COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..491184 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(37..1344) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368669.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1697..3256) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene aspA CDS complement(3367..4212) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856149.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene hisG CDS complement(4242..4505) product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4558..5280) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014410.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5204..5371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(5408..5791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856129.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(5816..7063) product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene mshC CDS complement(7080..7943) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 8001..9047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 9052..10167 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(10258..10650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(10650..11189) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 tRNA 11417..11503 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 11670..12296 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856111.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 12351..12929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS complement(12926..13765) product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 13799..14572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014433.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS complement(14569..15642) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014434.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(15674..17128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(18848..19312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 19641..22454 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170844367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene can CDS 22646..23221 product TetR/AcrR family transcriptional regulator AcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856101.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene acnR CDS complement(23299..24435) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853505.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(24426..25118) product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(25118..25864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(26011..26982) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015421.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS complement(27004..27678) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856099.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 27783..28052 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 28054..29418 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856096.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(29443..30744) product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(30772..32421) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014443.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(32518..32925) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856083.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(32926..33378) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(33375..34622) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(34668..35426) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856078.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene sufC CDS complement(35457..36611) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014448.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene sufD CDS complement(36617..38056) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene sufB CDS complement(38053..38790) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862282.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 39060..40784 product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265766.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene mptB CDS 40791..41720 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 41778..42542 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014451.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 42621..43640 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 43705..44682 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856060.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(44766..45710) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271337.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 46059..48131 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856055.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene tkt CDS 48159..49244 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856053.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene tal CDS 49344..50876 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene zwf CDS 50891..51826 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 51869..52630 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862263.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 gene pgl CDS complement(52777..53010) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene secG CDS complement(53195..53977) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene tpiA CDS complement(54017..55234) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862252.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene pgk CDS complement(55351..56358) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862250.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene gap CDS 56899..58545 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(58681..59634) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene whiA CDS complement(59845..60828) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014467.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene yvcK CDS complement(60852..61685) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene rapZ CDS complement(61774..63849) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene uvrC CDS complement(63853..64401) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014469.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(64477..64956) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856018.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene ribH CDS complement(64986..66248) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(66260..66880) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014470.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(66910..67932) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014471.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene ribD CDS complement(67932..68600) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene rpe CDS complement(68620..70173) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014473.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(70170..71117) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862229.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene fmt CDS complement(71194..71715) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene def CDS complement(71806..73845) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014474.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(73857..75089) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene metK CDS complement(75199..76446) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene coaBC CDS complement(76576..76884) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855993.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene rpoZ CDS complement(76919..77488) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855988.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene gmk CDS complement(77497..77817) product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene mihF CDS complement(78077..78916) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014477.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene pyrF CDS complement(78900..82241) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862217.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene carB CDS complement(82267..83469) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014478.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene carA CDS complement(83472..84809) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014479.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(84844..85800) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862210.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(85803..86411) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene pyrR CDS complement(86431..86697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 86904..88097 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(88208..88417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 88560..88733 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(88976..89098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 89415..89906 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014481.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 89899..90411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(90498..91361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(91463..92092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(92104..92667) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855973.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 gene efp CDS 92921..93817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(93814..94920) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014485.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(95040..95468) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene aroQ CDS complement(95471..96541) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014486.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 gene aroB CDS complement(96607..97143) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(97147..98307) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 gene aroC CDS complement(98427..98849) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014489.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(98932..99759) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(99791..101017) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014494.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene mltG CDS complement(101023..101574) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014495.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 gene ruvX CDS complement(101585..104269) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene alaS CDS complement(104371..105762) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855936.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(105806..107020) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014497.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(107144..108976) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene aspS CDS 109222..110118 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014499.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 110338..111945 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411694.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 112035..112811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 112888..114000 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 114003..114662 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975539.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 114834..116243 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014507.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 116254..116829 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(116856..118145) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene hisS CDS complement(118151..118786) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014510.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(118870..119214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 note possible pseudo, frameshifted CDS 119164..119406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 119509..120369 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014511.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(120375..120545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 120723..121073 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(121199..121771) product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(121869..123941) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013569.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(124129..126423) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855910.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(126504..127049) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014514.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(127104..128771) product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014515.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(128825..129985) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014516.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene secF CDS complement(129988..131904) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855902.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene secD CDS complement(132119..132478) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene yajC CDS complement(132555..133634) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855899.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene ruvB CDS complement(133657..134274) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene ruvA CDS complement(134309..134860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(135056..135811) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(135905..136777) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 136958..138298 product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(138320..138781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855892.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(138781..139884) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(139884..140828) product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014523.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(140868..141473) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(141466..142065) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(142052..144115) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855874.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene thrS CDS complement(144193..145299) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(145422..146024) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014526.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(146024..146587) product copper resistance protein CopC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855865.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 tRNA complement(147121..147196) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(147239..147311) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(147338..147409) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(147440..147515) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA complement(147553..147625) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA complement(147673..147748) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 tRNA 147994..148066 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 148139..149041 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 149114..149800 product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014736.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 149819..150970 product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene aftC CDS 150980..151402 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene msrB CDS complement(151513..152214) product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 152362..153021 product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014739.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 153023..154267 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(154288..156213) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene dxs CDS complement(156352..157560) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014742.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(157568..158290) product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS complement(158308..159255) product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(159304..159777) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene dut CDS 159920..160378 product DUF3093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859852.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(160490..160780) product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(160928..161779) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014746.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 161778..162536 product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014747.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene ppgK CDS 162737..164194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(164288..166054) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859837.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(166051..166380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 166440..166814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 166830..168401 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS 168445..168888 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859832.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene dtd CDS 169248..170663 product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450473.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene sdaC CDS 170710..172083 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624305.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene sdaA CDS 172240..173019 product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356661.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 173202..174215 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 174438..175115 product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 175119..176105 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 gene galE CDS complement(176118..177203) product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066566054.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS 177446..178510 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 178545..181088 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286432.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(181178..181702) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412536.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(181800..182393) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 182554..183498 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014757.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(183586..184494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 184601..188488 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014759.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene hrpA CDS complement(188485..188943) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene nrdR CDS complement(189028..189423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 189672..190376 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857389.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene lexA CDS 190735..191517 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(191539..193227) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014763.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene ptsP CDS complement(193351..193584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 193471..194391 product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014765.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 194405..196534 product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014766.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 196589..196858 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(196927..197916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(198048..199220) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(199360..200853) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene hflX CDS 200929..201726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014770.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 201796..202374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014771.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(202407..203267) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene dapF CDS complement(203273..204169) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014773.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene miaA CDS complement(204169..204768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014774.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 204905..206209 product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 206209..207336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(207348..207977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(208000..209469) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857429.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene miaB CDS complement(209608..210210) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene recX CDS complement(210262..211398) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857444.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene recA CDS complement(211581..211796) product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 211954..212523 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene bioY CDS 212523..213215 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 213227..213847 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857456.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(213928..214800) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(214974..215339) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861658.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(215363..215860) product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014786.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(215868..216452) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 gene pgsA CDS 216512..216799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(216796..217917) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(218087..221500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(221630..222265) product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857475.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(222324..224462) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014791.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(224465..225361) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014792.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene dapA CDS complement(225430..226176) product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014793.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene thyX CDS complement(226180..226926) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene dapB CDS complement(226943..227248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 227225..227458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 227567..228271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(228368..230614) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014796.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(230758..231027) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene rpsO CDS complement(231197..232129) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014797.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(232130..233152) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121910865.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 233176..234069 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene truB CDS complement(234066..234737) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857486.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(234737..235549) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(235636..236952) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(236973..237935) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014801.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(237936..238379) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861694.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene rbfA CDS complement(238643..241477) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene infB CDS complement(241584..241931) product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014803.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(242016..243032) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene nusA CDS complement(243056..243595) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014804.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene rimP CDS 243577..244485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 244667..244996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(245118..245489) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(245520..247289) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS 247288..248043 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene yaaA CDS complement(248074..249393) product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(249415..250167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(250199..251098) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892221.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(251165..251908) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(251901..253085) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189923413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 253153..253974 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973698.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 253975..255330 product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014812.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(255410..256906) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014814.