOCUS_04990 594676 592937 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_04990 595352 594729 gene locus_tag LOCUS_05000 595352 594729 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107703.1 protein_id gnl|my_center|LOCUS_05000 596634 595363 gene locus_tag LOCUS_05010 gene serS 596634 595363 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_05010 596619 596777 gene locus_tag LOCUS_05020 596619 596777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 597489 596833 gene locus_tag LOCUS_05030 597489 596833 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_05030 598039 597593 gene locus_tag LOCUS_05040 598039 597593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 598795 598097 gene locus_tag LOCUS_05050 598795 598097 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_05050 601157 598854 gene locus_tag LOCUS_05060 601157 598854 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_05060 601646 601167 gene locus_tag LOCUS_05070 601646 601167 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_05070 602853 601630 gene locus_tag LOCUS_05080 gene ricT 602853 601630 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_05080 603270 603112 gene locus_tag LOCUS_05090 603270 603112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05090 604117 603242 gene locus_tag LOCUS_05100 604117 603242 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_05100 605581 604220 gene locus_tag LOCUS_05110 605581 604220 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962203.1 protein_id gnl|my_center|LOCUS_05110 606143 605733 gene locus_tag LOCUS_05120 606143 605733 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_05120 606265 606954 gene locus_tag LOCUS_05130 606265 606954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 607210 607653 gene locus_tag LOCUS_05140 607210 607653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05140 607708 607959 gene locus_tag LOCUS_05150 607708 607959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 608489 607980 gene locus_tag LOCUS_05160 608489 607980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 609203 608739 gene locus_tag LOCUS_05170 609203 608739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 611391 609313 gene locus_tag LOCUS_05180 611391 609313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 611484 613355 gene locus_tag LOCUS_05190 611484 613355 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_05190 613425 614078 gene locus_tag LOCUS_05200 613425 614078 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_05200 614446 615060 gene locus_tag LOCUS_05210 614446 615060 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203445.1 protein_id gnl|my_center|LOCUS_05210 615117 616232 gene locus_tag LOCUS_05220 615117 616232 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138280268.1 protein_id gnl|my_center|LOCUS_05220 616416 619685 gene locus_tag LOCUS_05230 616416 619685 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098195218.1 protein_id gnl|my_center|LOCUS_05230 619714 621252 gene locus_tag LOCUS_05240 619714 621252 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_05240 621345 622325 gene locus_tag LOCUS_05250 621345 622325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 622338 623342 gene locus_tag LOCUS_05260 622338 623342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 623365 624612 gene locus_tag LOCUS_05270 623365 624612 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_05270 624620 625606 gene locus_tag LOCUS_05280 624620 625606 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_05280 626497 625772 gene locus_tag LOCUS_05290 626497 625772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 626989 626543 gene locus_tag LOCUS_05300 626989 626543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 627350 627114 gene locus_tag LOCUS_05310 627350 627114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 629158 627689 gene locus_tag LOCUS_05320 629158 627689 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206971.1 protein_id gnl|my_center|LOCUS_05320 630051 629566 gene locus_tag LOCUS_05330 630051 629566 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963609.1 protein_id gnl|my_center|LOCUS_05330 632203 630104 gene locus_tag LOCUS_05340 gene feoB 632203 630104 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_05340 632442 632203 gene locus_tag LOCUS_05350 632442 632203 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_05350 633153 632536 gene locus_tag LOCUS_05360 633153 632536 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_05360 633470 635806 gene locus_tag LOCUS_05370 633470 635806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 636627 635818 gene locus_tag LOCUS_05380 636627 635818 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_05380 636898 637389 gene locus_tag LOCUS_05390 636898 637389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 638382 637615 gene locus_tag LOCUS_05400 638382 637615 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_05400 639959 638529 gene locus_tag LOCUS_05410 gene pyk 639959 638529 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_05410 640453 639965 gene locus_tag LOCUS_05420 640453 639965 CDS product IPExxxVDY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_05420 641308 640568 gene locus_tag LOCUS_05430 gene rnc 641308 640568 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962378.1 protein_id gnl|my_center|LOCUS_05430 642576 641323 gene locus_tag LOCUS_05440 gene fabF 642576 641323 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962377.1 protein_id gnl|my_center|LOCUS_05440 643050 642814 gene locus_tag LOCUS_05450 643050 642814 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007137004.1 protein_id gnl|my_center|LOCUS_05450 643226 643792 gene locus_tag LOCUS_05460 643226 643792 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_05460 643792 644394 gene locus_tag LOCUS_05470 643792 644394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 644397 644876 gene locus_tag LOCUS_05480 gene rnhA 644397 644876 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_05480 644953 645876 gene locus_tag LOCUS_05490 644953 645876 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_05490 645945 647843 gene locus_tag LOCUS_05500 645945 647843 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_05500 648739 648134 gene locus_tag LOCUS_05510 648739 648134 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_05510 649099 648887 gene locus_tag LOCUS_05520 649099 648887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 649284 650351 gene locus_tag LOCUS_05530 649284 650351 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962872.1 protein_id gnl|my_center|LOCUS_05530 650504 653653 gene locus_tag LOCUS_05540 650504 653653 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_05540 653916 655316 gene locus_tag LOCUS_05550 653916 655316 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_05550 655380 658142 gene locus_tag LOCUS_05560 655380 658142 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_05560 659043 658261 gene locus_tag LOCUS_05570 659043 658261 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_05570 659239 659433 gene locus_tag LOCUS_05580 659239 659433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 660753 659524 gene locus_tag LOCUS_05590 660753 659524 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_05590 661154 661822 gene locus_tag LOCUS_05600 661154 661822 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_05600 661838 663847 gene locus_tag LOCUS_05610 661838 663847 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_05610 663855 664616 gene locus_tag LOCUS_05620 663855 664616 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_05620 664730 666385 gene locus_tag LOCUS_05630 664730 666385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 666382 667014 gene locus_tag LOCUS_05640 gene nreC 666382 667014 CDS product nitrate respiration regulation response regulator NreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485230.1 protein_id gnl|my_center|LOCUS_05640 667130 667453 gene locus_tag LOCUS_05650 667130 667453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 667608 668375 gene locus_tag LOCUS_05660 667608 668375 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_05660 670040 668364 gene locus_tag LOCUS_05670 670040 668364 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_05670 670668 670111 gene locus_tag LOCUS_05680 670668 670111 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_05680 670893 672434 gene locus_tag LOCUS_05690 670893 672434 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964517.1 protein_id gnl|my_center|LOCUS_05690 672790 673626 gene locus_tag LOCUS_05700 672790 673626 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 protein_id gnl|my_center|LOCUS_05700 673805 674104 gene locus_tag LOCUS_05710 673805 674104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 674209 676233 gene locus_tag LOCUS_05720 674209 676233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 676246 676938 gene locus_tag LOCUS_05730 676246 676938 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_05730 677073 679175 gene locus_tag LOCUS_05740 677073 679175 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479228.1 protein_id gnl|my_center|LOCUS_05740 679310 679525 gene locus_tag LOCUS_05750 679310 679525 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_05750 679512 680738 gene locus_tag LOCUS_05760 679512 680738 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 protein_id gnl|my_center|LOCUS_05760 680723 682939 gene locus_tag LOCUS_05770 680723 682939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 682943 684220 gene locus_tag LOCUS_05780 682943 684220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 684403 686808 gene locus_tag LOCUS_05790 684403 686808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 687948 686794 gene locus_tag LOCUS_05800 687948 686794 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_05800 689445 688174 gene locus_tag LOCUS_05810 gene bioA 689445 688174 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_05810 690121 689504 gene locus_tag LOCUS_05820 gene bioD 690121 689504 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964418.1 protein_id gnl|my_center|LOCUS_05820 691397 690246 gene locus_tag LOCUS_05830 691397 690246 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_05830 691729 696462 gene locus_tag LOCUS_05840 691729 696462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 696616 696529 gene locus_tag LOCUS_t00040 696616 696529 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 697706 696678 gene locus_tag LOCUS_05850 697706 696678 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_05850 698832 697696 gene locus_tag LOCUS_05860 698832 697696 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_05860 699661 698894 gene locus_tag LOCUS_05870 699661 698894 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_05870 701769 699811 gene locus_tag LOCUS_05880 701769 699811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 702821 701853 gene locus_tag LOCUS_05890 702821 701853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 703071 703652 gene locus_tag LOCUS_05900 703071 703652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 703655 704377 gene locus_tag LOCUS_05910 703655 704377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 704364 706991 gene locus_tag LOCUS_05920 704364 706991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 706988 707428 gene locus_tag LOCUS_05930 706988 707428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 708215 707436 gene locus_tag LOCUS_05940 708215 707436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 709413 708328 gene locus_tag LOCUS_05950 gene bioB 709413 708328 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_05950 709929 709492 gene locus_tag LOCUS_05960 709929 709492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 710968 710036 gene locus_tag LOCUS_05970 710968 710036 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_05970 713163 711070 gene locus_tag LOCUS_05980 713163 711070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 713862 713236 gene locus_tag LOCUS_05990 gene pth 713862 713236 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_05990 714744 713968 gene locus_tag LOCUS_06000 714744 713968 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765472.1 protein_id gnl|my_center|LOCUS_06000 715562 714951 gene locus_tag LOCUS_06010 715562 714951 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_06010 716682 715741 gene locus_tag LOCUS_06020 716682 715741 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_06020 716968 717048 gene locus_tag LOCUS_t00050 716968 717048 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 717706 717242 gene locus_tag LOCUS_06030 717706 717242 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_06030 717914 718303 gene locus_tag LOCUS_06040 717914 718303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 protein_id gnl|my_center|LOCUS_06040 718457 718284 gene locus_tag LOCUS_06050 718457 718284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 720504 718492 gene locus_tag LOCUS_06060 720504 718492 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_06060 722008 721019 gene locus_tag LOCUS_06070 722008 721019 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_06070 722594 722178 gene locus_tag LOCUS_06080 gene mscL 722594 722178 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963210.1 protein_id gnl|my_center|LOCUS_06080 725109 722662 gene locus_tag LOCUS_06090 725109 722662 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503907.1 protein_id gnl|my_center|LOCUS_06090 725742 725113 gene locus_tag LOCUS_06100 725742 725113 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963208.1 protein_id gnl|my_center|LOCUS_06100 725844 726788 gene locus_tag LOCUS_06110 725844 726788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_06110 726789 727490 gene locus_tag LOCUS_06120 gene rsmI 726789 727490 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963206.1 protein_id gnl|my_center|LOCUS_06120 727502 727849 gene locus_tag LOCUS_06130 727502 727849 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963205.1 protein_id gnl|my_center|LOCUS_06130 729221 727929 gene locus_tag LOCUS_06140 729221 727929 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_06140 729559 729224 gene locus_tag LOCUS_06150 729559 729224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 731262 729640 gene locus_tag LOCUS_06160 gene ade 731262 729640 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_06160 732632 731403 gene locus_tag LOCUS_06170 gene odhB 732632 731403 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_06170 735486 732694 gene locus_tag LOCUS_06180 735486 732694 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_06180 735606 736154 gene locus_tag LOCUS_06190 735606 736154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 protein_id gnl|my_center|LOCUS_06190 736410 736715 gene locus_tag LOCUS_06200 736410 736715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 736835 737281 gene locus_tag LOCUS_06210 736835 737281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 737761 737411 gene locus_tag LOCUS_06220 737761 737411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_06220 738824 737805 gene locus_tag LOCUS_06230 738824 737805 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_06230 738998 740272 gene locus_tag LOCUS_06240 738998 740272 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_06240 740263 740703 gene locus_tag LOCUS_06250 gene umuD 740263 740703 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_06250 741056 740982 gene locus_tag LOCUS_t00060 741056 740982 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 741160 741924 gene locus_tag LOCUS_06260 741160 741924 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_06260 742045 742497 gene locus_tag LOCUS_06270 742045 742497 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_06270 742542 743291 gene locus_tag LOCUS_06280 742542 743291 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_06280 744648 743374 gene locus_tag LOCUS_06290 gene nreB 744648 743374 CDS product nickel resistance MFS transporter NreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_06290 746343 744655 gene locus_tag LOCUS_06300 gene recJ 746343 744655 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_06300 746570 747052 gene locus_tag LOCUS_06310 746570 747052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 747197 747550 gene locus_tag LOCUS_06320 747197 747550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 748367 747627 gene locus_tag LOCUS_06330 gene mtgA 748367 747627 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964436.1 protein_id gnl|my_center|LOCUS_06330 748542 750395 gene locus_tag LOCUS_06340 748542 750395 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964457.1 protein_id gnl|my_center|LOCUS_06340 751813 750461 gene locus_tag LOCUS_06350 gene accC 751813 750461 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_06350 752383 751904 gene locus_tag LOCUS_06360 gene accB 752383 751904 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_06360 753408 752410 gene locus_tag LOCUS_06370 753408 752410 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_06370 753780 753586 gene locus_tag LOCUS_06380 gene rpmF 753780 753586 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_06380 754332 753790 gene locus_tag LOCUS_06390 754332 753790 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_06390 755466 754423 gene locus_tag LOCUS_06400 gene pdxA 755466 754423 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964471.1 protein_id gnl|my_center|LOCUS_06400 755525 756112 gene locus_tag LOCUS_06410 755525 756112 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_06410 756241 756375 gene locus_tag LOCUS_06420 756241 756375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 756642 756568 gene locus_tag LOCUS_t00070 756642 756568 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 756877 757269 gene locus_tag LOCUS_06430 gene rbfA 756877 757269 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962413.1 protein_id gnl|my_center|LOCUS_06430 757273 758472 gene locus_tag LOCUS_06440 757273 758472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_06440 758775 758473 gene locus_tag LOCUS_06450 758775 758473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 758998 758765 gene locus_tag LOCUS_06460 758998 758765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 760003 759065 gene locus_tag LOCUS_06470 gene dusB 760003 759065 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_06470 760458 762254 gene locus_tag LOCUS_06480 gene lepA 760458 762254 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_06480 762354 763064 gene locus_tag LOCUS_06490 762354 763064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 763245 764204 gene locus_tag LOCUS_06500 763245 764204 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_06500 764973 764491 gene locus_tag LOCUS_06510 764973 764491 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_06510 765977 765045 gene locus_tag LOCUS_06520 gene pfkB 765977 765045 CDS product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251741.1 protein_id gnl|my_center|LOCUS_06520 766104 767156 gene locus_tag LOCUS_06530 gene thiL 766104 767156 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_06530 767465 767959 gene locus_tag LOCUS_06540 767465 767959 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_06540 768064 768660 gene locus_tag LOCUS_06550 768064 768660 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_06550 768664 770001 gene locus_tag LOCUS_06560 768664 770001 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_06560 770007 771071 gene locus_tag LOCUS_06570 770007 771071 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941060.1 protein_id gnl|my_center|LOCUS_06570 771168 774344 gene locus_tag LOCUS_06580 771168 774344 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_06580 774637 777294 gene locus_tag LOCUS_06590 774637 777294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 777787 778245 gene locus_tag LOCUS_06600 777787 778245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447940.1 protein_id gnl|my_center|LOCUS_06600 778317 778799 gene locus_tag LOCUS_06610 778317 778799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 779230 780354 gene locus_tag LOCUS_06620 779230 780354 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_06620 781297 780632 gene locus_tag LOCUS_06630 781297 780632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 785941 781406 gene locus_tag LOCUS_06640 gene dnaE 785941 781406 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_06640 786596 787990 gene locus_tag LOCUS_06650 gene leuC 786596 787990 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_06650 788158 788754 gene locus_tag LOCUS_06660 gene leuD 788158 788754 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_06660 788878 790395 gene locus_tag LOCUS_06670 788878 790395 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_06670 790475 791530 gene locus_tag LOCUS_06680 gene leuB 790475 791530 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_06680 792790 791684 gene locus_tag LOCUS_06690 792790 791684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_06690 793766 792795 gene locus_tag LOCUS_06700 793766 792795 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962386.1 protein_id gnl|my_center|LOCUS_06700 795440 793887 gene locus_tag LOCUS_06710 795440 793887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 797742 795592 gene locus_tag LOCUS_06720 797742 795592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 801610 797978 gene locus_tag LOCUS_06730 801610 797978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 801861 802814 gene locus_tag LOCUS_06740 801861 802814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 802817 803371 gene locus_tag LOCUS_06750 gene ruvC 802817 803371 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_06750 803521 804594 gene locus_tag LOCUS_06760 gene hemW 803521 804594 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_06760 805674 804802 gene locus_tag LOCUS_06770 805674 804802 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_06770 805926 805738 gene locus_tag LOCUS_06780 805926 805738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 805956 806540 gene locus_tag LOCUS_06790 805956 806540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 807597 806605 gene locus_tag LOCUS_06800 807597 806605 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_06800 808489 807608 gene locus_tag LOCUS_06810 808489 807608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 809652 808489 gene locus_tag LOCUS_06820 809652 808489 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_06820 811392 810001 gene locus_tag LOCUS_06830 811392 810001 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964308.1 protein_id gnl|my_center|LOCUS_06830 812848 811406 gene locus_tag LOCUS_06840 812848 811406 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964309.1 protein_id gnl|my_center|LOCUS_06840 814739 812859 gene locus_tag LOCUS_06850 gene nuoL 814739 812859 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_06850 815064 814744 gene locus_tag LOCUS_06860 gene nuoK 815064 814744 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_06860 815606 815064 gene locus_tag LOCUS_06870 815606 815064 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964312.1 protein_id gnl|my_center|LOCUS_06870 816152 815607 gene locus_tag LOCUS_06880 816152 815607 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_06880 817300 816248 gene locus_tag LOCUS_06890 gene nuoH 817300 816248 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_06890 818348 817293 gene locus_tag LOCUS_06900 818348 817293 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964315.1 protein_id gnl|my_center|LOCUS_06900 819355 818387 gene locus_tag LOCUS_06910 819355 818387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964316.1 protein_id gnl|my_center|LOCUS_06910 820732 819365 gene locus_tag LOCUS_06920 gene nuoF 820732 819365 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964317.1 protein_id gnl|my_center|LOCUS_06920 821264 820734 gene locus_tag LOCUS_06930 821264 820734 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964318.1 protein_id gnl|my_center|LOCUS_06930 822607 821369 gene locus_tag LOCUS_06940 822607 821369 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_06940 823265 822744 gene locus_tag LOCUS_06950 823265 822744 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964320.1 protein_id gnl|my_center|LOCUS_06950 823818 823270 gene locus_tag LOCUS_06960 823818 823270 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_06960 824495 823926 gene locus_tag LOCUS_06970 824495 823926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 824709 824515 gene locus_tag LOCUS_06980 824709 824515 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_06980 826586 824835 gene locus_tag LOCUS_06990 gene aspS 826586 824835 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_06990 826736 827776 gene locus_tag LOCUS_07000 826736 827776 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 protein_id gnl|my_center|LOCUS_07000 828141 828059 gene locus_tag LOCUS_t00080 828141 828059 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 828251 829639 gene locus_tag LOCUS_07010 828251 829639 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_07010 831071 829716 gene locus_tag LOCUS_07020 831071 829716 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_07020 831195 831584 gene locus_tag LOCUS_07030 831195 831584 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_07030 832759 831701 gene locus_tag LOCUS_07040 832759 831701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 835609 832835 gene locus_tag LOCUS_07050 835609 832835 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_07050 836867 835791 gene locus_tag LOCUS_07060 836867 835791 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_07060 837059 839272 gene locus_tag LOCUS_07070 837059 839272 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 protein_id gnl|my_center|LOCUS_07070 839290 840663 gene locus_tag LOCUS_07080 839290 840663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 841434 840745 gene locus_tag LOCUS_07090 841434 840745 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962381.1 protein_id gnl|my_center|LOCUS_07090 841854 841483 gene locus_tag LOCUS_07100 841854 841483 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_07100 842252 841851 gene locus_tag LOCUS_07110 842252 841851 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704723.1 protein_id gnl|my_center|LOCUS_07110 843188 842358 gene locus_tag LOCUS_07120 843188 842358 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_07120 843989 843192 gene locus_tag LOCUS_07130 843989 843192 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_07130 845029 844016 gene locus_tag LOCUS_07140 845029 844016 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_07140 845441 847237 gene locus_tag LOCUS_07150 845441 847237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_07150 847249 849318 gene locus_tag LOCUS_07160 847249 849318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 849315 850292 gene locus_tag LOCUS_07170 849315 850292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 850448 850765 gene locus_tag LOCUS_07180 gene trxA 850448 850765 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_07180 850894 851820 gene locus_tag LOCUS_07190 850894 851820 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_07190 851908 851982 gene locus_tag LOCUS_t00090 851908 851982 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 853230 852244 gene locus_tag LOCUS_07200 853230 852244 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962300.1 protein_id gnl|my_center|LOCUS_07200 853672 853334 gene locus_tag LOCUS_07210 853672 853334 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962299.1 protein_id gnl|my_center|LOCUS_07210 853920 854603 gene locus_tag LOCUS_07220 853920 854603 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_07220 854725 855720 gene locus_tag LOCUS_07230 854725 855720 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_07230 855894 857231 gene locus_tag LOCUS_07240 855894 857231 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035575.1 protein_id gnl|my_center|LOCUS_07240 857427 858260 gene locus_tag LOCUS_07250 857427 858260 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962532.1 protein_id gnl|my_center|LOCUS_07250 858327 859547 gene locus_tag LOCUS_07260 gene pstC 858327 859547 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962533.1 protein_id gnl|my_center|LOCUS_07260 859550 860497 gene locus_tag LOCUS_07270 gene pstA 859550 860497 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962534.1 protein_id gnl|my_center|LOCUS_07270 860593 861351 gene locus_tag LOCUS_07280 gene pstB 860593 861351 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_07280 861440 862129 gene locus_tag LOCUS_07290 gene phoU 861440 862129 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100092.1 protein_id gnl|my_center|LOCUS_07290 863249 862185 gene locus_tag LOCUS_07300 863249 862185 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_07300 863840 863397 gene locus_tag LOCUS_07310 863840 863397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 867333 863917 gene locus_tag LOCUS_07320 867333 863917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_07320 868716 867460 gene locus_tag LOCUS_07330 868716 867460 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_07330 869298 868831 gene locus_tag LOCUS_07340 869298 868831 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_07340 869465 870484 gene locus_tag LOCUS_07350 gene fbp 869465 870484 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962470.1 protein_id gnl|my_center|LOCUS_07350 871020 870589 gene locus_tag LOCUS_07360 871020 870589 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_07360 871210 871803 gene locus_tag LOCUS_07370 871210 871803 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_07370 871805 872233 gene locus_tag LOCUS_07380 871805 872233 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_07380 872323 873894 gene locus_tag LOCUS_07390 872323 873894 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_07390 874503 873895 gene locus_tag LOCUS_07400 874503 873895 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 protein_id gnl|my_center|LOCUS_07400 874706 874503 gene locus_tag LOCUS_07410 874706 874503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962630.1 protein_id gnl|my_center|LOCUS_07410 875335 874760 gene locus_tag LOCUS_07420 875335 874760 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_07420 875553 876134 gene locus_tag LOCUS_07430 875553 876134 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_07430 876371 877348 gene locus_tag LOCUS_07440 876371 877348 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_07440 877499 879928 gene locus_tag LOCUS_07450 877499 879928 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962626.1 protein_id gnl|my_center|LOCUS_07450 880007 880480 gene locus_tag LOCUS_07460 880007 880480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 881422 880502 gene locus_tag LOCUS_07470 881422 880502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 881725 884175 gene locus_tag LOCUS_07480 881725 884175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 884305 885369 gene locus_tag LOCUS_07490 884305 885369 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_07490 885366 886949 gene locus_tag LOCUS_07500 885366 886949 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766132.1 protein_id gnl|my_center|LOCUS_07500 887017 889134 gene locus_tag LOCUS_07510 887017 889134 CDS product alpha-L-rhamnosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695108.1 protein_id gnl|my_center|LOCUS_07510 889134 890792 gene locus_tag LOCUS_07520 889134 890792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 890978 892114 gene locus_tag LOCUS_07530 890978 892114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 892342 895527 gene locus_tag LOCUS_07540 gene lacZ 892342 895527 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_07540 895631 899035 gene locus_tag LOCUS_07550 895631 899035 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765775.1 protein_id gnl|my_center|LOCUS_07550 899120 900544 gene locus_tag LOCUS_07560 899120 900544 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765774.1 protein_id gnl|my_center|LOCUS_07560 900676 903006 gene locus_tag LOCUS_07570 900676 903006 CDS product DUF5703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765773.1 protein_id gnl|my_center|LOCUS_07570 903097 905550 gene locus_tag LOCUS_07580 903097 905550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 905682 907703 gene locus_tag LOCUS_07590 905682 907703 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107563.1 protein_id gnl|my_center|LOCUS_07590 907995 908903 gene locus_tag LOCUS_07600 907995 908903 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103676442.1 protein_id gnl|my_center|LOCUS_07600 908996 909928 gene locus_tag LOCUS_07610 908996 909928 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_07610 909934 911583 gene locus_tag LOCUS_07620 909934 911583 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_07620 911583 912368 gene locus_tag LOCUS_07630 911583 912368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 913138 916476 gene locus_tag LOCUS_07640 913138 916476 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109115.1 protein_id gnl|my_center|LOCUS_07640 916463 918499 gene locus_tag LOCUS_07650 916463 918499 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764345.1 protein_id gnl|my_center|LOCUS_07650 918680 920383 gene locus_tag LOCUS_07660 918680 920383 CDS product thrombospondin type 3 repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765812.1 protein_id gnl|my_center|LOCUS_07660 920488 921156 gene locus_tag LOCUS_07670 920488 921156 CDS product DUF3826 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765811.1 protein_id gnl|my_center|LOCUS_07670 921185 922891 gene locus_tag LOCUS_07680 921185 922891 CDS product polysaccharide lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765769.1 protein_id gnl|my_center|LOCUS_07680 923041 926121 gene locus_tag LOCUS_07690 923041 926121 CDS product DUF6298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149839243.1 protein_id gnl|my_center|LOCUS_07690 926139 927536 gene locus_tag LOCUS_07700 926139 927536 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107572.1 protein_id gnl|my_center|LOCUS_07700 927569 929143 gene locus_tag LOCUS_07710 927569 929143 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107578.1 protein_id gnl|my_center|LOCUS_07710 929400 929903 gene locus_tag LOCUS_07720 929400 929903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 929966 930883 gene locus_tag LOCUS_07730 929966 930883 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217731.1 protein_id gnl|my_center|LOCUS_07730 931013 932887 gene locus_tag LOCUS_07740 931013 932887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 933084 935741 gene locus_tag LOCUS_07750 933084 935741 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765808.1 protein_id gnl|my_center|LOCUS_07750 935922 937346 gene locus_tag LOCUS_07760 935922 937346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 937567 940032 gene locus_tag LOCUS_07770 937567 940032 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_07770 940097 940639 gene locus_tag LOCUS_07780 940097 940639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 940629 941102 gene locus_tag LOCUS_07790 940629 941102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 941331 942872 gene locus_tag LOCUS_07800 941331 942872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 942922 943905 gene locus_tag LOCUS_07810 942922 943905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 944120 946771 gene locus_tag LOCUS_07820 944120 946771 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_07820 946777 947928 gene locus_tag LOCUS_07830 946777 947928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 948003 948926 gene locus_tag LOCUS_07840 948003 948926 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_07840 949052 951784 gene locus_tag LOCUS_07850 949052 951784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303161.1 protein_id gnl|my_center|LOCUS_07850 951848 955336 gene locus_tag LOCUS_07860 951848 955336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 955419 957830 gene locus_tag LOCUS_07870 gene galB 955419 957830 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_07870 957857 959098 gene locus_tag LOCUS_07880 957857 959098 CDS product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533063.1 protein_id gnl|my_center|LOCUS_07880 959098 960477 gene locus_tag LOCUS_07890 959098 960477 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533064.1 protein_id gnl|my_center|LOCUS_07890 960474 961136 gene locus_tag LOCUS_07900 960474 961136 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393497.1 protein_id gnl|my_center|LOCUS_07900 961253 962452 gene locus_tag LOCUS_07910 961253 962452 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_07910 965267 962535 gene locus_tag LOCUS_07920 965267 962535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 966273 965686 gene locus_tag LOCUS_07930 966273 965686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 967751 966450 gene locus_tag LOCUS_07940 gene fucP 967751 966450 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039140.1 protein_id gnl|my_center|LOCUS_07940 968214 967774 gene locus_tag LOCUS_07950 968214 967774 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975563.1 protein_id gnl|my_center|LOCUS_07950 969460 968393 gene locus_tag LOCUS_07960 969460 968393 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533030.1 protein_id gnl|my_center|LOCUS_07960 970753 969530 gene locus_tag LOCUS_07970 970753 969530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 971892 970756 gene locus_tag LOCUS_07980 971892 970756 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015243166.1 protein_id gnl|my_center|LOCUS_07980 973032 971893 gene locus_tag LOCUS_07990 973032 971893 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533015.1 protein_id gnl|my_center|LOCUS_07990 974177 973029 gene locus_tag LOCUS_08000 974177 973029 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975545.1 protein_id gnl|my_center|LOCUS_08000 974220 974393 gene locus_tag LOCUS_08010 974220 974393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 974817 974365 gene locus_tag LOCUS_08020 974817 974365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 976397 975081 gene locus_tag LOCUS_08030 gene ahcY 976397 975081 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_08030 976635 977270 gene locus_tag LOCUS_08040 976635 977270 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_08040 978506 977313 gene locus_tag LOCUS_08050 978506 977313 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_08050 978713 979435 gene locus_tag LOCUS_08060 978713 979435 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_08060 979435 980055 gene locus_tag LOCUS_08070 gene pnuC 979435 980055 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_08070 980019 982130 gene locus_tag LOCUS_08080 980019 982130 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962362.1 protein_id gnl|my_center|LOCUS_08080 982130 982531 gene locus_tag LOCUS_08090 gene arfB 982130 982531 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_08090 982762 984987 gene locus_tag LOCUS_08100 982762 984987 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_08100 985471 985049 gene locus_tag LOCUS_08110 985471 985049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_08110 985602 986114 gene locus_tag LOCUS_08120 gene greA 985602 986114 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_08120 986210 986596 gene locus_tag LOCUS_08130 986210 986596 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_08130 987656 986637 gene locus_tag LOCUS_08140 987656 986637 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_08140 988067 988447 gene locus_tag LOCUS_08150 988067 988447 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_08150 989201 988500 gene locus_tag LOCUS_08160 989201 988500 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_08160 990361 989357 gene locus_tag LOCUS_08170 990361 989357 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530514.1 protein_id gnl|my_center|LOCUS_08170 991167 990367 gene locus_tag LOCUS_08180 991167 990367 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463536.1 protein_id gnl|my_center|LOCUS_08180 991269 991676 gene locus_tag LOCUS_08190 991269 991676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 991876 991703 gene locus_tag LOCUS_08200 991876 991703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 991806 992456 gene locus_tag LOCUS_08210 gene aat 991806 992456 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_08210 992516 993307 gene locus_tag LOCUS_08220 992516 993307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 994377 993547 gene locus_tag LOCUS_08230 994377 993547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 995042 994479 gene locus_tag LOCUS_08240 995042 994479 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_08240 996054 995125 gene locus_tag LOCUS_08250 996054 995125 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_08250 997234 996056 gene locus_tag LOCUS_08260 997234 996056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 998493 997231 gene locus_tag LOCUS_08270 998493 997231 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_08270 1001044 998624 gene locus_tag LOCUS_08280 1001044 998624 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_08280 1001201 1002229 gene locus_tag LOCUS_08290 1001201 1002229 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_08290 1003435 1002473 gene locus_tag LOCUS_08300 gene tsf 1003435 1002473 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325915.1 protein_id gnl|my_center|LOCUS_08300 1004364 1003573 gene locus_tag LOCUS_08310 gene rpsB 1004364 1003573 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962623.1 protein_id gnl|my_center|LOCUS_08310 1004935 1004549 gene locus_tag LOCUS_08320 gene rpsI 1004935 1004549 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962624.1 protein_id gnl|my_center|LOCUS_08320 1005390 1004935 gene locus_tag LOCUS_08330 gene rplM 1005390 1004935 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_08330 1005715 1006740 gene locus_tag LOCUS_08340 1005715 1006740 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_08340 1007150 1006758 gene locus_tag LOCUS_08350 1007150 1006758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1010041 1007210 gene locus_tag LOCUS_08360 gene polA 1010041 1007210 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_08360 1010152 1010382 gene locus_tag LOCUS_08370 1010152 1010382 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_08370 1010383 1010736 gene locus_tag LOCUS_08380 1010383 1010736 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143969.1 protein_id gnl|my_center|LOCUS_08380 1012793 1010937 gene locus_tag LOCUS_08390 1012793 1010937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1013536 1012790 gene locus_tag LOCUS_08400 1013536 1012790 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_08400 1013711 1015312 gene locus_tag LOCUS_08410 1013711 1015312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1017501 1015378 gene locus_tag LOCUS_08420 1017501 1015378 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303096.1 protein_id gnl|my_center|LOCUS_08420 1018261 1017503 gene locus_tag LOCUS_08430 1018261 1017503 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_08430 1020225 1018366 gene locus_tag LOCUS_08440 1020225 1018366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1020795 1022027 