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene mqo CDS 257171..258199 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 258227..259624 product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene mtr CDS 259947..260321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 260370..260765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(260961..261830) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene map CDS complement(261897..263795) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(263832..264995) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene ispG CDS complement(265104..266312) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(266327..267487) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014825.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 gene dxr CDS 267665..268126 product DUF2631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857542.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(268342..269940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014826.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(269946..270776) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861735.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(270795..271907) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861738.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene rlmN CDS 272002..272409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(272495..273376) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(273523..274080) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014829.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene frr CDS complement(274152..274880) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene pyrH CDS complement(275105..275917) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene tsf CDS complement(276216..277049) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014831.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene rpsB CDS 277422..277949 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014832.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(277946..278815) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857565.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(278899..280080) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861752.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene dprA CDS complement(280077..281435) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014834.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 281386..281592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(281626..282024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(282197..282502) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857573.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(282565..283206) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982719.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(283193..283864) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene lepB CDS complement(283908..284711) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 gene lepB CDS complement(284897..285241) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene rplS CDS complement(285394..287508) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(287701..290034) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014841.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(290180..290818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(290940..291314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(291314..292186) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050816932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene trmD CDS complement(292183..292680) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene rimM CDS 292856..293191 product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861911.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 293221..293916 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225458.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(294134..294649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 295003..297270 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013830.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(297401..299050) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene ffh CDS complement(299102..301225) product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014852.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(301232..301570) product P-II family nitrogen regulator GlnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014853.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene glnK CDS complement(301801..302169) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(302173..302463) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013517.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(302460..302993) product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013518.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(302994..304535) product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS complement(304535..305011) product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013520.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(305011..307989) product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(308361..310298) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029703265.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene ftsY CDS complement(310388..313909) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene smc CDS complement(313988..314272) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856367.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(314289..315788) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(315842..316501) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087736.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene mutM CDS 316439..316663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(316660..317430) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861938.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene rnc CDS complement(317427..317960) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 318123..318770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(318962..319720) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(319922..321277) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene gdhA CDS 321467..322549 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(322546..322944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 322981..324186 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014868.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 324284..326674 product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene malP CDS complement(326747..327271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 note possible pseudo, internal stop codon CDS complement(327302..327538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 note possible pseudo, internal stop codon CDS complement(327575..327775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 note possible pseudo, internal stop codon CDS 327908..328090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 328092..329252 product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059232860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 329347..330039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 note possible pseudo, frameshifted CDS complement(330047..330937) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014254.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(331233..332585) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014873.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene pyk CDS complement(332817..333761) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene lgt CDS complement(333807..334637) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894608.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene trpC CDS complement(334722..335360) product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(335357..335719) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014876.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene hisI CDS complement(335716..336486) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856413.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene hisF CDS complement(336517..337299) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861968.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(337303..338091) product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856418.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene priA CDS complement(338106..338738) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014877.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene hisH CDS complement(338742..339992) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(339989..340156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(340162..340764) product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861983.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene hisB CDS complement(340761..341891) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(341892..343202) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene hisD CDS 343329..344225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(344235..344747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(344722..345507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 345670..346209 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014884.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 346219..348429 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014885.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene glgX CDS 348443..349774 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856453.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 349855..350472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284123.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 350483..351481 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(351504..351893) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(351894..352133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(352136..352774) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS complement(352774..354042) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862033.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 gene ilvA CDS 354142..356007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 356070..356555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(356606..357796) product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856473.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(357869..361441) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856475.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene dnaE CDS 361469..362338 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014902.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene rarD CDS complement(362325..362594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(362648..363673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(363734..364270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014908.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(364267..365193) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(365186..365590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 365719..366660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(366661..367311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860404.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS 367420..368313 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(368310..369698) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014912.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS 370003..370626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 370692..371336 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062703.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 371333..372565 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(372637..375807) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014916.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene ileS CDS 376096..377097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(377173..377394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(377494..378663) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860384.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(378867..379160) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(379237..379689) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856516.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(379794..380492) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856518.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(380492..381223) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene pgeF CDS complement(381248..382567) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene ftsZ CDS complement(382881..383552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(383552..385015) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene murC CDS complement(385016..386116) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856529.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene murG CDS complement(386140..387540) product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014922.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(387570..388961) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene murD CDS complement(389004..390110) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014924.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene mraY CDS complement(390141..391670) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014925.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(391673..393208) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856539.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS complement(393218..395086) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014926.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS complement(395285..396079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(396076..397116) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene rsmH CDS complement(397274..397708) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene mraZ CDS complement(398159..398557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(398667..398843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 398867..399088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 399325..399879 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856553.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 399894..401009 product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene idsA CDS 401018..402508 product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(402477..402845) product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 402901..404244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(404241..405629) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856581.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(405674..406192) product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 406243..407439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(407345..408439) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014940.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(408502..409242) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(409266..410198) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(410237..411340) product GDP-mannose-dependent monoacylated alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014943.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene pimB CDS complement(411341..412384) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014944.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(412499..413128) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(414090..415712) product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene qcrB CDS complement(415712..416932) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014946.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(416929..417813) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172768931.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(417870..418415) product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(419028..419459) product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014950.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(419479..420552) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014951.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS 420943..422865 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene asnB CDS complement(422932..423276) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856623.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 423418..424110 product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856624.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 424122..424916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(424925..426028) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014956.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 426126..427613 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 427652..428188 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 428615..430396 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene thiC CDS complement(430388..430798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856631.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 430924..432957 product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014958.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene sucB CDS 433252..436095 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284375.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene gcvP CDS 436098..437210 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene gcvT CDS 437247..437639 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene gcvH CDS 437720..438523 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856633.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene lipB CDS 438651..439715 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856634.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene lipA CDS 439796..440581 product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(440655..441128) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856936.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 441247..442680 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene glnA CDS complement(442781..443890) product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 gene mcrC CDS complement(443887..446091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 446335..447312 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 447331..447540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 447540..447914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(447917..448462) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(448492..449256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(449303..449449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(449453..450895) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene thrC CDS 450935..452242 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(452257..452964) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015413.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(452975..453193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(453339..453806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(453799..454143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(454241..457312) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014971.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(457320..458657) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856962.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 458850..459908 product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS complement(459918..460160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 460044..461780 product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856966.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(461840..462028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(462104..462292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 462286..463560 product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856970.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(463573..464967) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856972.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(465458..466588) product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859605.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(466588..467304) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014976.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(467305..468444) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 468459..469031 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856982.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS 469042..470046 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856984.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(470625..471440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(471568..472299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 472979..473932 product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 tRNA complement(474074..474147) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(474216..474614) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859595.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 474952..477699 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene aceE CDS complement(477812..478810) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856999.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 478832..479131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 479128..479913 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(479983..480396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(480873..481667) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857011.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 482070..483749 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(483899..484987) product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039311.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(485123..486709) product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096455574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(486806..487909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 tRNA complement(487969..488043) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 488176..489072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 repeat_region 489117..491156 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggctcatccccgcttacgcggggagcac sequence02 source 1..74352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 107..1774 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149407.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(1787..2617) product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 2616..3917 product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 3946..4782 product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860005.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 4862..6433 product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene arc CDS 6430..7962 product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 gene dop CDS 8007..8198 product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856167.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 8201..9616 product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565680.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene pafA CDS 9653..10639 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 10642..11598 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014402.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS 11696..11959 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014401.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 gene tatA CDS 12116..13162 product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856179.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 gene tatC CDS 13184..16000 product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 16033..17160 product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014398.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(17172..17462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 17361..17906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(17921..18610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 18791..19393 product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014393.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 19396..20922 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene lnt CDS 20928..21821 product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010186600.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(21900..22283) product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863735.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 22405..22755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467698.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 22759..23460 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 23476..23640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856198.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 23820..24017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 24216..25142 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(25169..26482) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014384.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 26716..28059 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 28304..29116 product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014383.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene thiM CDS 29117..29746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 note possible pseudo, frameshifted CDS 29739..31274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 note possible pseudo, frameshifted CDS complement(31271..31873) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856229.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 31982..33055 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene corA CDS 33079..34245 product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064064.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS complement(34242..34688) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014373.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 34748..36199 product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene gndA CDS 36308..37606 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 37626..38474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309556.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(38466..38900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 38869..39360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(39645..40208) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856248.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(40355..40948) product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863762.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(40987..41664) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(41833..42267) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(42353..44644) product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014367.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene secA2 CDS 44732..45889 product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856255.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 45889..46278 product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400687.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 tRNA 46350..46424 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(46474..46812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 46812..47003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 47189..47701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 note possible pseudo, frameshifted CDS complement(47659..49041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(49246..49419) product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856746.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 49756..51015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(51012..51971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(51968..53713) product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014362.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS complement(53710..55014) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014361.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 55178..55984 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(55981..57366) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074061.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(57523..59103) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328343.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene der CDS complement(59096..59791) product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene cmk CDS complement(59791..60702) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(60758..61312) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene scpB CDS 61401..61967 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(61964..62761) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856272.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(62768..63646) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(63768..64775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(64788..65678) product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene xerD CDS complement(65675..66313) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(66317..67219) product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014348.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(67223..68374) product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 gene steA CDS complement(68394..70064) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014346.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene recN CDS complement(70064..70948) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(70945..71751) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856296.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(71751..71912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(71903..72886) product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(72886..73695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(73775..74134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 sequence03 source 1..49181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 176..664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(774..2276) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS complement(2288..3595) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013738.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 3969..5294 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene secY CDS 5294..5839 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 5842..6636 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene map CDS 6701..7552 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013729.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 7772..8035 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854422.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene infA CDS 8219..8587 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854425.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene rpsM CDS 8591..8995 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854428.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene rpsK CDS 9017..9622 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013730.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene rpsD CDS 9737..10747 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013731.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 10820..11317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 11466..12347 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene truA CDS 12422..13708 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013736.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene eccB CDS complement(13698..14846) product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013739.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene mycP CDS complement(14846..16198) product type VII secretion integral membrane protein EccD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564626.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene eccD CDS 16427..20146 product type VII secretion protein EccCa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382017.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene eccCa CDS 20147..21271 product type VII secretion-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013742.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 21414..21728 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013743.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 21798..22085 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854533.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 22365..22934 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene rplM CDS 22934..23467 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene rpsI CDS 23655..24998 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013744.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene glmM CDS 25144..25422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 25419..27134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS 27134..27394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(27398..28171) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 28436..31240 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 31336..33207 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene glmS CDS 33400..34923 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085191.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 35003..36109 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013748.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene alr CDS 36099..36599 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene tsaE CDS 36737..38278 product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 38442..38951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 38951..39658 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013751.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene tsaB CDS 39655..40155 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860686.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 gene rimI CDS 40165..41208 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013752.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene tsaD CDS 41299..41727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860693.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 41850..43313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 CDS complement(43332..43967) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(43964..45106) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 45219..45824 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029799.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 45808..47049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 47235..47528 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854559.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene groES CDS 47537..49153 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013754.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene groL sequence04 source 1..42931 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(402..476) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 636..3275 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014298.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene polA CDS 3259..4218 product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931514.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 4294..4650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(4614..5090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(5094..5825) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 6076..7536 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene rpsA CDS 7833..9884 product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 10047..10565 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene coaE CDS 10656..11018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 11053..13152 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948572.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene uvrB CDS 13282..13734 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 13818..14258 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(14329..15345) product App1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014988.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS complement(15366..17591) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400581.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(17755..18771) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014318.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS complement(18849..19451) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 19517..22357 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene uvrA CDS 22365..23213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 23559..24005 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014321.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene infC CDS 24042..24236 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene rpmI CDS 24292..24675 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene rplT CDS 24829..25281 product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162861142.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 25293..26192 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 26296..27342 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897202.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene pheS CDS 27367..29880 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene pheT CDS 30027..31070 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene argC CDS 31086..32255 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene argJ CDS 32269..33204 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene argB CDS 33201..34379 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 34376..35296 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014335.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene argF CDS 35300..35782 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 35864..37084 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858678.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 37091..38521 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene argH CDS 38740..40257 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313426.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 40277..41314 product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804303.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 41371..41544 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 41568..42827 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene tyrS sequence05 source 1..41088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1046..1657 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 1672..3099 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862124.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 3092..3862 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014105.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 3889..4440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014106.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 4673..5044 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene rpsL CDS 5051..5518 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854222.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene rpsG CDS 5841..7970 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854224.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene fusA CDS 8363..9553 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene tuf CDS complement(9776..11470) product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(11582..13486) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(13483..14475) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812440.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(14476..15459) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138444.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 15783..16490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013697.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(16479..17054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(17047..17613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS complement(17606..18571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(18571..18765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(18768..19115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(19121..19600) product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074067.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 20320..20625 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854291.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene rpsJ CDS 20649..21305 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene rplC CDS 21302..21955 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene rplD CDS 21955..22257 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854294.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene rplW CDS 22293..23129 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene rplB CDS 23143..23421 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854296.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene rpsS CDS 23425..23787 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene rplV CDS 23787..24530 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854298.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene rpsC CDS 24534..24950 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854302.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene rplP CDS 24950..25180 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene rpmC CDS 25183..25491 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene rpsQ CDS complement(25564..26385) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 26488..27435 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013789.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 27451..28521 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537650.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 28525..29559 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 29645..30487 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(30524..30916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(30913..31797) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 31818..32069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(32334..33263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS 33796..34164 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene rplN CDS 34169..34483 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene rplX CDS 34486..35037 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene rplE CDS complement(35147..36028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS 36170..36955 product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727259.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(36952..37770) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene fdhD CDS complement(37770..38018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 38374..38757 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene rpsH CDS 38773..39309 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene rplF CDS 39313..39714 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene rplR CDS 39755..40378 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene rpsE CDS 40382..40567 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860590.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene rpmD CDS 40571..41017 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rplO sequence06 source 1..25788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(26..976) product replication protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205285.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS complement(1353..1616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(1823..1957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 1998..2117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS complement(2157..2531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 2763..7196 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(7281..7517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(7528..8061) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(8471..8770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(9081..9653) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015249.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(9671..11170) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 11217..11429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 11435..11689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 11689..12282 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014562.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 12715..12864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(13144..13407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(13766..14218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS complement(14677..14943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(14940..15530) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058038.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(15660..15926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(16070..19420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 19888..20181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 20198..20908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(21069..21410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(21987..22274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 22357..22674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(22897..23109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(23358..23579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(23681..24070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(24211..24501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 sequence07 source 1..24676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1575 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111699.1:potassium-transporting ATPase subunit KdpA locus_tag LOCUS_07070 CDS 1572..3635 product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223786.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene kdpB CDS 3722..4204 product potassium-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005087732.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 4217..6811 product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 6804..7517 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS 8104..8409 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815632.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 8402..9550 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 9735..11186 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene amn CDS 11260..11772 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 11793..13274 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 13560..14057 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860285.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 14140..14493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 14507..15103 product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(15086..16156) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283847.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 16328..16897 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067248.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 16967..18637 product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013418.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(18634..19725) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 19838..20608 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283863.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(20609..22876) product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013422.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(22877..23533) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857169.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(23668..24435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 note possible pseudo, frameshifted sequence08 source 1..20076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(70..633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(1188..3014) product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456327.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 3028..3198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 3191..3700 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014075.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS complement(3697..4890) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(5026..5931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(5953..7284) product alkaline phosphatase PhoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009969242.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene phoD CDS complement(7584..8192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS 8322..9746 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 9756..10697 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 10890..11399 product gluconokinase, GntK/IdnK-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015160.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(11396..12790) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(12963..13580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(13756..14877) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene ugpC CDS complement(14922..16244) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014326.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(16327..17193) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014325.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS complement(17201..18181) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265737.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 18441..19658 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004122184.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 sequence09 source 1..10303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..1226 product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512298.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(1278..1463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 1611..5105 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 5212..9207 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013691.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 sequence10 source 1..4069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(936..1886) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(1985..2218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 note possible pseudo, internal stop codon, frameshifted CDS complement(2483..2671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 2986..3507 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013688.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene rplJ CDS 3596..3985 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene rplL sequence11 source 1..3319 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA complement(16..122) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence12 source 1..401856 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 110..892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(889..1512) product DUF3239 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013908.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS complement(1509..3134) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858302.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(3131..5146) product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013909.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 5213..5398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858306.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(5486..6115) product DUF3235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862355.