gene locus_tag LOCUS_08450 1020795 1022027 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_08450 1022102 1022398 gene locus_tag LOCUS_08460 1022102 1022398 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_08460 1023048 1022395 gene locus_tag LOCUS_08470 1023048 1022395 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_08470 1026406 1023134 gene locus_tag LOCUS_08480 1026406 1023134 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 protein_id gnl|my_center|LOCUS_08480 1026644 1026715 gene locus_tag LOCUS_t00100 1026644 1026715 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1027592 1026768 gene locus_tag LOCUS_08490 1027592 1026768 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_08490 1027774 1028238 gene locus_tag LOCUS_08500 gene rimP 1027774 1028238 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962637.1 protein_id gnl|my_center|LOCUS_08500 1028252 1029505 gene locus_tag LOCUS_08510 gene nusA 1028252 1029505 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962638.1 protein_id gnl|my_center|LOCUS_08510 1029663 1032539 gene locus_tag LOCUS_08520 gene infB 1029663 1032539 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962639.1 protein_id gnl|my_center|LOCUS_08520 1033620 1033231 gene locus_tag LOCUS_08530 1033620 1033231 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 protein_id gnl|my_center|LOCUS_08530 1033896 1035173 gene locus_tag LOCUS_08540 1033896 1035173 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_08540 1035208 1038276 gene locus_tag LOCUS_08550 1035208 1038276 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_08550 1038305 1039708 gene locus_tag LOCUS_08560 gene nrfD 1038305 1039708 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_08560 1039701 1040225 gene locus_tag LOCUS_08570 1039701 1040225 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_08570 1040234 1040785 gene locus_tag LOCUS_08580 1040234 1040785 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_08580 1040858 1042324 gene locus_tag LOCUS_08590 1040858 1042324 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_08590 1042342 1043499 gene locus_tag LOCUS_08600 1042342 1043499 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_08600 1043529 1045325 gene locus_tag LOCUS_08610 1043529 1045325 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_08610 1045404 1046426 gene locus_tag LOCUS_08620 gene ruvB 1045404 1046426 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_08620 1046429 1047352 gene locus_tag LOCUS_08630 gene queG 1046429 1047352 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_08630 1047422 1047847 gene locus_tag LOCUS_08640 1047422 1047847 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_08640 1048076 1048966 gene locus_tag LOCUS_08650 gene cyoE 1048076 1048966 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964205.1 protein_id gnl|my_center|LOCUS_08650 1048969 1049556 gene locus_tag LOCUS_08660 1048969 1049556 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_08660 1049599 1050576 gene locus_tag LOCUS_08670 1049599 1050576 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_08670 1050596 1050946 gene locus_tag LOCUS_08680 1050596 1050946 CDS product cytochrome C oxidase subunit IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_08680 1051022 1051663 gene locus_tag LOCUS_08690 1051022 1051663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_08690 1051675 1052361 gene locus_tag LOCUS_08700 1051675 1052361 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_08700 1052364 1052903 gene locus_tag LOCUS_08710 1052364 1052903 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_08710 1052896 1053159 gene locus_tag LOCUS_08720 1052896 1053159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 protein_id gnl|my_center|LOCUS_08720 1054603 1053206 gene locus_tag LOCUS_08730 1054603 1053206 CDS product DUF4403 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964213.1 protein_id gnl|my_center|LOCUS_08730 1054776 1055477 gene locus_tag LOCUS_08740 1054776 1055477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_08740 1055470 1056714 gene locus_tag LOCUS_08750 1055470 1056714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_08750 1056717 1057979 gene locus_tag LOCUS_08760 1056717 1057979 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_08760 1058020 1059135 gene locus_tag LOCUS_08770 1058020 1059135 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_08770 1059265 1060575 gene locus_tag LOCUS_08780 1059265 1060575 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_08780 1060582 1061871 gene locus_tag LOCUS_08790 1060582 1061871 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_08790 1061981 1062649 gene locus_tag LOCUS_08800 gene tsaB 1061981 1062649 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_08800 1063287 1062745 gene locus_tag LOCUS_08810 1063287 1062745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1064326 1063508 gene locus_tag LOCUS_08820 1064326 1063508 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963360.1 protein_id gnl|my_center|LOCUS_08820 1065247 1064348 gene locus_tag LOCUS_08830 1065247 1064348 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_08830 1065409 1066377 gene locus_tag LOCUS_08840 1065409 1066377 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_08840 1066386 1066904 gene locus_tag LOCUS_08850 1066386 1066904 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_08850 1067681 1066908 gene locus_tag LOCUS_08860 gene murI 1067681 1066908 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_08860 1068381 1067881 gene locus_tag LOCUS_08870 1068381 1067881 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100219.1 protein_id gnl|my_center|LOCUS_08870 1069638 1068415 gene locus_tag LOCUS_08880 1069638 1068415 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_08880 1072430 1069674 gene locus_tag LOCUS_08890 gene bamA 1072430 1069674 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_08890 1073103 1072363 gene locus_tag LOCUS_08900 1073103 1072363 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_08900 1073750 1073106 gene locus_tag LOCUS_08910 1073750 1073106 CDS product DUF6089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_08910 1073718 1073873 gene locus_tag LOCUS_08920 1073718 1073873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1074837 1073953 gene locus_tag LOCUS_08930 1074837 1073953 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_08930 1075541 1074882 gene locus_tag LOCUS_08940 1075541 1074882 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_08940 1075651 1076364 gene locus_tag LOCUS_08950 1075651 1076364 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964190.1 protein_id gnl|my_center|LOCUS_08950 1076461 1077222 gene locus_tag LOCUS_08960 1076461 1077222 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_08960 1077250 1077594 gene locus_tag LOCUS_08970 1077250 1077594 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 protein_id gnl|my_center|LOCUS_08970 1077716 1079041 gene locus_tag LOCUS_08980 1077716 1079041 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_08980 1079274 1079945 gene locus_tag LOCUS_08990 gene clpP 1079274 1079945 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964184.1 protein_id gnl|my_center|LOCUS_08990 1080022 1081257 gene locus_tag LOCUS_09000 gene clpX 1080022 1081257 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964183.1 protein_id gnl|my_center|LOCUS_09000 1081351 1082400 gene locus_tag LOCUS_09010 1081351 1082400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1082646 1083881 gene locus_tag LOCUS_09020 gene serB 1082646 1083881 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010528670.1 protein_id gnl|my_center|LOCUS_09020 1084527 1084012 gene locus_tag LOCUS_09030 1084527 1084012 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853140.1 protein_id gnl|my_center|LOCUS_09030 1085366 1084875 gene locus_tag LOCUS_09040 1085366 1084875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1086288 1085356 gene locus_tag LOCUS_09050 1086288 1085356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432060.1 protein_id gnl|my_center|LOCUS_09050 1086762 1088171 gene locus_tag LOCUS_09060 1086762 1088171 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_09060 1089785 1088391 gene locus_tag LOCUS_09070 1089785 1088391 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_09070 1089968 1090750 gene locus_tag LOCUS_09080 gene dapF 1089968 1090750 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_09080 1090750 1091283 gene locus_tag LOCUS_09090 1090750 1091283 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_09090 1091295 1092335 gene locus_tag LOCUS_09100 gene mltG 1091295 1092335 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_09100 1092374 1093252 gene locus_tag LOCUS_09110 1092374 1093252 CDS product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 protein_id gnl|my_center|LOCUS_09110 1093352 1093990 gene locus_tag LOCUS_09120 1093352 1093990 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 protein_id gnl|my_center|LOCUS_09120 1094485 1094072 gene locus_tag LOCUS_09130 1094485 1094072 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_09130 1094730 1094482 gene locus_tag LOCUS_09140 1094730 1094482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1095564 1094839 gene locus_tag LOCUS_09150 1095564 1094839 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_09150 1096088 1095621 gene locus_tag LOCUS_09160 1096088 1095621 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_09160 1097523 1096096 gene locus_tag LOCUS_09170 gene dnaA 1097523 1096096 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_09170 1097700 1098104 gene locus_tag LOCUS_09180 1097700 1098104 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_09180 1098762 1098154 gene locus_tag LOCUS_09190 1098762 1098154 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_09190 1099592 1098981 gene locus_tag LOCUS_09200 1099592 1098981 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_09200 1100628 1099585 gene locus_tag LOCUS_09210 gene ribD 1100628 1099585 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_09210 1101064 1101948 gene locus_tag LOCUS_09220 gene prmC 1101064 1101948 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_09220 1102432 1102070 gene locus_tag LOCUS_09230 1102432 1102070 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_09230 1103786 1102548 gene locus_tag LOCUS_09240 1103786 1102548 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_09240 1104009 1105379 gene locus_tag LOCUS_09250 gene hisS 1104009 1105379 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_09250 1105737 1105486 gene locus_tag LOCUS_09260 1105737 1105486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1112484 1106038 gene locus_tag LOCUS_09270 1112484 1106038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1113364 1113137 gene locus_tag LOCUS_09280 1113364 1113137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1118119 1113515 gene locus_tag LOCUS_09290 1118119 1113515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1122627 1118362 gene locus_tag LOCUS_09300 1122627 1118362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1124853 1122811 gene locus_tag LOCUS_09310 1124853 1122811 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206116.1 protein_id gnl|my_center|LOCUS_09310 1125673 1125110 gene locus_tag LOCUS_09320 1125673 1125110 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_09320 1125983 1127665 gene locus_tag LOCUS_09330 1125983 1127665 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100342827.1 protein_id gnl|my_center|LOCUS_09330 1127684 1128976 gene locus_tag LOCUS_09340 1127684 1128976 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_09340 1130113 1128977 gene locus_tag LOCUS_09350 1130113 1128977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1131012 1130227 gene locus_tag LOCUS_09360 1131012 1130227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1134997 1130999 gene locus_tag LOCUS_09370 1134997 1130999 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208353729.1 protein_id gnl|my_center|LOCUS_09370 1137972 1135342 gene locus_tag LOCUS_09380 1137972 1135342 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208353729.1 protein_id gnl|my_center|LOCUS_09380 1142538 1138564 gene locus_tag LOCUS_09390 1142538 1138564 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208353729.1 protein_id gnl|my_center|LOCUS_09390 1149227 1142622 gene locus_tag LOCUS_09400 1149227 1142622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1149729 1151759 gene locus_tag LOCUS_09410 1149729 1151759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1152338 1152817 gene locus_tag LOCUS_09420 1152338 1152817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1152814 1153542 gene locus_tag LOCUS_09430 1152814 1153542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1153539 1155740 gene locus_tag LOCUS_09440 1153539 1155740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1156213 1156566 gene locus_tag LOCUS_09450 1156213 1156566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1156726 1158138 gene locus_tag LOCUS_09460 1156726 1158138 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_09460 1158221 1159522 gene locus_tag LOCUS_09470 1158221 1159522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1159530 1160324 gene locus_tag LOCUS_09480 1159530 1160324 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_09480 1160365 1161288 gene locus_tag LOCUS_09490 1160365 1161288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1161298 1162296 gene locus_tag LOCUS_09500 1161298 1162296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1162313 1163284 gene locus_tag LOCUS_09510 1162313 1163284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1163487 1164485 gene locus_tag LOCUS_09520 1163487 1164485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1164551 1165567 gene locus_tag LOCUS_09530 1164551 1165567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 1165564 1166814 gene locus_tag LOCUS_09540 1165564 1166814 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974188.1 protein_id gnl|my_center|LOCUS_09540 1166820 1168124 gene locus_tag LOCUS_09550 1166820 1168124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1168191 1169297 gene locus_tag LOCUS_09560 1168191 1169297 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_09560 1169294 1170376 gene locus_tag LOCUS_09570 1169294 1170376 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331373.1 protein_id gnl|my_center|LOCUS_09570 1170373 1171485 gene locus_tag LOCUS_09580 1170373 1171485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1171628 1172044 gene locus_tag LOCUS_09590 1171628 1172044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1172037 1172864 gene locus_tag LOCUS_09600 1172037 1172864 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_09600 1172866 1173807 gene locus_tag LOCUS_09610 1172866 1173807 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_09610 1174150 1174899 gene locus_tag LOCUS_09620 1174150 1174899 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921533.1 protein_id gnl|my_center|LOCUS_09620 1174970 1175761 gene locus_tag LOCUS_09630 1174970 1175761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1175861 1178191 gene locus_tag LOCUS_09640 1175861 1178191 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107290.1 protein_id gnl|my_center|LOCUS_09640 1178253 1178687 gene locus_tag LOCUS_09650 1178253 1178687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1178708 1180057 gene locus_tag LOCUS_09660 1178708 1180057 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_09660 1180038 1180274 gene locus_tag LOCUS_09670 1180038 1180274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1180574 1182589 gene locus_tag LOCUS_09680 1180574 1182589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1182741 1184654 gene locus_tag LOCUS_09690 1182741 1184654 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_09690 1185704 1184991 gene locus_tag LOCUS_09700 1185704 1184991 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_09700 1186634 1185765 gene locus_tag LOCUS_09710 1186634 1185765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1186952 1189198 gene locus_tag LOCUS_09720 1186952 1189198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1189215 1191092 gene locus_tag LOCUS_09730 1189215 1191092 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_09730 1191159 1192124 gene locus_tag LOCUS_09740 1191159 1192124 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107586.1 protein_id gnl|my_center|LOCUS_09740 1192132 1193196 gene locus_tag LOCUS_09750 1192132 1193196 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_09750 1193287 1194393 gene locus_tag LOCUS_09760 1193287 1194393 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_09760 1194405 1195508 gene locus_tag LOCUS_09770 1194405 1195508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1195522 1196538 gene locus_tag LOCUS_09780 1195522 1196538 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_09780 1196591 1198897 gene locus_tag LOCUS_09790 1196591 1198897 CDS product glycoside hydrolase family 20 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107900.1 protein_id gnl|my_center|LOCUS_09790 1198965 1200785 gene locus_tag LOCUS_09800 1198965 1200785 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203551.1 protein_id gnl|my_center|LOCUS_09800 1200816 1202300 gene locus_tag LOCUS_09810 1200816 1202300 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_09810 1202310 1204553 gene locus_tag LOCUS_09820 1202310 1204553 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_09820 1204566 1207226 gene locus_tag LOCUS_09830 1204566 1207226 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107972.1 protein_id gnl|my_center|LOCUS_09830 1207551 1210643 gene locus_tag LOCUS_09840 1207551 1210643 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090706773.1 protein_id gnl|my_center|LOCUS_09840 1210665 1212266 gene locus_tag LOCUS_09850 1210665 1212266 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107590.1 protein_id gnl|my_center|LOCUS_09850 1212394 1213116 gene locus_tag LOCUS_09860 gene cutC 1212394 1213116 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185770.1 protein_id gnl|my_center|LOCUS_09860 1213203 1214531 gene locus_tag LOCUS_09870 1213203 1214531 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_09870 1214585 1215604 gene locus_tag LOCUS_09880 1214585 1215604 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_09880 1215633 1215968 gene locus_tag LOCUS_09890 1215633 1215968 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039139.1 protein_id gnl|my_center|LOCUS_09890 1216035 1216976 gene locus_tag LOCUS_09900 1216035 1216976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1217149 1217075 gene locus_tag LOCUS_t00110 1217149 1217075 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1217306 1217698 gene locus_tag LOCUS_09910 1217306 1217698 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_09910 1217752 1218591 gene locus_tag LOCUS_09920 1217752 1218591 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_09920 1219148 1218588 gene locus_tag LOCUS_09930 1219148 1218588 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_09930 1219656 1219384 gene locus_tag LOCUS_09940 1219656 1219384 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_09940 1220786 1219839 gene locus_tag LOCUS_09950 gene fmt 1220786 1219839 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964109.1 protein_id gnl|my_center|LOCUS_09950 1222681 1220786 gene locus_tag LOCUS_09960 1222681 1220786 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_09960 1223234 1222701 gene locus_tag LOCUS_09970 1223234 1222701 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_09970 1223385 1223669 gene locus_tag LOCUS_09980 1223385 1223669 CDS product DUF493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_09980 1223767 1224495 gene locus_tag LOCUS_09990 1223767 1224495 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_09990 1224577 1225887 gene locus_tag LOCUS_10000 gene murA 1224577 1225887 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964114.1 protein_id gnl|my_center|LOCUS_10000 1225975 1226847 gene locus_tag LOCUS_10010 1225975 1226847 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_10010 1227338 1226925 gene locus_tag LOCUS_10020 gene aroQ 1227338 1226925 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964118.1 protein_id gnl|my_center|LOCUS_10020 1227956 1227414 gene locus_tag LOCUS_10030 1227956 1227414 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_10030 1228211 1228807 gene locus_tag LOCUS_10040 1228211 1228807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1228882 1229778 gene locus_tag LOCUS_10050 gene xerD 1228882 1229778 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_10050 1230365 1229793 gene locus_tag LOCUS_10060 1230365 1229793 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_10060 1232107 1230545 gene locus_tag LOCUS_10070 gene rny 1232107 1230545 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_10070 1232612 1232319 gene locus_tag LOCUS_10080 1232612 1232319 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963283.1 protein_id gnl|my_center|LOCUS_10080 1232911 1232621 gene locus_tag LOCUS_10090 1232911 1232621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_10090 1233033 1234781 gene locus_tag LOCUS_10100 1233033 1234781 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_10100 1234842 1237259 gene locus_tag LOCUS_10110 1234842 1237259 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_10110 1237391 1237918 gene locus_tag LOCUS_10120 1237391 1237918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1240869 1238290 gene locus_tag LOCUS_10130 1240869 1238290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1244034 1240876 gene locus_tag LOCUS_10140 1244034 1240876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1245797 1244163 gene locus_tag LOCUS_10150 1245797 1244163 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_10150 1247039 1245840 gene locus_tag LOCUS_10160 1247039 1245840 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_10160 1248770 1247166 gene locus_tag LOCUS_10170 1248770 1247166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1250723 1248828 gene locus_tag LOCUS_10180 1250723 1248828 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_10180 1253963 1250742 gene locus_tag LOCUS_10190 1253963 1250742 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_10190 1254832 1254017 gene locus_tag LOCUS_10200 1254832 1254017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1259573 1255275 gene locus_tag LOCUS_10210 1259573 1255275 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109105.1 protein_id gnl|my_center|LOCUS_10210 1259915 1262530 gene locus_tag LOCUS_10220 1259915 1262530 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_10220 1263433 1262732 gene locus_tag LOCUS_10230 1263433 1262732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963278.1 protein_id gnl|my_center|LOCUS_10230 1265335 1263509 gene locus_tag LOCUS_10240 1265335 1263509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_10240 1267198 1265420 gene locus_tag LOCUS_10250 1267198 1265420 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_10250 1268171 1267218 gene locus_tag LOCUS_10260 1268171 1267218 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_10260 1268707 1268180 gene locus_tag LOCUS_10270 1268707 1268180 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963274.1 protein_id gnl|my_center|LOCUS_10270 1268954 1269205 gene locus_tag LOCUS_10280 1268954 1269205 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_10280 1269372 1270547 gene locus_tag LOCUS_10290 1269372 1270547 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_10290 1270693 1272021 gene locus_tag LOCUS_10300 gene mtaB 1270693 1272021 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_10300 1272926 1272099 gene locus_tag LOCUS_10310 1272926 1272099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962726.1 protein_id gnl|my_center|LOCUS_10310 1273083 1273961 gene locus_tag LOCUS_10320 1273083 1273961 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_10320 1274590 1274033 gene locus_tag LOCUS_10330 1274590 1274033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1274994 1276376 gene locus_tag LOCUS_10340 1274994 1276376 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_10340 1276385 1276615 gene locus_tag LOCUS_10350 1276385 1276615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_10350 1277061 1277816 gene locus_tag LOCUS_10360 1277061 1277816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1278521 1277880 gene locus_tag LOCUS_10370 1278521 1277880 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764706.1 protein_id gnl|my_center|LOCUS_10370 1278985 1278578 gene locus_tag LOCUS_10380 1278985 1278578 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383201.1 protein_id gnl|my_center|LOCUS_10380 1279114 1280025 gene locus_tag LOCUS_10390 1279114 1280025 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906865.1 protein_id gnl|my_center|LOCUS_10390 1280039 1281259 gene locus_tag LOCUS_10400 1280039 1281259 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097845.1 protein_id gnl|my_center|LOCUS_10400 1281349 1281987 gene locus_tag LOCUS_10410 1281349 1281987 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318285.1 protein_id gnl|my_center|LOCUS_10410 1282425 1282069 gene locus_tag LOCUS_10420 1282425 1282069 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_10420 1282722 1282429 gene locus_tag LOCUS_10430 1282722 1282429 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_10430 1283378 1282797 gene locus_tag LOCUS_10440 gene nudK 1283378 1282797 CDS product GDP-mannose pyrophosphatase NudK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_10440 1284949 1283423 gene locus_tag LOCUS_10450 1284949 1283423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1288110 1285147 gene locus_tag LOCUS_10460 gene secDF 1288110 1285147 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_10460 1289268 1288333 gene locus_tag LOCUS_10470 1289268 1288333 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962692.1 protein_id gnl|my_center|LOCUS_10470 1291290 1289347 gene locus_tag LOCUS_10480 gene gyrB 1291290 1289347 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_10480 1292576 1291464 gene locus_tag LOCUS_10490 1292576 1291464 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_10490 1292656 1293045 gene locus_tag LOCUS_10500 1292656 1293045 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_10500 1293093 1293593 gene locus_tag LOCUS_10510 1293093 1293593 CDS product phosphoribosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_10510 1294103 1293585 gene locus_tag LOCUS_10520 1294103 1293585 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963564.1 protein_id gnl|my_center|LOCUS_10520 1294231 1294304 gene locus_tag LOCUS_t00120 1294231 1294304 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1294342 1294415 gene locus_tag LOCUS_t00130 1294342 1294415 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1294458 1294541 gene locus_tag LOCUS_t00140 1294458 1294541 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1295332 1294703 gene locus_tag LOCUS_10530 1295332 1294703 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941342.1 protein_id gnl|my_center|LOCUS_10530 1297266 1295329 gene locus_tag LOCUS_10540 1297266 1295329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1297947 1299770 gene locus_tag LOCUS_10550 1297947 1299770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1299850 1300035 gene locus_tag LOCUS_10560 1299850 1300035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1300058 1300840 gene locus_tag LOCUS_10570 1300058 1300840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1300901 1301755 gene locus_tag LOCUS_10580 1300901 1301755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1302573 1301863 gene locus_tag LOCUS_10590 1302573 1301863 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_10590 1304549 1302684 gene locus_tag LOCUS_10600 1304549 1302684 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_10600 1304937 1304659 gene locus_tag LOCUS_10610 1304937 1304659 CDS product DUF2805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963289.1 protein_id gnl|my_center|LOCUS_10610 1306095 1305196 gene locus_tag LOCUS_10620 1306095 1305196 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963631.1 protein_id gnl|my_center|LOCUS_10620 1307314 1306139 gene locus_tag LOCUS_10630 1307314 1306139 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_10630 1308707 1307325 gene locus_tag LOCUS_10640 1308707 1307325 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963629.1 protein_id gnl|my_center|LOCUS_10640 1310869 1309061 gene locus_tag LOCUS_10650 1310869 1309061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1311668 1310871 gene locus_tag LOCUS_10660 1311668 1310871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1313883 1312000 gene locus_tag LOCUS_10670 gene htpG 1313883 1312000 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_10670 1314064 1314540 gene locus_tag LOCUS_10680 1314064 1314540 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963626.1 protein_id gnl|my_center|LOCUS_10680 1314558 1315247 gene locus_tag LOCUS_10690 1314558 1315247 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963625.1 protein_id gnl|my_center|LOCUS_10690 1315360 1316493 gene locus_tag LOCUS_10700 1315360 1316493 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 protein_id gnl|my_center|LOCUS_10700 1316717 1317997 gene locus_tag LOCUS_10710 1316717 1317997 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_10710 1318142 1318912 gene locus_tag LOCUS_10720 1318142 1318912 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_10720 1318978 1319589 gene locus_tag LOCUS_10730 1318978 1319589 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_10730 1319590 1319934 gene locus_tag LOCUS_10740 1319590 1319934 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361989.1 protein_id gnl|my_center|LOCUS_10740 1319991 1321244 gene locus_tag LOCUS_10750 1319991 1321244 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_10750 1321317 1321553 gene locus_tag LOCUS_10760 gene rpmB 1321317 1321553 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_10760 1321582 1321764 gene locus_tag LOCUS_10770 gene rpmG 1321582 1321764 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963553.1 protein_id gnl|my_center|LOCUS_10770 1321836 1321988 gene locus_tag LOCUS_10780 1321836 1321988 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_10780 1322241 1323194 gene locus_tag LOCUS_10790 gene ftsY 1322241 1323194 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_10790 1324496 1323426 gene locus_tag LOCUS_10800 1324496 1323426 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_10800 1324665 1325108 gene locus_tag LOCUS_10810 1324665 1325108 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_10810 1325089 1325385 gene locus_tag LOCUS_10820 1325089 1325385 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_10820 1325925 1325506 gene locus_tag LOCUS_10830 1325925 1325506 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_10830 1327555 1326017 gene locus_tag LOCUS_10840 gene bshC 1327555 1326017 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963529.1 protein_id gnl|my_center|LOCUS_10840 1327694 1328977 gene locus_tag LOCUS_10850 1327694 1328977 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207605.1 protein_id gnl|my_center|LOCUS_10850 1330194 1329082 gene locus_tag LOCUS_10860 1330194 1329082 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476615.1 protein_id gnl|my_center|LOCUS_10860 1332251 1330215 gene locus_tag LOCUS_10870 1332251 1330215 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_10870 1332356 1332610 gene locus_tag LOCUS_10880 1332356 1332610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1332780 1334978 gene locus_tag LOCUS_10890 1332780 1334978 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_10890 1334987 1335658 gene locus_tag LOCUS_10900 1334987 1335658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1338656 1335741 gene locus_tag LOCUS_10910 1338656 1335741 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963047.1 protein_id gnl|my_center|LOCUS_10910 1339169 1338825 gene locus_tag LOCUS_10920 gene rplT 1339169 1338825 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_10920 1339538 1339341 gene locus_tag LOCUS_10930 gene rpmI 1339538 1339341 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963049.1 protein_id gnl|my_center|LOCUS_10930 1340115 1339639 gene locus_tag LOCUS_10940 gene infC 1340115 1339639 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_10940 1342159 1340213 gene locus_tag LOCUS_10950 gene thrS 1342159 1340213 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963051.1 protein_id gnl|my_center|LOCUS_10950 1343270 1344780 gene locus_tag LOCUS_r00010 1343270 1344780 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1344904 1344978 gene locus_tag LOCUS_t00150 1344904 1344978 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1345069 1345143 gene locus_tag LOCUS_t00160 1345069 1345143 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1345341 1348210 gene locus_tag LOCUS_r00020 1345341 1348210 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1348369 1348472 gene locus_tag LOCUS_r00030 1348369 1348472 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1348849 1350891 gene locus_tag LOCUS_10960 1348849 1350891 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951079.1 protein_id gnl|my_center|LOCUS_10960 1350894 1353842 gene locus_tag LOCUS_10970 1350894 1353842 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033406.1 protein_id gnl|my_center|LOCUS_10970 1354479 1353820 gene locus_tag LOCUS_10980 gene nth 1354479 1353820 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228256.1 protein_id gnl|my_center|LOCUS_10980 1355392 1354511 gene locus_tag LOCUS_10990 1355392 1354511 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_10990 1356790 1355447 gene locus_tag LOCUS_11000 1356790 1355447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 1358151 1356787 gene locus_tag LOCUS_11010 1358151 1356787 CDS product methylmalonyl-CoA mutase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_11010 1358568 1358236 gene locus_tag LOCUS_11020 1358568 1358236 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_11020 1359235 1358627 gene locus_tag LOCUS_11030 gene udk 1359235 1358627 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963257.1 protein_id gnl|my_center|LOCUS_11030 1359436 1359513 gene locus_tag LOCUS_t00170 1359436 1359513 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1359639 1360589 gene locus_tag LOCUS_11040 gene trxB 1359639 1360589 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_11040 1361488 1360652 gene locus_tag LOCUS_11050 1361488 1360652 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962838.1 protein_id gnl|my_center|LOCUS_11050 1362237 1361578 gene locus_tag LOCUS_11060 1362237 1361578 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_11060 1364039 1362327 gene locus_tag LOCUS_11070 1364039 1362327 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_11070 1364374 1364045 gene locus_tag LOCUS_11080 1364374 1364045 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_11080 1364883 1364428 gene locus_tag LOCUS_11090 1364883 1364428 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 protein_id gnl|my_center|LOCUS_11090 1365118 1365582 gene locus_tag LOCUS_11100 1365118 1365582 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_11100 1365943 1366500 gene locus_tag LOCUS_11110 1365943 1366500 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962831.1 protein_id gnl|my_center|LOCUS_11110 1366511 1367629 gene locus_tag LOCUS_11120 gene dnaJ 1366511 1367629 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962830.1 protein_id gnl|my_center|LOCUS_11120 1367787 1368707 gene locus_tag LOCUS_11130 1367787 1368707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_11130 1368864 1370111 gene locus_tag LOCUS_11140 1368864 1370111 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_11140 1370182 1371345 gene locus_tag LOCUS_11150 1370182 1371345 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_11150 1371416 1372111 gene locus_tag LOCUS_11160 1371416 1372111 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962826.1 protein_id gnl|my_center|LOCUS_11160 1372148 1372366 gene locus_tag LOCUS_11170 1372148 1372366 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962825.1 protein_id gnl|my_center|LOCUS_11170 1372430 1372690 gene locus_tag LOCUS_11180 1372430 1372690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1372690 1372998 gene locus_tag LOCUS_11190 1372690 1372998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1373052 1373855 gene locus_tag LOCUS_11200 1373052 1373855 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221373.1 protein_id gnl|my_center|LOCUS_11200 1374762 1373863 gene locus_tag LOCUS_11210 1374762 1373863 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_11210 1375226 1374768 gene locus_tag LOCUS_11220 1375226 1374768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1375736 1375239 gene locus_tag LOCUS_11230 1375736 1375239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1376883 1375798 gene locus_tag LOCUS_11240 1376883 1375798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1377066 1378700 gene locus_tag LOCUS_11250 1377066 1378700 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_11250 1378960 1379616 gene locus_tag LOCUS_11260 1378960 1379616 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_11260 1380184 1379669 gene locus_tag LOCUS_11270 1380184 1379669 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_11270 1380657 1383512 gene locus_tag LOCUS_11280 gene carB 1380657 1383512 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_11280 1384104 1383586 gene locus_tag LOCUS_11290 1384104 1383586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1384811 1384320 gene locus_tag LOCUS_11300 1384811 1384320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1385968 1385075 gene locus_tag LOCUS_11310 1385968 1385075 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118048.1 protein_id gnl|my_center|LOCUS_11310 1387411 1386050 gene locus_tag LOCUS_11320 1387411 1386050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1387552 1388553 gene locus_tag LOCUS_11330 1387552 1388553 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_11330 1388588 1389520 gene locus_tag LOCUS_11340 1388588 1389520 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_11340 1390840 1389578 gene locus_tag LOCUS_11350 1390840 1389578 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_11350 1391415 1391089 gene locus_tag LOCUS_11360 1391415 1391089 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_11360 1392171 1391455 gene locus_tag LOCUS_11370 1392171 1391455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1393216 1392665 gene locus_tag LOCUS_11380 1393216 1392665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1395304 1393523 gene locus_tag LOCUS_11390 gene fucI 1395304 1393523 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_11390 1395497 1396456 gene locus_tag LOCUS_11400 1395497 1396456 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 protein_id gnl|my_center|LOCUS_11400 1396507 1397406 gene locus_tag LOCUS_11410 1396507 1397406 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_11410 1397460 1398920 gene locus_tag LOCUS_11420 gene crtI 1397460 1398920 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_11420 1398932 1399744 gene locus_tag LOCUS_11430 1398932 1399744 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_11430 1399782 1400222 gene locus_tag LOCUS_11440 1399782 1400222 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_11440 1400346 1400951 gene locus_tag LOCUS_11450 1400346 1400951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1401032 1401493 gene locus_tag LOCUS_11460 1401032 1401493 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_11460 1401493 1402788 gene locus_tag LOCUS_11470 1401493 1402788 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_11470 1404322 1402904 gene locus_tag LOCUS_11480 1404322 1402904 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_11480 1404957 1404346 gene locus_tag LOCUS_11490 gene folE 1404957 1404346 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062927.1 protein_id gnl|my_center|LOCUS_11490 1405658 1404975 gene locus_tag LOCUS_11500 1405658 1404975 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_11500 1406963 1405662 gene locus_tag LOCUS_11510 1406963 1405662 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_11510 1407622 1406963 gene locus_tag LOCUS_11520 1407622 1406963 CDS product TetR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_11520 1407739 1408653 gene locus_tag LOCUS_11530 1407739 1408653 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_11530 1409194 1408631 gene locus_tag LOCUS_11540 1409194 1408631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1409878 1409513 gene locus_tag LOCUS_11550 1409878 1409513 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_11550 1411256 1409889 gene locus_tag LOCUS_11560 1411256 1409889 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_11560 1411195 1411356 gene locus_tag LOCUS_11570 1411195 1411356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1411362 1411934 gene locus_tag LOCUS_11580 1411362 1411934 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964094.1 protein_id gnl|my_center|LOCUS_11580 1411970 1412143 gene locus_tag LOCUS_11590 1411970 1412143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1412130 1412501 gene locus_tag LOCUS_11600 1412130 1412501 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_11600 1412501 1412956 gene locus_tag LOCUS_11610 1412501 1412956 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964095.1 protein_id gnl|my_center|LOCUS_11610 1413792 1413013 gene locus_tag LOCUS_11620 1413792 1413013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_11620 1414298 1413885 gene locus_tag LOCUS_11630 1414298 1413885 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_11630 1415371 1414442 gene locus_tag LOCUS_11640 1415371 1414442 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_11640 1416813 1415671 gene locus_tag LOCUS_11650 1416813 1415671 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_11650 1417267 1419096 gene locus_tag LOCUS_11660 1417267 1419096 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_11660 1419101 1420171 gene locus_tag LOCUS_11670 1419101 1420171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963574.1 protein_id gnl|my_center|LOCUS_11670 1421338 1420208 gene locus_tag LOCUS_11680 1421338 1420208 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_11680 1423591 1421435 gene locus_tag LOCUS_11690 1423591 1421435 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_11690 1424252 1423779 gene locus_tag LOCUS_11700 1424252 1423779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1426786 1424492 gene locus_tag LOCUS_11710 1426786 1424492 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108131.1 protein_id gnl|my_center|LOCUS_11710 1427018 1428208 gene locus_tag LOCUS_11720 1427018 1428208 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_11720 1428415 1428269 gene locus_tag LOCUS_11730 1428415 1428269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1428984 1428412 gene locus_tag LOCUS_11740 1428984 1428412 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_11740 1429847 1429221 gene locus_tag LOCUS_11750 1429847 1429221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1430747 1430022 gene locus_tag LOCUS_11760 1430747 1430022 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_11760 1431877 1430750 gene locus_tag LOCUS_11770 1431877 1430750 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_11770 