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 6437..6817 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858310.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(6814..7392) product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858312.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(7399..8163) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858314.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 8235..8870 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083271.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 8920..10323 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 10333..11139 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS complement(11100..11930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858320.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS complement(11933..12808) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013912.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene sepH CDS complement(12922..14040) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013913.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene serC CDS 14201..15493 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013914.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS 15617..15976 product FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858324.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene fkpA CDS 16046..16909 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803740.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 17200..17547 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS 17547..19190 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013917.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 19284..20252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(20255..21247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(21361..21789) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229473.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 21901..22530 product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903504.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 22783..23226 product DUF2871 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001836564.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(23411..24004) product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887713.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(24210..24683) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776012.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS 24866..25411 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 25529..25696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 25687..25944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 note possible pseudo, internal stop codon, frameshifted tRNA complement(26589..26662) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(26733..27014) product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013923.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(27014..27544) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013924.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(27544..28341) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(28352..29110) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 29140..33945 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013925.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 33964..34782 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862398.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 34798..35220 product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858364.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(35386..37023) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene pgi CDS complement(37110..38456) product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225704.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(38504..38827) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 38925..41438 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013929.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene pcrA CDS complement(41435..42193) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 42220..42363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(42842..43591) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(43835..44137) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 44092..45675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 45686..46306 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858391.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene purN CDS 46334..47866 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene purH CDS 47882..48829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 48854..49480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS complement(49497..50213) product TetR/AcrR family transcriptional regulator AmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene amtR CDS complement(50315..51094) product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(51336..51590) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene rpsR CDS complement(51606..51911) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013938.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene rpsN CDS complement(51915..52079) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene rpmG CDS complement(52082..52318) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene rpmB CDS 52791..53060 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 53076..53249 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene rpmF CDS 53415..54113 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 54305..55669 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013941.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 55779..57245 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 57331..57939 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858456.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(58286..58789) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene mscL CDS complement(58889..59590) product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(59639..60214) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092258658.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 60282..61208 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 61264..62574 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858461.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS 62574..63284 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458539.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 63515..64804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS complement(64819..65535) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 65692..66105 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 66092..66793 product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858471.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(66811..68391) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013949.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 68455..69309 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858478.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene rsmI CDS 69557..71413 product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene betP CDS 71516..73399 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 gene metG CDS complement(73534..74034) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(74045..74500) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963787.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 74538..75392 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013965.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 75678..76859 product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 76932..77792 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene rsmA CDS 77793..78773 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(78774..80117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777041.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 80210..82018 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013968.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 81985..83718 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730823.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(83723..84637) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015084.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 84803..85393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 85482..85805 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776253.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(85998..89750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(89871..90713) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 90738..91781 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(91758..92933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(92976..93575) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(93568..95946) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013977.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 96121..96834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013979.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(96831..97370) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(97389..97766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(97778..98119) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 98109..99014 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 99215..100732 product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803796.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(100805..102439) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(102464..103300) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 103445..104734 product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776429.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 104727..105419 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(105416..106063) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013986.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene pth CDS 106147..106536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 note possible pseudo, internal stop codon CDS 106567..107082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 note possible pseudo, internal stop codon CDS 107147..108601 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(108739..109485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(110222..110935) product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(111022..111681) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(111674..112852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(112882..113769) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene ppk2 CDS complement(113846..114706) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(114712..115305) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene pth CDS complement(115335..115985) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS complement(116240..117214) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860060.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(117230..118675) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013993.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene glmU CDS complement(118744..119940) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 120063..120779 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013417.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 tRNA complement(120783..120855) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 120938..121543 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 121544..125185 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856733.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 gene mfd CDS complement(125186..126661) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 126713..127306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 127318..128079 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 128170..129447 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene eno CDS complement(129437..130648) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS complement(130732..131319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(131355..131885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 131984..132544 product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014020.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 132553..133101 product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 133112..134077 product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene ppx2 tRNA 134118..134192 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 134383..135153 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 135518..136240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 136259..138106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(138149..138427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(138469..138990) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014029.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene greA CDS complement(139111..139581) product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856773.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 139677..140567 product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene mca CDS 140571..140882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 140895..141671 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(141675..142601) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856789.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene coaA CDS 142720..144003 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene glyA CDS complement(144000..144365) product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856795.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 144401..145075 product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014037.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 145222..145812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 145997..147361 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088595.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 147431..148009 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(148162..148371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(148371..149939) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(149933..150556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(150731..152131) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856814.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(152217..153230) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene glpX CDS 153419..153988 product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014052.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS complement(153972..154340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS complement(154340..154609) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856839.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(154631..155872) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene xseA CDS 156014..156964 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(157029..157832) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856844.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(157895..158995) product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776294.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(159002..160471) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014057.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 160519..161604 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene ychF CDS 161733..162266 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119882.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 162494..163405 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 163920..164828 product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(164897..166258) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 166540..167622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 167813..168400 product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002994169.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene pcp CDS 168448..169014 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804584.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 169084..171714 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115412280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 171715..172773 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804586.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 172770..173885 product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804587.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene nrfD CDS complement(173882..174472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(174474..175457) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene selD tRNA 175628..175722 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 175748..177064 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene selA CDS 177065..178837 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804590.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene selB CDS complement(178866..179951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 180218..182083 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184324359.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 182228..182914 product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856259.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene zupT CDS complement(182943..183890) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS complement(183894..184430) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(184431..185159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 185435..187345 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene typA CDS complement(187356..188018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS complement(188029..188205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS 188222..189739 product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569582.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS 189729..190598 product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene mshB CDS 190598..190975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858629.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 191029..191352 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS 191356..192444 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene dapC CDS 192413..193276 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 193307..193870 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(193867..194043) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(194176..194658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS complement(194651..194860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(194915..195775) product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066563683.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(196125..197510) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene aroP CDS complement(197556..198527) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730317.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene dapD CDS complement(198545..199903) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene aroP CDS 199942..201081 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene dapE CDS 201085..201849 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 201846..202676 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855021.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene folP CDS 202673..203395 product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 203399..203692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 203705..203872 product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855015.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 203882..204748 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(205174..206385) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150490919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(206677..208443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(208440..209222) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(209447..210658) product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150490919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS complement(210923..212365) product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(212378..213538) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855006.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene glgA CDS 213642..214859 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene glgC CDS complement(214856..215503) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863800.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 215655..216284 product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene sigE CDS 216385..216834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 216858..217412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(217417..218547) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 218653..219393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(219823..223545) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014138.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS complement(223707..224441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 224558..226261 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854963.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 226343..227191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014144.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 227319..228161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(228158..228739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 228789..230030 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 230344..231540 product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 231533..232540 product DUF4928 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 232782..233117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(233104..233499) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 233633..234979 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(235075..235221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 235216..235515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS complement(235553..236485) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene hutG CDS complement(236509..237849) product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777033.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(237868..239016) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(239043..240209) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 240410..241162 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 241271..242824 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene hutH CDS 242873..243463 product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109873.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(243446..244240) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033434014.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 244420..246096 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777035.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 246097..247266 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene hutI CDS 247310..249169 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 249318..250544 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(250565..251014) product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073069.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(251059..251637) product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014166.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(251675..253240) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene putP CDS 253408..256443 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014168.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 256447..257268 product 2-oxo acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854920.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 257268..258386 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014169.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 258386..260971 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014170.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 260977..261483 product MarR family transcriptional regulator RosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861276.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene rosR CDS 261489..261788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 261897..262100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(262159..263325) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(263329..264228) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(264231..264650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 264837..265634 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 tRNA complement(265732..265806) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(265860..267431) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014178.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(267549..268169) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(268166..269671) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(269671..270456) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 270668..272320 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014179.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene argS CDS 272321..273658 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014180.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 gene lysA CDS 273833..275176 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 275201..276130 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014183.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene thrB CDS complement(276117..276776) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014184.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(276815..278647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(278651..279415) product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110929.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene modA CDS complement(279483..279743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 279810..280889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 280876..282054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 282055..283422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(283638..284234) product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(284234..284713) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028813.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene moaC CDS complement(284723..285922) product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014194.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(285933..287045) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014195.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene moaA CDS complement(287112..288893) product long-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 289249..291087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 291080..292156 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854866.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene prfA CDS 292163..292999 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene prmC CDS 293032..293700 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 293713..294888 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014199.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 294905..295339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854858.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 295798..296610 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene atpB CDS 296714..296956 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 297001..297573 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 297580..298395 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 298456..300096 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene atpA CDS 300147..301136 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014203.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 301140..302585 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene atpD CDS 302596..302964 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 303150..303626 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854831.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 303650..304342 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene nucS CDS 304637..304945 product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854825.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 304946..305872 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014209.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS 305889..306281 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014415.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(306287..308404) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014214.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene glgB CDS complement(308449..310464) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014215.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 310517..311338 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 311335..312162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854804.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 312159..313292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014217.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 313317..314099 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014218.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 314108..315049 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014219.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 315049..316164 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014220.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(316161..317357) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 317579..318700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(318681..319517) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 319612..320697 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861382.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene mnmA CDS complement(320690..321058) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 321136..322050 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014226.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(322047..323168) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014224.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(323215..323499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(323509..324501) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015101.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(324501..324998) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015100.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(325039..325710) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS 325756..327825 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014227.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene ligA CDS complement(327836..328495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861389.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 328700..328996 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene gatC CDS 328997..330484 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene gatA CDS 330565..331065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(331138..331461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 331509..332885 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 332910..333941 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 334021..334989 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854741.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(335002..335823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 335836..337350 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene gatB CDS 337508..338539 product furfural detoxificationalcohol dehydrogenase FudC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013571.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene fudC CDS 338741..340168 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS 340176..341255 product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene mgrA CDS complement(341279..341971) product L-lysine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854734.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene lysE CDS 342042..342914 product ArgP/LysG family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 342984..343925 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 344054..344512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS 344512..344826 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(344801..346075) product alpha-(1-2)-mannopyranosyltransferase MptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014935.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene mptD CDS complement(346154..348007) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene ilvD CDS complement(348061..348603) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014244.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 348912..350762 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS 350765..351283 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286979.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene ilvN CDS 351383..352396 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854117.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene ilvC CDS 352519..354309 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 354251..355204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 355268..356854 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854094.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 gene serA CDS 356972..357991 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 358170..358979 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 358972..359547 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014262.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(359544..360509) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 360721..361863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(361948..363429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(363426..364334) product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS complement(364331..365059) product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(365052..365930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS complement(365923..367434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(367434..369035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(369072..371066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(371105..371515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 371814..373241 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447895.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene gltX tRNA 373482..373554 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 373593..373666 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 tRNA 374320..374395 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(374819..377026) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(377030..379615) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 379903..380202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(380377..381000) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014280.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 381113..382534 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014281.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene leuC CDS 382556..383146 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene leuD CDS 383301..384257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(384362..385360) product bifunctional NUDIX hydrolase/histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858854.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 385522..386520 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 386543..387604 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(387618..388517) product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014286.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 388546..389502 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858840.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 389503..390141 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858837.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 390152..391495 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858835.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 391498..393630 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014290.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 393650..393862 product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858832.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 393863..394444 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858829.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene rsmD CDS 394471..394944 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene coaD CDS 394941..395684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(395771..396535) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(396535..397488) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858824.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(397481..398368) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(398368..399258) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014292.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 399630..401795 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031789.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 sequence13 source 1..2913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 440..739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(723..908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(2232..2378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 sequence14 source 1..2816 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 84..311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 311..1444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11420 sequence15 source 1..1687 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1540 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014066.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 sequence16 source 1..1663 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(31..1392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 sequence17 source 1..1551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 21..1534 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 sequence18 source 1..1441 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 227..547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 586..1407 product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002301552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 sequence19 source 1..1195 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence20 source 1..1026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence21 source 1..910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence22 source 1..523 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 338..505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 sequence23 source 1..310889 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region <1..148 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcatccccgcttacgcggggagcac CDS complement(589..1527) product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene cas1e CDS complement(1524..2225) product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene cas6e CDS complement(2222..2938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(2953..4095) product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 gene cas7e CDS complement(4126..4488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(4644..4793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(4790..6535) product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674071.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(6632..8098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 note possible pseudo, internal stop codon CDS complement(8108..9412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 note possible pseudo, internal stop codon CDS 9853..10668 product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 10680..12257 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015583.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 12295..12906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS complement(12936..13295) product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS complement(13313..13882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(14220..14351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 14506..14925 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063604.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS complement(15173..15406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(16619..16843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 16949..17584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(18344..18541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS 19438..20787 product IS256-like element ISRm3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS 21296..21601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(21845..22030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 22258..22752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(23305..23454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(23755..24030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 24089..24742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 24742..26049 product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530317.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 26300..27196 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224176.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 27210..28388 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224177.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 28388..29242 product transcriptional repressor QapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099726.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene qapR CDS complement(29648..30073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(30277..30606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 30779..31237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS 31264..31416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(31479..32327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027651.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(33032..34507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 34857..36098 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776761.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene wecC CDS 36122..36532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 36562..38160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 38161..38721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 38718..42665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 42665..44533 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(44530..45012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 45567..45731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 46645..47370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(47335..48873) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776768.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(48866..49879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 tRNA 50466..50539 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(50757..51179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS complement(51172..51576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(51580..51909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(51909..53279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(53343..53990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(53999..54277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(54300..54593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(54627..54938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(54978..56006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(56010..57761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(57762..58631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(58622..59350) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(59359..64926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(64957..65337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(65394..65663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(65764..66513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS complement(66553..66918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS complement(66923..67171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(67184..67351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(67348..67695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(67698..68081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(68084..68998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(69011..69376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(69403..69951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(70071..70922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(70944..72338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(72355..74004) product terminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389873.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS complement(74017..74328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(74402..74863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(75267..75557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(75789..76400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(76454..76714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(76711..76902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(76836..77162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(77233..77448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(77445..77777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(77770..78147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(78140..78478) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(78471..78731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(78728..79072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(79069..79443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(79573..79977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(79974..80819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(80832..81014) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(81004..81144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(81144..81815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(81812..82231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(82295..83155) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(83152..83454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(83457..83576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(83586..84056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(84057..84377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(84378..85193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(85196..85363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(85363..85566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS complement(85563..85742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(85742..86653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(86640..86948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(86939..87112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(87096..87290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(87368..87535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 88056..88670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS complement(88675..88896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(88945..89715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(89778..90038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 90179..90700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 90693..91070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 91067..91672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 91892..92992 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 93348..94973 product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(94991..95674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(95687..96868) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776765.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene wecB CDS complement(96972..98141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 98683..98964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(99044..100966) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene dnaG CDS 101178..101639 product ribonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 101642..101875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(102014..105280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(105590..106924) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015002.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS complement(106931..107506) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857039.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 107552..109588 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015004.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(109693..110133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(110133..110642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015006.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(110645..112024) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 112209..112499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 112570..112989 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(113069..113824) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(113835..114551) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene recO CDS complement(114558..115595) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015011.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene era CDS complement(115677..115916) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 115915..116301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(116387..117403) product formamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938461.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(117778..118626) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene pdxY CDS complement(118678..119295) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene ybeY CDS complement(119292..120302) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015013.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(120296..121054) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015014.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS complement(121054..122205) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015015.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene dnaJ CDS complement(122275..123324) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859450.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene hrcA CDS complement(123335..123523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(123723..124862) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 gene hemW CDS 125010..126404 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 126404..127462 product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014191.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(127440..127697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 127685..128557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS complement(128780..130384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(130729..131409) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(131662..133494) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 133589..135712 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene malQ CDS complement(135761..136000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(135993..136208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 136247..137545 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015022.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(137546..138082) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948619.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 gene idi CDS complement(138079..138627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015028.