1432490 1433566 gene locus_tag LOCUS_11780 gene prfA 1432490 1433566 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_11780 1433751 1435922 gene locus_tag LOCUS_11790 1433751 1435922 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964024.1 protein_id gnl|my_center|LOCUS_11790 1436662 1436000 gene locus_tag LOCUS_11800 1436662 1436000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1436943 1436665 gene locus_tag LOCUS_11810 1436943 1436665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1437793 1437143 gene locus_tag LOCUS_11820 1437793 1437143 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_11820 1439199 1438213 gene locus_tag LOCUS_11830 1439199 1438213 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_11830 1439753 1439199 gene locus_tag LOCUS_11840 1439753 1439199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1442075 1439850 gene locus_tag LOCUS_11850 1442075 1439850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1442537 1442091 gene locus_tag LOCUS_11860 1442537 1442091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_11860 1443104 1442550 gene locus_tag LOCUS_11870 1443104 1442550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1444304 1443255 gene locus_tag LOCUS_11880 1444304 1443255 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225205.1 protein_id gnl|my_center|LOCUS_11880 1444686 1444501 gene locus_tag LOCUS_11890 1444686 1444501 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_11890 1444846 1445664 gene locus_tag LOCUS_11900 gene pyrF 1444846 1445664 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_11900 1445707 1446492 gene locus_tag LOCUS_11910 1445707 1446492 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_11910 1446973 1448463 gene locus_tag LOCUS_11920 1446973 1448463 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785885.1 protein_id gnl|my_center|LOCUS_11920 1449393 1448539 gene locus_tag LOCUS_11930 gene purU 1449393 1448539 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_11930 1450056 1449403 gene locus_tag LOCUS_11940 1450056 1449403 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_11940 1450392 1450892 gene locus_tag LOCUS_11950 1450392 1450892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1451878 1450964 gene locus_tag LOCUS_11960 1451878 1450964 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962707.1 protein_id gnl|my_center|LOCUS_11960 1453071 1452052 gene locus_tag LOCUS_11970 1453071 1452052 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_11970 1453486 1455675 gene locus_tag LOCUS_11980 1453486 1455675 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_11980 1455972 1457150 gene locus_tag LOCUS_11990 1455972 1457150 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_11990 1457255 1457611 gene locus_tag LOCUS_12000 1457255 1457611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962846.1 protein_id gnl|my_center|LOCUS_12000 1457723 1458352 gene locus_tag LOCUS_12010 1457723 1458352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1458399 1458707 gene locus_tag LOCUS_12020 1458399 1458707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1458821 1459321 gene locus_tag LOCUS_12030 1458821 1459321 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962847.1 protein_id gnl|my_center|LOCUS_12030 1459335 1459682 gene locus_tag LOCUS_12040 1459335 1459682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962555.1 protein_id gnl|my_center|LOCUS_12040 1460741 1459800 gene locus_tag LOCUS_12050 1460741 1459800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1461281 1460763 gene locus_tag LOCUS_12060 1461281 1460763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1462731 1461292 gene locus_tag LOCUS_12070 gene rimO 1462731 1461292 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_12070 1464399 1462786 gene locus_tag LOCUS_12080 1464399 1462786 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_12080 1465275 1464406 gene locus_tag LOCUS_12090 1465275 1464406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1465447 1466925 gene locus_tag LOCUS_12100 gene proS 1465447 1466925 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963521.1 protein_id gnl|my_center|LOCUS_12100 1467004 1467076 gene locus_tag LOCUS_t00180 1467004 1467076 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1467123 1467195 gene locus_tag LOCUS_t00190 1467123 1467195 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1467359 1467610 gene locus_tag LOCUS_12110 gene rpsT 1467359 1467610 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963520.1 protein_id gnl|my_center|LOCUS_12110 1468065 1467664 gene locus_tag LOCUS_12120 1468065 1467664 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_12120 1469783 1468068 gene locus_tag LOCUS_12130 1469783 1468068 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288614.1 protein_id gnl|my_center|LOCUS_12130 1469947 1471743 gene locus_tag LOCUS_12140 gene typA 1469947 1471743 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_12140 1471877 1472173 gene locus_tag LOCUS_12150 1471877 1472173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1472653 1472324 gene locus_tag LOCUS_12160 1472653 1472324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1473955 1472657 gene locus_tag LOCUS_12170 1473955 1472657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1479342 1474435 gene locus_tag LOCUS_12180 1479342 1474435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1481559 1479406 gene locus_tag LOCUS_12190 1481559 1479406 CDS product choice-of-anchor L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963773.1 protein_id gnl|my_center|LOCUS_12190 1481838 1482890 gene locus_tag LOCUS_12200 1481838 1482890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1482895 1483752 gene locus_tag LOCUS_12210 1482895 1483752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1487565 1483831 gene locus_tag LOCUS_12220 1487565 1483831 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_12220 1487590 1488774 gene locus_tag LOCUS_12230 1487590 1488774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1491294 1488919 gene locus_tag LOCUS_12240 1491294 1488919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1492924 1491866 gene locus_tag LOCUS_12250 1492924 1491866 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_12250 1493557 1493015 gene locus_tag LOCUS_12260 1493557 1493015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_12260 1493986 1493702 gene locus_tag LOCUS_12270 1493986 1493702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1494353 1494051 gene locus_tag LOCUS_12280 1494353 1494051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1495201 1494605 gene locus_tag LOCUS_12290 1495201 1494605 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_12290 1496486 1495206 gene locus_tag LOCUS_12300 1496486 1495206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1496990 1496601 gene locus_tag LOCUS_12310 1496990 1496601 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227644.1 protein_id gnl|my_center|LOCUS_12310 1497563 1497006 gene locus_tag LOCUS_12320 1497563 1497006 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145388845.1 protein_id gnl|my_center|LOCUS_12320 1497909 1499249 gene locus_tag LOCUS_12330 1497909 1499249 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_12330 1499268 1499576 gene locus_tag LOCUS_12340 1499268 1499576 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963760.1 protein_id gnl|my_center|LOCUS_12340 1499646 1500404 gene locus_tag LOCUS_12350 1499646 1500404 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_12350 1500833 1501309 gene locus_tag LOCUS_12360 1500833 1501309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1501322 1501927 gene locus_tag LOCUS_12370 1501322 1501927 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_12370 1502754 1501984 gene locus_tag LOCUS_12380 1502754 1501984 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_12380 1503325 1502813 gene locus_tag LOCUS_12390 1503325 1502813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1504356 1503334 gene locus_tag LOCUS_12400 1504356 1503334 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963757.1 protein_id gnl|my_center|LOCUS_12400 1505827 1504406 gene locus_tag LOCUS_12410 1505827 1504406 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_12410 1506245 1505862 gene locus_tag LOCUS_12420 1506245 1505862 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_12420 1506846 1506283 gene locus_tag LOCUS_12430 1506846 1506283 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_12430 1507826 1506870 gene locus_tag LOCUS_12440 1507826 1506870 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963750.1 protein_id gnl|my_center|LOCUS_12440 1508007 1508789 gene locus_tag LOCUS_12450 1508007 1508789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1508815 1509579 gene locus_tag LOCUS_12460 1508815 1509579 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_12460 1510734 1509646 gene locus_tag LOCUS_12470 1510734 1509646 CDS product CDP-glycerol--glycerophosphate glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074271.1 protein_id gnl|my_center|LOCUS_12470 1511803 1510727 gene locus_tag LOCUS_12480 1511803 1510727 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707880.1 protein_id gnl|my_center|LOCUS_12480 1512758 1511943 gene locus_tag LOCUS_12490 1512758 1511943 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_12490 1512922 1513338 gene locus_tag LOCUS_12500 gene ruvX 1512922 1513338 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_12500 1513416 1514906 gene locus_tag LOCUS_12510 1513416 1514906 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963862.1 protein_id gnl|my_center|LOCUS_12510 1517180 1514928 gene locus_tag LOCUS_12520 1517180 1514928 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814008.1 protein_id gnl|my_center|LOCUS_12520 1517369 1517956 gene locus_tag LOCUS_12530 gene def 1517369 1517956 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963863.1 protein_id gnl|my_center|LOCUS_12530 1518029 1518520 gene locus_tag LOCUS_12540 1518029 1518520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1518659 1519432 gene locus_tag LOCUS_12550 gene mazG 1518659 1519432 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_12550 1520410 1519475 gene locus_tag LOCUS_12560 1520410 1519475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1521319 1520639 gene locus_tag LOCUS_12570 1521319 1520639 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_12570 1521433 1523805 gene locus_tag LOCUS_12580 1521433 1523805 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_12580 1524134 1524328 gene locus_tag LOCUS_12590 gene ccoS 1524134 1524328 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963292.1 protein_id gnl|my_center|LOCUS_12590 1524363 1526540 gene locus_tag LOCUS_12600 gene ccoN 1524363 1526540 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_12600 1526545 1526724 gene locus_tag LOCUS_12610 1526545 1526724 CDS product cbb3-type cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963295.1 protein_id gnl|my_center|LOCUS_12610 1526856 1527638 gene locus_tag LOCUS_12620 1526856 1527638 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_12620 1528207 1529262 gene locus_tag LOCUS_12630 1528207 1529262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1529280 1529729 gene locus_tag LOCUS_12640 1529280 1529729 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_12640 1529867 1530514 gene locus_tag LOCUS_12650 1529867 1530514 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_12650 1531888 1530524 gene locus_tag LOCUS_12660 gene hemN 1531888 1530524 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963301.1 protein_id gnl|my_center|LOCUS_12660 1533963 1532029 gene locus_tag LOCUS_12670 1533963 1532029 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_12670 1535109 1534111 gene locus_tag LOCUS_12680 1535109 1534111 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_12680 1536602 1535331 gene locus_tag LOCUS_12690 1536602 1535331 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964006.1 protein_id gnl|my_center|LOCUS_12690 1537083 1536604 gene locus_tag LOCUS_12700 1537083 1536604 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_12700 1539393 1537171 gene locus_tag LOCUS_12710 1539393 1537171 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_12710 1540306 1539521 gene locus_tag LOCUS_12720 1540306 1539521 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_12720 1541880 1540549 gene locus_tag LOCUS_12730 1541880 1540549 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_12730 1543000 1541993 gene locus_tag LOCUS_12740 1543000 1541993 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_12740 1544329 1543130 gene locus_tag LOCUS_12750 1544329 1543130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1545041 1544322 gene locus_tag LOCUS_12760 1545041 1544322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1546087 1545119 gene locus_tag LOCUS_12770 1546087 1545119 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108173.1 protein_id gnl|my_center|LOCUS_12770 1546109 1546852 gene locus_tag LOCUS_12780 1546109 1546852 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_12780 1547052 1547888 gene locus_tag LOCUS_12790 1547052 1547888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_12790 1547885 1548982 gene locus_tag LOCUS_12800 1547885 1548982 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963975.1 protein_id gnl|my_center|LOCUS_12800 1548982 1549551 gene locus_tag LOCUS_12810 1548982 1549551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1549554 1550840 gene locus_tag LOCUS_12820 1549554 1550840 CDS product O-antigen translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963976.1 protein_id gnl|my_center|LOCUS_12820 1552048 1550909 gene locus_tag LOCUS_12830 1552048 1550909 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963970.1 protein_id gnl|my_center|LOCUS_12830 1552093 1552929 gene locus_tag LOCUS_12840 1552093 1552929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1552922 1553320 gene locus_tag LOCUS_12850 1552922 1553320 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963968.1 protein_id gnl|my_center|LOCUS_12850 1553317 1554399 gene locus_tag LOCUS_12860 1553317 1554399 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107643.1 protein_id gnl|my_center|LOCUS_12860 1555300 1554416 gene locus_tag LOCUS_12870 1555300 1554416 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_12870 1556652 1555306 gene locus_tag LOCUS_12880 1556652 1555306 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986762.1 protein_id gnl|my_center|LOCUS_12880 1557348 1556665 gene locus_tag LOCUS_12890 1557348 1556665 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_12890 1557544 1560555 gene locus_tag LOCUS_12900 1557544 1560555 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_12900 1560616 1562415 gene locus_tag LOCUS_12910 1560616 1562415 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_12910 1562533 1562982 gene locus_tag LOCUS_12920 1562533 1562982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_12920 1562999 1563196 gene locus_tag LOCUS_12930 1562999 1563196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1564480 1563344 gene locus_tag LOCUS_12940 1564480 1563344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1566894 1564708 gene locus_tag LOCUS_12950 1566894 1564708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1567165 1567458 gene locus_tag LOCUS_12960 1567165 1567458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 1567460 1568857 gene locus_tag LOCUS_12970 gene gatA 1567460 1568857 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_12970 1568857 1572189 gene locus_tag LOCUS_12980 1568857 1572189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1573023 1572262 gene locus_tag LOCUS_12990 1573023 1572262 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_12990 1573440 1573527 gene locus_tag LOCUS_t00200 1573440 1573527 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1573541 1573616 gene locus_tag LOCUS_t00210 1573541 1573616 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1573644 1573718 gene locus_tag LOCUS_t00220 1573644 1573718 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1574531 1574268 gene locus_tag LOCUS_13000 1574531 1574268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1575099 1574545 gene locus_tag LOCUS_13010 1575099 1574545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1575328 1575837 gene locus_tag LOCUS_13020 1575328 1575837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1577191 1576115 gene locus_tag LOCUS_13030 1577191 1576115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1578564 1577458 gene locus_tag LOCUS_13040 1578564 1577458 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962430.1 protein_id gnl|my_center|LOCUS_13040 1579552 1578551 gene locus_tag LOCUS_13050 1579552 1578551 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962431.1 protein_id gnl|my_center|LOCUS_13050 1581193 1579901 gene locus_tag LOCUS_13060 1581193 1579901 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_13060 1581353 1581538 gene locus_tag LOCUS_13070 1581353 1581538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 1581969 1582103 gene locus_tag LOCUS_13080 1581969 1582103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1582273 1585401 gene locus_tag LOCUS_13090 1582273 1585401 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_13090 1585423 1586895 gene locus_tag LOCUS_13100 1585423 1586895 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_13100 1587203 1589122 gene locus_tag LOCUS_13110 1587203 1589122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1589397 1590455 gene locus_tag LOCUS_13120 1589397 1590455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1590619 1591689 gene locus_tag LOCUS_13130 1590619 1591689 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_13130 1591969 1591640 gene locus_tag LOCUS_13140 1591969 1591640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1592371 1592084 gene locus_tag LOCUS_13150 1592371 1592084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 1593582 1595092 gene locus_tag LOCUS_r00040 1593582 1595092 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1595216 1595290 gene locus_tag LOCUS_t00230 1595216 1595290 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1595381 1595455 gene locus_tag LOCUS_t00240 1595381 1595455 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1595653 1598522 gene locus_tag LOCUS_r00050 1595653 1598522 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1598681 1598784 gene locus_tag LOCUS_r00060 1598681 1598784 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1599896 1599411 gene locus_tag LOCUS_13160 1599896 1599411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1600098 1601159 gene locus_tag LOCUS_13170 gene aroC 1600098 1601159 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962924.1 protein_id gnl|my_center|LOCUS_13170 1601291 1602553 gene locus_tag LOCUS_13180 1601291 1602553 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962925.1 protein_id gnl|my_center|LOCUS_13180 1602733 1604919 gene locus_tag LOCUS_13190 1602733 1604919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_13190 1605447 1604920 gene locus_tag LOCUS_13200 1605447 1604920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1605924 1608866 gene locus_tag LOCUS_13210 1605924 1608866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1609191 1609904 gene locus_tag LOCUS_13220 1609191 1609904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1609985 1611169 gene locus_tag LOCUS_13230 1609985 1611169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1612303 1611443 gene locus_tag LOCUS_13240 1612303 1611443 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962903.1 protein_id gnl|my_center|LOCUS_13240 1613136 1612339 gene locus_tag LOCUS_13250 1613136 1612339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963045.1 protein_id gnl|my_center|LOCUS_13250 1613866 1613177 gene locus_tag LOCUS_13260 1613866 1613177 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_13260 1615304 1613883 gene locus_tag LOCUS_13270 1615304 1613883 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_13270 1616078 1615305 gene locus_tag LOCUS_13280 1616078 1615305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1616968 1616150 gene locus_tag LOCUS_13290 gene panB 1616968 1616150 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_13290 1617135 1618247 gene locus_tag LOCUS_13300 1617135 1618247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 1618240 1618926 gene locus_tag LOCUS_13310 1618240 1618926 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103914.1 protein_id gnl|my_center|LOCUS_13310 1619151 1621085 gene locus_tag LOCUS_13320 1619151 1621085 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_13320 1621521 1621138 gene locus_tag LOCUS_13330 1621521 1621138 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093444.1 protein_id gnl|my_center|LOCUS_13330 1622525 1621668 gene locus_tag LOCUS_13340 1622525 1621668 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_13340 1624264 1622729 gene locus_tag LOCUS_13350 1624264 1622729 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966261.1 protein_id gnl|my_center|LOCUS_13350 1625508 1624270 gene locus_tag LOCUS_13360 1625508 1624270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1627718 1625781 gene locus_tag LOCUS_13370 1627718 1625781 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_13370 1628635 1627730 gene locus_tag LOCUS_13380 1628635 1627730 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_13380 1645331 1628694 gene locus_tag LOCUS_13390 1645331 1628694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1645967 1645422 gene locus_tag LOCUS_13400 1645967 1645422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1646716 1647201 gene locus_tag LOCUS_13410 gene sixA 1646716 1647201 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_13410 1647204 1649276 gene locus_tag LOCUS_13420 gene ppk1 1647204 1649276 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_13420 1649308 1650216 gene locus_tag LOCUS_13430 1649308 1650216 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_13430 1650879 1650313 gene locus_tag LOCUS_13440 1650879 1650313 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963114.1 protein_id gnl|my_center|LOCUS_13440 1652048 1650963 gene locus_tag LOCUS_13450 gene dnaX 1652048 1650963 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 protein_id gnl|my_center|LOCUS_13450 1654308 1652143 gene locus_tag LOCUS_13460 1654308 1652143 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963184.1 protein_id gnl|my_center|LOCUS_13460 1654478 1655146 gene locus_tag LOCUS_13470 1654478 1655146 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963183.1 protein_id gnl|my_center|LOCUS_13470 1655940 1655155 gene locus_tag LOCUS_13480 1655940 1655155 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_13480 1656499 1655957 gene locus_tag LOCUS_13490 1656499 1655957 CDS product DUF6452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_13490 1657979 1656567 gene locus_tag LOCUS_13500 gene rlmD 1657979 1656567 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_13500 1658415 1659122 gene locus_tag LOCUS_13510 1658415 1659122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_13510 1659193 1660083 gene locus_tag LOCUS_13520 1659193 1660083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1660236 1661423 gene locus_tag LOCUS_13530 gene mnmA 1660236 1661423 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_13530 1661451 1663067 gene locus_tag LOCUS_13540 1661451 1663067 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_13540 1663105 1663521 gene locus_tag LOCUS_13550 1663105 1663521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1665355 1663577 gene locus_tag LOCUS_13560 1665355 1663577 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 protein_id gnl|my_center|LOCUS_13560 1666886 1665429 gene locus_tag LOCUS_13570 1666886 1665429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 protein_id gnl|my_center|LOCUS_13570 1668478 1667063 gene locus_tag LOCUS_13580 1668478 1667063 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_13580 1668837 1669376 gene locus_tag LOCUS_13590 1668837 1669376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1670335 1669382 gene locus_tag LOCUS_13600 1670335 1669382 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_13600 1670877 1672127 gene locus_tag LOCUS_13610 gene rocD 1670877 1672127 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_13610 1672682 1672203 gene locus_tag LOCUS_13620 1672682 1672203 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 protein_id gnl|my_center|LOCUS_13620 1672828 1673568 gene locus_tag LOCUS_13630 1672828 1673568 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193777.1 protein_id gnl|my_center|LOCUS_13630 1673582 1673878 gene locus_tag LOCUS_13640 1673582 1673878 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970501.1 protein_id gnl|my_center|LOCUS_13640 1673935 1674405 gene locus_tag LOCUS_13650 1673935 1674405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1675080 1674469 gene locus_tag LOCUS_13660 1675080 1674469 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_13660 1676163 1675450 gene locus_tag LOCUS_13670 1676163 1675450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1677462 1676359 gene locus_tag LOCUS_13680 1677462 1676359 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919990.1 protein_id gnl|my_center|LOCUS_13680 1678928 1677495 gene locus_tag LOCUS_13690 1678928 1677495 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_13690 1682208 1679044 gene locus_tag LOCUS_13700 1682208 1679044 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_13700 1683426 1682218 gene locus_tag LOCUS_13710 1683426 1682218 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_13710 1684155 1683577 gene locus_tag LOCUS_13720 1684155 1683577 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_13720 1684472 1688125 gene locus_tag LOCUS_13730 1684472 1688125 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_13730 1689399 1688275 gene locus_tag LOCUS_13740 1689399 1688275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1689990 1689409 gene locus_tag LOCUS_13750 1689990 1689409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1690390 1693377 gene locus_tag LOCUS_13760 1690390 1693377 CDS product DUF4982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108444.1 protein_id gnl|my_center|LOCUS_13760 1693612 1694874 gene locus_tag LOCUS_13770 1693612 1694874 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_13770 1694968 1696176 gene locus_tag LOCUS_13780 gene uxuA 1694968 1696176 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438562.1 protein_id gnl|my_center|LOCUS_13780 1696372 1698627 gene locus_tag LOCUS_13790 1696372 1698627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1699003 1700016 gene locus_tag LOCUS_13800 1699003 1700016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1700134 1701573 gene locus_tag LOCUS_13810 1700134 1701573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1701788 1706329 gene locus_tag LOCUS_13820 1701788 1706329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1706435 1707061 gene locus_tag LOCUS_13830 1706435 1707061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1708362 1707145 gene locus_tag LOCUS_13840 gene lysA 1708362 1707145 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_13840 1709145 1708537 gene locus_tag LOCUS_13850 1709145 1708537 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_13850 1709239 1710129 gene locus_tag LOCUS_13860 1709239 1710129 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004302105.1 protein_id gnl|my_center|LOCUS_13860 1713820 1710113 gene locus_tag LOCUS_13870 1713820 1710113 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203101.1 protein_id gnl|my_center|LOCUS_13870 1715052 1714045 gene locus_tag LOCUS_13880 1715052 1714045 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 protein_id gnl|my_center|LOCUS_13880 1716680 1715220 gene locus_tag LOCUS_13890 1716680 1715220 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_13890 1721197 1716683 gene locus_tag LOCUS_13900 gene gltB 1721197 1716683 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_13900 1721303 1721500 gene locus_tag LOCUS_13910 1721303 1721500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1721606 1722799 gene locus_tag LOCUS_13920 gene sucC 1721606 1722799 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_13920 1722968 1724533 gene locus_tag LOCUS_13930 1722968 1724533 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122546.1 protein_id gnl|my_center|LOCUS_13930 1725027 1724560 gene locus_tag LOCUS_13940 1725027 1724560 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_13940 1725543 1725139 gene locus_tag LOCUS_13950 1725543 1725139 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_13950 1727896 1725536 gene locus_tag LOCUS_13960 1727896 1725536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1730044 1728053 gene locus_tag LOCUS_13970 gene uvrB 1730044 1728053 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_13970 1731331 1730342 gene locus_tag LOCUS_13980 gene rlmF 1731331 1730342 CDS product 23S rRNA (adenine(1618)-N(6))-methyltransferase RlmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963878.1 protein_id gnl|my_center|LOCUS_13980 1732150 1731488 gene locus_tag LOCUS_13990 1732150 1731488 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963877.1 protein_id gnl|my_center|LOCUS_13990 1732308 1733132 gene locus_tag LOCUS_14000 1732308 1733132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1733414 1735294 gene locus_tag LOCUS_14010 gene dnaK 1733414 1735294 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_14010 1735437 1735823 gene locus_tag LOCUS_14020 1735437 1735823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963078.1 protein_id gnl|my_center|LOCUS_14020 1735999 1737081 gene locus_tag LOCUS_14030 1735999 1737081 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_14030 1737269 1740313 gene locus_tag LOCUS_14040 1737269 1740313 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_14040 1740303 1741736 gene locus_tag LOCUS_14050 1740303 1741736 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_14050 1742227 1741820 gene locus_tag LOCUS_14060 1742227 1741820 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_14060 1742616 1742317 gene locus_tag LOCUS_14070 1742616 1742317 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084855.1 protein_id gnl|my_center|LOCUS_14070 1743058 1742711 gene locus_tag LOCUS_14080 1743058 1742711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1743248 1743039 gene locus_tag LOCUS_14090 1743248 1743039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1743501 1744289 gene locus_tag LOCUS_14100 1743501 1744289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1744286 1745149 gene locus_tag LOCUS_14110 1744286 1745149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1747841 1745430 gene locus_tag LOCUS_14120 1747841 1745430 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_14120 1750863 1748032 gene locus_tag LOCUS_14130 1750863 1748032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_14130 1751616 1750888 gene locus_tag LOCUS_14140 1751616 1750888 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_14140 1752702 1751857 gene locus_tag LOCUS_14150 gene cobA 1752702 1751857 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_14150 1754386 1752980 gene locus_tag LOCUS_14160 gene fumC 1754386 1752980 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963718.1 protein_id gnl|my_center|LOCUS_14160 1754578 1754742 gene locus_tag LOCUS_14170 1754578 1754742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1755495 1754851 gene locus_tag LOCUS_14180 1755495 1754851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1755860 1757866 gene locus_tag LOCUS_14190 1755860 1757866 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072426.1 protein_id gnl|my_center|LOCUS_14190 1757927 1759501 gene locus_tag LOCUS_14200 1757927 1759501 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_14200 1759515 1761740 gene locus_tag LOCUS_14210 1759515 1761740 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_14210 1761782 1763293 gene locus_tag LOCUS_14220 1761782 1763293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1763395 1765740 gene locus_tag LOCUS_14230 1763395 1765740 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_14230 1766985 1765753 gene locus_tag LOCUS_14240 1766985 1765753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963654.1 protein_id gnl|my_center|LOCUS_14240 1768193 1767192 gene locus_tag LOCUS_14250 1768193 1767192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1772598 1768210 gene locus_tag LOCUS_14260 1772598 1768210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1772857 1773711 gene locus_tag LOCUS_14270 1772857 1773711 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_14270 1774246 1775901 gene locus_tag LOCUS_14280 1774246 1775901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1775928 1776572 gene locus_tag LOCUS_14290 1775928 1776572 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_14290 1776867 1777625 gene locus_tag LOCUS_14300 1776867 1777625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1778462 1777632 gene locus_tag LOCUS_14310 1778462 1777632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1778692 1779522 gene locus_tag LOCUS_14320 1778692 1779522 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962642.1 protein_id gnl|my_center|LOCUS_14320 1779599 1780558 gene locus_tag LOCUS_14330 gene menA 1779599 1780558 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962643.1 protein_id gnl|my_center|LOCUS_14330 1780606 1781049 gene locus_tag LOCUS_14340 1780606 1781049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1781133 1781810 gene locus_tag LOCUS_14350 1781133 1781810 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_14350 1781982 1783190 gene locus_tag LOCUS_14360 1781982 1783190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962663.1 protein_id gnl|my_center|LOCUS_14360 1783212 1783748 gene locus_tag LOCUS_14370 1783212 1783748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1783914 1784888 gene locus_tag LOCUS_14380 1783914 1784888 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962662.1 protein_id gnl|my_center|LOCUS_14380 1785248 1784955 gene locus_tag LOCUS_14390 1785248 1784955 CDS product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_14390 1785464 1787797 gene locus_tag LOCUS_14400 1785464 1787797 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963024.1 protein_id gnl|my_center|LOCUS_14400 1787784 1788257 gene locus_tag LOCUS_14410 1787784 1788257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1788309 1788929 gene locus_tag LOCUS_14420 1788309 1788929 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_14420 1789733 1788993 gene locus_tag LOCUS_14430 1789733 1788993 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_14430 1789946 1789734 gene locus_tag LOCUS_14440 1789946 1789734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1790845 1789943 gene locus_tag LOCUS_14450 gene miaA 1790845 1789943 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_14450 1791433 1790999 gene locus_tag LOCUS_14460 1791433 1790999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 1793216 1791855 gene locus_tag LOCUS_14470 1793216 1791855 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_14470 1793975 1793310 gene locus_tag LOCUS_14480 1793975 1793310 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_14480 1794345 1793977 gene locus_tag LOCUS_14490 1794345 1793977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1794949 1794395 gene locus_tag LOCUS_14500 1794949 1794395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1795918 1794953 gene locus_tag LOCUS_14510 1795918 1794953 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_14510 1796051 1796692 gene locus_tag LOCUS_14520 1796051 1796692 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_14520 1797768 1796719 gene locus_tag LOCUS_14530 1797768 1796719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1798290 1797838 gene locus_tag LOCUS_14540 gene smpB 1798290 1797838 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963988.1 protein_id gnl|my_center|LOCUS_14540 1798361 1798591 gene locus_tag LOCUS_14550 1798361 1798591 CDS product VF530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963989.1 protein_id gnl|my_center|LOCUS_14550 1799145 1798588 gene locus_tag LOCUS_14560 1799145 1798588 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962219.1 protein_id gnl|my_center|LOCUS_14560 1800070 1799219 gene locus_tag LOCUS_14570 1800070 1799219 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127403.1 protein_id gnl|my_center|LOCUS_14570 1800177 1800458 gene locus_tag LOCUS_14580 1800177 1800458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963991.1 protein_id gnl|my_center|LOCUS_14580 1801573 1800533 gene locus_tag LOCUS_14590 1801573 1800533 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_14590 1802464 1801577 gene locus_tag LOCUS_14600 1802464 1801577 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329752.1 protein_id gnl|my_center|LOCUS_14600 1804476 1802662 gene locus_tag LOCUS_14610 1804476 1802662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1807423 1804460 gene locus_tag LOCUS_14620 1807423 1804460 CDS product DUF4982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108444.1 protein_id gnl|my_center|LOCUS_14620 1808554 1807430 gene locus_tag LOCUS_14630 1808554 1807430 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_14630 1811379 1808578 gene locus_tag LOCUS_14640 1811379 1808578 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_14640 1811807 1814968 gene locus_tag LOCUS_14650 1811807 1814968 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_14650 1815021 1817126 gene locus_tag LOCUS_14660 1815021 1817126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1818970 1817354 gene locus_tag LOCUS_14670 1818970 1817354 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_14670 1820441 1818999 gene locus_tag LOCUS_14680 1820441 1818999 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_14680 1821930 1820512 gene locus_tag LOCUS_14690 gene uxaC 1821930 1820512 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793937.1 protein_id gnl|my_center|LOCUS_14690 1822734 1821949 gene locus_tag LOCUS_14700 1822734 1821949 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359838.1 protein_id gnl|my_center|LOCUS_14700 1823574 1822738 gene locus_tag LOCUS_14710 gene kduI 1823574 1822738 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_14710 1824040 1824897 gene locus_tag LOCUS_14720 gene nadC 1824040 1824897 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_14720 1824909 1825832 gene locus_tag LOCUS_14730 1824909 1825832 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_14730 1825878 1828328 gene locus_tag LOCUS_14740 gene priA 1825878 1828328 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_14740 1829020 1828325 gene locus_tag LOCUS_14750 1829020 1828325 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_14750 1829188 1829529 gene locus_tag LOCUS_14760 gene rpsF 1829188 1829529 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963956.1 protein_id gnl|my_center|LOCUS_14760 1829535 1829831 gene locus_tag LOCUS_14770 gene rpsR 1829535 1829831 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963955.1 protein_id gnl|my_center|LOCUS_14770 1829894 1830337 gene locus_tag LOCUS_14780 gene rplI 1829894 1830337 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963954.1 protein_id gnl|my_center|LOCUS_14780 1830416 1830889 gene locus_tag LOCUS_14790 1830416 1830889 CDS product DUF6495 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_14790 1830963 1832969 gene locus_tag LOCUS_14800 gene ligA 1830963 1832969 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963952.1 protein_id gnl|my_center|LOCUS_14800 1832956 1833648 gene locus_tag LOCUS_14810 1832956 1833648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963951.1 protein_id gnl|my_center|LOCUS_14810 1833645 1834334 gene locus_tag LOCUS_14820 1833645 1834334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1835232 1834324 gene locus_tag LOCUS_14830 1835232 1834324 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_14830 1836047 1835268 gene locus_tag LOCUS_14840 1836047 1835268 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_14840 1836096 1836614 gene locus_tag LOCUS_14850 1836096 1836614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963940.1 protein_id gnl|my_center|LOCUS_14850 1836623 1837510 gene locus_tag LOCUS_14860 gene dapA 1836623 1837510 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_14860 1837643 1838515 gene locus_tag LOCUS_14870 gene bamD 1837643 1838515 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_14870 1838525 1838842 gene locus_tag LOCUS_14880 1838525 1838842 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_14880 1838849 1840060 gene locus_tag LOCUS_14890 gene coaBC 1838849 1840060 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_14890 1840053 1840937 gene locus_tag LOCUS_14900 1840053 1840937 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_14900 1840994 1842646 gene locus_tag LOCUS_14910 gene recN 1840994 1842646 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963946.1 protein_id gnl|my_center|LOCUS_14910 1842707 1843897 gene locus_tag LOCUS_14920 1842707 1843897 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963947.1 protein_id gnl|my_center|LOCUS_14920 1843980 1845311 gene locus_tag LOCUS_14930 1843980 1845311 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_14930 1845424 1846422 gene locus_tag LOCUS_14940 1845424 1846422 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_14940 1846424 1847005 gene locus_tag LOCUS_14950 gene coaE 1846424 1847005 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_14950 1847116 1848663 gene locus_tag LOCUS_14960 1847116 1848663 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_14960 1848667 1849371 gene locus_tag LOCUS_14970 1848667 1849371 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_14970 1850388 1849447 gene locus_tag LOCUS_14980 1850388 1849447 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_14980 1850563 1851198 gene locus_tag LOCUS_14990 gene can 1850563 1851198 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964129.1 protein_id gnl|my_center|LOCUS_14990 1852537 1851329 gene locus_tag LOCUS_15000 1852537 1851329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1853158 1852589 gene locus_tag LOCUS_15010 1853158 1852589 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_15010 1854959 1853175 gene locus_tag LOCUS_15020 1854959 1853175 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963883.1 protein_id gnl|my_center|LOCUS_15020 1855670 1855002 gene locus_tag LOCUS_15030 1855670 1855002 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_15030 1856352 1855759 gene locus_tag LOCUS_15040 1856352 1855759 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_15040 1856589 1857989 gene locus_tag LOCUS_15050 gene glmM 1856589 1857989 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_15050 1859355 1858096 gene locus_tag LOCUS_15060 1859355 1858096 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_15060 1860687 1859638 gene locus_tag LOCUS_15070 1860687 1859638 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963810.1 protein_id gnl|my_center|LOCUS_15070 1860782 1861663 gene locus_tag LOCUS_15080 1860782 1861663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098557.1 protein_id gnl|my_center|LOCUS_15080 1862788 1861739 gene locus_tag LOCUS_15090 1862788 1861739 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_15090 1863041 1862775 gene locus_tag LOCUS_15100 1863041 1862775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1863045 1863848 gene locus_tag