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS 138818..140728 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 140739..141911 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015029.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS 142114..143514 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene brnQ CDS 143701..144720 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015031.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(144717..145259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 145456..146220 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS 146353..147840 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS 147837..148805 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015038.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS 148805..149626 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS 149623..151077 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015040.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 151145..152836 product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091849.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(152833..153375) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859391.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene thpR CDS complement(153379..153501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(153587..154981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 155155..155535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(155560..156213) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977171.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(156210..157064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(157489..158151) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030771.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(158151..158762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(158759..159973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS complement(160049..161425) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224417.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 161540..162571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(162768..164618) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015054.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene lepA CDS 164649..165173 product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859345.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 165443..165706 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene rpsT CDS complement(165825..166403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 166738..167580 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 167573..168904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(168901..169548) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015055.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(169545..169934) product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(169945..170913) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015057.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene holA CDS complement(170924..172336) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(172355..173047) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(173147..174022) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015060.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(174022..174720) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859329.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(174727..175197) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859327.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene rsfS CDS complement(175317..175934) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene nadD CDS complement(175958..177226) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859321.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(177323..177625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(177625..178530) product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(178530..179459) product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(179493..180749) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015063.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene proB CDS complement(180787..182319) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015064.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene obgE CDS complement(182557..182835) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859304.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 gene rpmA CDS complement(182878..183183) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene rplU CDS complement(183410..187282) product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015068.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS 187486..188253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(188250..189314) product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 gene arsB CDS 189417..189773 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(190042..190461) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene ndk CDS complement(190531..190842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(190889..191401) product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567665.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(191398..192933) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS complement(192933..195653) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(195734..196684) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015079.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 197058..197825 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015080.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(197892..199187) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene clpX CDS 199415..200182 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727184.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene fabG CDS complement(200282..200536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(200703..200993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727385.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(200997..202337) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(202614..204116) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(204353..204976) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(204997..205596) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS 205735..206415 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS complement(206500..206709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS 206678..206998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 207049..209244 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876938.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene nrdE CDS 209426..210322 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene nrdF CDS 210619..211200 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704526.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(211379..212737) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene tig tRNA complement(212827..212901) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(213036..213866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 tRNA 213989..214063 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 214163..214873 product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS 215054..215686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(215630..215833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(215993..216238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 216256..216537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 note possible pseudo, frameshifted CDS complement(216624..217097) product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 217214..217618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(217615..218238) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 218336..220852 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene pepN CDS complement(220849..221628) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029507.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(221704..222420) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015125.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS complement(222486..223700) product alkylhydroperoxidase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015117.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(223730..224458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 note possible pseudo, frameshifted CDS complement(224356..225351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 note possible pseudo, frameshifted CDS complement(225351..226163) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863669.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(226160..227167) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015119.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(227171..228826) product TIGR04028 family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015120.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 229029..230897 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(230933..232090) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015127.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 232236..233243 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727594.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS 233244..233627 product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(233728..234819) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894041.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene ald CDS complement(235109..235747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567537.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(235790..236203) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(236232..237902) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene ettA CDS complement(238022..238663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(238846..240810) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015135.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 240964..241881 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207887.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 tRNA 241921..241996 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS 242091..242891 product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015148.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 gene cmrA CDS complement(242888..244435) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 244647..245294 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015149.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene orn tRNA 245344..245419 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(245448..246404) product MsnO8 family LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804400.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(246434..247681) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 tRNA 247876..247951 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(248003..248764) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(248755..249810) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(249810..250973) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061356.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS complement(251064..252341) product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS complement(252392..252670) product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 252767..253234 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene bcp CDS 253257..253463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 253539..254525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(254737..255885) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(255945..257183) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(257195..258064) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene pflA CDS complement(258067..258318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(258359..260446) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112605.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene pflB CDS 260763..262673 product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(262674..263264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 tRNA complement(263342..263424) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 263506..263937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 263940..264284 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(264281..264889) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015172.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene rdgB CDS complement(264883..265611) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene rph CDS complement(265627..266388) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857989.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 gene cdpA CDS complement(266461..267240) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene murI CDS complement(267240..267893) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860306.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(267907..268833) product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(268833..269369) product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(269374..269700) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897801.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene clpS CDS 269805..271151 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015184.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 271170..273149 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015186.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(273115..273846) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567712.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(273839..275029) product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082353449.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene serB CDS complement(275133..276827) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene ctaD CDS complement(277170..278159) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015189.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene nrdF CDS 278302..278997 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567723.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(279053..281215) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857952.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene nrdE CDS complement(281270..281701) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene nrdI CDS complement(281724..281963) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 gene nrdH CDS complement(282270..283175) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(283341..283463) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene ykgO CDS complement(283584..284939) product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594890.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 284967..285788 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015194.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene nadE CDS complement(285785..286510) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015195.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(286541..286915) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721792.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 286996..287904 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 tRNA complement(287956..288029) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS complement(288106..288837) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(288892..289356) product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(289373..290989) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015199.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene pgm CDS 291127..292548 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 292559..292861 product fluoride efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015200.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 292858..293217 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 293303..294481 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014014.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 294450..296777 product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856739.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(296832..299375) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(299376..300104) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 300459..300674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 note possible pseudo, internal stop codon, frameshifted CDS 300885..301652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 note possible pseudo, internal stop codon, frameshifted CDS 301778..302383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(302411..302605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 302974..303207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 note possible pseudo, frameshifted CDS complement(303366..305138) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(305131..306879) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390093.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(306872..308356) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(309075..309548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS 309911..310360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(310267..310542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 sequence24 source 1..489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 275..432 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aggggtggtaaatatgcgca sequence25 source 1..462 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence26 source 1..450 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence27 source 1..413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence28 source 1..409 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence29 source 1..252544 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 363..1751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 note possible pseudo, frameshifted CDS complement(1836..2540) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene rplA CDS complement(2609..3052) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene rplK CDS complement(3225..4154) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013678.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene nusG CDS complement(4279..4614) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene secE tRNA complement(4827..4900) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA complement(5047..5120) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA complement(5159..5234) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS 5391..5741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 tRNA complement(6302..6384) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS complement(6495..7499) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 7610..8863 product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013675.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(8895..9584) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013674.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(9596..10795) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854169.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(10856..11326) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(11327..12949) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013670.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene menD CDS complement(13007..13741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(13821..16241) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 16442..17353 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(17357..18397) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013669.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 18760..22059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 22471..22977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 22961..23290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 repeat_region 23341..24719 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagtctatcaggggtaatgagaactgaaccccagc CDS complement(24763..25113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 25981..26442 product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS 26601..27704 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 27720..27869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 27961..28149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 28319..29485 product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115334.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 29492..30178 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399558.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 30175..31008 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111894.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 31008..31835 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111893.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 31946..33025 product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013660.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene menE CDS complement(33026..33706) product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854638.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 33912..34802 product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013659.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(34799..35161) product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082868777.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 35164..35409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(35406..35666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(35667..36686) product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene ccsB CDS complement(36781..38412) product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013653.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(38420..39223) product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013652.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(39224..39835) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855585.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS complement(39835..40443) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039673525.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(40452..41753) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265562.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene hemL CDS 41861..42382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(42379..42693) product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 42829..43647 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804286.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 43764..44801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(44872..46251) product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013650.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(46252..47286) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265560.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene hemE CDS complement(47324..47815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(47812..48540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(48550..49533) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene hemB CDS complement(49562..51283) product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013645.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(51447..52334) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013637.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene hemC CDS complement(52335..53669) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(53743..53985) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 54050..55111 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855543.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(55538..55726) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS complement(55952..56743) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene proC CDS complement(56816..57919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(57929..58774) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265553.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 58892..59818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(59815..60522) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(60519..61781) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855497.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(61845..62591) product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855496.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(62632..63897) product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene mshA CDS 63964..65679 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 65681..66166 product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226078.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 66239..67948 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 67960..69489 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(69486..70724) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013999.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 70796..71272 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804934.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(71414..72529) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 72545..73036 product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855491.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 73057..73869 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 74049..74831 product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(74828..75349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(75349..75639) product DUF2516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013613.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS complement(75645..76082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(76102..77436) product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(77688..78062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013608.