LOCUS_15110 1863045 1863848 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_15110 1864049 1864705 gene locus_tag LOCUS_15120 gene fsa 1864049 1864705 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_15120 1865598 1864762 gene locus_tag LOCUS_15130 1865598 1864762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1865941 1866948 gene locus_tag LOCUS_15140 1865941 1866948 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_15140 1867074 1868117 gene locus_tag LOCUS_15150 1867074 1868117 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_15150 1868127 1868576 gene locus_tag LOCUS_15160 1868127 1868576 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795018.1 protein_id gnl|my_center|LOCUS_15160 1868582 1869247 gene locus_tag LOCUS_15170 1868582 1869247 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_15170 1869250 1870062 gene locus_tag LOCUS_15180 1869250 1870062 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_15180 1870134 1871321 gene locus_tag LOCUS_15190 gene uxuA 1870134 1871321 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_15190 1871403 1872938 gene locus_tag LOCUS_15200 1871403 1872938 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_15200 1874837 1873047 gene locus_tag LOCUS_15210 1874837 1873047 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_15210 1876502 1875321 gene locus_tag LOCUS_15220 1876502 1875321 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_15220 1878985 1876595 gene locus_tag LOCUS_15230 1878985 1876595 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_15230 1879480 1879049 gene locus_tag LOCUS_15240 1879480 1879049 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_15240 1881407 1879620 gene locus_tag LOCUS_15250 1881407 1879620 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_15250 1882846 1881629 gene locus_tag LOCUS_15260 1882846 1881629 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_15260 1883024 1883644 gene locus_tag LOCUS_15270 1883024 1883644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1884128 1886635 gene locus_tag LOCUS_15280 gene nirB 1884128 1886635 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480247.1 protein_id gnl|my_center|LOCUS_15280 1886743 1887120 gene locus_tag LOCUS_15290 1886743 1887120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1887161 1887745 gene locus_tag LOCUS_15300 1887161 1887745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1887762 1889567 gene locus_tag LOCUS_15310 1887762 1889567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1889782 1890441 gene locus_tag LOCUS_15320 1889782 1890441 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_15320 1890578 1892068 gene locus_tag LOCUS_15330 1890578 1892068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1892454 1892197 gene locus_tag LOCUS_15340 1892454 1892197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_15340 1892850 1892521 gene locus_tag LOCUS_15350 1892850 1892521 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_15350 1893621 1892983 gene locus_tag LOCUS_15360 1893621 1892983 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_15360 1895446 1893848 gene locus_tag LOCUS_15370 1895446 1893848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1896795 1895536 gene locus_tag LOCUS_15380 1896795 1895536 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762567.1 protein_id gnl|my_center|LOCUS_15380 1898353 1896815 gene locus_tag LOCUS_15390 1898353 1896815 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635991.1 protein_id gnl|my_center|LOCUS_15390 1898613 1900541 gene locus_tag LOCUS_15400 1898613 1900541 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963842.1 protein_id gnl|my_center|LOCUS_15400 1900634 1901956 gene locus_tag LOCUS_15410 1900634 1901956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_15410 1902398 1904845 gene locus_tag LOCUS_15420 gene lon 1902398 1904845 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_15420 1905044 1906018 gene locus_tag LOCUS_15430 gene porQ 1905044 1906018 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_15430 1906026 1906706 gene locus_tag LOCUS_15440 gene cmk 1906026 1906706 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963822.1 protein_id gnl|my_center|LOCUS_15440 1907123 1906710 gene locus_tag LOCUS_15450 1907123 1906710 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_15450 1907653 1907273 gene locus_tag LOCUS_15460 1907653 1907273 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_15460 1908215 1907709 gene locus_tag LOCUS_15470 1908215 1907709 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_15470 1908786 1908208 gene locus_tag LOCUS_15480 1908786 1908208 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_15480 1909090 1908809 gene locus_tag LOCUS_15490 1909090 1908809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1909731 1909141 gene locus_tag LOCUS_15500 1909731 1909141 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963700.1 protein_id gnl|my_center|LOCUS_15500 1910383 1909820 gene locus_tag LOCUS_15510 1910383 1909820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963138.1 protein_id gnl|my_center|LOCUS_15510 1910548 1911618 gene locus_tag LOCUS_15520 gene corA 1910548 1911618 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963887.1 protein_id gnl|my_center|LOCUS_15520 1911656 1913749 gene locus_tag LOCUS_15530 gene pta 1911656 1913749 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_15530 1913835 1915019 gene locus_tag LOCUS_15540 gene ackA 1913835 1915019 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_15540 1915034 1915690 gene locus_tag LOCUS_15550 1915034 1915690 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963735.1 protein_id gnl|my_center|LOCUS_15550 1916256 1915687 gene locus_tag LOCUS_15560 1916256 1915687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963734.1 protein_id gnl|my_center|LOCUS_15560 1917442 1916249 gene locus_tag LOCUS_15570 1917442 1916249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_15570 1918530 1917442 gene locus_tag LOCUS_15580 1918530 1917442 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_15580 1919224 1918586 gene locus_tag LOCUS_15590 1919224 1918586 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_15590 1919986 1919282 gene locus_tag LOCUS_15600 1919986 1919282 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_15600 1921012 1919990 gene locus_tag LOCUS_15610 gene tsaD 1921012 1919990 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_15610 1921209 1925645 gene locus_tag LOCUS_15620 1921209 1925645 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_15620 1925839 1926825 gene locus_tag LOCUS_15630 gene pfkA 1925839 1926825 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963726.1 protein_id gnl|my_center|LOCUS_15630 1926904 1927908 gene locus_tag LOCUS_15640 gene gap 1926904 1927908 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963725.1 protein_id gnl|my_center|LOCUS_15640 1928142 1928993 gene locus_tag LOCUS_15650 1928142 1928993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_15650 1930482 1929076 gene locus_tag LOCUS_15660 gene rimK 1930482 1929076 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_15660 1931700 1930831 gene locus_tag LOCUS_15670 1931700 1930831 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207473.1 protein_id gnl|my_center|LOCUS_15670 1933157 1931763 gene locus_tag LOCUS_15680 1933157 1931763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1933556 1933275 gene locus_tag LOCUS_15690 1933556 1933275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1934906 1933794 gene locus_tag LOCUS_15700 1934906 1933794 CDS product RES domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399370.1 protein_id gnl|my_center|LOCUS_15700 1937000 1935138 gene locus_tag LOCUS_15710 1937000 1935138 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_15710 1937164 1938585 gene locus_tag LOCUS_15720 1937164 1938585 CDS product ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_15720 1938731 1939561 gene locus_tag LOCUS_15730 gene ygiD 1938731 1939561 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_15730 1939629 1940558 gene locus_tag LOCUS_15740 1939629 1940558 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546249.1 protein_id gnl|my_center|LOCUS_15740 1940615 1941340 gene locus_tag LOCUS_15750 gene kdsB 1940615 1941340 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963128.1 protein_id gnl|my_center|LOCUS_15750 1941375 1942664 gene locus_tag LOCUS_15760 1941375 1942664 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_15760 1942668 1944065 gene locus_tag LOCUS_15770 1942668 1944065 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_15770 1946706 1944286 gene locus_tag LOCUS_15780 gene pheT 1946706 1944286 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_15780 1947624 1947103 gene locus_tag LOCUS_15790 1947624 1947103 CDS product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779367.1 protein_id gnl|my_center|LOCUS_15790 1948498 1947635 gene locus_tag LOCUS_15800 1948498 1947635 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_15800 1949835 1948525 gene locus_tag LOCUS_15810 1949835 1948525 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_15810 1953053 1949958 gene locus_tag LOCUS_15820 1953053 1949958 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_15820 1954196 1953141 gene locus_tag LOCUS_15830 1954196 1953141 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_15830 1954568 1955626 gene locus_tag LOCUS_15840 1954568 1955626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1955774 1956028 gene locus_tag LOCUS_15850 1955774 1956028 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964534.1 protein_id gnl|my_center|LOCUS_15850 1956030 1956287 gene locus_tag LOCUS_15860 1956030 1956287 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_15860 1958654 1956546 gene locus_tag LOCUS_15870 gene recG 1958654 1956546 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963155.1 protein_id gnl|my_center|LOCUS_15870 1959297 1958884 gene locus_tag LOCUS_15880 1959297 1958884 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_15880 1959480 1961291 gene locus_tag LOCUS_15890 gene rho 1959480 1961291 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962876.1 protein_id gnl|my_center|LOCUS_15890 1964441 1961367 gene locus_tag LOCUS_15900 1964441 1961367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1965122 1964661 gene locus_tag LOCUS_15910 1965122 1964661 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_15910 1965876 1965349 gene locus_tag LOCUS_15920 1965876 1965349 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963846.1 protein_id gnl|my_center|LOCUS_15920 1966396 1966929 gene locus_tag LOCUS_15930 1966396 1966929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1967539 1966943 gene locus_tag LOCUS_15940 gene rsmD 1967539 1966943 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_15940 1968402 1967536 gene locus_tag LOCUS_15950 1968402 1967536 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_15950 1968524 1968841 gene locus_tag LOCUS_15960 1968524 1968841 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_15960 1968838 1969329 gene locus_tag LOCUS_15970 1968838 1969329 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808562.1 protein_id gnl|my_center|LOCUS_15970 1969342 1969716 gene locus_tag LOCUS_15980 1969342 1969716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1970931 1969771 gene locus_tag LOCUS_15990 gene pelA 1970931 1969771 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_15990 1971107 1972141 gene locus_tag LOCUS_16000 1971107 1972141 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815448.1 protein_id gnl|my_center|LOCUS_16000 1973172 1972312 gene locus_tag LOCUS_16010 1973172 1972312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1975009 1973327 gene locus_tag LOCUS_16020 1975009 1973327 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_16020 1977784 1975241 gene locus_tag LOCUS_16030 1977784 1975241 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_16030 1978048 1980699 gene locus_tag LOCUS_16040 gene gyrA 1978048 1980699 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_16040 1980740 1982038 gene locus_tag LOCUS_16050 1980740 1982038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962908.1 protein_id gnl|my_center|LOCUS_16050 1982682 1984085 gene locus_tag LOCUS_16060 gene lpdA 1982682 1984085 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_16060 1984761 1984294 gene locus_tag LOCUS_16070 1984761 1984294 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_16070 1985455 1985003 gene locus_tag LOCUS_16080 gene bcp 1985455 1985003 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_16080 1985790 1986449 gene locus_tag LOCUS_16090 1985790 1986449 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_16090 1987246 1986662 gene locus_tag LOCUS_16100 1987246 1986662 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_16100 1987777 1990563 gene locus_tag LOCUS_16110 gene uvrA 1987777 1990563 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963246.1 protein_id gnl|my_center|LOCUS_16110 1990905 1990630 gene locus_tag LOCUS_16120 gene yajC 1990905 1990630 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_16120 1991885 1990974 gene locus_tag LOCUS_16130 gene nusB 1991885 1990974 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962698.1 protein_id gnl|my_center|LOCUS_16130 1992319 1994079 gene locus_tag LOCUS_16140 1992319 1994079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_16140 1994150 1994524 gene locus_tag LOCUS_16150 1994150 1994524 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_16150 1994631 1995452 gene locus_tag LOCUS_16160 gene sseA 1994631 1995452 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 protein_id gnl|my_center|LOCUS_16160 1997004 1995541 gene locus_tag LOCUS_16170 1997004 1995541 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_16170 1997413 1998159 gene locus_tag LOCUS_16180 1997413 1998159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1998207 1998701 gene locus_tag LOCUS_16190 1998207 1998701 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_16190 1998708 1999337 gene locus_tag LOCUS_16200 1998708 1999337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_16200 2000147 1999344 gene locus_tag LOCUS_16210 2000147 1999344 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_16210 2000842 2000204 gene locus_tag LOCUS_16220 2000842 2000204 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_16220 2001128 2001571 gene locus_tag LOCUS_16230 2001128 2001571 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_16230 2001636 2003549 gene locus_tag LOCUS_16240 2001636 2003549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2003549 2005519 gene locus_tag LOCUS_16250 2003549 2005519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2006576 2006761 gene locus_tag LOCUS_16260 2006576 2006761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2006889 2006758 gene locus_tag LOCUS_16270 2006889 2006758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2009015 2007861 gene locus_tag LOCUS_16280 2009015 2007861 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_16280 2009260 2010462 gene locus_tag LOCUS_16290 2009260 2010462 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_16290 2011141 2010488 gene locus_tag LOCUS_16300 2011141 2010488 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_16300 2013048 2011138 gene locus_tag LOCUS_16310 2013048 2011138 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_16310 2013900 2013127 gene locus_tag LOCUS_16320 2013900 2013127 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 protein_id gnl|my_center|LOCUS_16320 2014346 2013978 gene locus_tag LOCUS_16330 2014346 2013978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_16330 2014998 2014426 gene locus_tag LOCUS_16340 2014998 2014426 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_16340 2015219 2014998 gene locus_tag LOCUS_16350 2015219 2014998 CDS product DUF6095 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962883.1 protein_id gnl|my_center|LOCUS_16350 2016039 2015221 gene locus_tag LOCUS_16360 gene murQ 2016039 2015221 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_16360 2016754 2016086 gene locus_tag LOCUS_16370 2016754 2016086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_16370 2017483 2016851 gene locus_tag LOCUS_16380 2017483 2016851 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_16380 2017663 2018868 gene locus_tag LOCUS_16390 2017663 2018868 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_16390 2020089 2019217 gene locus_tag LOCUS_16400 2020089 2019217 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_16400 2020502 2020173 gene locus_tag LOCUS_16410 2020502 2020173 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_16410 2021554 2020604 gene locus_tag LOCUS_16420 2021554 2020604 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_16420 2021805 2022161 gene locus_tag LOCUS_16430 2021805 2022161 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810732.1 protein_id gnl|my_center|LOCUS_16430 2023013 2022216 gene locus_tag LOCUS_16440 2023013 2022216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2024603 2023215 gene locus_tag LOCUS_16450 gene lpdA 2024603 2023215 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_16450 2026609 2024855 gene locus_tag LOCUS_16460 2026609 2024855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_16460 2027472 2026738 gene locus_tag LOCUS_16470 gene truA 2027472 2026738 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_16470 2027685 2028179 gene locus_tag LOCUS_16480 2027685 2028179 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_16480 2028622 2028248 gene locus_tag LOCUS_16490 2028622 2028248 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_16490 2029948 2028755 gene locus_tag LOCUS_16500 2029948 2028755 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_16500 2030416 2030009 gene locus_tag LOCUS_16510 gene tsaE 2030416 2030009 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_16510 2032034 2030481 gene locus_tag LOCUS_16520 2032034 2030481 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_16520 2032593 2032928 gene locus_tag LOCUS_16530 2032593 2032928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2033103 2034560 gene locus_tag LOCUS_16540 2033103 2034560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2034847 2035689 gene locus_tag LOCUS_16550 2034847 2035689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766198.1 protein_id gnl|my_center|LOCUS_16550 2037999 2035888 gene locus_tag LOCUS_16560 gene recQ 2037999 2035888 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_16560 2038707 2038309 gene locus_tag LOCUS_16570 2038707 2038309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2039686 2038715 gene locus_tag LOCUS_16580 2039686 2038715 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_16580 2041181 2039781 gene locus_tag LOCUS_16590 2041181 2039781 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_16590 2041414 2041235 gene locus_tag LOCUS_16600 2041414 2041235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2042540 2041473 gene locus_tag LOCUS_16610 gene aroB 2042540 2041473 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_16610 2042633 2043802 gene locus_tag LOCUS_16620 2042633 2043802 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_16620 2045711 2043921 gene locus_tag LOCUS_16630 2045711 2043921 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 protein_id gnl|my_center|LOCUS_16630 2045904 2045979 gene locus_tag LOCUS_t00250 2045904 2045979 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2046251 2046514 gene locus_tag LOCUS_16640 2046251 2046514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16640 2046572 2047492 gene locus_tag LOCUS_16650 2046572 2047492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16650 2047707 2048471 gene locus_tag LOCUS_16660 2047707 2048471 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966801.1 protein_id gnl|my_center|LOCUS_16660 2048482 2049381 gene locus_tag LOCUS_16670 2048482 2049381 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_16670 2049698 2050609 gene locus_tag LOCUS_16680 2049698 2050609 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_16680 2050800 2051357 gene locus_tag LOCUS_16690 2050800 2051357 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_159656972.1 protein_id gnl|my_center|LOCUS_16690 2051436 2052404 gene locus_tag LOCUS_16700 2051436 2052404 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900117.1 protein_id gnl|my_center|LOCUS_16700 2052870 2052532 gene locus_tag LOCUS_16710 2052870 2052532 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 protein_id gnl|my_center|LOCUS_16710 2052944 2053711 gene locus_tag LOCUS_16720 2052944 2053711 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161829.1 protein_id gnl|my_center|LOCUS_16720 2053973 2053743 gene locus_tag LOCUS_16730 2053973 2053743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2053906 2056311 gene locus_tag LOCUS_16740 2053906 2056311 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_16740 2056336 2057262 gene locus_tag LOCUS_16750 2056336 2057262 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974548.1 protein_id gnl|my_center|LOCUS_16750 2057349 2057789 gene locus_tag LOCUS_16760 2057349 2057789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2057943 2058218 gene locus_tag LOCUS_16770 2057943 2058218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2058223 2058423 gene locus_tag LOCUS_16780 2058223 2058423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2058442 2059479 gene locus_tag LOCUS_16790 2058442 2059479 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990135.1 protein_id gnl|my_center|LOCUS_16790 2059480 2060568 gene locus_tag LOCUS_16800 2059480 2060568 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803756.1 protein_id gnl|my_center|LOCUS_16800 2060599 2060949 gene locus_tag LOCUS_16810 2060599 2060949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2060963 2061871 gene locus_tag LOCUS_16820 2060963 2061871 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_16820 2061927 2062838 gene locus_tag LOCUS_16830 2061927 2062838 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_16830 2063050 2063922 gene locus_tag LOCUS_16840 2063050 2063922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2064012 2065499 gene locus_tag LOCUS_16850 2064012 2065499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963687.1 protein_id gnl|my_center|LOCUS_16850 2065643 2065476 gene locus_tag LOCUS_16860 2065643 2065476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162263850.1 protein_id gnl|my_center|LOCUS_16860 2066069 2066374 gene locus_tag LOCUS_16870 2066069 2066374 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_16870 2066371 2067234 gene locus_tag LOCUS_16880 2066371 2067234 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963651.1 protein_id gnl|my_center|LOCUS_16880 2067379 2068005 gene locus_tag LOCUS_16890 2067379 2068005 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963650.1 protein_id gnl|my_center|LOCUS_16890 2068105 2069322 gene locus_tag LOCUS_16900 2068105 2069322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 2069322 2071097 gene locus_tag LOCUS_16910 2069322 2071097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2071329 2072327 gene locus_tag LOCUS_16920 2071329 2072327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2072302 2073144 gene locus_tag LOCUS_16930 2072302 2073144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2073177 2076176 gene locus_tag LOCUS_16940 2073177 2076176 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834707.1 protein_id gnl|my_center|LOCUS_16940 2076426 2076265 gene locus_tag LOCUS_16950 2076426 2076265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2076675 2076502 gene locus_tag LOCUS_16960 2076675 2076502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_16960 2077371 2076844 gene locus_tag LOCUS_16970 2077371 2076844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657427.1 protein_id gnl|my_center|LOCUS_16970 2078098 2077355 gene locus_tag LOCUS_16980 2078098 2077355 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769912.1 protein_id gnl|my_center|LOCUS_16980 2078426 2078085 gene locus_tag LOCUS_16990 2078426 2078085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2080001 2080423 gene locus_tag LOCUS_17000 2080001 2080423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963665.1 protein_id gnl|my_center|LOCUS_17000 2080380 2080625 gene locus_tag LOCUS_17010 2080380 2080625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2080885 2080709 gene locus_tag LOCUS_17020 2080885 2080709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2081090 2080872 gene locus_tag LOCUS_17030 2081090 2080872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963662.1 protein_id gnl|my_center|LOCUS_17030 2081498 2081103 gene locus_tag LOCUS_17040 2081498 2081103 CDS product DUF5675 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963661.1 protein_id gnl|my_center|LOCUS_17040 2082256 2081498 gene locus_tag LOCUS_17050 2082256 2081498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_17050 2082524 2082727 gene locus_tag LOCUS_17060 2082524 2082727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161644875.1 protein_id gnl|my_center|LOCUS_17060 2083179 2083613 gene locus_tag LOCUS_17070 2083179 2083613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2084741 2083674 gene locus_tag LOCUS_17080 gene guaC 2084741 2083674 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217337.1 protein_id gnl|my_center|LOCUS_17080 2086121 2084940 gene locus_tag LOCUS_17090 2086121 2084940 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_17090 2087496 2086174 gene locus_tag LOCUS_17100 2087496 2086174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 2087724 2088539 gene locus_tag LOCUS_17110 2087724 2088539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2088551 2089549 gene locus_tag LOCUS_17120 2088551 2089549 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_17120 2089554 2089946 gene locus_tag LOCUS_17130 2089554 2089946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2090226 2091023 gene locus_tag LOCUS_17140 2090226 2091023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2091025 2091741 gene locus_tag LOCUS_17150 2091025 2091741 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_17150 2091827 2093443 gene locus_tag LOCUS_17160 2091827 2093443 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_17160 2093692 2093522 gene locus_tag LOCUS_17170 2093692 2093522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2093880 2094419 gene locus_tag LOCUS_17180 gene pyrR 2093880 2094419 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_17180 2094426 2095352 gene locus_tag LOCUS_17190 2094426 2095352 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_17190 2095382 2095714 gene locus_tag LOCUS_17200 2095382 2095714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_17200 2095786 2096691 gene locus_tag LOCUS_17210 2095786 2096691 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_17210 2096878 2097522 gene locus_tag LOCUS_17220 gene pdxH 2096878 2097522 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963814.1 protein_id gnl|my_center|LOCUS_17220 2097945 2099213 gene locus_tag LOCUS_17230 2097945 2099213 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_17230 2099704 2099309 gene locus_tag LOCUS_17240 2099704 2099309 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_17240 2100361 2099990 gene locus_tag LOCUS_17250 2100361 2099990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2100868 2100413 gene locus_tag LOCUS_17260 2100868 2100413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2101784 2100954 gene locus_tag LOCUS_17270 2101784 2100954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2102140 2103918 gene locus_tag LOCUS_17280 gene rpsA 2102140 2103918 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_17280 2104532 2103987 gene locus_tag LOCUS_17290 2104532 2103987 CDS product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090086.1 protein_id gnl|my_center|LOCUS_17290 2105433 2104627 gene locus_tag LOCUS_17300 2105433 2104627 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142088.1 protein_id gnl|my_center|LOCUS_17300 2106440 2105553 gene locus_tag LOCUS_17310 gene ntrB 2106440 2105553 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967199.1 protein_id gnl|my_center|LOCUS_17310 2107765 2106545 gene locus_tag LOCUS_17320 2107765 2106545 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029882726.1 protein_id gnl|my_center|LOCUS_17320 2109061 2107793 gene locus_tag LOCUS_17330 2109061 2107793 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_17330 2110146 2109448 gene locus_tag LOCUS_17340 2110146 2109448 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476586.1 protein_id gnl|my_center|LOCUS_17340 2110323 2113835 gene locus_tag LOCUS_17350 2110323 2113835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2113924 2115351 gene locus_tag LOCUS_17360 2113924 2115351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2115397 2115945 gene locus_tag LOCUS_17370 2115397 2115945 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_17370 2116412 2116029 gene locus_tag LOCUS_17380 2116412 2116029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2116857 2116504 gene locus_tag LOCUS_17390 2116857 2116504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2117003 2116869 gene locus_tag LOCUS_17400 2117003 2116869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2117157 2116966 gene locus_tag LOCUS_17410 2117157 2116966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2117561 2118106 gene locus_tag LOCUS_17420 2117561 2118106 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_17420 2118333 2119232 gene locus_tag LOCUS_17430 2118333 2119232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2119846 2119355 gene locus_tag LOCUS_17440 2119846 2119355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2120468 2119947 gene locus_tag LOCUS_17450 2120468 2119947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_17450 2120517 2121044 gene locus_tag LOCUS_17460 2120517 2121044 CDS product DUF6155 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963095.1 protein_id gnl|my_center|LOCUS_17460 2121156 2122694 gene locus_tag LOCUS_17470 2121156 2122694 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_17470 2123058 2124392 gene locus_tag LOCUS_17480 2123058 2124392 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_17480 2124473 2125744 gene locus_tag LOCUS_17490 2124473 2125744 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786418.1 protein_id gnl|my_center|LOCUS_17490 2125875 2126057 gene locus_tag LOCUS_17500 2125875 2126057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2126318 2126623 gene locus_tag LOCUS_17510 2126318 2126623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2126627 2127400 gene locus_tag LOCUS_17520 2126627 2127400 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052085.1 protein_id gnl|my_center|LOCUS_17520 2127394 2127663 gene locus_tag LOCUS_17530 2127394 2127663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2127784 2128833 gene locus_tag LOCUS_17540 2127784 2128833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2130336 2129152 gene locus_tag LOCUS_17550 2130336 2129152 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266545.1 protein_id gnl|my_center|LOCUS_17550 2131376 2130639 gene locus_tag LOCUS_17560 2131376 2130639 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_17560 2131811 2133106 gene locus_tag LOCUS_17570 2131811 2133106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2133152 2133994 gene locus_tag LOCUS_17580 2133152 2133994 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974123.1 protein_id gnl|my_center|LOCUS_17580 2134084 2134977 gene locus_tag LOCUS_17590 2134084 2134977 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_17590 2135033 2136346 gene locus_tag LOCUS_17600 2135033 2136346 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_17600 2137079 2136564 gene locus_tag LOCUS_17610 2137079 2136564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2137256 2139172 gene locus_tag LOCUS_17620 2137256 2139172 CDS product DUF294 nucleotidyltransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_17620 2139176 2139772 gene locus_tag LOCUS_17630 2139176 2139772 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963091.1 protein_id gnl|my_center|LOCUS_17630 2140866 2139859 gene locus_tag LOCUS_17640 2140866 2139859 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_17640 2142916 2141441 gene locus_tag LOCUS_17650 gene ilvC 2142916 2141441 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074006.1 protein_id gnl|my_center|LOCUS_17650 2143494 2142967 gene locus_tag LOCUS_17660 gene ilvN 2143494 2142967 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_17660 2145189 2143501 gene locus_tag LOCUS_17670 gene ilvB 2145189 2143501 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_17670 2146945 2145272 gene locus_tag LOCUS_17680 gene ilvD 2146945 2145272 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_17680 2148118 2147003 gene locus_tag LOCUS_17690 gene leuB 2148118 2147003 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_17690 2149358 2148183 gene locus_tag LOCUS_17700 2149358 2148183 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789851.1 protein_id gnl|my_center|LOCUS_17700 2149513 2151057 gene locus_tag LOCUS_17710 2149513 2151057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_17710 2151107 2151676 gene locus_tag LOCUS_17720 2151107 2151676 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_17720 2153425 2151734 gene locus_tag LOCUS_17730 gene ettA 2153425 2151734 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_17730 2153745 2153452 gene locus_tag LOCUS_17740 2153745 2153452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2154034 2153747 gene locus_tag LOCUS_17750 2154034 2153747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2154266 2154598 gene locus_tag LOCUS_17760 2154266 2154598 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_17760 2154618 2155079 gene locus_tag LOCUS_17770 2154618 2155079 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_17770 2155118 2155732 gene locus_tag LOCUS_17780 2155118 2155732 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_17780 2155735 2156799 gene locus_tag LOCUS_17790 gene arsB 2155735 2156799 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_17790 2157073 2156891 gene locus_tag LOCUS_17800 2157073 2156891 CDS product CAL67264 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_17800 2158106 2157102 gene locus_tag LOCUS_17810 gene holA 2158106 2157102 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_17810 2158208 2158657 gene locus_tag LOCUS_17820 2158208 2158657 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_17820 2158781 2159488 gene locus_tag LOCUS_17830 2158781 2159488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2159524 2160510 gene locus_tag LOCUS_17840 2159524 2160510 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_17840 2160588 2161421 gene locus_tag LOCUS_17850 2160588 2161421 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_17850 2161779 2161582 gene locus_tag LOCUS_17860 2161779 2161582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_17860 2162556 2161894 gene locus_tag LOCUS_17870 gene mnmD 2162556 2161894 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_17870 2162830 2163894 gene locus_tag LOCUS_17880 2162830 2163894 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963851.1 protein_id gnl|my_center|LOCUS_17880 2164403 2164020 gene locus_tag LOCUS_17890 2164403 2164020 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_17890 2166764 2164728 gene locus_tag LOCUS_17900 2166764 2164728 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841441.1 protein_id gnl|my_center|LOCUS_17900 2167006 2168175 gene locus_tag LOCUS_17910 2167006 2168175 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963854.1 protein_id gnl|my_center|LOCUS_17910 2168239 2168781 gene locus_tag LOCUS_17920 2168239 2168781 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_17920 2168815 2169228 gene locus_tag LOCUS_17930 2168815 2169228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2169229 2169684 gene locus_tag LOCUS_17940 2169229 2169684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2169889 2171022 gene locus_tag LOCUS_17950 2169889 2171022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2171160 2173121 gene locus_tag LOCUS_17960 2171160 2173121 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962780.1 protein_id gnl|my_center|LOCUS_17960 2173705 2173208 gene locus_tag LOCUS_17970 2173705 2173208 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_17970 2175076 2173802 gene locus_tag LOCUS_17980 2175076 2173802 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962841.1 protein_id gnl|my_center|LOCUS_17980 2175185 2176468 gene locus_tag LOCUS_17990 gene fahA 2175185 2176468 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_17990 2176601 2177788 gene locus_tag LOCUS_18000 2176601 2177788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_18000 2178225 2178866 gene locus_tag LOCUS_18010 2178225 2178866 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_18010 2178916 2180115 gene locus_tag LOCUS_18020 2178916 2180115 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_18020 2180152 2180568 gene locus_tag LOCUS_18030 2180152 2180568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2180618 2181595 gene locus_tag LOCUS_18040 gene argC 2180618 2181595 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_18040 2181666 2182802 gene locus_tag LOCUS_18050 2181666 2182802 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_18050 2182942 2183121 gene locus_tag LOCUS_18060 2182942 2183121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2183118 2184314 gene locus_tag LOCUS_18070 2183118 2184314 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083010.1 protein_id gnl|my_center|LOCUS_18070 2184526 2185287 gene locus_tag LOCUS_18080 2184526 2185287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2185290 2186240 gene locus_tag LOCUS_18090 2185290 2186240 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_18090 2186230 2187015 gene locus_tag LOCUS_18100 gene argB 2186230 2187015 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_18100 2187101 2188171 gene locus_tag LOCUS_18110 2187101 2188171 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_18110 2188203 2188580 gene locus_tag LOCUS_18120 2188203 2188580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2188640 2189920 gene locus_tag LOCUS_18130 gene argH 2188640 2189920 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_18130 2190407 2190018 gene locus_tag LOCUS_18140 gene ytxJ 2190407 2190018 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_18140 2190554 2193160 gene locus_tag LOCUS_18150 gene clpB 2190554 2193160 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963875.1 protein_id gnl|my_center|LOCUS_18150 2193589 2193245 gene locus_tag LOCUS_18160 2193589 2193245 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_18160 2193866 2193579 gene locus_tag LOCUS_18170 2193866 2193579 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_18170 2194347 2197088 gene locus_tag LOCUS_18180 2194347 2197088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2197738 2197436 gene locus_tag LOCUS_18190 2197738 2197436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2197986 2197735 gene locus_tag LOCUS_18200 2197986 2197735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2198140 2199222 gene locus_tag LOCUS_18210 2198140 2199222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2199280 2199879 gene locus_tag LOCUS_18220 gene nfsB 2199280 2199879 CDS product oxygen-insensitive NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021632.1 protein_id gnl|my_center|LOCUS_18220 2199890 2200393 gene locus_tag LOCUS_18230 2199890 2200393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2200472 2200966 gene locus_tag LOCUS_18240 2200472 2200966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2200969 2201628 gene locus_tag LOCUS_18250 2200969 2201628 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_18250 2201764 2201690 gene locus_tag LOCUS_t00260 2201764 2201690 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2202544 2201828 gene locus_tag LOCUS_18260 gene bshB1 2202544 2201828 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_18260 2203644 2202589 gene locus_tag LOCUS_18270 2203644 2202589 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_18270 2204081 2203647 gene locus_tag LOCUS_18280 2204081 2203647 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_18280 2204372 2205874 gene locus_tag LOCUS_18290 2204372 2205874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_18290 2205973 2208018 gene locus_tag LOCUS_18300 2205973 2208018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 2208111 2211770 gene locus_tag LOCUS_18310 gene purL 2208111 2211770 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962854.1 protein_id gnl|my_center|LOCUS_18310 2211929 2212330 gene locus_tag LOCUS_18320 2211929 2212330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_18320 2214000 2212348 gene locus_tag LOCUS_18330 2214000 2212348 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_18330 2214697 2214101 gene locus_tag LOCUS_18340 gene hisIE 2214697 2214101 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963101.1 protein_id gnl|my_center|LOCUS_18340 2215556 2214801 gene locus_tag LOCUS_18350 gene hisF 2215556 2214801 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_18350 2216377 2215652 gene locus_tag LOCUS_18360 gene hisA 2216377 2215652 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963103.1 protein_id gnl|my_center|LOCUS_18360 2217002 2216421 gene locus_tag LOCUS_18370 gene hisH 2217002 2216421 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963104.1 protein_id gnl|my_center|LOCUS_18370 2218215 2217079 gene locus_tag LOCUS_18380 gene hisB 2218215 2217079 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963105.1 protein_id gnl|my_center|LOCUS_18380 2218672 2218262 gene locus_tag LOCUS_18390 2218672 2218262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2219724 2218669 gene locus_tag LOCUS_18400 gene hisC 2219724 2218669 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_18400 2220304 2219741 gene locus_tag LOCUS_18410 2220304 2219741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2221631 2220342 gene locus_tag LOCUS_18420 gene hisD 2221631 2220342 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_18420 2222564 2221707 gene locus_tag LOCUS_18430 gene hisG 2222564 2221707 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_18430 2222962 2222753 gene locus_tag LOCUS_18440 2222962 2222753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2224615 2222990 gene locus_tag LOCUS_18450 gene pckA 2224615 2222990 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208912.1 protein_id gnl|my_center|LOCUS_18450 2225632 2224823 gene locus_tag LOCUS_18460 2225632 2224823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2226263 2225862 gene locus_tag LOCUS_18470 2226263 2225862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2227741 2226269 gene locus_tag LOCUS_18480 gene guaB 2227741 2226269 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_18480 2229255 2227858 gene locus_tag LOCUS_18490 2229255 2227858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2229788 2229252 gene locus_tag LOCUS_18500 2229788 2229252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2230704 2229841 gene locus_tag LOCUS_18510 2230704 2229841 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_18510 2230961 2231572 gene locus_tag LOCUS_18520 2230961 2231572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2231569 2232270 gene locus_tag LOCUS_18530 2231569 2232270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2233275 2232250 gene locus_tag LOCUS_18540 2233275 2232250 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_18540 2233432 2234271 gene locus_tag LOCUS_18550 gene prmA 2233432 2234271 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_18550 2234333 2234608 gene locus_tag LOCUS_18560 2234333 2234608 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_18560 2234625 2235077 gene locus_tag LOCUS_18570 2234625 2235077 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963795.1 protein_id gnl|my_center|LOCUS_18570 2235138 2235956 gene locus_tag LOCUS_18580 gene kdsA 2235138 2235956 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962665.1 protein_id gnl|my_center|LOCUS_18580 2235967 2236821 gene locus_tag LOCUS_18590 2235967 2236821 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_18590 2237446 2236892 gene locus_tag LOCUS_18600 2237446 2236892 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 protein_id gnl|my_center|LOCUS_18600 2237736 2238233 gene locus_tag LOCUS_18610 gene tpx 2237736 2238233 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963706.1 protein_id gnl|my_center|LOCUS_18610 2238242 2238616 gene locus_tag LOCUS_18620 2238242 2238616 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_18620 2238634 2241105 gene locus_tag LOCUS_18630 2238634 2241105 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_18630 2241092 2241757 gene locus_tag LOCUS_18640 2241092 2241757 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_18640 2241767 2243212 gene locus_tag LOCUS_18650 2241767 2243212 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_18650 2243225 2244358 gene locus_tag LOCUS_18660 gene ribB 2243225 2244358 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_18660 2244516 2244601 gene locus_tag LOCUS_t00270 2244516 2244601 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2244892 2246199 gene locus_tag LOCUS_18670 2244892 2246199 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_18670 2246553 2246236 gene locus_tag LOCUS_18680 2246553 2246236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2246854 2246546 gene locus_tag LOCUS_18690 2246854 2246546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 2248033 2250309 gene locus_tag LOCUS_18700 2248033 2250309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2250309 2251562 gene locus_tag LOCUS_18710 2250309 2251562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 2251596 2252414 gene locus_tag LOCUS_18720 2251596 2252414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2252417 2253937 gene locus_tag LOCUS_18730 2252417 2253937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2254731 2253946 gene locus_tag LOCUS_18740 2254731 2253946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 2255635 2254742 gene locus_tag LOCUS_18750 2255635 2254742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2256361 2256116 gene locus_tag LOCUS_18760 2256361 2256116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2257367 2260063 gene locus_tag LOCUS_18770 2257367 2260063 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_18770 2260199 2261506 gene locus_tag LOCUS_18780 2260199 2261506 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_18780 2261610 2264192 gene locus_tag LOCUS_18790 2261610 2264192 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_18790 2264533 2264264 gene locus_tag LOCUS_18800 2264533 2264264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2265510 2264629 gene locus_tag LOCUS_18810 2265510 2264629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2267180 2266257 gene locus_tag LOCUS_18820 2267180 2266257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2267642 2267250 gene locus_tag LOCUS_18830 2267642 2267250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2267849 2270272 gene locus_tag LOCUS_18840 2267849 2270272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2270310 2271140 gene locus_tag LOCUS_18850 2270310 2271140 CDS product RteC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_18850 2271388 2275050 gene locus_tag LOCUS_18860 2271388 2275050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086952.1 protein_id gnl|my_center|LOCUS_18860 2276199 2275207 gene locus_tag LOCUS_18870 2276199 2275207 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_18870 2276990 2276199 gene locus_tag LOCUS_18880 2276990 2276199 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_18880 2278624 2277107 gene locus_tag LOCUS_18890 2278624 2277107 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_18890 2279076 2279369 gene locus_tag LOCUS_18900 2279076 2279369 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005926255.1 protein_id gnl|my_center|LOCUS_18900 2279469 2280854 gene locus_tag LOCUS_18910 2279469 2280854 CDS product DUF3945 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107112.1 protein_id gnl|my_center|LOCUS_18910 2280875 2282956 gene locus_tag LOCUS_18920 2280875 2282956 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107114.1 protein_id gnl|my_center|LOCUS_18920 2283094 2284542 gene locus_tag LOCUS_18930 2283094 2284542 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207649719.1 protein_id gnl|my_center|LOCUS_18930 2284937 2284761 gene locus_tag LOCUS_18940 2284937 2284761 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_18940 2285134 2285571 gene locus_tag LOCUS_18950 2285134 2285571 CDS product DUF1896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485366.1 protein_id gnl|my_center|LOCUS_18950 2285669 2290963 gene locus_tag LOCUS_18960 2285669 2290963 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108226.1 protein_id gnl|my_center|LOCUS_18960 2293102 2291102 gene locus_tag LOCUS_18970 gene mobC 2293102 2291102 CDS product conjugal transfer protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107111.1 protein_id gnl|my_center|LOCUS_18970 2294550 2293234 gene locus_tag LOCUS_18980 gene mobB 2294550 2293234 CDS product conjugal transfer protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202381.1 protein_id gnl|my_center|LOCUS_18980 2294993 2294547 gene locus_tag LOCUS_18990 gene mobA 2294993 2294547 CDS product conjugal transfer protein MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007216065.1 protein_id gnl|my_center|LOCUS_18990 2295663 2296430 gene locus_tag LOCUS_19000 2295663 2296430 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107109.1 protein_id gnl|my_center|LOCUS_19000 2296435 2296869 gene locus_tag LOCUS_19010 2296435 2296869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2296866 2297504 gene locus_tag LOCUS_19020 2296866 2297504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2297695 2298504 gene locus_tag LOCUS_19030 2297695 2298504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2298501 2299280 gene locus_tag LOCUS_19040 2298501 2299280 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024997765.1 protein_id gnl|my_center|LOCUS_19040 2302672 2299409 gene locus_tag LOCUS_19050 2302672 2299409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2302924 2303229 gene locus_tag LOCUS_19060 2302924 2303229 CDS product DUF4134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107106.1 protein_id gnl|my_center|LOCUS_19060 2303678 2306068 gene locus_tag LOCUS_19070 2303678 2306068 CDS product TraG family conjugative transposon ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_19070 2306150 2306725 gene locus_tag LOCUS_19080 2306150 2306725 CDS product DUF4141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485401.1 protein_id gnl|my_center|LOCUS_19080 2306728 2307720 gene locus_tag LOCUS_19090 gene traJ 2306728 2307720 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107101.1 protein_id gnl|my_center|LOCUS_19090 2307742 2308365 gene locus_tag LOCUS_19100 gene traK 2307742 2308365 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107100.1 protein_id gnl|my_center|LOCUS_19100 2308376 2309962 gene locus_tag LOCUS_19110 gene traM 2308376 2309962 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202373.1 protein_id gnl|my_center|LOCUS_19110 2309997 2310899 gene locus_tag LOCUS_19120 gene traN 2309997 2310899 CDS product conjugative transposon protein TraN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202372.1 protein_id gnl|my_center|LOCUS_19120 2311073 2311348 gene locus_tag LOCUS_19130 2311073 2311348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2312379 2311573 gene locus_tag LOCUS_19140 2312379 2311573 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_19140 2313101 2312379 gene locus_tag LOCUS_19150 2313101 2312379 CDS product prokaryotic E2 ligase family D protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108425.1 protein_id gnl|my_center|LOCUS_19150 2314273 2313098 gene locus_tag LOCUS_19160 2314273 2313098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2314509 2314291 gene locus_tag LOCUS_19170 2314509 2314291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2315138 2314533 gene locus_tag LOCUS_19180 2315138 2314533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 2315345 2315151 gene locus_tag LOCUS_19190 2315345 2315151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2316473 2315400 gene locus_tag LOCUS_19200 2316473 2315400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2316910 2316518 gene locus_tag LOCUS_19210 gene ssb 2316910 2316518 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905690.1 protein_id gnl|my_center|LOCUS_19210 2317977 2318981 gene locus_tag LOCUS_19220 2317977 2318981 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005941495.1 protein_id gnl|my_center|LOCUS_19220 2319661 2319143 gene locus_tag LOCUS_19230 2319661 2319143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2324064 2319676 gene locus_tag LOCUS_19240 2324064 2319676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2327276 2324076 gene locus_tag LOCUS_19250 2327276 2324076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 2327720 2328613 gene locus_tag LOCUS_19260 2327720 2328613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2328858 2328649 gene locus_tag LOCUS_19270 2328858 2328649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2329103 2329588 gene locus_tag LOCUS_19280 2329103 2329588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2330300 2330043 gene locus_tag LOCUS_19290 2330300 2330043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2334599 2330304 gene locus_tag LOCUS_19300 2334599 2330304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2337496 2334611 gene locus_tag LOCUS_19310 2337496 2334611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767440.1 protein_id gnl|my_center|LOCUS_19310 2339030 2337894 gene locus_tag LOCUS_19320 2339030 2337894 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_19320 2339493 2339020 gene locus_tag LOCUS_19330 2339493 2339020 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964405.1 protein_id gnl|my_center|LOCUS_19330 2339818 2339480 gene locus_tag LOCUS_19340 2339818 2339480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964404.1 protein_id gnl|my_center|LOCUS_19340 2341089 2339806 gene locus_tag LOCUS_19350 2341089 2339806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964403.1 protein_id gnl|my_center|LOCUS_19350 2341508 2341086 gene locus_tag LOCUS_19360 2341508 2341086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964402.1 protein_id gnl|my_center|LOCUS_19360 2342433 2341573 gene locus_tag LOCUS_19370 2342433 2341573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964401.1 protein_id gnl|my_center|LOCUS_19370 2343303 2342566 gene locus_tag LOCUS_19380 2343303 2342566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964400.1 protein_id gnl|my_center|LOCUS_19380 2343481 2343975 gene locus_tag LOCUS_19390 2343481 2343975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2344256 2344759 gene locus_tag LOCUS_19400 2344256 2344759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2344746 2344922 gene locus_tag LOCUS_19410 2344746 2344922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 2344944 2345183 gene locus_tag LOCUS_19420 2344944 2345183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2345954 2345298 gene locus_tag LOCUS_19430 2345954 2345298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2350207 2345951 gene locus_tag LOCUS_19440 2350207 2345951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 2353512 2350219 gene locus_tag LOCUS_19450 2353512 2350219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2353923 2354333 gene locus_tag LOCUS_19460 2353923 2354333 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_19460 2354818 2356221 gene locus_tag LOCUS_19470 2354818 2356221 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_19470 2356256 2358514 gene locus_tag LOCUS_19480 2356256 2358514 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964388.1 protein_id gnl|my_center|LOCUS_19480 2358514 2359710 gene locus_tag LOCUS_19490 2358514 2359710 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964387.1 protein_id gnl|my_center|LOCUS_19490 2359712 2360236 gene locus_tag LOCUS_19500 2359712 2360236 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964386.1 protein_id gnl|my_center|LOCUS_19500 2360905 2362161 gene locus_tag LOCUS_19510 2360905 2362161 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_19510 2362615 2362427 gene locus_tag LOCUS_19520 2362615 2362427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19520 2362657 2363334 gene locus_tag LOCUS_19530 2362657 2363334 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_19530 2363327 2364592 gene locus_tag LOCUS_19540 2363327 2364592 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_19540 2364843 2364607 gene locus_tag LOCUS_19550 2364843 2364607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2364728 2367067 gene locus_tag LOCUS_19560 2364728 2367067 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963130.1 protein_id gnl|my_center|LOCUS_19560 2367085 2367840 gene locus_tag LOCUS_19570 2367085 2367840 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024697047.1 protein_id gnl|my_center|LOCUS_19570 2367943 2368365 gene locus_tag LOCUS_19580 2367943 2368365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2368641 2369693 gene locus_tag LOCUS_19590 2368641 2369693 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_19590 2369772 2370521 gene locus_tag LOCUS_19600 2369772 2370521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2370643 2372586 gene locus_tag LOCUS_19610 2370643 2372586 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065250839.1 protein_id gnl|my_center|LOCUS_19610 2373338 2377657 gene locus_tag LOCUS_19620 2373338 2377657 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_19620 2377669 2378919 gene locus_tag LOCUS_19630 2377669 2378919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2380081 2380338 gene locus_tag LOCUS_19640 2380081 2380338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2380669 2381301 gene locus_tag LOCUS_19650 2380669 2381301 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_19650 2381494 2382363 gene locus_tag LOCUS_19660 2381494 2382363 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038390.1 protein_id gnl|my_center|LOCUS_19660 2382374 2382841 gene locus_tag LOCUS_19670 2382374 2382841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2382878 2384974 gene locus_tag LOCUS_19680 2382878 2384974 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_19680 2385241 2386722 gene locus_tag LOCUS_19690 2385241 2386722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963687.1 protein_id gnl|my_center|LOCUS_19690 2386866 2386699 gene locus_tag LOCUS_19700 2386866 2386699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162263850.1 protein_id gnl|my_center|LOCUS_19700 2387292 2387597 gene locus_tag LOCUS_19710 2387292 2387597 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_19710 2387582 2388442 gene locus_tag LOCUS_19720 2387582 2388442 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963684.1 protein_id gnl|my_center|LOCUS_19720 2388512 2389123 gene locus_tag LOCUS_19730 2388512 2389123 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_19730 2389165 2389812 gene locus_tag LOCUS_19740 2389165 2389812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963682.1 protein_id gnl|my_center|LOCUS_19740 2389905 2390978 gene locus_tag LOCUS_19750 2389905 2390978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2391002 2391622 gene locus_tag LOCUS_19760 2391002 2391622 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705714.1 protein_id gnl|my_center|LOCUS_19760 2392398 2393246 gene locus_tag LOCUS_19770 2392398 2393246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2393266 2393883 gene locus_tag LOCUS_19780 2393266 2393883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2394006 2394518 gene locus_tag LOCUS_19790 2394006 2394518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2394574 2394978 gene locus_tag LOCUS_19800 2394574 2394978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2394968 2397217 gene locus_tag LOCUS_19810 2394968 2397217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2398635 2399057 gene locus_tag LOCUS_19820 2398635 2399057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964407.1 protein_id gnl|my_center|LOCUS_19820 2399087 2399266 gene locus_tag LOCUS_19830 2399087 2399266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964408.1 protein_id gnl|my_center|LOCUS_19830 2399730 2399512 gene locus_tag LOCUS_19840 2399730 2399512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963662.1 protein_id gnl|my_center|LOCUS_19840 2400157 2399735 gene locus_tag LOCUS_19850 2400157 2399735 CDS product DUF5675 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963661.1 protein_id gnl|my_center|LOCUS_19850 2400915 2400157 gene locus_tag LOCUS_19860 2400915 2400157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_19860 2401939 2402589 gene locus_tag LOCUS_19870 2401939 2402589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19870 2402564 2403181 gene locus_tag LOCUS_19880 2402564 2403181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19880 2403584 2403234 gene locus_tag LOCUS_19890 2403584 2403234 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476381.1 protein_id gnl|my_center|LOCUS_19890 2403756 2404106 gene locus_tag LOCUS_19900 2403756 2404106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2404134 2404364 gene locus_tag LOCUS_19910 2404134 2404364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2404399 2405289 gene locus_tag LOCUS_19920 2404399 2405289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209850.1 protein_id gnl|my_center|LOCUS_19920 2405283 2405744 gene locus_tag LOCUS_19930 2405283 2405744 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530093.1 protein_id gnl|my_center|LOCUS_19930 2405843 2406424 gene locus_tag LOCUS_19940 2405843 2406424 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_19940 2406560 2407567 gene locus_tag LOCUS_19950 2406560 2407567 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902587.1 protein_id gnl|my_center|LOCUS_19950 2407678 2408298 gene locus_tag LOCUS_19960 2407678 2408298 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526504.1 protein_id gnl|my_center|LOCUS_19960 2408760 2408398 gene locus_tag LOCUS_19970 2408760 2408398 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_19970 2408851 2409501 gene locus_tag LOCUS_19980 2408851 2409501 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948076.1 protein_id gnl|my_center|LOCUS_19980 2409725 2410231 gene locus_tag LOCUS_19990 2409725 2410231 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233857.1 protein_id gnl|my_center|LOCUS_19990 2410383 2410739 gene locus_tag LOCUS_20000 2410383 2410739 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404760.1 protein_id gnl|my_center|LOCUS_20000 2410816 2411682 gene locus_tag LOCUS_20010 2410816 2411682 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816436.1 protein_id gnl|my_center|LOCUS_20010 2411689 2412768 gene locus_tag LOCUS_20020 2411689 2412768 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315813.1 protein_id gnl|my_center|LOCUS_20020 2412792 2413538 gene locus_tag LOCUS_20030 2412792 2413538 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121677.1 protein_id gnl|my_center|LOCUS_20030 2413557 2414570 gene locus_tag LOCUS_20040 2413557 2414570 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_20040 2414661 2415338 gene locus_tag LOCUS_20050 2414661 2415338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 2415371 2415985 gene locus_tag LOCUS_20060 2415371 2415985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2416086 2417057 gene locus_tag LOCUS_20070 2416086 2417057 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_20070 2417145 2417741 gene locus_tag LOCUS_20080 2417145 2417741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 2418011 2418793 gene locus_tag LOCUS_20090 2418011 2418793 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210326921.1 protein_id gnl|my_center|LOCUS_20090 2418784 2419755 gene locus_tag LOCUS_20100 2418784 2419755 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_20100 2421815 2419842 gene locus_tag LOCUS_20110 2421815 2419842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2422252 2421986 gene locus_tag LOCUS_20120 2422252 2421986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20120 2422716 2422414 gene locus_tag LOCUS_20130 2422716 2422414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20130 2423283 2424167 gene locus_tag LOCUS_20140 2423283 2424167 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_20140 2424944 2424468 gene locus_tag LOCUS_20150 2424944 2424468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963109.1 protein_id gnl|my_center|LOCUS_20150 2426094 2424976 gene locus_tag LOCUS_20160 2426094 2424976 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_20160 2430439 2426105 gene locus_tag LOCUS_20170 2430439 2426105 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_20170 2431992 2430592 gene locus_tag LOCUS_20180 2431992 2430592 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_20180 2432653 2431985 gene locus_tag LOCUS_20190 2432653 2431985 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_20190 2434109 2432658 gene locus_tag LOCUS_20200 2434109 2432658 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_20200 2434364 2434152 gene locus_tag LOCUS_20210 2434364 2434152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2435349 2434366 gene locus_tag LOCUS_20220 2435349 2434366 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_20220 2435783 2435346 gene locus_tag LOCUS_20230 2435783 2435346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2437965 2435938 gene locus_tag LOCUS_20240 2437965 2435938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_20240 2438782 2438036 gene locus_tag LOCUS_20250 gene fabG 2438782 2438036 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_20250 2439328 2438900 gene locus_tag LOCUS_20260 2439328 2438900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963185.1 protein_id gnl|my_center|LOCUS_20260 2440278 2439406 gene locus_tag LOCUS_20270 gene sucD 2440278 2439406 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_20270 2441413 2440484 gene locus_tag LOCUS_20280 2441413 2440484 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_20280 2442116 2441463 gene locus_tag LOCUS_20290 gene efp 2442116 2441463 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_20290 2442922 2442137 gene locus_tag LOCUS_20300 gene lpxA 2442922 2442137 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_20300 2444381 2442993 gene locus_tag LOCUS_20310 2444381 2442993 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_20310 2445420 2444374 gene locus_tag LOCUS_20320 gene lpxD 2445420 2444374 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_20320 2446781 2445552 gene locus_tag LOCUS_20330 2446781 2445552 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_20330 2446978 2447877 gene locus_tag LOCUS_20340 2446978 2447877 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_20340 2447880 2448080 gene locus_tag LOCUS_20350 2447880 2448080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 2448092 2448565 gene locus_tag LOCUS_20360 2448092 2448565 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613738.1 protein_id gnl|my_center|LOCUS_20360 2448588 2450384 gene locus_tag LOCUS_20370 2448588 2450384 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962335.1 protein_id gnl|my_center|LOCUS_20370 2450520 2450768 gene locus_tag LOCUS_20380 2450520 2450768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2451411 2450896 gene locus_tag LOCUS_20390 2451411 2450896 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_20390 2454061 2451476 gene locus_tag LOCUS_20400 gene ppc 2454061 2451476 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058155.1 protein_id gnl|my_center|LOCUS_20400 2454629 2454150 gene locus_tag LOCUS_20410 2454629 2454150 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_20410 2455848 2454694 gene locus_tag LOCUS_20420 2455848 2454694 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_20420 2456160 2456624 gene locus_tag LOCUS_20430 2456160 2456624 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_20430 2456689 2457354 gene locus_tag LOCUS_20440 2456689 2457354 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962995.1 protein_id gnl|my_center|LOCUS_20440 2457838 2457398 gene locus_tag LOCUS_20450 2457838 2457398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 2459116 2457896 gene locus_tag LOCUS_20460 2459116 2457896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2459940 2459299 gene locus_tag LOCUS_20470 2459940 2459299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2460498 2460046 gene locus_tag LOCUS_20480 2460498 2460046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2463127 2460683 gene locus_tag LOCUS_20490 2463127 2460683 CDS product Plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658068.1 protein_id gnl|my_center|LOCUS_20490 2463812 2463162 gene locus_tag LOCUS_20500 2463812 2463162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2465528 2463828 gene locus_tag LOCUS_20510 2465528 2463828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2467393 2465732 gene locus_tag LOCUS_20520 gene menD 2467393 2465732 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963786.1 protein_id gnl|my_center|LOCUS_20520 2467525 2468022 gene locus_tag LOCUS_20530 2467525 2468022 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 protein_id gnl|my_center|LOCUS_20530 2468159 2469109 gene locus_tag LOCUS_20540 2468159 2469109 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_20540 2469767 2469195 gene locus_tag LOCUS_20550 2469767 2469195 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963538.1 protein_id gnl|my_center|LOCUS_20550 2470016 2470615 gene locus_tag LOCUS_20560 2470016 2470615 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_20560 2470615 2471403 gene locus_tag LOCUS_20570 2470615 2471403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2474784 2471638 gene locus_tag LOCUS_20580 gene ccsA 2474784 2471638 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_20580 2475275 2476036 gene locus_tag LOCUS_20590 2475275 2476036 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_20590 2476020 2476547 gene locus_tag LOCUS_20600 2476020 2476547 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_20600 2476690 2477343 gene locus_tag LOCUS_20610 2476690 2477343 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_20610 2477443 2478261 gene locus_tag LOCUS_20620 2477443 2478261 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_20620 2480044 2478320 gene locus_tag LOCUS_20630 2480044 2478320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2482656 2480293 gene locus_tag LOCUS_20640 2482656 2480293 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_20640 2484422 2482953 gene locus_tag LOCUS_20650 2484422 2482953 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840507.1 protein_id gnl|my_center|LOCUS_20650 2487351 2484484 gene locus_tag LOCUS_20660 2487351 2484484 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109142.1 protein_id gnl|my_center|LOCUS_20660 2488696 2487365 gene locus_tag LOCUS_20670 2488696 2487365 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_20670 2489564 2488887 gene locus_tag LOCUS_20680 gene trmD 2489564 2488887 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_20680 2489691 2490125 gene locus_tag LOCUS_20690 2489691 2490125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2490138 2490527 gene locus_tag LOCUS_20700 2490138 2490527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2492556 2490550 gene locus_tag LOCUS_20710 2492556 2490550 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_20710 2493866 2492556 gene locus_tag LOCUS_20720 gene tilS 2493866 2492556 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_20720 2495030 2493876 gene locus_tag LOCUS_20730 2495030 2493876 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_20730 2496391 2495198 gene locus_tag LOCUS_20740 2496391 2495198 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_20740 2496580 2496954 gene locus_tag LOCUS_20750 2496580 2496954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2497231 2497857 gene locus_tag LOCUS_20760 2497231 2497857 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_20760 2498085 2499437 gene locus_tag LOCUS_20770 2498085 2499437 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_20770 2499458 2500495 gene locus_tag LOCUS_20780 gene cydB 2499458 2500495 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_20780 2500638 2502056 gene locus_tag LOCUS_20790 2500638 2502056 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_20790 2502079 2502384 gene locus_tag LOCUS_20800 2502079 2502384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2502391 2502960 gene locus_tag LOCUS_20810 2502391 2502960 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_20810 2502971 2503468 gene locus_tag LOCUS_20820 2502971 2503468 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_20820 2504092 2503493 gene locus_tag LOCUS_20830 2504092 2503493 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_20830 2504262 2505350 gene locus_tag LOCUS_20840 2504262 2505350 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_20840 2505537 2508368 gene locus_tag LOCUS_20850 gene uvrA 2505537 2508368 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_20850 2508426 2509568 gene locus_tag LOCUS_20860 2508426 2509568 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_20860 2509570 2510187 gene locus_tag LOCUS_20870 2509570 2510187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2510720 2512141 gene locus_tag LOCUS_20880 gene glgA 2510720 2512141 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860977.1 protein_id gnl|my_center|LOCUS_20880 2512138 2513418 gene locus_tag LOCUS_20890 2512138 2513418 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_20890 2513513 2515450 gene locus_tag LOCUS_20900 2513513 2515450 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933744.1 protein_id gnl|my_center|LOCUS_20900 2515505 2516476 gene locus_tag LOCUS_20910 2515505 2516476 CDS product COG2958 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851346.1 protein_id gnl|my_center|LOCUS_20910 2516542 2516877 gene locus_tag LOCUS_20920 2516542 2516877 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669612.1 protein_id gnl|my_center|LOCUS_20920 2516846 2517109 gene locus_tag LOCUS_20930 2516846 2517109 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20930 2517245 2519149 gene locus_tag LOCUS_20940 gene glgB 2517245 2519149 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_20940 2519357 2521756 gene locus_tag LOCUS_20950 2519357 2521756 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_20950 2521850 2522674 gene locus_tag LOCUS_20960 2521850 2522674 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_20960 2523039 2522761 gene locus_tag LOCUS_20970 2523039 2522761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2523903 2523121 gene locus_tag LOCUS_20980 2523903 2523121 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_20980 2525429 2524125 gene locus_tag LOCUS_20990 2525429 2524125 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109157.1 protein_id gnl|my_center|LOCUS_20990 2526001 2526513 gene locus_tag LOCUS_21000 2526001 2526513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2526743 2527201 gene locus_tag LOCUS_21010 2526743 2527201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2527201 2527554 gene locus_tag LOCUS_21020 2527201 2527554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2527851 2527561 gene locus_tag LOCUS_21030 2527851 2527561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2528777 2527839 gene locus_tag LOCUS_21040 2528777 2527839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2530612 2528879 gene locus_tag LOCUS_21050 2530612 2528879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023577041.1 protein_id gnl|my_center|LOCUS_21050 2531345 2530815 gene locus_tag LOCUS_21060 2531345 2530815 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704518.1 protein_id gnl|my_center|LOCUS_21060 2531940 2531356 gene locus_tag LOCUS_21070 2531940 2531356 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963543.1 protein_id gnl|my_center|LOCUS_21070 2532859 2531933 gene locus_tag LOCUS_21080 2532859 2531933 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_21080 2533606 2532893 gene locus_tag LOCUS_21090 2533606 2532893 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963855.1 protein_id gnl|my_center|LOCUS_21090 2534271 2533618 gene locus_tag LOCUS_21100 2534271 2533618 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_21100 2534713 2535930 gene locus_tag LOCUS_21110 2534713 2535930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_21110 2536017 2536412 gene locus_tag LOCUS_21120 2536017 2536412 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_21120 2536417 2538276 gene locus_tag LOCUS_21130 2536417 2538276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2538653 2538727 gene locus_tag LOCUS_t00280 2538653 2538727 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2539216 2538791 gene locus_tag LOCUS_21140 2539216 2538791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2540346 2539213 gene locus_tag LOCUS_21150 gene bshA 2540346 2539213 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_21150 2542524 2540557 gene locus_tag LOCUS_21160 2542524 2540557 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_21160 2543588 2543106 gene locus_tag LOCUS_21170 2543588 2543106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_21170 2544472 2543681 gene locus_tag LOCUS_21180 2544472 2543681 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_21180 2545878 2544547 gene locus_tag LOCUS_21190 2545878 2544547 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_21190 2546849 2545884 gene locus_tag LOCUS_21200 2546849 2545884 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_21200 2548062 2546911 gene locus_tag LOCUS_21210 2548062 2546911 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_21210 2548196 2550886 gene locus_tag LOCUS_21220 2548196 2550886 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_21220 2550924 2551304 gene locus_tag LOCUS_21230 2550924 2551304 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_21230 2554066 2551358 gene locus_tag LOCUS_21240 2554066 2551358 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_21240 2554385 2554083 gene locus_tag LOCUS_21250 2554385 2554083 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962809.1 protein_id gnl|my_center|LOCUS_21250 2554795 2554385 gene locus_tag LOCUS_21260 2554795 2554385 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962808.1 protein_id gnl|my_center|LOCUS_21260 2554954 2554805 gene locus_tag LOCUS_21270 2554954 2554805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2556972 2555110 gene locus_tag LOCUS_21280 2556972 2555110 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_21280 2557760 2557077 gene locus_tag LOCUS_21290 2557760 2557077 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972295.1 protein_id gnl|my_center|LOCUS_21290 2558339 2557818 gene locus_tag LOCUS_21300 2558339 2557818 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263911.1 protein_id gnl|my_center|LOCUS_21300 2559546 2558452 gene locus_tag LOCUS_21310 gene ychF 2559546 2558452 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962805.1 protein_id gnl|my_center|LOCUS_21310 2559730 2562405 gene locus_tag LOCUS_21320 2559730 2562405 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_21320 2563639 2562476 gene locus_tag LOCUS_21330 2563639 2562476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962804.1 protein_id gnl|my_center|LOCUS_21330 2564149 2563799 gene locus_tag LOCUS_21340 2564149 2563799 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_21340 2564302 2565360 gene locus_tag LOCUS_21350 2564302 2565360 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_21350 2565454 2566527 gene locus_tag LOCUS_21360 gene serC 2565454 2566527 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_21360 2566598 2567548 gene locus_tag LOCUS_21370 2566598 2567548 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_21370 2567647 2568204 gene locus_tag LOCUS_21380 2567647 2568204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2568318 2568749 gene locus_tag LOCUS_21390 2568318 2568749 CDS product DUF6146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_21390 2568781 2569098 gene locus_tag LOCUS_21400 2568781 2569098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_21400 2569391 2569095 gene locus_tag LOCUS_21410 2569391 2569095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 2569529 2570194 gene locus_tag LOCUS_21420 2569529 2570194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962793.1 protein_id gnl|my_center|LOCUS_21420 2570398 2571879 gene locus_tag LOCUS_21430 2570398 2571879 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879752.1 protein_id gnl|my_center|LOCUS_21430 2571872 2572636 gene locus_tag LOCUS_21440 2571872 2572636 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_21440 2572848 2575622 gene locus_tag LOCUS_21450 2572848 2575622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2575693 2576451 gene locus_tag LOCUS_21460 2575693 2576451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2576710 2578059 gene locus_tag LOCUS_21470 2576710 2578059 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_21470 2579235 2578117 gene locus_tag LOCUS_21480 2579235 2578117 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_21480 2580103 2579279 gene locus_tag LOCUS_21490 2580103 2579279 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_21490 2580453 2582114 gene locus_tag LOCUS_21500 2580453 2582114 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_21500 2582221 2583474 gene locus_tag LOCUS_21510 2582221 2583474 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_21510 2583591 2583923 gene locus_tag LOCUS_21520 2583591 2583923 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_21520 2584000 2584644 gene locus_tag LOCUS_21530 2584000 2584644 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_21530 2585204 2584704 gene locus_tag LOCUS_21540 2585204 2584704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_21540 2585981 2585217 gene locus_tag LOCUS_21550 2585981 2585217 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_21550 2586089 2587549 gene locus_tag LOCUS_21560 2586089 2587549 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_21560 2587673 2588065 gene locus_tag LOCUS_21570 gene rplS 2587673 2588065 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963978.1 protein_id gnl|my_center|LOCUS_21570 2588351 2590573 gene locus_tag LOCUS_21580 2588351 2590573 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_21580 2590659 2591033 gene locus_tag LOCUS_21590 2590659 2591033 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_21590 2591144 2593519 gene locus_tag LOCUS_21600 2591144 2593519 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_21600 2593523 2594362 gene locus_tag LOCUS_21610 2593523 2594362 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_21610 2594389 2594748 gene locus_tag LOCUS_21620 2594389 2594748 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_21620 2594833 2595765 gene locus_tag LOCUS_21630 2594833 2595765 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964012.1 protein_id gnl|my_center|LOCUS_21630 2595855 2596169 gene locus_tag LOCUS_21640 2595855 2596169 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963805.1 protein_id gnl|my_center|LOCUS_21640 2596509 2596279 gene locus_tag LOCUS_21650 2596509 2596279 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_21650 2596996 2596595 gene locus_tag LOCUS_21660 2596996 2596595 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 protein_id gnl|my_center|LOCUS_21660 2598889 2597030 gene locus_tag LOCUS_21670 2598889 2597030 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_21670 2600834 2599305 gene locus_tag LOCUS_21680 gene guaA 2600834 2599305 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963998.1 protein_id gnl|my_center|LOCUS_21680 2600923 2601546 gene locus_tag LOCUS_21690 2600923 2601546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2602621 2601707 gene locus_tag LOCUS_21700 2602621 2601707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2603520 2602777 gene locus_tag LOCUS_21710 2603520 2602777 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266861.1 protein_id gnl|my_center|LOCUS_21710 2603797 2603522 gene locus_tag LOCUS_21720 2603797 2603522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 2604679 2604008 gene locus_tag LOCUS_21730 2604679 2604008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 2604857 2606329 gene locus_tag LOCUS_21740 2604857 2606329 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 protein_id gnl|my_center|LOCUS_21740 2607069 2606338 gene locus_tag LOCUS_21750 2607069 2606338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2607914 2607348 gene locus_tag LOCUS_21760 2607914 2607348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2608181 2608567 gene locus_tag LOCUS_21770 2608181 2608567 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_21770 2608724 2609971 gene locus_tag LOCUS_21780 2608724 2609971 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_21780 2610041 2611045 gene locus_tag LOCUS_21790 2610041 2611045 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_21790 2611052 2611684 gene locus_tag LOCUS_21800 gene gldI 2611052 2611684 CDS product gliding motility-associated peptidyl-prolyl isomerase GldI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963996.1 protein_id gnl|my_center|LOCUS_21800 2611699 2612796 gene locus_tag LOCUS_21810 2611699 2612796 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_21810 2612872 2614062 gene locus_tag LOCUS_21820 2612872 2614062 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_21820 2614632 2614195 gene locus_tag LOCUS_21830 2614632 2614195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362012.1 protein_id gnl|my_center|LOCUS_21830 2615066 2615980 gene locus_tag LOCUS_21840 2615066 2615980 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_21840 2616131 2616445 gene locus_tag LOCUS_21850 2616131 2616445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 2616450 2616800 gene locus_tag LOCUS_21860 2616450 2616800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 2616775 2616954 gene locus_tag LOCUS_21870 2616775 2616954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 2616996 2617796 gene locus_tag LOCUS_21880 2616996 2617796 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681658.1 protein_id gnl|my_center|LOCUS_21880 2618005 2618232 gene locus_tag LOCUS_21890 2618005 2618232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2618225 2618680 gene locus_tag LOCUS_21900 2618225 2618680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2620070 2619156 gene locus_tag