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(78119..78868) product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(78868..80883) product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(80899..81654) product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 82039..83433 product acetate metabolism transcriptional regulator RamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859703.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene ramB CDS complement(83558..84970) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013602.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene lpdA CDS 85504..86916 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 86950..88029 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 88075..89400 product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013579.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 89542..91020 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015456.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 91076..92080 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855430.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene rfbB CDS 92083..93438 product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 93439..94287 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013572.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene rfbA CDS complement(94291..94905) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(94905..95990) product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863269.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(96042..96857) product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 97009..98631 product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 tRNA complement(98687..98762) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(98839..100038) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 100109..101608 product class III adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285716.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 101621..102859 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(102809..103411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(103421..106396) product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013552.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene topA CDS 106645..107274 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(107291..107494) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013551.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS 107674..110037 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(110061..110387) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(110380..110697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863285.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(110750..110869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(111932..112210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(112207..112563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(112767..113513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS complement(113788..113961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(113942..114601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(114598..114783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(115058..117904) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(118230..119816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(119835..120002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(120126..120413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(120416..122086) product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028449.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS complement(122199..122795) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013549.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(122792..123580) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(123573..124751) product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(124748..125815) product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013546.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(125819..126229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 126276..127157 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(127154..127870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 127979..128482 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 128603..129517 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013543.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS complement(129514..130710) product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013542.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS complement(130768..131469) product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013541.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(131466..132029) product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(132039..132695) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene nth CDS 133036..133719 product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(133940..134755) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285704.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(134774..135232) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855793.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(135233..135391) product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(135436..135759) product WhiB family transcriptional regulator WhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855789.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene whcA CDS 135904..138396 product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(138424..138888) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS 138913..139812 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 tRNA 139891..139967 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(140003..141172) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083499.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(141190..141366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(141827..143275) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013522.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 143362..143958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(144053..145603) product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013509.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 145686..146252 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 146564..147937 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(148048..149079) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(149114..150379) product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855724.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 150609..151487 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(151484..152509) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977073.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 152831..154648 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene leuA CDS 154706..155482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 155592..157769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 157821..159269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 159297..160574 product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013502.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 160567..161340 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013501.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 161450..162541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(162565..163221) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013500.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(163292..163660) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(163724..166033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS complement(166097..166687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(166641..167912) product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 tRNA 168250..168338 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 168960..173885 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015608.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 173767..174003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 note possible pseudo, frameshifted CDS 174142..175362 product DUF4263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444645.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 175484..176035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(176245..176529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(176513..176773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(177048..177383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(177394..178974) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(178986..179753) product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013493.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene gluQRS CDS 179913..180587 product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(180572..181816) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 gene tgt CDS complement(181819..184365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(184655..185515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(185602..186243) product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(186421..187470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS complement(187463..188257) product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(188257..189294) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859752.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(189287..190333) product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859750.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(190344..192227) product HtaA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013621.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 192348..192851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 tRNA complement(192890..192978) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(193068..193268) product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(193320..193751) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855650.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene tadA CDS complement(193777..194256) product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863394.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 194359..195324 product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013487.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(195321..196355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(196358..197281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(197463..197654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 tRNA complement(197718..197791) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS complement(197911..198984) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013819.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(199035..200609) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(200870..202234) product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453796.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene mgtE CDS complement(202326..203105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(203150..203458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(203451..203786) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891506.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 203945..204310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS 204339..204722 product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087887.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 tRNA complement(205116..205204) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS 205312..206364 product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 gene hisC CDS 206365..206757 product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013480.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(206754..207014) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863405.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 207074..208210 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013476.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 208207..208686 product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013474.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 208676..209137 product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013473.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 209134..210132 product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013472.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(210160..210420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 tRNA complement(210648..210732) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 210895..211866 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857642.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(211863..213119) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013468.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 213294..214184 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 214231..215034 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(215031..215621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 215803..216717 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(217012..217452) product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897783.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(217464..218378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013461.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(218382..218846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 218875..219156 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 219283..220698 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 220736..221494 product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013458.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 221708..223648 product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857673.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 223723..227181 product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013456.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(227120..228496) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567734.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(228560..229453) product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013428.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(229494..231428) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013430.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 231471..232052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 232053..232904 product PrsW family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(232938..233255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(233252..233611) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(233608..233913) product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863721.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(233919..234746) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(234747..235031) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(235067..235912) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(235995..236324) product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(236334..237008) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013426.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(237145..237654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 note possible pseudo, frameshifted CDS complement(237771..238121) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 238235..238960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 239614..239802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(239871..241763) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(241760..242119) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(242147..242443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(243011..244786) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066521.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene betA CDS 245120..247369 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776257.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene betT CDS 247415..248992 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292971.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(249077..249622) product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(249661..250350) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013424.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 250501..250968 product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858809.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 251588..252019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(252114..252431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 sequence30 source 1..186056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..1343) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene murA CDS complement(1365..2204) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 2469..3404 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene cysK CDS 3469..4038 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene cysE CDS complement(4079..4369) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 tRNA complement(4417..4490) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(4509..4583) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS complement(4669..4983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 tRNA complement(5040..5114) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(5150..5225) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 5308..5640 product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776001.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 tRNA complement(5671..5744) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(5853..7355) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 7547..8692 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene dusB CDS 8794..9522 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene phoU CDS complement(9597..10370) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 gene pstB CDS complement(10422..11336) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene pstA CDS complement(11351..12397) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene pstC CDS complement(12518..13696) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene pstS CDS complement(13834..14820) product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene mshD CDS 14785..15612 product LmeA family phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(15596..16480) product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015227.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 16687..17382 product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(17379..18170) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 18060..19337 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015229.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 19472..19675 product DUF3073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863131.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(19765..20817) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene purM CDS complement(20836..22332) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene purF CDS complement(22343..22747) product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 22781..23791 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 23928..25091 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(25088..25684) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015232.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(26022..28331) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene purL CDS complement(28345..29028) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene purQ CDS complement(29029..29271) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene purS CDS 29503..32277 product SpnA family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(32463..33146) product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854006.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(33203..35326) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(35376..36269) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(36412..37842) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328348.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene purB CDS complement(37884..39191) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863105.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene purD CDS 39194..39622 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(39619..41130) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(41143..41847) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(42034..43779) product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 44051..45463 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 45429..45983 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015249.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 tRNA complement(46011..46084) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 46254..47972 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 48059..48430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 48445..49887 product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 49884..50405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 50424..51206 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863055.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene otsB CDS complement(51232..52404) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 52443..53438 product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 53438..54139 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS 54132..55031 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015262.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 55043..55879 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015255.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS 55943..56953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(56957..57904) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene rlmB CDS complement(57927..59306) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene cysS CDS complement(59360..59842) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene ispF CDS complement(59835..60584) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015289.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene ispD CDS complement(60556..61140) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 61332..61919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(62033..62224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS 62211..63359 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015292.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene radA CDS complement(63363..64067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(64132..64746) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 64782..65642 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(65699..65875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 66039..67139 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(67232..69994) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015301.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 70214..71419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(71475..72896) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015308.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 73009..74445 product GuaB1 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015302.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 75192..76067 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 76078..77607 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013773.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(77669..79246) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015310.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene lysS CDS 79435..81537 product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 81764..83476 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 83460..83717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 83708..84649 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 84699..85997 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118354.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS 86011..87312 product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055726.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(87309..87929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(87929..88819) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(88816..89490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(89491..90534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(90540..91013) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(91010..91495) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene folK CDS complement(91495..91875) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene folB CDS complement(91879..92841) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene folP CDS complement(92879..93472) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 gene folE CDS complement(93472..95820) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene ftsH CDS complement(95833..96420) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene hpt CDS complement(96433..97317) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 gene tilS CDS complement(97370..98527) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 gene dacB CDS 98724..99212 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(99423..100199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(100249..101649) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776542.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS complement(101646..102332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 102443..103135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 103139..103795 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(104082..104576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(104794..106038) product IS256-like element IS1081 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901078.