LOCUS_21910 2620070 2619156 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184594.1 protein_id gnl|my_center|LOCUS_21910 2621138 2620101 gene locus_tag LOCUS_21920 2621138 2620101 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_21920 2621479 2622912 gene locus_tag LOCUS_21930 gene pelB 2621479 2622912 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_21930 2623096 2623938 gene locus_tag LOCUS_21940 2623096 2623938 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_21940 2623980 2625152 gene locus_tag LOCUS_21950 2623980 2625152 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_21950 2625180 2626415 gene locus_tag LOCUS_21960 2625180 2626415 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_21960 2626424 2628055 gene locus_tag LOCUS_21970 2626424 2628055 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_21970 2628066 2629151 gene locus_tag LOCUS_21980 gene pelA 2628066 2629151 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764019.1 protein_id gnl|my_center|LOCUS_21980 2629454 2630095 gene locus_tag LOCUS_21990 2629454 2630095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2630163 2631467 gene locus_tag LOCUS_22000 gene pelB 2630163 2631467 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_22000 2631495 2632229 gene locus_tag LOCUS_22010 2631495 2632229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2632261 2633280 gene locus_tag LOCUS_22020 gene fbp 2632261 2633280 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962470.1 protein_id gnl|my_center|LOCUS_22020 2633429 2634616 gene locus_tag LOCUS_22030 2633429 2634616 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_22030 2635757 2634729 gene locus_tag LOCUS_22040 2635757 2634729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2636440 2636724 gene locus_tag LOCUS_22050 2636440 2636724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 2636812 2638425 gene locus_tag LOCUS_22060 2636812 2638425 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 protein_id gnl|my_center|LOCUS_22060 2638438 2639121 gene locus_tag LOCUS_22070 2638438 2639121 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_22070 2640100 2639246 gene locus_tag LOCUS_22080 2640100 2639246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 2640444 2640605 gene locus_tag LOCUS_22090 2640444 2640605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2640711 2642381 gene locus_tag LOCUS_22100 2640711 2642381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 2642395 2643063 gene locus_tag LOCUS_22110 2642395 2643063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2643461 2643766 gene locus_tag LOCUS_22120 2643461 2643766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2643778 2643972 gene locus_tag LOCUS_22130 2643778 2643972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2644293 2644817 gene locus_tag LOCUS_22140 2644293 2644817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2644814 2646049 gene locus_tag LOCUS_22150 2644814 2646049 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_22150 2646042 2647574 gene locus_tag LOCUS_22160 2646042 2647574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2647574 2649310 gene locus_tag LOCUS_22170 2647574 2649310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 2649313 2649825 gene locus_tag LOCUS_22180 2649313 2649825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 2649893 2650300 gene locus_tag LOCUS_22190 2649893 2650300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2650416 2650937 gene locus_tag LOCUS_22200 2650416 2650937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2650930 2651616 gene locus_tag LOCUS_22210 2650930 2651616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015462938.1 protein_id gnl|my_center|LOCUS_22210 2651616 2652419 gene locus_tag LOCUS_22220 2651616 2652419 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903695.1 protein_id gnl|my_center|LOCUS_22220 2653653 2652469 gene locus_tag LOCUS_22230 2653653 2652469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_22230 2655509 2653968 gene locus_tag LOCUS_22240 gene dnaB 2655509 2653968 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_22240 2656603 2655650 gene locus_tag LOCUS_22250 2656603 2655650 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_22250 2657605 2656721 gene locus_tag LOCUS_22260 2657605 2656721 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_22260 2658680 2657592 gene locus_tag LOCUS_22270 2658680 2657592 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_22270 2659914 2658784 gene locus_tag LOCUS_22280 gene tgt 2659914 2658784 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_22280 2660156 2661064 gene locus_tag LOCUS_22290 gene cas1 2660156 2661064 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_22290 2661064 2661369 gene locus_tag LOCUS_22300 gene cas2 2661064 2661369 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_22300 2661476 2664937 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatatcgtgttttctaatctttaatcaaaccacaac 2665307 2665032 gene locus_tag LOCUS_22310 2665307 2665032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2665539 2665300 gene locus_tag LOCUS_22320 2665539 2665300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2668971 2665588 gene locus_tag LOCUS_22330 2668971 2665588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2669501 2670814 gene locus_tag LOCUS_22340 2669501 2670814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2670780 2671211 gene locus_tag LOCUS_22350 2670780 2671211 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_22350 2672814 2671246 gene locus_tag LOCUS_22360 2672814 2671246 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_22360 2672975 2673235 gene locus_tag LOCUS_22370 2672975 2673235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_22370 2675502 2673307 gene locus_tag LOCUS_22380 gene recQ 2675502 2673307 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_22380 2675589 2676554 gene locus_tag LOCUS_22390 2675589 2676554 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_22390 2676554 2677375 gene locus_tag LOCUS_22400 gene tatC 2676554 2677375 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_22400 2677433 2678173 gene locus_tag LOCUS_22410 gene lptB 2677433 2678173 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_22410 2678224 2678466 gene locus_tag LOCUS_22420 2678224 2678466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2679180 2678467 gene locus_tag LOCUS_22430 2679180 2678467 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963370.1 protein_id gnl|my_center|LOCUS_22430 2680049 2679330 gene locus_tag LOCUS_22440 2680049 2679330 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_22440 2680326 2681312 gene locus_tag LOCUS_22450 2680326 2681312 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_22450 2681326 2682459 gene locus_tag LOCUS_22460 2681326 2682459 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963373.1 protein_id gnl|my_center|LOCUS_22460 2683854 2682460 gene locus_tag LOCUS_22470 2683854 2682460 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_22470 2685406 2684054 gene locus_tag LOCUS_22480 2685406 2684054 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 protein_id gnl|my_center|LOCUS_22480 2686482 2685403 gene locus_tag LOCUS_22490 2686482 2685403 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963378.1 protein_id gnl|my_center|LOCUS_22490 2687597 2686479 gene locus_tag LOCUS_22500 2687597 2686479 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963379.1 protein_id gnl|my_center|LOCUS_22500 2687844 2688608 gene locus_tag LOCUS_22510 2687844 2688608 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_22510 2688614 2689516 gene locus_tag LOCUS_22520 2688614 2689516 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_22520 2689552 2690076 gene locus_tag LOCUS_22530 2689552 2690076 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_22530 2690136 2690831 gene locus_tag LOCUS_22540 gene dapB 2690136 2690831 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_22540 2690963 2692522 gene locus_tag LOCUS_22550 gene lepB 2690963 2692522 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_22550 2692609 2693232 gene locus_tag LOCUS_22560 2692609 2693232 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_22560 2694061 2693240 gene locus_tag LOCUS_22570 2694061 2693240 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_22570 2695289 2694420 gene locus_tag LOCUS_22580 2695289 2694420 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_22580 2696627 2695365 gene locus_tag LOCUS_22590 2696627 2695365 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_22590 2696876 2697679 gene locus_tag LOCUS_22600 2696876 2697679 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_22600 2697866 2699377 gene locus_tag LOCUS_22610 2697866 2699377 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194399.1 protein_id gnl|my_center|LOCUS_22610 2699398 2700060 gene locus_tag LOCUS_22620 2699398 2700060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 2701122 2700175 gene locus_tag LOCUS_22630 2701122 2700175 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316074.1 protein_id gnl|my_center|LOCUS_22630 2701885 2701163 gene locus_tag LOCUS_22640 2701885 2701163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2703353 2701965 gene locus_tag LOCUS_22650 2703353 2701965 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765564.1 protein_id gnl|my_center|LOCUS_22650 2704030 2703356 gene locus_tag LOCUS_22660 2704030 2703356 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660145.1 protein_id gnl|my_center|LOCUS_22660 2704475 2705050 gene locus_tag LOCUS_22670 2704475 2705050 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963926.1 protein_id gnl|my_center|LOCUS_22670 2705225 2707147 gene locus_tag LOCUS_22680 2705225 2707147 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_22680 2707289 2708056 gene locus_tag LOCUS_22690 2707289 2708056 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_22690 2708334 2709170 gene locus_tag LOCUS_22700 2708334 2709170 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963585.1 protein_id gnl|my_center|LOCUS_22700 2710077 2709220 gene locus_tag LOCUS_22710 2710077 2709220 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962471.1 protein_id gnl|my_center|LOCUS_22710 2710256 2710882 gene locus_tag LOCUS_22720 2710256 2710882 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962669.1 protein_id gnl|my_center|LOCUS_22720 2710872 2712197 gene locus_tag LOCUS_22730 2710872 2712197 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962668.1 protein_id gnl|my_center|LOCUS_22730 2712206 2713285 gene locus_tag LOCUS_22740 2712206 2713285 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962667.1 protein_id gnl|my_center|LOCUS_22740 2713389 2714978 gene locus_tag LOCUS_22750 2713389 2714978 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962666.1 protein_id gnl|my_center|LOCUS_22750 2715811 2715053 gene locus_tag LOCUS_22760 gene yaaA 2715811 2715053 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962877.1 protein_id gnl|my_center|LOCUS_22760 2716071 2717300 gene locus_tag LOCUS_22770 2716071 2717300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2718451 2717411 gene locus_tag LOCUS_22780 2718451 2717411 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_22780 2719064 2718441 gene locus_tag LOCUS_22790 2719064 2718441 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_22790 2719184 2720155 gene locus_tag LOCUS_22800 2719184 2720155 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962814.1 protein_id gnl|my_center|LOCUS_22800 2720302 2720874 gene locus_tag LOCUS_22810 2720302 2720874 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530981.1 protein_id gnl|my_center|LOCUS_22810 2720877 2721338 gene locus_tag LOCUS_22820 gene coaD 2720877 2721338 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_22820 2721398 2721964 gene locus_tag LOCUS_22830 2721398 2721964 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_22830 2723749 2722217 gene locus_tag LOCUS_22840 2723749 2722217 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461421.1 protein_id gnl|my_center|LOCUS_22840 2725136 2723790 gene locus_tag LOCUS_22850 2725136 2723790 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_22850 2725854 2725252 gene locus_tag LOCUS_22860 2725854 2725252 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_22860 2725862 2726509 gene locus_tag LOCUS_22870 gene pyrE 2725862 2726509 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962823.1 protein_id gnl|my_center|LOCUS_22870 2726560 2726952 gene locus_tag LOCUS_22880 2726560 2726952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_22880 2727737 2727009 gene locus_tag LOCUS_22890 2727737 2727009 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_22890 2727835 2728206 gene locus_tag LOCUS_22900 gene rsfS 2727835 2728206 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_22900 2728221 2730140 gene locus_tag LOCUS_22910 gene ftsH 2728221 2730140 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_22910 2730252 2730854 gene locus_tag LOCUS_22920 2730252 2730854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_22920 2730856 2731746 gene locus_tag LOCUS_22930 2730856 2731746 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_22930 2731736 2732389 gene locus_tag LOCUS_22940 2731736 2732389 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_22940 2732389 2732658 gene locus_tag LOCUS_22950 2732389 2732658 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962768.1 protein_id gnl|my_center|LOCUS_22950 2732669 2733442 gene locus_tag LOCUS_22960 2732669 2733442 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962769.1 protein_id gnl|my_center|LOCUS_22960 2733641 2735206 gene locus_tag LOCUS_22970 2733641 2735206 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_22970 2735412 2736590 gene locus_tag LOCUS_22980 2735412 2736590 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_22980 2736725 2738119 gene locus_tag LOCUS_22990 2736725 2738119 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_22990 2738214 2738966 gene locus_tag LOCUS_23000 2738214 2738966 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_23000 2739179 2739616 gene locus_tag LOCUS_23010 2739179 2739616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 2740271 2739666 gene locus_tag LOCUS_23020 2740271 2739666 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_23020 2740685 2740362 gene locus_tag LOCUS_23030 2740685 2740362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 2742473 2740938 gene locus_tag LOCUS_23040 2742473 2740938 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_23040 2743502 2742519 gene locus_tag LOCUS_23050 2743502 2742519 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_23050 2743696 2744709 gene locus_tag LOCUS_23060 2743696 2744709 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_23060 2745012 2746337 gene locus_tag LOCUS_23070 2745012 2746337 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_23070 2748659 2746449 gene locus_tag LOCUS_23080 2748659 2746449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202476.1 protein_id gnl|my_center|LOCUS_23080 2748819 2749700 gene locus_tag LOCUS_23090 2748819 2749700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 2750725 2750138 gene locus_tag LOCUS_23100 2750725 2750138 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922085.1 protein_id gnl|my_center|LOCUS_23100 2752118 2750718 gene locus_tag LOCUS_23110 2752118 2750718 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_23110 2753414 2752158 gene locus_tag LOCUS_23120 2753414 2752158 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_23120 2753314 2753535 gene locus_tag LOCUS_23130 2753314 2753535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 2754320 2753577 gene locus_tag LOCUS_23140 2754320 2753577 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_23140 2755835 2754480 gene locus_tag LOCUS_23150 2755835 2754480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 2757270 2755996 gene locus_tag LOCUS_23160 gene rhaI 2757270 2755996 CDS product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 protein_id gnl|my_center|LOCUS_23160 2759664 2757523 gene locus_tag LOCUS_23170 2759664 2757523 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327307.1 protein_id gnl|my_center|LOCUS_23170 2760746 2759697 gene locus_tag LOCUS_23180 gene rhaT 2760746 2759697 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_23180 2761437 2762477 gene locus_tag LOCUS_23190 2761437 2762477 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_23190 2763484 2762630 gene locus_tag LOCUS_23200 2763484 2762630 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_23200 2764278 2763514 gene locus_tag LOCUS_23210 2764278 2763514 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_23210 2765349 2764417 gene locus_tag LOCUS_23220 2765349 2764417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2766927 2765446 gene locus_tag LOCUS_23230 2766927 2765446 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_23230 2768604 2767006 gene locus_tag LOCUS_23240 2768604 2767006 CDS product DUF4957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200106318.1 protein_id gnl|my_center|LOCUS_23240 2770442 2768634 gene locus_tag LOCUS_23250 2770442 2768634 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_23250 2773851 2770489 gene locus_tag LOCUS_23260 2773851 2770489 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_23260 2775784 2774414 gene locus_tag LOCUS_23270 2775784 2774414 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767667.1 protein_id gnl|my_center|LOCUS_23270 2778206 2775795 gene locus_tag LOCUS_23280 2778206 2775795 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767247.1 protein_id gnl|my_center|LOCUS_23280 2779634 2778345 gene locus_tag LOCUS_23290 2779634 2778345 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_23290 2781143 2779710 gene locus_tag LOCUS_23300 2781143 2779710 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767248.1 protein_id gnl|my_center|LOCUS_23300 2782116 2781235 gene locus_tag LOCUS_23310 2782116 2781235 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_23310 2782299 2783645 gene locus_tag LOCUS_23320 2782299 2783645 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_23320 2783792 2787091 gene locus_tag LOCUS_23330 2783792 2787091 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_23330 2787123 2789558 gene locus_tag LOCUS_23340 2787123 2789558 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_23340 2789714 2792062 gene locus_tag LOCUS_23350 2789714 2792062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2792069 2793427 gene locus_tag LOCUS_23360 2792069 2793427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2793477 2795945 gene locus_tag LOCUS_23370 2793477 2795945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2796080 2798389 gene locus_tag LOCUS_23380 2796080 2798389 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767049.1 protein_id gnl|my_center|LOCUS_23380 2798448 2801351 gene locus_tag LOCUS_23390 2798448 2801351 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_23390 2803760 2801424 gene locus_tag LOCUS_23400 2803760 2801424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 2805116 2803776 gene locus_tag LOCUS_23410 2805116 2803776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2806471 2805119 gene locus_tag LOCUS_23420 2806471 2805119 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109152.1 protein_id gnl|my_center|LOCUS_23420 2807600 2806524 gene locus_tag LOCUS_23430 2807600 2806524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2810251 2807819 gene locus_tag LOCUS_23440 gene galB 2810251 2807819 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_23440 2810625 2810296 gene locus_tag LOCUS_23450 gene rhaM 2810625 2810296 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759851.1 protein_id gnl|my_center|LOCUS_23450 2814517 2810846 gene locus_tag LOCUS_23460 2814517 2810846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2816406 2814892 gene locus_tag LOCUS_23470 2816406 2814892 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_23470 2818932 2816557 gene locus_tag LOCUS_23480 2818932 2816557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 2819206 2820447 gene locus_tag LOCUS_23490 gene pepT 2819206 2820447 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964023.1 protein_id gnl|my_center|LOCUS_23490 2820904 2821380 gene locus_tag LOCUS_23500 2820904 2821380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2822407 2821454 gene locus_tag LOCUS_23510 2822407 2821454 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_23510 2822977 2822588 gene locus_tag LOCUS_23520 2822977 2822588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2824152 2823199 gene locus_tag LOCUS_23530 2824152 2823199 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963218.1 protein_id gnl|my_center|LOCUS_23530 2825058 2824243 gene locus_tag LOCUS_23540 2825058 2824243 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478981.1 protein_id gnl|my_center|LOCUS_23540 2826282 2825332 gene locus_tag LOCUS_23550 2826282 2825332 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_23550 2826389 2827216 gene locus_tag LOCUS_23560 2826389 2827216 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_23560 2827278 2827754 gene locus_tag LOCUS_23570 2827278 2827754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 2827836 2828561 gene locus_tag LOCUS_23580 gene gldF 2827836 2828561 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_23580 2828561 2830246 gene locus_tag LOCUS_23590 gene gldG 2828561 2830246 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_23590 2830341 2831459 gene locus_tag LOCUS_23600 gene dnaN 2830341 2831459 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_23600 2831718 2832347 gene locus_tag LOCUS_23610 2831718 2832347 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_23610 2834201 2832624 gene locus_tag LOCUS_23620 2834201 2832624 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_23620 2835495 2834623 gene locus_tag LOCUS_23630 2835495 2834623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2835752 2837152 gene locus_tag LOCUS_23640 gene mnmE 2835752 2837152 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_23640 2837945 2839087 gene locus_tag LOCUS_23650 2837945 2839087 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361999.1 protein_id gnl|my_center|LOCUS_23650 2839253 2839591 gene locus_tag LOCUS_23660 2839253 2839591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2839794 2840522 gene locus_tag LOCUS_23670 2839794 2840522 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485360.1 protein_id gnl|my_center|LOCUS_23670 2840522 2841505 gene locus_tag LOCUS_23680 2840522 2841505 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202383.1 protein_id gnl|my_center|LOCUS_23680 2842812 2841634 gene locus_tag LOCUS_23690 2842812 2841634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2843798 2842809 gene locus_tag LOCUS_23700 gene yejK 2843798 2842809 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419943.1 protein_id gnl|my_center|LOCUS_23700 2844454 2844140 gene locus_tag LOCUS_23710 2844454 2844140 CDS product DUF3892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091022.1 protein_id gnl|my_center|LOCUS_23710 2846743 2844812 gene locus_tag LOCUS_23720 2846743 2844812 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204822.1 protein_id gnl|my_center|LOCUS_23720 2847251 2846730 gene locus_tag LOCUS_23730 2847251 2846730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975389.1 protein_id gnl|my_center|LOCUS_23730 2847810 2847238 gene locus_tag LOCUS_23740 2847810 2847238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2848172 2847813 gene locus_tag LOCUS_23750 2848172 2847813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2848725 2848540 gene locus_tag LOCUS_23760 2848725 2848540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2849464 2849865 gene locus_tag LOCUS_23770 2849464 2849865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 2849893 2850180 gene locus_tag LOCUS_23780 2849893 2850180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 2850167 2851480 gene locus_tag LOCUS_23790 gene traM 2850167 2851480 CDS product conjugative transposon protein TraM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108206.1 protein_id gnl|my_center|LOCUS_23790 2851515 2851871 gene locus_tag LOCUS_23800 2851515 2851871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23800 2851868 2852416 gene locus_tag LOCUS_23810 2851868 2852416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23810 2853897 2853091 gene locus_tag LOCUS_23820 2853897 2853091 CDS product PRTRC system ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108426.1 protein_id gnl|my_center|LOCUS_23820 2854607 2853897 gene locus_tag LOCUS_23830 2854607 2853897 CDS product prokaryotic E2 ligase family D protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108425.1 protein_id gnl|my_center|LOCUS_23830 2855777 2854620 gene locus_tag LOCUS_23840 2855777 2854620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2856016 2855798 gene locus_tag LOCUS_23850 2856016 2855798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2856571 2856035 gene locus_tag LOCUS_23860 2856571 2856035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 2856814 2856596 gene locus_tag LOCUS_23870 2856814 2856596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2857868 2856795 gene locus_tag LOCUS_23880 2857868 2856795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2858305 2857913 gene locus_tag LOCUS_23890 gene ssb 2858305 2857913 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905690.1 protein_id gnl|my_center|LOCUS_23890 2859672 2859202 gene locus_tag LOCUS_23900 2859672 2859202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2863964 2859675 gene locus_tag LOCUS_23910 2863964 2859675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2867584 2864060 gene locus_tag LOCUS_23920 2867584 2864060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2868604 2867654 gene locus_tag LOCUS_23930 2868604 2867654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2870289 2869153 gene locus_tag LOCUS_23940 2870289 2869153 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964406.1 protein_id gnl|my_center|LOCUS_23940 2870752 2870279 gene locus_tag LOCUS_23950 2870752 2870279 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964405.1 protein_id gnl|my_center|LOCUS_23950 2871077 2870739 gene locus_tag LOCUS_23960 2871077 2870739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964404.1 protein_id gnl|my_center|LOCUS_23960 2872348 2871065 gene locus_tag LOCUS_23970 2872348 2871065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964403.1 protein_id gnl|my_center|LOCUS_23970 2872767 2872345 gene locus_tag LOCUS_23980 2872767 2872345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964402.1 protein_id gnl|my_center|LOCUS_23980 2873691 2872831 gene locus_tag LOCUS_23990 2873691 2872831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964401.1 protein_id gnl|my_center|LOCUS_23990 2874542 2873805 gene locus_tag LOCUS_24000 2874542 2873805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964400.1 protein_id gnl|my_center|LOCUS_24000 2875330 2874914 gene locus_tag LOCUS_24010 2875330 2874914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2879801 2875506 gene locus_tag LOCUS_24020 2879801 2875506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2883283 2879813 gene locus_tag LOCUS_24030 2883283 2879813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 2883759 2884199 gene locus_tag LOCUS_24040 2883759 2884199 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964391.1 protein_id gnl|my_center|LOCUS_24040 2884684 2886087 gene locus_tag LOCUS_24050 2884684 2886087 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964389.1 protein_id gnl|my_center|LOCUS_24050 2886123 2888357 gene locus_tag LOCUS_24060 2886123 2888357 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964388.1 protein_id gnl|my_center|LOCUS_24060 2888357 2889553 gene locus_tag LOCUS_24070 2888357 2889553 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964387.1 protein_id gnl|my_center|LOCUS_24070 2889555 2890079 gene locus_tag LOCUS_24080 2889555 2890079 CDS product general secretion pathway protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964386.1 protein_id gnl|my_center|LOCUS_24080 2892025 2890109 gene locus_tag LOCUS_24090 2892025 2890109 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679307.1 protein_id gnl|my_center|LOCUS_24090 2893904 2892018 gene locus_tag LOCUS_24100 2893904 2892018 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679308.1 protein_id gnl|my_center|LOCUS_24100 2894941 2894075 gene locus_tag LOCUS_24110 2894941 2894075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207842.1 protein_id gnl|my_center|LOCUS_24110 2895717 2894938 gene locus_tag LOCUS_24120 2895717 2894938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2895819 2896328 gene locus_tag LOCUS_24130 2895819 2896328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2897098 2896349 gene locus_tag LOCUS_24140 2897098 2896349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 2898485 2897286 gene locus_tag LOCUS_24150 2898485 2897286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2899175 2898837 gene locus_tag LOCUS_24160 2899175 2898837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24160 2899775 2899584 gene locus_tag LOCUS_24170 2899775 2899584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2899955 2899788 gene locus_tag LOCUS_24180 2899955 2899788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2900367 2899966 gene locus_tag LOCUS_24190 2900367 2899966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2903183 2900379 gene locus_tag LOCUS_24200 2903183 2900379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2906540 2904948 gene locus_tag LOCUS_24210 2906540 2904948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2908465 2906570 gene locus_tag LOCUS_24220 2908465 2906570 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_24220 2911964 2908602 gene locus_tag LOCUS_24230 2911964 2908602 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_24230 2914087 2912510 gene locus_tag LOCUS_24240 2914087 2912510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2916235 2914142 gene locus_tag LOCUS_24250 gene rhgW 2916235 2914142 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_24250 2919008 2916477 gene locus_tag LOCUS_24260 2919008 2916477 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_24260 2922244 2919164 gene locus_tag LOCUS_24270 2922244 2919164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 2923412 2922375 gene locus_tag LOCUS_24280 2923412 2922375 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_24280 2925917 2923440 gene locus_tag LOCUS_24290 2925917 2923440 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_24290 2926410 2930738 gene locus_tag LOCUS_24300 2926410 2930738 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109105.1 protein_id gnl|my_center|LOCUS_24300 2930792 2931589 gene locus_tag LOCUS_24310 2930792 2931589 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_24310 2932199 2932522 gene locus_tag LOCUS_24320 2932199 2932522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2932796 2933155 gene locus_tag LOCUS_24330 2932796 2933155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2933244 2933978 gene locus_tag LOCUS_24340 2933244 2933978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2934193 2937600 gene locus_tag LOCUS_24350 2934193 2937600 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266501.1 protein_id gnl|my_center|LOCUS_24350 2937775 2940366 gene locus_tag LOCUS_24360 2937775 2940366 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266502.1 protein_id gnl|my_center|LOCUS_24360 2940356 2941225 gene locus_tag LOCUS_24370 2940356 2941225 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112287.1 protein_id gnl|my_center|LOCUS_24370 2941351 2942265 gene locus_tag LOCUS_24380 2941351 2942265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2943767 2942310 gene locus_tag LOCUS_24390 2943767 2942310 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_24390 2945018 2943900 gene locus_tag LOCUS_24400 2945018 2943900 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_24400 2945413 2945105 gene locus_tag LOCUS_24410 2945413 2945105 CDS product YchJ family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963077.1 protein_id gnl|my_center|LOCUS_24410 2945708 2945481 gene locus_tag LOCUS_24420 2945708 2945481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 2945864 2945712 gene locus_tag LOCUS_24430 2945864 2945712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963202.1 protein_id gnl|my_center|LOCUS_24430 2946406 2945864 gene locus_tag LOCUS_24440 2946406 2945864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963203.1 protein_id gnl|my_center|LOCUS_24440 2946498 2946743 gene locus_tag LOCUS_24450 2946498 2946743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963201.1 protein_id gnl|my_center|LOCUS_24450 2946878 2947318 gene locus_tag LOCUS_24460 2946878 2947318 CDS product KTSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_24460 2947456 2947695 gene locus_tag LOCUS_24470 2947456 2947695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2947898 2948674 gene locus_tag LOCUS_24480 2947898 2948674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2948720 2949079 gene locus_tag LOCUS_24490 2948720 2949079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2949251 2949332 gene locus_tag LOCUS_t00290 2949251 2949332 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2950078 2949389 gene locus_tag LOCUS_24500 2950078 2949389 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963019.1 protein_id gnl|my_center|LOCUS_24500 2950772 2950134 gene locus_tag LOCUS_24510 2950772 2950134 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_24510 2950938 2951756 gene locus_tag LOCUS_24520 2950938 2951756 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_24520 2952068 2952463 gene locus_tag LOCUS_24530 2952068 2952463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2954761 2952521 gene locus_tag LOCUS_24540 2954761 2952521 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_24540 2955467 2954943 gene locus_tag LOCUS_24550 2955467 2954943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2957100 2955754 gene locus_tag LOCUS_24560 gene purB 2957100 2955754 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_24560 2957886 2957194 gene locus_tag LOCUS_24570 2957886 2957194 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_24570 2958040 2958699 gene locus_tag LOCUS_24580 2958040 2958699 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_24580 2960343 2958763 gene locus_tag LOCUS_24590 2960343 2958763 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_24590 2960720 2960415 gene locus_tag LOCUS_24600 2960720 2960415 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_24600 2961082 2961540 gene locus_tag LOCUS_24610 2961082 2961540 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_24610 2961561 2962193 gene locus_tag LOCUS_24620 2961561 2962193 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_24620 2962224 2962787 gene locus_tag LOCUS_24630 2962224 2962787 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_24630 2963089 2964489 gene locus_tag LOCUS_24640 2963089 2964489 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_24640 2964590 2965156 gene locus_tag LOCUS_24650 2964590 2965156 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_24650 2965205 2966197 gene locus_tag LOCUS_24660 gene trpD 2965205 2966197 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962675.1 protein_id gnl|my_center|LOCUS_24660 2966201 2966983 gene locus_tag LOCUS_24670 gene trpC 2966201 2966983 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962674.1 protein_id gnl|my_center|LOCUS_24670 2967094 2968908 gene locus_tag LOCUS_24680 2967094 2968908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 2969008 2969322 gene locus_tag LOCUS_24690 2969008 2969322 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444506.1 protein_id gnl|my_center|LOCUS_24690 2969412 2970173 gene locus_tag LOCUS_24700 gene trpA 2969412 2970173 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_24700 2970427 2971365 gene locus_tag LOCUS_24710 2970427 2971365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 2971472 2972104 gene locus_tag LOCUS_24720 2971472 2972104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2972724 2972170 gene locus_tag LOCUS_24730 2972724 2972170 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 protein_id gnl|my_center|LOCUS_24730 2972930 2973799 gene locus_tag LOCUS_24740 gene lipA 2972930 2973799 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_24740 2973874 2974866 gene locus_tag LOCUS_24750 gene gap 2973874 2974866 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_24750 2974909 2977086 gene locus_tag LOCUS_24760 2974909 2977086 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_24760 2978156 2977110 gene locus_tag LOCUS_24770 gene lpxK 2978156 2977110 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963591.1 protein_id gnl|my_center|LOCUS_24770 2978437 2978156 gene locus_tag LOCUS_24780 2978437 2978156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2978661 2978413 gene locus_tag LOCUS_24790 2978661 2978413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2978761 2979855 gene locus_tag LOCUS_24800 2978761 2979855 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963351.1 protein_id gnl|my_center|LOCUS_24800 2979866 2980645 gene locus_tag LOCUS_24810 2979866 2980645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_24810 2980747 2981604 gene locus_tag LOCUS_24820 2980747 2981604 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_24820 2981638 2982456 gene locus_tag LOCUS_24830 gene rluF 2981638 2982456 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_24830 2985422 2982699 gene locus_tag LOCUS_24840 2985422 2982699 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_24840 2986239 2985544 gene locus_tag LOCUS_24850 2986239 2985544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2986603 2986226 gene locus_tag LOCUS_24860 2986603 2986226 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_24860 2987447 2986605 gene locus_tag LOCUS_24870 2987447 2986605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 2988273 2987437 gene locus_tag LOCUS_24880 2988273 2987437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107699.1 protein_id gnl|my_center|LOCUS_24880 2988747 2989790 gene locus_tag LOCUS_24890 2988747 2989790 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_24890 2991090 2989852 gene locus_tag LOCUS_24900 2991090 2989852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 2991582 2991289 gene locus_tag LOCUS_24910 2991582 2991289 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_24910 2992207 2991593 gene locus_tag LOCUS_24920 2992207 2991593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303162.1 protein_id gnl|my_center|LOCUS_24920 2993299 2992373 gene locus_tag LOCUS_24930 2993299 2992373 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_24930 2994406 2993525 gene locus_tag LOCUS_24940 2994406 2993525 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963593.1 protein_id gnl|my_center|LOCUS_24940 2995874 2994513 gene locus_tag LOCUS_24950 gene ffh 2995874 2994513 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_24950 2997060 2996029 gene locus_tag LOCUS_24960 2997060 2996029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 2997241 2997756 gene locus_tag LOCUS_24970 2997241 2997756 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_24970 2997812 2998711 gene locus_tag LOCUS_24980 2997812 2998711 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_24980 2998712 3001246 gene locus_tag LOCUS_24990 2998712 3001246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 3001366 3001755 gene locus_tag LOCUS_25000 3001366 3001755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 3001748 3002629 gene locus_tag LOCUS_25010 3001748 3002629 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_25010 3002658 3003005 gene locus_tag LOCUS_25020 3002658 3003005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 3003025 3003570 gene locus_tag LOCUS_25030 3003025 3003570 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577498.1 protein_id gnl|my_center|LOCUS_25030 3003581 3004096 gene locus_tag LOCUS_25040 3003581 3004096 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963598.1 protein_id gnl|my_center|LOCUS_25040 3004104 3004883 gene locus_tag LOCUS_25050 3004104 3004883 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963597.1 protein_id gnl|my_center|LOCUS_25050 3005426 3005704 gene locus_tag LOCUS_25060 3005426 3005704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963615.1 protein_id gnl|my_center|LOCUS_25060 3007617 3005809 gene locus_tag LOCUS_25070 gene argS 3007617 3005809 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963616.1 protein_id gnl|my_center|LOCUS_25070 3008718 3007711 gene locus_tag LOCUS_25080 3008718 3007711 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_25080 3008817 3009770 gene locus_tag LOCUS_25090 3008817 3009770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 3010094 3009810 gene locus_tag LOCUS_25100 3010094 3009810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3011704 3010235 gene locus_tag LOCUS_25110 3011704 3010235 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292875.1 protein_id gnl|my_center|LOCUS_25110 3013020 3011728 gene locus_tag LOCUS_25120 3013020 3011728 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_25120 3015414 3013069 gene locus_tag LOCUS_25130 3015414 3013069 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_25130 3015900 3015577 gene locus_tag LOCUS_25140 3015900 3015577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963907.1 protein_id gnl|my_center|LOCUS_25140 3015983 3016933 gene locus_tag LOCUS_25150 3015983 3016933 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_25150 3016939 3018057 gene locus_tag LOCUS_25160 3016939 3018057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_25160 3018917 3018159 gene locus_tag LOCUS_25170 3018917 3018159 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_25170 3020788 3018914 gene locus_tag LOCUS_25180 gene mutL 3020788 3018914 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_25180 3021738 3021169 gene locus_tag LOCUS_25190 gene ribH 3021738 3021169 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964104.1 protein_id gnl|my_center|LOCUS_25190 3022603 3021821 gene locus_tag LOCUS_25200 3022603 3021821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_25200 3022748 3023827 gene locus_tag LOCUS_25210 gene recF 3022748 3023827 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_25210 3023846 3024520 gene locus_tag LOCUS_25220 3023846 3024520 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964100.1 protein_id gnl|my_center|LOCUS_25220 3024531 3025598 gene locus_tag LOCUS_25230 3024531 3025598 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964099.1 protein_id gnl|my_center|LOCUS_25230 3025601 3027448 gene locus_tag LOCUS_25240 gene asnB 3025601 3027448 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964098.1 protein_id gnl|my_center|LOCUS_25240 3027500 3028180 gene locus_tag LOCUS_25250 3027500 3028180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 3028292 3029305 gene locus_tag LOCUS_25260 gene murB 3028292 3029305 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_25260 3029339 3029842 gene locus_tag LOCUS_25270 3029339 3029842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 3030008 3031114 gene locus_tag LOCUS_25280 3030008 3031114 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_25280 3031105 3031656 gene locus_tag LOCUS_25290 3031105 3031656 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_25290 3031879 3032820 gene locus_tag LOCUS_25300 3031879 3032820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 3032839 3035355 gene locus_tag LOCUS_25310 3032839 3035355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 3035506 3036330 gene locus_tag LOCUS_25320 3035506 3036330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 3036509 3036979 gene locus_tag LOCUS_25330 3036509 3036979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 3038604 3037054 gene locus_tag LOCUS_25340 3038604 3037054 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_25340 3038794 3039573 gene locus_tag LOCUS_25350 3038794 3039573 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_25350 3039671 3040357 gene locus_tag LOCUS_25360 3039671 3040357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_25360 3040420 3040989 gene locus_tag LOCUS_25370 3040420 3040989 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_25370 3041153 3041374 gene locus_tag LOCUS_25380 3041153 3041374 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_25380 3041515 3044862 gene locus_tag LOCUS_25390 gene secA 3041515 3044862 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962742.1 protein_id gnl|my_center|LOCUS_25390 3045048 3045386 gene locus_tag LOCUS_25400 3045048 3045386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963894.1 protein_id gnl|my_center|LOCUS_25400 3045493 3046290 gene locus_tag LOCUS_25410 3045493 3046290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_25410 3046467 3047468 gene locus_tag LOCUS_25420 3046467 3047468 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_25420 3047482 3048375 gene locus_tag LOCUS_25430 3047482 3048375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_25430 3048439 3048987 gene locus_tag LOCUS_25440 3048439 3048987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 3050424 3049060 gene locus_tag LOCUS_25450 3050424 3049060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3051105 3050461 gene locus_tag LOCUS_25460 3051105 3050461 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963146.1 protein_id gnl|my_center|LOCUS_25460 3051528 3053978 gene locus_tag LOCUS_25470 gene thrA 3051528 3053978 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_25470 3054037 3054957 gene locus_tag LOCUS_25480 3054037 3054957 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_25480 3054977 3055231 gene locus_tag LOCUS_25490 3054977 3055231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3055321 3055569 gene locus_tag LOCUS_25500 3055321 3055569 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_25500 3055562 3055861 gene locus_tag LOCUS_25510 3055562 3055861 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277486.1 protein_id gnl|my_center|LOCUS_25510 3055940 3057229 gene locus_tag LOCUS_25520 gene thrC 3055940 3057229 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_25520 3057805 3057332 gene locus_tag LOCUS_25530 gene rlmH 3057805 3057332 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_25530 3058085 3059320 gene locus_tag LOCUS_25540 3058085 3059320 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_25540 3061837 3059384 gene locus_tag LOCUS_25550 3061837 3059384 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_25550 3062255 3061914 gene locus_tag LOCUS_25560 gene arsC 3062255 3061914 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_25560 3062354 3063256 gene locus_tag LOCUS_25570 3062354 3063256 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_25570 3063287 3064351 gene locus_tag LOCUS_25580 3063287 3064351 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_25580 3064839 3064417 gene locus_tag LOCUS_25590 3064839 3064417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3066546 3064918 gene locus_tag LOCUS_25600 3066546 3064918 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_25600 3067732 3066737 gene locus_tag LOCUS_25610 gene lpxD 3067732 3066737 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963712.1 protein_id gnl|my_center|LOCUS_25610 3067921 3068826 gene locus_tag LOCUS_25620 3067921 3068826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 3069879 3068893 gene locus_tag LOCUS_25630 gene prfB 3069879 3068893 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_25630 3070076 3071095 gene locus_tag LOCUS_25640 3070076 3071095 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_25640 3071505 3071104 gene locus_tag LOCUS_25650 3071505 3071104 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_25650 3071792 3071505 gene locus_tag LOCUS_25660 3071792 3071505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 3072210 3071800 gene locus_tag LOCUS_25670 3072210 3071800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3072608 3072288 gene locus_tag LOCUS_25680 3072608 3072288 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963031.1 protein_id gnl|my_center|LOCUS_25680 3072749 3074809 gene locus_tag LOCUS_25690 3072749 3074809 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_25690 3074881 3075921 gene locus_tag LOCUS_25700 3074881 3075921 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098105.1 protein_id gnl|my_center|LOCUS_25700 3076795 3076085 gene locus_tag LOCUS_25710 3076795 3076085 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_25710 3077890 3076856 gene locus_tag LOCUS_25720 3077890 3076856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 3079936 3077897 gene locus_tag LOCUS_25730 3079936 3077897 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_25730 3081202 3080120 gene locus_tag LOCUS_25740 gene gcvT 3081202 3080120 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_25740 3082265 3081333 gene locus_tag LOCUS_25750 3082265 3081333 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_25750 3083549 3082269 gene locus_tag LOCUS_25760 3083549 3082269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3084602 3083988 gene locus_tag LOCUS_25770 3084602 3083988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3085428 3084793 gene locus_tag LOCUS_25780 3085428 3084793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3086288 3085425 gene locus_tag LOCUS_25790 gene folP 3086288 3085425 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_25790 3086343 3086885 gene locus_tag LOCUS_25800 3086343 3086885 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_25800 3086951 3088051 gene locus_tag LOCUS_25810 3086951 3088051 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_25810 3088073 3088348 gene locus_tag LOCUS_25820 3088073 3088348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 3088356 3088850 gene locus_tag LOCUS_25830 3088356 3088850 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_25830 3089048 3089800 gene locus_tag LOCUS_25840 gene tpiA 3089048 3089800 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963550.1 protein_id gnl|my_center|LOCUS_25840 3090983 3089856 gene locus_tag LOCUS_25850 3090983 3089856 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_25850 3091058 3092026 gene locus_tag LOCUS_25860 3091058 3092026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963719.1 protein_id gnl|my_center|LOCUS_25860 3092711 3092160 gene locus_tag LOCUS_25870 3092711 3092160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_25870 3092933 3093724 gene locus_tag LOCUS_25880 3092933 3093724 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993515.1 protein_id gnl|my_center|LOCUS_25880 3093724 3094611 gene locus_tag LOCUS_25890 gene cysM 3093724 3094611 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_25890 3095092 3094682 gene locus_tag LOCUS_25900 3095092 3094682 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338337.1 protein_id gnl|my_center|LOCUS_25900 3095529 3096482 gene locus_tag LOCUS_25910 3095529 3096482 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_25910 3096663 3097298 gene locus_tag LOCUS_25920 3096663 3097298 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267339.1 protein_id gnl|my_center|LOCUS_25920 3097315 3098301 gene locus_tag LOCUS_25930 3097315 3098301 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_25930 3098569 3099012 gene locus_tag LOCUS_25940 3098569 3099012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 3100074 3099019 gene locus_tag LOCUS_25950 3100074 3099019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3102161 3100257 gene locus_tag LOCUS_25960 gene yidC 3102161 3100257 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964004.1 protein_id gnl|my_center|LOCUS_25960 3103845 3102232 gene locus_tag LOCUS_25970 3103845 3102232 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_25970 3106398 3104008 gene locus_tag LOCUS_25980 3106398 3104008 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091172195.1 protein_id gnl|my_center|LOCUS_25980 3106737 3107027 gene locus_tag LOCUS_25990 3106737 3107027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3107645 3107073 gene locus_tag LOCUS_26000 3107645 3107073 CDS product DUF4252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_26000 3107750 3109222 gene locus_tag LOCUS_26010 3107750 3109222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 3109502 3111028 gene locus_tag LOCUS_26020 3109502 3111028 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208888955.1 protein_id gnl|my_center|LOCUS_26020 3111187 3111579 gene locus_tag LOCUS_26030 3111187 3111579 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_26030 3111675 3113867 gene locus_tag LOCUS_26040 3111675 3113867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3114112 3115020 gene locus_tag LOCUS_26050 3114112 3115020 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059223299.1 protein_id gnl|my_center|LOCUS_26050 3116180 3115017 gene locus_tag LOCUS_26060 3116180 3115017 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_26060 3116547 3118832 gene locus_tag LOCUS_26070 3116547 3118832 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964026.1 protein_id gnl|my_center|LOCUS_26070 3121176 3118894 gene locus_tag LOCUS_26080 3121176 3118894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 3122182 3121136 gene locus_tag LOCUS_26090 3122182 3121136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767375.1 protein_id gnl|my_center|LOCUS_26090 3124964 3122331 gene locus_tag LOCUS_26100 3124964 3122331 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963808.1 protein_id gnl|my_center|LOCUS_26100 3125152 3125562 gene locus_tag LOCUS_26110 3125152 3125562 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_26110 3127761 3125635 gene locus_tag LOCUS_26120 3127761 3125635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3128698 3127763 gene locus_tag LOCUS_26130 3128698 3127763 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_26130 3131593 3128726 gene locus_tag LOCUS_26140 3131593 3128726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 3133025 3131715 gene locus_tag LOCUS_26150 3133025 3131715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3133151 3134380 gene locus_tag LOCUS_26160 3133151 3134380 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_26160 3134615 3135286 gene locus_tag LOCUS_26170 gene folE 3134615 3135286 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_26170 3135359 3136840 gene locus_tag LOCUS_26180 gene cysS 3135359 3136840 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962759.1 protein_id gnl|my_center|LOCUS_26180 3136919 3137167 gene locus_tag LOCUS_26190 gene yidD 3136919 3137167 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962760.1 protein_id gnl|my_center|LOCUS_26190 3137229 3138155 gene locus_tag LOCUS_26200 gene lgt 3137229 3138155 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962761.1 protein_id gnl|my_center|LOCUS_26200 3138554 3138234 gene locus_tag LOCUS_26210 3138554 3138234 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_26210 3139018 3138551 gene locus_tag LOCUS_26220 3139018 3138551 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_26220 3140384 3139158 gene locus_tag LOCUS_26230 gene glgA 3140384 3139158 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839391.1 protein_id gnl|my_center|LOCUS_26230 3141636 3140632 gene locus_tag LOCUS_26240 3141636 3140632 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_26240 3141897 3142424 gene locus_tag LOCUS_26250 gene idi 3141897 3142424 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_26250 3142469 3142879 gene locus_tag LOCUS_26260 3142469 3142879 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963898.1 protein_id gnl|my_center|LOCUS_26260 3142879 3143337 gene locus_tag LOCUS_26270 3142879 3143337 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_26270 3143445 3144407 gene locus_tag LOCUS_26280 3143445 3144407 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_26280 3144465 3144734 gene locus_tag LOCUS_26290 3144465 3144734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_26290 3144810 3144884 gene locus_tag LOCUS_t00300 3144810 3144884 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3146297 3145020 gene locus_tag LOCUS_26300 3146297 3145020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 3149944 3146477 gene locus_tag LOCUS_26310 3149944 3146477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 3151361 3150333 gene locus_tag LOCUS_26320 3151361 3150333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3152365 3151364 gene locus_tag LOCUS_26330 3152365 3151364 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963382.1 protein_id gnl|my_center|LOCUS_26330 3153586 3152372 gene locus_tag LOCUS_26340 3153586 3152372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3154404 3153673 gene locus_tag LOCUS_26350 3154404 3153673 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_26350 3155974 3154433 gene locus_tag LOCUS_26360 3155974 3154433 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963383.1 protein_id gnl|my_center|LOCUS_26360 3157150 3155990 gene locus_tag LOCUS_26370 3157150 3155990 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963384.1 protein_id gnl|my_center|LOCUS_26370 3158163 3157147 gene locus_tag LOCUS_26380 3158163 3157147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3159614 3158223 gene locus_tag LOCUS_26390 3159614 3158223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 protein_id gnl|my_center|LOCUS_26390 3160736 3159615 gene locus_tag LOCUS_26400 gene neuC 3160736 3159615 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963387.1 protein_id gnl|my_center|LOCUS_26400 3161778 3160738 gene locus_tag LOCUS_26410 3161778 3160738 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963388.1 protein_id gnl|my_center|LOCUS_26410 3162481 3161807 gene locus_tag LOCUS_26420 3162481 3161807 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963389.1 protein_id gnl|my_center|LOCUS_26420 3163424 3162507 gene locus_tag LOCUS_26430 3163424 3162507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 3164660 3163446 gene locus_tag LOCUS_26440 3164660 3163446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963391.1 protein_id gnl|my_center|LOCUS_26440 3165640 3164696 gene locus_tag LOCUS_26450 3165640 3164696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 3166637 3165642 gene locus_tag LOCUS_26460 3166637 3165642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3167593 3166634 gene locus_tag LOCUS_26470 3167593 3166634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3168485 3167646 gene locus_tag LOCUS_26480 3168485 3167646 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282880.1 protein_id gnl|my_center|LOCUS_26480 3169519 3168482 gene locus_tag LOCUS_26490 3169519 3168482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3170382 3169504 gene locus_tag LOCUS_26500 3170382 3169504 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006843524.1 protein_id gnl|my_center|LOCUS_26500 3171044 3170379 gene locus_tag LOCUS_26510 3171044 3170379 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157798770.1 protein_id gnl|my_center|LOCUS_26510 3171738 3171055 gene locus_tag LOCUS_26520 3171738 3171055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3173058 3171763 gene locus_tag LOCUS_26530 3173058 3171763 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_26530 3174102 3173248 gene locus_tag LOCUS_26540 3174102 3173248 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282880.1 protein_id gnl|my_center|LOCUS_26540 3175109 3174219 gene locus_tag LOCUS_26550 3175109 3174219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 3176106 3175237 gene locus_tag LOCUS_26560 3176106 3175237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_26560 3176289 3177029 gene locus_tag LOCUS_26570 3176289 3177029 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_26570 3178970 3177030 gene locus_tag LOCUS_26580 3178970 3177030 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_26580 3180100 3179231 gene locus_tag LOCUS_26590 gene rfbA 3180100 3179231 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_26590 3181003 3180152 gene locus_tag LOCUS_26600 gene rfbD 3181003 3180152 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_26600 3181551 3181003 gene locus_tag LOCUS_26610 gene rfbC 3181551 3181003 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_26610 3182717 3181569 gene locus_tag LOCUS_26620 3182717 3181569 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 protein_id gnl|my_center|LOCUS_26620 3183706 3182756 gene locus_tag LOCUS_26630 3183706 3182756 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202921.1 protein_id gnl|my_center|LOCUS_26630 3184739 3183840 gene locus_tag LOCUS_26640 3184739 3183840 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202922.1 protein_id gnl|my_center|LOCUS_26640 3185503 3184757 gene locus_tag LOCUS_26650 3185503 3184757 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_26650 3186353 3185652 gene locus_tag LOCUS_26660 3186353 3185652 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_26660 3187620 3186397 gene locus_tag LOCUS_26670 3187620 3186397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 3188815 3187646 gene locus_tag LOCUS_26680 3188815 3187646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 3188817 3189047 gene locus_tag LOCUS_26690 3188817 3189047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3190192 3189122 gene locus_tag LOCUS_26700 3190192 3189122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 3192560 3190206 gene locus_tag LOCUS_26710 3192560 3190206 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694753.1 protein_id gnl|my_center|LOCUS_26710 3193386 3192916 gene locus_tag LOCUS_26720 3193386 3192916 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572205.1 protein_id gnl|my_center|LOCUS_26720 3194514 3193468 gene locus_tag LOCUS_26730 gene rfbB 3194514 3193468 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_26730 3195842 3194559 gene locus_tag LOCUS_26740 3195842 3194559 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_26740 3196886 3195906 gene locus_tag LOCUS_26750 3196886 3195906 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_26750 3199369 3196904 gene locus_tag LOCUS_26760 3199369 3196904 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_26760 3200171 3199383 gene locus_tag LOCUS_26770 3200171 3199383 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 protein_id gnl|my_center|LOCUS_26770 3201082 3200243 gene locus_tag LOCUS_26780 3201082 3200243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3203393 3201006 gene locus_tag LOCUS_26790 3203393 3201006 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_26790 3204201 3203401 gene locus_tag LOCUS_26800 3204201 3203401 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_26800 3205745 3204720 gene locus_tag LOCUS_26810 3205745 3204720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3207095 3206358 gene locus_tag LOCUS_26820 3207095 3206358 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_26820 3208252 3207092 gene locus_tag LOCUS_26830 3208252 3207092 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_26830 3209424 3208273 gene locus_tag LOCUS_26840 3209424 3208273 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203058.1 protein_id gnl|my_center|LOCUS_26840 3210638 3209514 gene locus_tag LOCUS_26850 3210638 3209514 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203057.1 protein_id gnl|my_center|LOCUS_26850 3211332 3210640 gene locus_tag LOCUS_26860 3211332 3210640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3212174 3211335 gene locus_tag LOCUS_26870 3212174 3211335 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_26870 3213389 3212289 gene locus_tag LOCUS_26880 3213389 3212289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3214654 3213386 gene locus_tag LOCUS_26890 3214654 3213386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203009.1 protein_id gnl|my_center|LOCUS_26890 3215337 3214657 gene locus_tag LOCUS_26900 3215337 3214657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3216431 3215349 gene locus_tag LOCUS_26910 3216431 3215349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_26910 3217505 3216504 gene locus_tag LOCUS_26920 3217505 3216504 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_26920 3218511 3217519 gene locus_tag LOCUS_26930 3218511 3217519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3220083 3218557 gene locus_tag LOCUS_26940 3220083 3218557 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_26940 3221288 3220197 gene locus_tag LOCUS_26950 gene gmd 3221288 3220197 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706703.1 protein_id gnl|my_center|LOCUS_26950 3221802 3221410 gene locus_tag LOCUS_26960 3221802 3221410 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963264.1 protein_id gnl|my_center|LOCUS_26960 3222865 3221909 gene locus_tag LOCUS_26970 3222865 3221909 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_26970 3223704 3223339 gene locus_tag LOCUS_26980 3223704 3223339 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_26980 3224815 3223928 gene locus_tag LOCUS_26990 3224815 3223928 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_26990 3225897 3224986 gene locus_tag LOCUS_27000 3225897 3224986 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_27000 3227259 3225976 gene locus_tag LOCUS_27010 3227259 3225976 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_27010 3228700 3227408 gene locus_tag LOCUS_27020 gene eno 3228700 3227408 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963441.1 protein_id gnl|my_center|LOCUS_27020 3229029 3230618 gene locus_tag LOCUS_27030 3229029 3230618 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963308.1 protein_id gnl|my_center|LOCUS_27030 3231693 3230821 gene locus_tag LOCUS_27040 3231693 3230821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 3232334 3231963 gene locus_tag LOCUS_27050 3232334 3231963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 3232788 3232555 gene locus_tag LOCUS_27060 3232788 3232555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 3235071 3232825 gene locus_tag LOCUS_27070 3235071 3232825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 3235628 3235326 gene locus_tag LOCUS_27080 3235628 3235326 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_27080 3240035 3235728 gene locus_tag LOCUS_27090 gene rpoC 3240035 3235728 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963311.1 protein_id gnl|my_center|LOCUS_27090 3244093 3240281 gene locus_tag LOCUS_27100 gene rpoB 3244093 3240281 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963312.1 protein_id gnl|my_center|LOCUS_27100 3244724 3244353 gene locus_tag LOCUS_27110 gene rplL 3244724 3244353 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963313.1 protein_id gnl|my_center|LOCUS_27110 3245318 3244818 gene locus_tag LOCUS_27120 gene rplJ 3245318 3244818 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963314.1 protein_id gnl|my_center|LOCUS_27120 3246030 3245341 gene locus_tag LOCUS_27130 gene rplA 3246030 3245341 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963315.1 protein_id gnl|my_center|LOCUS_27130 3246480 3246034 gene locus_tag LOCUS_27140 gene rplK 3246480 3246034 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_27140 3247096 3246545 gene locus_tag LOCUS_27150 gene nusG 3247096 3246545 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963317.1 protein_id gnl|my_center|LOCUS_27150 3247393 3247320 gene locus_tag LOCUS_t00310 3247393 3247320 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3248635 3247448 gene locus_tag LOCUS_27160 gene tuf 3248635 3247448 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963319.1 protein_id gnl|my_center|LOCUS_27160 3248760 3248688 gene locus_tag LOCUS_t00320 3248760 3248688 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3248927 3248846 gene locus_tag LOCUS_t00330 3248927 3248846 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3249062 3248988 gene locus_tag LOCUS_t00340 3249062 3248988 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3249457 3249155 gene locus_tag LOCUS_27170 gene raiA 3249457 3249155 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_27170 3250386 3249490 gene locus_tag LOCUS_27180 3250386 3249490 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_27180 3250653 3250456 gene locus_tag LOCUS_27190 gene rpsU 3250653 3250456 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_27190 3251989 3250847 gene locus_tag LOCUS_27200 3251989 3250847 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_27200 3252907 3252011 gene locus_tag LOCUS_27210 3252907 3252011 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_27210 3253080 3254717 gene locus_tag LOCUS_27220 3253080 3254717 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_27220 3255004 3254777 gene locus_tag LOCUS_27230 3255004 3254777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_27230 3256326 3255055 gene locus_tag LOCUS_27240 3256326 3255055 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_27240 3256937 3256455 gene locus_tag LOCUS_27250 3256937 3256455 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963327.1 protein_id gnl|my_center|LOCUS_27250 3258861 3257218 gene locus_tag LOCUS_27260 3258861 3257218 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_27260 3261905 3258873 gene locus_tag LOCUS_27270 3261905 3258873 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_27270 3262969 3262571 gene locus_tag LOCUS_27280 3262969 3262571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3265072 3263159 gene locus_tag LOCUS_27290 3265072 3263159 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_27290 3265291 3265950 gene locus_tag LOCUS_27300 3265291 3265950 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963332.1 protein_id gnl|my_center|LOCUS_27300 3266753 3266049 gene locus_tag LOCUS_27310 gene lipB 3266753 3266049 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_27310 3266925 3268625 gene locus_tag LOCUS_27320 gene lysS 3266925 3268625 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963334.1 protein_id gnl|my_center|LOCUS_27320 3268713 3270032 gene locus_tag LOCUS_27330 3268713 3270032 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979161.1 protein_id gnl|my_center|LOCUS_27330 3270029 3270535 gene locus_tag LOCUS_27340 3270029 3270535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3271522 3270536 gene locus_tag LOCUS_27350 gene moaA 3271522 3270536 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_27350 3272447 3271533 gene locus_tag LOCUS_27360 gene moaCB 3272447 3271533 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_27360 3273002 3272556 gene locus_tag LOCUS_27370 3273002 3272556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3274078 3273011 gene locus_tag LOCUS_27380 gene moeB 3274078 3273011 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768795.1 protein_id gnl|my_center|LOCUS_27380 3274507 3274265 gene locus_tag LOCUS_27390 3274507 3274265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 3275070 3274504 gene locus_tag LOCUS_27400 3275070 3274504 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_27400 3275819 3275070 gene locus_tag LOCUS_27410 3275819 3275070 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014858053.1 protein_id gnl|my_center|LOCUS_27410 3276145 3275816 gene locus_tag LOCUS_27420 3276145 3275816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 3276390 3277712 gene locus_tag LOCUS_27430 3276390 3277712 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962461.1 protein_id gnl|my_center|LOCUS_27430 3279501 3278470 gene locus_tag LOCUS_27440 3279501 3278470 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_27440 3280120 3279806 gene locus_tag LOCUS_27450 3280120 3279806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 3281591 3280422 gene locus_tag LOCUS_27460 3281591 3280422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 3283362 3282052 gene locus_tag LOCUS_27470 gene der 3283362 3282052 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_27470 3284345 3283734 gene locus_tag LOCUS_27480 3284345 3283734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 3285334 3284453 gene locus_tag LOCUS_27490 gene era 3285334 3284453 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_27490 3286001 3285501 gene locus_tag LOCUS_27500 3286001 3285501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 3286927 3286484 gene locus_tag LOCUS_27510 3286927 3286484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 3287135 3286947 gene locus_tag LOCUS_27520 3287135 3286947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 3287651 3287244 gene locus_tag LOCUS_27530 3287651 3287244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3288363 3287890 gene locus_tag LOCUS_27540 3288363 3287890 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_27540 3290285 3288615 gene locus_tag LOCUS_27550 3290285 3288615 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_27550 3290867 3290418 gene locus_tag LOCUS_27560 3290867 3290418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 3293509 3290864 gene locus_tag LOCUS_27570 3293509 3290864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3294063 3293530 gene locus_tag LOCUS_27580 3294063 3293530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3294844 3294374 gene locus_tag LOCUS_27590 3294844 3294374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3297123 3295342 gene locus_tag LOCUS_27600 3297123 3295342 CDS product TIGR04141 family sporadically distributed protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183389.1 protein_id gnl|my_center|LOCUS_27600 3297885 3300566 gene locus_tag LOCUS_27610 3297885 3300566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108819.1 protein_id gnl|my_center|LOCUS_27610 3301072 3303192 gene locus_tag LOCUS_27620 3301072 3303192 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_27620 3303215 3304336 gene locus_tag LOCUS_27630 3303215 3304336 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_27630 3304393 3305826 gene locus_tag LOCUS_27640 3304393 3305826 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 protein_id gnl|my_center|LOCUS_27640 3305860 3306882 gene locus_tag LOCUS_27650 3305860 3306882 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_27650 3310226 3307509 gene locus_tag LOCUS_27660 3310226 3307509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3313066 3310541 gene locus_tag LOCUS_27670 3313066 3310541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3315013 3313127 gene locus_tag LOCUS_27680 3315013 3313127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3316258 3315095 gene locus_tag LOCUS_27690 3316258 3315095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3317449 3316364 gene locus_tag LOCUS_27700 3317449 3316364 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_27700 3318851 3317562 gene locus_tag LOCUS_27710 3318851 3317562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 3319810 3318887 gene locus_tag LOCUS_27720 3319810 3318887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3322747 3319868 gene locus_tag LOCUS_27730 3322747 3319868 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_27730 3323681 3322830 gene locus_tag LOCUS_27740 3323681 3322830 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759854.1 protein_id gnl|my_center|LOCUS_27740 3324986 3323751 gene locus_tag LOCUS_27750 3324986 3323751 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640418.1 protein_id gnl|my_center|LOCUS_27750 3327851 3324999 gene locus_tag LOCUS_27760 3327851 3324999 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_27760 3329271 3328111 gene locus_tag LOCUS_27770 3329271 3328111 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 protein_id gnl|my_center|LOCUS_27770 3330627 3329425 gene locus_tag LOCUS_27780 3330627 3329425 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583995.1 protein_id gnl|my_center|LOCUS_27780 3331161 3330793 gene locus_tag LOCUS_27790 3331161 3330793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 3333001 3331232 gene locus_tag LOCUS_27800 3333001 3331232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 3334414 3333026 gene locus_tag LOCUS_27810 3334414 3333026 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_27810 3336299 3334572 gene locus_tag LOCUS_27820 3336299 3334572 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 protein_id gnl|my_center|LOCUS_27820 3337679 3336333 gene locus_tag LOCUS_27830 3337679 3336333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3339617 3337704 gene locus_tag LOCUS_27840 3339617 3337704 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_27840 3341190 3339832 gene locus_tag LOCUS_27850 3341190 3339832 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_27850 3342574 3341237 gene locus_tag LOCUS_27860 3342574 3341237 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890799.1 protein_id gnl|my_center|LOCUS_27860 3345079 3342602 gene locus_tag LOCUS_27870 3345079 3342602 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_27870 3347670 3345076 gene locus_tag LOCUS_27880 3347670 3345076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3349515 3347680 gene locus_tag LOCUS_27890 3349515 3347680 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767036.1 protein_id gnl|my_center|LOCUS_27890 3351987 3349594 gene locus_tag LOCUS_27900 3351987 3349594 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_27900 3354546 3351994 gene locus_tag LOCUS_27910 3354546 3351994 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_27910 3356209 3354638 gene locus_tag LOCUS_27920 3356209 3354638 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_27920 3359428 3356252 gene locus_tag LOCUS_27930 3359428 3356252 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_27930 3360657 3359530 gene locus_tag LOCUS_27940 3360657 3359530 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767181.1 protein_id gnl|my_center|LOCUS_27940 3362794 3360737 gene locus_tag LOCUS_27950 3362794 3360737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3365407 3362942 gene locus_tag LOCUS_27960 3365407 3362942 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_27960 3369892 3365861 gene locus_tag LOCUS_27970 3369892 3365861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3371442 3370387 gene locus_tag LOCUS_27980 3371442 3370387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 3373272 3371467 gene locus_tag LOCUS_27990 3373272 3371467 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764317.1 protein_id gnl|my_center|LOCUS_27990 3376317 3373291 gene locus_tag LOCUS_28000 3376317 3373291 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021929855.1 protein_id gnl|my_center|LOCUS_28000 3378417 3376411 gene locus_tag LOCUS_28010 3378417 3376411 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765813.1 protein_id gnl|my_center|LOCUS_28010 3381599 3378429 gene locus_tag LOCUS_28020 3381599 3378429 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_28020 3383539 3382871 gene locus_tag LOCUS_28030 gene fsa 3383539 3382871 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_28030 3385594 3383558 gene locus_tag LOCUS_28040 3385594 3383558 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_28040 3386683 3386610 gene locus_tag LOCUS_t00350 3386683 3386610 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3387814 3386957 gene locus_tag LOCUS_28050 3387814 3386957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 3388009 3388497 gene locus_tag LOCUS_28060 3388009 3388497 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_28060 3388618 3389766 gene locus_tag LOCUS_28070 3388618 3389766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_28070 3390689 3389820 gene locus_tag LOCUS_28080 3390689 3389820 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_28080 3390752 3391714 gene locus_tag LOCUS_28090 3390752 3391714 CDS product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_28090 3393622 3391709 gene locus_tag LOCUS_28100 3393622 3391709 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_28100 3393685 3394062 gene locus_tag LOCUS_28110 3393685 3394062 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_28110 3396086 3394065 gene locus_tag LOCUS_28120 3396086 3394065 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767024.1 protein_id gnl|my_center|LOCUS_28120 3397169 3396123 gene locus_tag LOCUS_28130 3397169 3396123 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_28130 3398153 3397260 gene locus_tag LOCUS_28140 gene gldN 3398153 3397260 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_28140 3399741 3398200 gene locus_tag LOCUS_28150 gene gldM 3399741 3398200 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_28150 3400423 3399788 gene locus_tag LOCUS_28160 gene gldL 3400423 3399788 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_28160 3401891 3400476 gene locus_tag LOCUS_28170 gene gldK 3401891 3400476 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_28170 3403314 3402163 gene locus_tag LOCUS_28180 3403314 3402163 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_28180 3405837 3403318 gene locus_tag LOCUS_28190 gene topA 3405837 3403318 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964077.1 protein_id gnl|my_center|LOCUS_28190 3406213 3413097 gene locus_tag LOCUS_28200 3406213 3413097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 3413108 3414103 gene locus_tag LOCUS_28210 3413108 3414103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3414559 3416142 gene locus_tag LOCUS_28220 3414559 3416142 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_28220 3416834 3416268 gene locus_tag LOCUS_28230 3416834 3416268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 3417375 3418820 gene locus_tag LOCUS_28240 gene miaB 3417375 3418820 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_28240 3418897 3419268 gene locus_tag LOCUS_28250 3418897 3419268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3419416 3420672 gene locus_tag LOCUS_28260 3419416 3420672 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_28260 3420754 3421257 gene locus_tag LOCUS_28270 3420754 3421257 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_28270 3421327 3422178 gene locus_tag LOCUS_28280 3421327 3422178 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_28280 3422248 3422520 gene locus_tag LOCUS_28290 3422248 3422520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 3422661 3422936 gene locus_tag LOCUS_28300 3422661 3422936 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_28300 3423029 3424657 gene locus_tag LOCUS_28310 gene groL 3423029 3424657 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_28310 3424867 3427224 gene locus_tag LOCUS_28320 3424867 3427224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 3427437 3432509 gene locus_tag LOCUS_28330 3427437 3432509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3432581 3434800 gene locus_tag LOCUS_28340 3432581 3434800 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_28340 3435254 3434880 gene locus_tag LOCUS_28350 3435254 3434880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3436115 3435438 gene locus_tag LOCUS_28360 3436115 3435438 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964128.1 protein_id gnl|my_center|LOCUS_28360 3436621 3436268 gene locus_tag LOCUS_28370 3436621 3436268 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_28370 3438702 3436675 gene locus_tag LOCUS_28380 3438702 3436675 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_28380 3439187 3438771 gene locus_tag LOCUS_28390 3439187 3438771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964134.1 protein_id gnl|my_center|LOCUS_28390 3439625 3439245 gene locus_tag LOCUS_28400 3439625 3439245 CDS product exosortase F system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964135.1 protein_id gnl|my_center|LOCUS_28400 3440163 3439666 gene locus_tag LOCUS_28410 gene xrtF 3440163 3439666 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_28410 3440291 3440746 gene locus_tag LOCUS_28420 3440291 3440746 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_28420 3440878 3441183 gene locus_tag LOCUS_28430 3440878 3441183 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_28430 3441183 3441581 gene locus_tag LOCUS_28440 3441183 3441581 CDS product DUF2452 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_28440 3441631 3442233 gene locus_tag LOCUS_28450 3441631 3442233 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_28450 3442250 3443758 gene locus_tag LOCUS_28460 3442250 3443758 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_28460 3443936 3445471 gene locus_tag LOCUS_28470 3443936 3445471 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503887.1 protein_id gnl|my_center|LOCUS_28470 3445471 3446760 gene locus_tag LOCUS_28480 3445471 3446760 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_28480 3446842 3447282 gene locus_tag LOCUS_28490 3446842 3447282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 3447261 3447806 gene locus_tag LOCUS_28500 3447261 3447806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3447912 3448181 gene locus_tag LOCUS_28510 gene rpsO 3447912 3448181 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964145.1 protein_id gnl|my_center|LOCUS_28510 3448401 3450536 gene locus_tag LOCUS_28520 3448401 3450536 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964146.1 protein_id gnl|my_center|LOCUS_28520 3450871 3452001 gene locus_tag LOCUS_28530 3450871 3452001 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_28530 3452224 3452616 gene locus_tag LOCUS_28540 3452224 3452616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3452661 3454397 gene locus_tag LOCUS_28550 3452661 3454397 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012792659.1 protein_id gnl|my_center|LOCUS_28550 3454390 3455136 gene locus_tag LOCUS_28560 3454390 3455136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897796.1 protein_id gnl|my_center|LOCUS_28560 3455311 3455556 gene locus_tag LOCUS_28570 3455311 3455556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 3455824 3456687 gene locus_tag LOCUS_28580 3455824 3456687 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_28580 3457297 3457962 gene locus_tag LOCUS_28590 gene rpe 3457297 3457962 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_28590 3458266 3462135 gene locus_tag LOCUS_28600 3458266 3462135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3462702 3462304 gene locus_tag LOCUS_28610 3462702 3462304 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_28610 3463653 3462793 gene locus_tag LOCUS_28620 3463653 3462793 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 protein_id gnl|my_center|LOCUS_28620 3464377 3463778 gene locus_tag LOCUS_28630 3464377 3463778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3466005 3464563 gene locus_tag LOCUS_28640 3466005 3464563 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393182.1 protein_id gnl|my_center|LOCUS_28640 3466843 3466028 gene locus_tag LOCUS_28650 3466843 3466028 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_28650 3468573 3466933 gene locus_tag LOCUS_28660 3468573 3466933 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_28660 3469766 3468624 gene locus_tag LOCUS_28670 3469766 3468624 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_28670 3470664 3469792 gene locus_tag LOCUS_28680 3470664 3469792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3474935 3470901 gene locus_tag LOCUS_28690 3474935 3470901 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_28690 3476079 3474991 gene locus_tag LOCUS_28700 3476079 3474991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28700 3476821 3476084 gene locus_tag LOCUS_28710 3476821 3476084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28710 3478418 3476835 gene locus_tag LOCUS_28720 3478418 3476835 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918459.1 protein_id gnl|my_center|LOCUS_28720 3479353 3478502 gene locus_tag LOCUS_28730 3479353 3478502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3481230 3479437 gene locus_tag LOCUS_28740 3481230 3479437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 3481953 3481432 gene locus_tag LOCUS_28750 3481953 3481432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3484282 3482006 gene locus_tag LOCUS_28760 3484282 3482006 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918421.1 protein_id gnl|my_center|LOCUS_28760 3486075 3484462 gene locus_tag LOCUS_28770 3486075 3484462 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_28770 3489113 3486108 gene locus_tag LOCUS_28780 3489113 3486108 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_28780 3491189 3489261 gene locus_tag LOCUS_28790 3491189 3489261 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_28790 3493635 3491449 gene locus_tag LOCUS_28800 3493635 3491449 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918428.1 protein_id gnl|my_center|LOCUS_28800 3494784 3493996 gene locus_tag LOCUS_28810 3494784 3493996 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964150.1 protein_id gnl|my_center|LOCUS_28810 3494968 3494894 gene locus_tag LOCUS_t00360 3494968 3494894 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3495473 3495024 gene locus_tag LOCUS_28820 3495473 3495024 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_28820 3497608 3495626 gene locus_tag LOCUS_28830 gene ftsZ 3497608 3495626 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964152.1 protein_id gnl|my_center|LOCUS_28830 3499042 3497660 gene locus_tag LOCUS_28840 gene ftsA 3499042 3497660 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_28840 3499771 3499049 gene locus_tag LOCUS_28850 3499771 3499049 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_28850 3501107 3499758 gene locus_tag LOCUS_28860 gene murC 3501107 3499758 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964155.1 protein_id gnl|my_center|LOCUS_28860 3502359 3501268 gene locus_tag LOCUS_28870 gene murG 3502359 3501268 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_28870 3503679 3502372 gene locus_tag LOCUS_28880 3503679 3502372 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_28880 3505096 3503759 gene locus_tag LOCUS_28890 gene murD 3505096 3503759 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_28890 3505517 3505164 gene locus_tag LOCUS_28900 3505517 3505164 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_28900 3506789 3505560 gene locus_tag LOCUS_28910 gene mraY 3506789 3505560 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_28910 3508315 3506852 gene locus_tag LOCUS_28920 3508315 3506852 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_28920 3510318 3508312 gene locus_tag LOCUS_28930 3510318 3508312 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_28930 3510659 3510309 gene locus_tag LOCUS_28940 3510659 3510309 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_28940 3511606 3510710 gene locus_tag LOCUS_28950 gene rsmH 3511606 3510710 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_28950 3512012 3511593 gene locus_tag LOCUS_28960 gene mraZ 3512012 3511593 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_28960 3512684 3514969 gene locus_tag LOCUS_28970 3512684 3514969 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_28970 3515244 3515825 gene locus_tag LOCUS_28980 gene ruvA 3515244 3515825 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_28980 3515892 3523004 gene locus_tag LOCUS_28990 gene sprA 3515892 3523004 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_28990 3523115 3523495 gene locus_tag LOCUS_29000 gene gcvH 3523115 3523495 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_29000 3523551 3523874 gene locus_tag LOCUS_29010 3523551 3523874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3524164 3526290 gene locus_tag LOCUS_29020 3524164 3526290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 protein_id gnl|my_center|LOCUS_29020 3526508 3527281 gene locus_tag LOCUS_29030 3526508 3527281 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_29030 3527312 3527932 gene locus_tag LOCUS_29040 gene yihA 3527312 3527932 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964166.1 protein_id gnl|my_center|LOCUS_29040 3528336 3528007 gene locus_tag LOCUS_29050 gene gldC 3528336 3528007 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_29050 3529292 3528336 gene locus_tag LOCUS_29060 gene gldB 3529292 3528336 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_29060 3529438 3530244 gene locus_tag LOCUS_29070 gene nadE 3529438 3530244 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964169.1 protein_id gnl|my_center|LOCUS_29070 3530332 3530961 gene locus_tag LOCUS_29080 3530332 3530961 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_29080 3532937 3530958 gene locus_tag LOCUS_29090 gene dnaG 3532937 3530958 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964171.1 protein_id gnl|my_center|LOCUS_29090 3533987 3533010 gene locus_tag LOCUS_29100 3533987 3533010 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_29100 3535096 3534053 gene locus_tag LOCUS_29110 gene rlmN 3535096 3534053 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_29110 3535197 3535838 gene locus_tag LOCUS_29120 3535197 3535838 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_29120 3536403 3535840 gene locus_tag LOCUS_29130 3536403 3535840 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_29130 3536804 3536403 gene locus_tag LOCUS_29140 3536804 3536403 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_29140 3537628 3536894 gene locus_tag LOCUS_29150 3537628 3536894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964228.1 protein_id gnl|my_center|LOCUS_29150 3538406 3537645 gene locus_tag LOCUS_29160 3538406 3537645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964228.1 protein_id gnl|my_center|LOCUS_29160 3538488 3539195 gene locus_tag LOCUS_29170 gene pepE 3538488 3539195 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_29170 3539298 3539225 gene locus_tag LOCUS_t00370 3539298 3539225 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3539439 3539366 gene locus_tag LOCUS_t00380 3539439 3539366 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3540343 3539621 gene locus_tag LOCUS_29180 3540343 3539621 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964232.1 protein_id gnl|my_center|LOCUS_29180 3540566 3542941 gene locus_tag LOCUS_29190 3540566 3542941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 3543082 3544599 gene locus_tag LOCUS_29200 gene gpmI 3543082 3544599 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_29200 3544756 3545427 gene locus_tag LOCUS_29210 3544756 3545427 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_29210 3545451 3547112 gene locus_tag LOCUS_29220 3545451 3547112 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_29220 3547115 3548461 gene locus_tag LOCUS_29230 3547115 3548461 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_29230 3548461 3549846 gene locus_tag LOCUS_29240 3548461 3549846 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_29240 3549888 3550706 gene locus_tag LOCUS_29250 gene map 3549888 3550706 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962588.1 protein_id gnl|my_center|LOCUS_29250 3550765 3551172 gene locus_tag LOCUS_29260 3550765 3551172 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_29260 3551222 3551986 gene locus_tag LOCUS_29270 3551222 3551986 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_29270 3552108 3553322 gene locus_tag LOCUS_29280 3552108 3553322 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_29280 3553405 3553791 gene locus_tag LOCUS_29290 gene apaG 3553405 3553791 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_29290 3553897 3555525 gene locus_tag LOCUS_29300 gene pruA 3553897 3555525 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_29300 3556320 3555637 gene locus_tag LOCUS_29310 3556320 3555637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 3556980 3556348 gene locus_tag LOCUS_29320 gene rsmG 3556980 3556348 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_29320 3557314 3558183 gene locus_tag LOCUS_29330 3557314 3558183 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_29330 3558226 3559416 gene locus_tag LOCUS_29340 3558226 3559416 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_29340 3559655 3561436 gene locus_tag LOCUS_29350 gene rhgW 3559655 3561436 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_29350 3561704 3563842 gene locus_tag LOCUS_29360 gene rhgW 3561704 3563842 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_29360 3564057 3565931 gene locus_tag LOCUS_29370 3564057 3565931 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963172.1 protein_id gnl|my_center|LOCUS_29370 3566143 3566667 gene locus_tag LOCUS_29380 3566143 3566667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 3566713 3567288 gene locus_tag LOCUS_29390 3566713 3567288 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108257.1 protein_id gnl|my_center|LOCUS_29390 3567436 3568155 gene locus_tag LOCUS_29400 3567436 3568155 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_29400 3568344 3568628 gene locus_tag LOCUS_29410 3568344 3568628 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_29410 3568651 3569058 gene locus_tag LOCUS_29420 3568651 3569058 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_29420 3569061 3569294 gene locus_tag LOCUS_29430 3569061 3569294 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107822.1 protein_id gnl|my_center|LOCUS_29430 3569447 3569974 gene locus_tag LOCUS_29440 3569447 3569974 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_29440 3570160 3571032 gene locus_tag LOCUS_29450 gene fabD 3570160 3571032 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_29450 3572346 3571330 gene locus_tag LOCUS_29460 gene galE 3572346 3571330 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_29460 3572801 3572358 gene locus_tag LOCUS_29470 3572801 3572358 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622221.1 protein_id gnl|my_center|LOCUS_29470 3573939 3572806 gene locus_tag LOCUS_29480 3573939 3572806 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_29480 3574075 3575313 gene locus_tag LOCUS_29490 3574075 3575313 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_29490 3575626 3575820 gene locus_tag LOCUS_29500 3575626 3575820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 3576146 3576060 gene locus_tag LOCUS_t00390 3576146 3576060 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3576376 3576303 gene locus_tag LOCUS_t00400 3576376 3576303 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3579088 3576521 gene locus_tag LOCUS_29510 gene mutS 3579088 3576521 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962564.1 protein_id gnl|my_center|LOCUS_29510 3579279 3579746 gene locus_tag LOCUS_29520 3579279 3579746 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 protein_id gnl|my_center|LOCUS_29520 3579822 3580358 gene locus_tag LOCUS_29530 3579822 3580358 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_29530 3580486 3583260 gene locus_tag LOCUS_29540 3580486 3583260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 3583330 3586440 gene locus_tag LOCUS_29550 3583330 3586440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3587492 3586452 gene locus_tag LOCUS_29560 gene folK 3587492 3586452 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_29560 3587705 3589465 gene locus_tag LOCUS_29570 gene sppA 3587705 3589465 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_29570 3589619 3592258 gene locus_tag LOCUS_29580 3589619 3592258 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_29580 3592763 3592371 gene locus_tag LOCUS_29590 3592763 3592371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 3593606 3592812 gene locus_tag LOCUS_29600 3593606 3592812 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_29600 3593855 3595273 gene locus_tag LOCUS_29610 3593855 3595273 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_29610 3597005 3595314 gene locus_tag LOCUS_29620 3597005 3595314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3599529 3597262 gene locus_tag LOCUS_29630 3599529 3597262 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_29630 3602425 3599654 gene locus_tag LOCUS_29640 3602425 3599654 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 protein_id gnl|my_center|LOCUS_29640 3603734 3602781 gene locus_tag LOCUS_29650 3603734 3602781 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_29650 3605226 3603814 gene locus_tag LOCUS_29660 3605226 3603814 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_29660 3605516 3606250 gene locus_tag LOCUS_29670 3605516 3606250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 3607414 3606314 gene locus_tag LOCUS_29680 gene carA 3607414 3606314 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_29680 3608196 3607687 gene locus_tag LOCUS_29690 gene rplQ 3608196 3607687 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963444.1 protein_id gnl|my_center|LOCUS_29690 3609251 3608259 gene locus_tag LOCUS_29700 3609251 3608259 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_29700 3609878 3609273 gene locus_tag LOCUS_29710 gene rpsD 3609878 3609273 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_29710 3610355 3609972 gene locus_tag LOCUS_29720 gene rpsK 3610355 3609972 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_29720 3610738 3610364 gene locus_tag LOCUS_29730 gene rpsM 3610738 3610364 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_29730 3611084 3610869 gene locus_tag LOCUS_29740 gene infA 3611084 3610869 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963449.1 protein_id gnl|my_center|LOCUS_29740 3612435 3611089 gene locus_tag LOCUS_29750 gene secY 3612435 3611089 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963450.1 protein_id gnl|my_center|LOCUS_29750 3612901 3612449 gene locus_tag LOCUS_29760 gene rplO 3612901 3612449 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963451.1 protein_id gnl|my_center|LOCUS_29760 3613094 3612912 gene locus_tag LOCUS_29770 gene rpmD 3613094 3612912 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963452.1 protein_id gnl|my_center|LOCUS_29770 3613634 3613107 gene locus_tag LOCUS_29780 gene rpsE 3613634 3613107 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963453.1 protein_id gnl|my_center|LOCUS_29780 3613991 3613641 gene locus_tag LOCUS_29790 gene rplR 3613991 3613641 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_29790 3614545 3614003 gene locus_tag LOCUS_29800 gene rplF 3614545 3614003 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963455.1 protein_id gnl|my_center|LOCUS_29800 3614963 3614565 gene locus_tag LOCUS_29810 gene rpsH 3614963 3614565 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_29810 3615336 3615067 gene locus_tag LOCUS_29820 gene rpsN 3615336 3615067 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_29820 3615891 3615340 gene locus_tag LOCUS_29830 gene rplE 3615891 3615340 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963458.1 protein_id gnl|my_center|LOCUS_29830 3616208 3615894 gene locus_tag LOCUS_29840 gene rplX 3616208 3615894 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963459.1 protein_id gnl|my_center|LOCUS_29840 3616587 3616219 gene locus_tag LOCUS_29850 gene rplN 3616587 3616219 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_29850 3616850 3616590 gene locus_tag LOCUS_29860 gene rpsQ 3616850 3616590 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_29860 3617059 3616868 gene locus_tag LOCUS_29870 gene rpmC 3617059 3616868 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963462.1 protein_id gnl|my_center|LOCUS_29870 3617498 3617073 gene locus_tag LOCUS_29880 gene rplP 3617498 3617073 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963463.1 protein_id gnl|my_center|LOCUS_29880 3618279 3617518 gene locus_tag LOCUS_29890 gene rpsC 3618279 3617518 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_29890 3618699 3618286 gene locus_tag LOCUS_29900 gene rplV 3618699 3618286 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_29900 3618984 3618706 gene locus_tag LOCUS_29910 gene rpsS 3618984 3618706 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007136562.1 protein_id gnl|my_center|LOCUS_29910 3619815 3618991 gene locus_tag LOCUS_29920 gene rplB 3619815 3618991 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_29920 3620112 3619822 gene locus_tag LOCUS_29930 gene rplW 3620112 3619822 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_29930 3620748 3620119 gene locus_tag LOCUS_29940 gene rplD 3620748 3620119 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_29940 3621365 3620748 gene locus_tag LOCUS_29950 gene rplC 3621365 3620748 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_29950 3621824 3621519 gene locus_tag LOCUS_29960 gene rpsJ 3621824 3621519 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963470.1 protein_id gnl|my_center|LOCUS_29960 3623992 3621836 gene locus_tag LOCUS_29970 gene fusA 3623992 3621836 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963471.1 protein_id gnl|my_center|LOCUS_29970 3624479 3624003 gene locus_tag LOCUS_29980 gene rpsG 3624479 3624003 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_29980 3624925 3624542 gene locus_tag LOCUS_29990 gene rpsL 3624925 3624542 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_29990 3625195 3626892 gene locus_tag LOCUS_30000 3625195 3626892 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_30000 3627084 3630194 gene locus_tag LOCUS_30010 3627084 3630194 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_30010 3630205 3631665 gene locus_tag LOCUS_30020 3630205 3631665 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109245.1 protein_id gnl|my_center|LOCUS_30020 3631690 3632436 gene locus_tag LOCUS_30030 3631690 3632436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 3632447 3632935 gene locus_tag LOCUS_30040 3632447 3632935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3633005 3633739 gene locus_tag LOCUS_30050 gene rlmB 3633005 3633739 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_30050 3634549 3633785 gene locus_tag LOCUS_30060 3634549 3633785 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_30060 3634758 3636035 gene locus_tag LOCUS_30070 3634758 3636035 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_30070 3636913 3636167 gene locus_tag LOCUS_30080 3636913 3636167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963480.1 protein_id gnl|my_center|LOCUS_30080 3637602 3636916 gene locus_tag LOCUS_30090 3637602 3636916 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_30090 3638310 3637618 gene locus_tag LOCUS_30100 gene radC 3638310 3637618 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_30100 3638380 3638985 gene locus_tag LOCUS_30110 3638380 3638985 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_30110 3639448 3639095 gene locus_tag LOCUS_30120 3639448 3639095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 3640814 3639459 gene locus_tag LOCUS_30130 3640814 3639459 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_30130 3641563 3640874 gene locus_tag LOCUS_30140 3641563 3640874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963484.1 protein_id gnl|my_center|LOCUS_30140 3641867 3642682 gene locus_tag LOCUS_30150 3641867 3642682 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_30150 3642712 3643701 gene locus_tag LOCUS_30160 3642712 3643701 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_30160 3644866 3643865 gene locus_tag LOCUS_30170 gene obgE 3644866 3643865 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963487.1 protein_id gnl|my_center|LOCUS_30170 3646162 3644939 gene locus_tag LOCUS_30180 3646162 3644939 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963488.1 protein_id gnl|my_center|LOCUS_30180 3646810 3646238 gene locus_tag LOCUS_30190 3646810 3646238 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_30190 3647376 3646846 gene locus_tag LOCUS_30200 gene hpt 3647376 3646846 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_30200 3647467 3648021 gene locus_tag LOCUS_30210 3647467 3648021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_30210 3648055 3648318 gene locus_tag LOCUS_30220 3648055 3648318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 3648315 3648731 gene locus_tag LOCUS_30230 3648315 3648731 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_30230 3648805 3649956 gene locus_tag LOCUS_30240 3648805 3649956 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963492.1 protein_id gnl|my_center|LOCUS_30240 3650178 3650663 gene locus_tag LOCUS_30250 gene purE 3650178 3650663 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963493.1 protein_id gnl|my_center|LOCUS_30250 3650778 3652805 gene locus_tag LOCUS_30260 3650778 3652805 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_30260 3652821 3653309 gene locus_tag LOCUS_30270 3652821 3653309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 3653497 3654000 gene locus_tag LOCUS_30280 3653497 3654000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 3654054 3654875 gene locus_tag LOCUS_30290 3654054 3654875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 3654878 3655789 gene locus_tag LOCUS_30300 3654878 3655789 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033982.1 protein_id gnl|my_center|LOCUS_30300 3655786 3656253 gene locus_tag LOCUS_30310 3655786 3656253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 3657346 3656231 gene locus_tag LOCUS_30320 3657346 3656231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_30320 3658196 3657471 gene locus_tag LOCUS_30330 3658196 3657471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30330 3658429 3661278 gene locus_tag LOCUS_30340 gene gcvP 3658429 3661278 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963500.1 protein_id gnl|my_center|LOCUS_30340 3661352 3661729 gene locus_tag LOCUS_30350 3661352 3661729 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963501.1 protein_id gnl|my_center|LOCUS_30350 3661826 3662884 gene locus_tag LOCUS_30360 3661826 3662884 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_30360 3662960 3663481 gene locus_tag LOCUS_30370 3662960 3663481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3663590 3664438 gene locus_tag LOCUS_30380 3663590 3664438 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_30380 3664555 3665301 gene locus_tag LOCUS_30390 3664555 3665301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_30390 3665301 3666062 gene locus_tag LOCUS_30400 3665301 3666062 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_30400 3666644 3666138 gene locus_tag LOCUS_30410 3666644 3666138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 3666889 3666814 gene locus_tag LOCUS_t00410 3666889 3666814 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3668191 3666971 gene locus_tag LOCUS_30420 3668191 3666971 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_30420 3668315 3669010 gene locus_tag LOCUS_30430 3668315 3669010 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962705.1 protein_id gnl|my_center|LOCUS_30430 3669013 3669408 gene locus_tag LOCUS_30440 3669013 3669408 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962706.1 protein_id gnl|my_center|LOCUS_30440 3670352 3669501 gene locus_tag LOCUS_30450 3670352 3669501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_30450 3671600 3670461 gene locus_tag LOCUS_30460 gene nhaA 3671600 3670461 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963884.1 protein_id gnl|my_center|LOCUS_30460 3672681 3671608 gene locus_tag LOCUS_30470 3672681 3671608 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_30470 3672816 3673493 gene locus_tag LOCUS_30480 3672816 3673493 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_30480 3673581 3674003 gene locus_tag LOCUS_30490 3673581 3674003 CDS product DM13 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962864.1 protein_id gnl|my_center|LOCUS_30490 3674009 3674908 gene locus_tag LOCUS_30500 3674009 3674908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962863.1 protein_id gnl|my_center|LOCUS_30500 3674983 3675582 gene locus_tag LOCUS_30510 3674983 3675582 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962861.1 protein_id gnl|my_center|LOCUS_30510 3675707 3676039 gene locus_tag LOCUS_30520 3675707 3676039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 3676052 3676435 gene locus_tag LOCUS_30530 3676052 3676435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 3676438 3676926 gene locus_tag LOCUS_30540 3676438 3676926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_30540 3676914 3677624 gene locus_tag LOCUS_30550 3676914 3677624 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_30550 3677799 3678674 gene locus_tag LOCUS_30560 3677799 3678674 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_30560 3678678 3679325 gene locus_tag LOCUS_30570 3678678 3679325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962857.1 protein_id gnl|my_center|LOCUS_30570 3679423 3680178 gene locus_tag LOCUS_30580 3679423 3680178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 3680473 3680619 gene locus_tag LOCUS_30590 3680473 3680619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 3680641 3681819 gene locus_tag LOCUS_30600 3680641 3681819 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130092588.1 protein_id gnl|my_center|LOCUS_30600 3681917 3682594 gene locus_tag LOCUS_30610 3681917 3682594 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_30610 3682641 3683243 gene locus_tag LOCUS_30620 3682641 3683243 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_30620 3683377 3684435 gene locus_tag LOCUS_30630 3683377 3684435 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_30630 3687163 3684527 gene locus_tag LOCUS_30640 gene alaS 3687163 3684527 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964045.1 protein_id gnl|my_center|LOCUS_30640 3687472 3688362 gene locus_tag LOCUS_30650 3687472 3688362 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_30650 3688426 3688758 gene locus_tag LOCUS_30660 3688426 3688758 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_30660 3688807 3689394 gene locus_tag LOCUS_30670 3688807 3689394 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_30670 3689407 3689844 gene locus_tag LOCUS_30680 3689407 3689844 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_30680 3689844 3690680 gene locus_tag LOCUS_30690 3689844 3690680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 3690765 3691178 gene locus_tag LOCUS_30700 3690765 3691178 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_30700 3691417 3694011 gene locus_tag LOCUS_30710 3691417 3694011 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639902.1 protein_id gnl|my_center|LOCUS_30710 3694094 3694633 gene locus_tag LOCUS_30720 3694094 3694633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 3694652 3695830 gene locus_tag LOCUS_30730 3694652 3695830 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 protein_id gnl|my_center|LOCUS_30730 3695956 3696699 gene locus_tag LOCUS_30740 3695956 3696699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 3697211 3696756 gene locus_tag LOCUS_30750 3697211 3696756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 3700083 3697297 gene locus_tag LOCUS_30760 3700083 3697297 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_30760 3702005 3700233 gene locus_tag LOCUS_30770 3702005 3700233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 3702288 3703217 gene locus_tag LOCUS_30780 gene nadA 3702288 3703217 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140196.1 protein_id gnl|my_center|LOCUS_30780 3703217 3704737 gene locus_tag LOCUS_30790 gene nadB 3703217 3704737 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_30790 3704796 3705515 gene locus_tag LOCUS_30800 3704796 3705515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3705779 3706243 gene locus_tag LOCUS_30810 3705779 3706243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 3707642 3706356 gene locus_tag LOCUS_30820 gene hemL 3707642 3706356 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_30820 3708461 3707679 gene locus_tag LOCUS_30830 3708461 3707679 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_30830 3709380 3708454 gene locus_tag LOCUS_30840 3709380 3708454 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_30840 3709494 3709709 gene locus_tag LOCUS_30850 3709494 3709709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 3711299 3709782 gene locus_tag LOCUS_30860 3711299 3709782 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688809.1 protein_id gnl|my_center|LOCUS_30860 3712139 3711303 gene locus_tag LOCUS_30870 3712139 3711303 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546419.1 protein_id gnl|my_center|LOCUS_30870 3713378 3712146 gene locus_tag LOCUS_30880 gene dcm 3713378 3712146 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_30880 3713785 3713459 gene locus_tag LOCUS_30890 3713785 3713459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_30890 3713775 3713990 gene locus_tag LOCUS_30900 3713775 3713990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3714620 3714000 gene locus_tag LOCUS_30910 3714620 3714000 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_30910 3717233 3714894 gene locus_tag LOCUS_30920 3717233 3714894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 3718128 3717478 gene locus_tag LOCUS_30930 3718128 3717478 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_30930 3720261 3718372 gene locus_tag LOCUS_30940 3720261 3718372 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_30940 3720820 3720542 gene locus_tag LOCUS_30950 3720820 3720542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 3722194 3720833 gene locus_tag LOCUS_30960 3722194 3720833 CDS product T9SS type A sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964550.1 protein_id gnl|my_center|LOCUS_30960 3723700 3722276 gene locus_tag LOCUS_30970 3723700 3722276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3725659 3723797 gene locus_tag LOCUS_30980 3725659 3723797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 3726056 3725682 gene locus_tag LOCUS_30990 3726056 3725682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 3727094 3726138 gene locus_tag LOCUS_31000 3727094 3726138 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_31000 3728407 3727124 gene locus_tag LOCUS_31010 3728407 3727124 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_31010 3730146 3728470 gene locus_tag LOCUS_31020 gene gldJ 3730146 3728470 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_31020 3730355 3734188 gene locus_tag LOCUS_31030 gene porU 3730355 3734188 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_31030 3734226 3735404 gene locus_tag LOCUS_31040 gene porV 3734226 3735404 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_31040 3735471 3735953 gene locus_tag LOCUS_31050 gene cdd 3735471 3735953 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_31050 3736133 3737131 gene locus_tag LOCUS_31060 gene pdhA 3736133 3737131 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_31060 3737140 3738792 gene locus_tag LOCUS_31070 3737140 3738792 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_31070 3740417 3739176 gene locus_tag LOCUS_31080 3740417 3739176 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_31080 3740522 3741103 gene locus_tag LOCUS_31090 3740522 3741103 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_31090 3741148 3743904 gene locus_tag LOCUS_31100 3741148 3743904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 3745025 3743916 gene locus_tag LOCUS_31110 3745025 3743916 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31110 3745252 3745046 gene locus_tag LOCUS_31120 3745252 3745046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31120 3745500 3745397 gene locus_tag LOCUS_r00070 3745500 3745397 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3748528 3745659 gene locus_tag LOCUS_r00080 3748528 3745659 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3748800 3748726 gene locus_tag LOCUS_t00420 3748800 3748726 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3748965 3748891 gene locus_tag LOCUS_t00430 3748965 3748891 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3750599 3749089 gene locus_tag LOCUS_r00090 3750599 3749089 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3752869 3751634 gene locus_tag LOCUS_31130 3752869 3751634 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_31130 3753464 3752970 gene locus_tag LOCUS_31140 3753464 3752970 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_31140 3753548 3754252 gene locus_tag LOCUS_31150 3753548 3754252 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_31150 3755439 3754282 gene locus_tag LOCUS_31160 3755439 3754282 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_31160 3755887 3755492 gene locus_tag LOCUS_31170 3755887 3755492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 3756305 3755907 gene locus_tag LOCUS_31180 3756305 3755907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3756940 3756308 gene locus_tag LOCUS_31190 3756940 3756308 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_31190 3758753 3757050 gene locus_tag LOCUS_31200 3758753 3757050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964295.1 protein_id gnl|my_center|LOCUS_31200 3759714 3758761 gene locus_tag LOCUS_31210 3759714 3758761 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964296.1 protein_id gnl|my_center|LOCUS_31210 3760704 3759907 gene locus_tag LOCUS_31220 3760704 3759907 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964297.1 protein_id gnl|my_center|LOCUS_31220 3761297 3760752 gene locus_tag LOCUS_31230 3761297 3760752 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_31230 3761928 3761317 gene locus_tag LOCUS_31240 3761928 3761317 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_31240 3762825 3762007 gene locus_tag LOCUS_31250 3762825 3762007 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964300.1 protein_id gnl|my_center|LOCUS_31250 3763199 3764719 gene locus_tag LOCUS_31260 3763199 3764719 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_31260 3765190 3764780 gene locus_tag LOCUS_31270 3765190 3764780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 3766402 3765353 gene locus_tag LOCUS_31280 gene queA 3766402 3765353 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_31280 3767783 3766560 gene locus_tag LOCUS_31290 3767783 3766560 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962416.1 protein_id gnl|my_center|LOCUS_31290 3768205 3767879 gene locus_tag LOCUS_31300 3768205 3767879 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_31300 3770198 3768207 gene locus_tag LOCUS_31310 3770198 3768207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 3772218 3770203 gene locus_tag LOCUS_31320 3772218 3770203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 3774134 3772224 gene locus_tag LOCUS_31330 3774134 3772224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3774636 3774184 gene locus_tag LOCUS_31340 gene dtd 3774636 3774184 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_31340 3775691 3774714 gene locus_tag LOCUS_31350 gene rsgA 3775691 3774714 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_31350 3776498 3775854 gene locus_tag LOCUS_31360 3776498 3775854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 3777672 3776593 gene locus_tag LOCUS_31370 3777672 3776593 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_31370 3778603 3777746 gene locus_tag LOCUS_31380 3778603 3777746 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_31380 3779752 3778607 gene locus_tag LOCUS_31390 3779752 3778607 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962425.1 protein_id gnl|my_center|LOCUS_31390 3780576 3779749 gene locus_tag LOCUS_31400 3780576 3779749 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_31400 3780878 3781777 gene locus_tag LOCUS_31410 gene gldA 3780878 3781777 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_31410 3782828 3781875 gene locus_tag LOCUS_31420 gene metF 3782828 3781875 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_31420 3785595 3782914 gene locus_tag LOCUS_31430 3785595 3782914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 3785909 3785673 gene locus_tag LOCUS_31440 3785909 3785673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31440 3786900 3785869 gene locus_tag LOCUS_31450 3786900 3785869 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31450 3787898 3787086 gene locus_tag LOCUS_31460 3787898 3787086 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_31460 3788584 3788144 gene locus_tag LOCUS_31470 3788584 3788144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 3789647 3788646 gene locus_tag LOCUS_31480 3789647 3788646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 3791104 3790052 gene locus_tag LOCUS_31490 3791104 3790052 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963782.1 protein_id gnl|my_center|LOCUS_31490 3791842 3791261 gene locus_tag LOCUS_31500 3791842 3791261 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_31500 3792618 3791842 gene locus_tag LOCUS_31510 gene cobA 3792618 3791842 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_31510 3794725 3792611 gene locus_tag LOCUS_31520 3794725 3792611 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_31520 3796077 3794833 gene locus_tag LOCUS_31530 3796077 3794833 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_31530 3797080 3796181 gene locus_tag LOCUS_31540 gene cysD 3797080 3796181 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_31540 3797910 3797209 gene locus_tag LOCUS_31550 3797910 3797209 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_31550 3798873 3797971 gene locus_tag LOCUS_31560 3798873 3797971 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024365.1 protein_id gnl|my_center|LOCUS_31560 3799214 3800002 gene locus_tag LOCUS_31570 3799214 3800002 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463393.1 protein_id gnl|my_center|LOCUS_31570 3800415 3800005 gene locus_tag LOCUS_31580 3800415 3800005 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 protein_id gnl|my_center|LOCUS_31580 3801658 3800486 gene locus_tag LOCUS_31590 3801658 3800486 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530350.1 protein_id gnl|my_center|LOCUS_31590 3802206 3801772 gene locus_tag LOCUS_31600 3802206 3801772 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206189.1 protein_id gnl|my_center|LOCUS_31600 3804674 3802263 gene locus_tag LOCUS_31610 gene thrA 3804674 3802263 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895993.1 protein_id gnl|my_center|LOCUS_31610 3805657 3804695 gene locus_tag LOCUS_31620 3805657 3804695 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962431.1 protein_id gnl|my_center|LOCUS_31620 3806205 3806002 gene locus_tag LOCUS_31630 3806205 3806002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3807261 3806899 gene locus_tag LOCUS_31640 3807261 3806899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3807358 3808224 gene locus_tag LOCUS_31650 3807358 3808224 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182921959.1 protein_id gnl|my_center|LOCUS_31650 3808472 3809722 gene locus_tag LOCUS_31660 gene metK 3808472 3809722 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962442.1 protein_id gnl|my_center|LOCUS_31660 3809840 3811612 gene locus_tag LOCUS_31670 3809840 3811612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 3814394 3811692 gene locus_tag LOCUS_31680 3814394 3811692 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_31680 3815321 3814434 gene locus_tag LOCUS_31690 3815321 3814434 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_31690 3815790 3816581 gene locus_tag LOCUS_31700 3815790 3816581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962437.1 protein_id gnl|my_center|LOCUS_31700 3816581 3817195 gene locus_tag LOCUS_31710 3816581 3817195 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_31710 3818701 3817268 gene locus_tag LOCUS_31720 3818701 3817268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 3820881 3818731 gene locus_tag LOCUS_31730 3820881 3818731 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_31730 3821297 3821911 gene locus_tag LOCUS_31740 3821297 3821911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 3821919 3822380 gene locus_tag LOCUS_31750 3821919 3822380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 3824982 3822472 gene locus_tag LOCUS_31760 3824982 3822472 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_31760 3825913 3825089 gene locus_tag LOCUS_31770 3825913 3825089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 3826550 3826017 gene locus_tag LOCUS_31780 3826550 3826017 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_31780 3829222 3826736 gene locus_tag LOCUS_31790 3829222 3826736 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_31790 3830314 3829334 gene locus_tag LOCUS_31800 3830314 3829334 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_31800 3830576 3831322 gene locus_tag LOCUS_31810 3830576 3831322 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_31810 3831386 3832351 gene locus_tag LOCUS_31820 3831386 3832351 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_31820 3832541 3833164 gene locus_tag LOCUS_31830 3832541 3833164 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_31830 3833253 3834077 gene locus_tag LOCUS_31840 3833253 3834077 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962504.1 protein_id gnl|my_center|LOCUS_31840 3834113 3834538 gene locus_tag LOCUS_31850 3834113 3834538 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_31850 3834956 3834600 gene locus_tag LOCUS_31860 3834956 3834600 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_31860 3835134 3835475 gene locus_tag LOCUS_31870 3835134 3835475 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962500.1 protein_id gnl|my_center|LOCUS_31870 3835488 3835964 gene locus_tag LOCUS_31880 3835488 3835964 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_31880 3836023 3836754 gene locus_tag LOCUS_31890 gene ubiE 3836023 3836754 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_31890 3836756 3837475 gene locus_tag LOCUS_31900 3836756 3837475 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_31900 3838236 3837496 gene locus_tag LOCUS_31910 3838236 3837496 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_31910 3838272 3840827 gene locus_tag LOCUS_31920 3838272 3840827 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_31920 3840892 3841959 gene locus_tag LOCUS_31930 gene fbaA 3840892 3841959 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_31930 3842207 3843061 gene locus_tag LOCUS_31940 gene accD 3842207 3843061 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_31940 3843291 3843515 gene locus_tag LOCUS_31950 3843291 3843515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 3843830 3844069 gene locus_tag LOCUS_31960 3843830 3844069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 3843960 3844187 gene locus_tag LOCUS_31970 3843960 3844187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 3844225 3844617 gene locus_tag LOCUS_31980 3844225 3844617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 3845012 3844806 gene locus_tag LOCUS_31990 3845012 3844806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990