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(106103..106402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS 106818..107114 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 107152..107610 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 107611..111513 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(111536..112969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 112980..113255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(113313..114461) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459069.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS complement(114739..115638) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene ppk2 CDS complement(115792..115938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(115972..116151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(116818..118464) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862917.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene groL CDS complement(118698..120668) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727591.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 120897..122264 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015336.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 122596..125577 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 125578..126078 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 126071..127897 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853718.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS 127890..128417 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS 128417..128692 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS 128689..129069 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853711.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene mnhG CDS 129085..130599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(130631..131767) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(131948..132745) product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015340.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(132769..133044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 133043..133666 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS 133666..134655 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015341.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 134768..135577 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 135578..137041 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(137153..137932) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(137939..138958) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(138961..139455) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853671.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 139526..140971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 140971..141984 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 141981..144554 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015349.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(145198..145644) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015633552.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(145782..147005) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862874.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(147006..148367) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853660.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene pta CDS 148596..149957 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015351.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 149961..150467 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015352.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(150464..151816) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853648.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene purT CDS complement(151968..152825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(152980..157245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(158016..158339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(158713..160005) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015361.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 160084..160932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(160986..162185) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 162329..163411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 note possible pseudo, frameshifted CDS complement(163550..164584) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene fbaA CDS complement(164729..165919) product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382136.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(165974..166672) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(166659..167249) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene pyrE CDS complement(167319..168773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(168865..169722) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(169779..172334) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015370.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene clpB CDS complement(172467..173879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(174140..175513) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 175693..176865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(176862..177677) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015383.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 177769..178032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 178029..179195 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015385.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(179213..180733) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015386.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(180978..181427) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015387.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(181448..182653) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene dnaJ CDS complement(182751..183458) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015389.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene grpE CDS complement(183458..185308) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene dnaK CDS 185761..185937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 sequence31 source 1..145223 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..1167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(1164..1967) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(1964..2338) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015515.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2542..3639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(3636..4373) product rod-shaped morphology protein RsmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855053.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene rsmP CDS complement(4457..4825) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene trxA CDS 4943..5143 product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855276.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 5152..7305 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013619.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 7315..8616 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855060.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 8606..9109 product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015564.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(9111..10541) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015543.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene dnaB CDS complement(11009..11461) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene rplI CDS complement(11510..12058) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400534.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(12108..12398) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene rpsF CDS complement(12521..12709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(12706..14103) product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015546.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(14110..16350) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015547.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(16426..16803) product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015548.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 16921..18009 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855107.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 18064..18564 product MarR family transcriptional regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855083.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene carR CDS 18651..19622 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855086.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 19632..20114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861203.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(20003..20398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 20279..21991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 21988..22734 product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014036.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(22731..23666) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(23858..25354) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775811.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS 25482..26297 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855116.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS 26316..27893 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013753.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(27890..28540) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(28533..29516) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 29670..30770 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 30763..31380 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 31380..32354 product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014413.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 32437..33186 product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460843.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(33183..33758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 33861..34826 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015197.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(34904..35362) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 35696..36337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(36338..39184) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene leuS CDS 39358..41931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013854.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 41942..42574 product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857654.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS complement(42883..44094) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(44447..45931) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013348.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(46152..46331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 46254..47771 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015581.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 47768..48415 product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 48417..49451 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene trpD CDS 49451..50857 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015582.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene trpCF CDS 50871..52076 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene trpB CDS 52076..52942 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567954.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene trpA CDS complement(53011..54222) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 54415..54885 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855171.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS 55225..55446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 55532..55897 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855195.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(56235..56426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 56374..56964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 57082..57288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(57301..57633) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(57634..58362) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS complement(58402..58998) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855283.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(58998..60434) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855284.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 60463..61116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 61116..63311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015621.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 63330..66758 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015622.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 66942..67475 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854913.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 67942..68427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(68617..69327) product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(69408..69662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS complement(69799..70143) product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222326.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(70219..70548) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(70545..70904) product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777071.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(70901..71446) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930077.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 71626..71889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS 71889..72482 product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014562.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 72874..73350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 73354..73698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 74179..74328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS complement(74297..74452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(74690..75598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 note possible pseudo, frameshifted CDS complement(75610..75792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 note possible pseudo, internal stop codon, frameshifted CDS 76081..78606 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326219.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 gene pepN CDS 78690..79238 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS 79323..80249 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene trxB CDS 80256..80579 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene trxA CDS 80668..81849 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855304.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(81859..82437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015626.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(82447..83487) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855307.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(83494..84342) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(84353..84961) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 gene rsmG CDS complement(84982..85959) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855313.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene yidC CDS complement(85973..86248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(86236..86598) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene rnpA CDS complement(86602..86745) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 gene rpmH CDS 87416..89053 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene dnaA CDS 89785..90966 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855336.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene dnaN CDS 90966..92177 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013310.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene recF CDS 92170..92739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 92897..94966 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene gyrB CDS complement(95037..96512) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803911.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(96555..96992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(97013..97369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(97408..97668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(97675..97884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 97976..100528 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene gyrA CDS 100532..100870 product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 tRNA 101031..101107 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA 101117..101190 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 101392..101766 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929919.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 101833..102318 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223356.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(102337..102885) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265466.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(102885..103742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 tRNA 103900..103973 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS 104229..104477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(104474..104944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS complement(105046..105249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(105383..106123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 106406..107338 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 107325..109595 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 gene metE CDS complement(109645..110283) product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 110426..112063 product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049825762.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(112023..112682) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015485.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 112752..113282 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116126.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 113390..114043 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855383.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 114350..115783 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013686.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(115755..116318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(116392..116661) product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene crgA CDS complement(116726..118684) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013340.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene pknB CDS complement(118688..120133) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013341.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(120133..121563) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(121560..122912) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(122916..124280) product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013344.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(124277..124729) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(124755..125588) product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861088.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 tRNA 125788..125875 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(126284..126511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(126530..128011) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(128083..128658) product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 128712..128912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 129063..129785 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 129782..130894 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 131054..131380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(131387..131632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 131705..133666 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 134067..134441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 note possible pseudo, frameshifted CDS complement(134532..135110) product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015495.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(135139..136335) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(136430..137230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(137227..137661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 137780..138145 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 138145..138984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 138950..139267 product CHY zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013367.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(139298..139873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(139887..141197) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 141276..142256 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728886.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene bioB CDS 142256..142528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013366.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS 142539..143462 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896407.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(143463..144452) product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013373.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 144560..144781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 144794..144985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 sequence32 source 1..136943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(335..1285) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 1326..1469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS 1511..2410 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 2530..2778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2857..3465 product TetR/AcrR family transcriptional regulator MbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015509.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene mcbR CDS complement(3422..4366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 4400..5062 product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 5062..5214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(5211..5792) product DUF2020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 5746..6909 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 6947..7585 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(7582..7893) product Lsr2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005065018.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(8082..8714) product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015503.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS 8784..10217 product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(10204..11502) product cupredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015501.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(11513..12634) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 12736..13590 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015499.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(13633..14235) product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 14400..15047 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene msrA CDS complement(15044..16480) product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015484.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 note possible pseudo, frameshifted CDS 16874..17821 product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015483.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS 17821..18525 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 18546..19466 product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284785.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS complement(19516..20385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 20293..20745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS complement(20817..21515) product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(21512..22648) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568791.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 22682..23578 product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene pheA CDS 23588..24241 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(24238..24585) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(24585..25658) product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(25695..26444) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 26510..27766 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene serS CDS 27790..29403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 29702..31426 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080751.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS 31430..32167 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742072.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS 32196..33743 product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene glpK CDS 33766..34596 product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015468.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(34593..36491) product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 36638..37834 product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene glf CDS 38086..38406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 38306..39598 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 note possible pseudo, frameshifted CDS complement(39595..42813) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(42850..43953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(43953..45584) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414057.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(45637..47631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 48097..48285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 48362..48949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(48946..50124) product DUF5129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015462.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS 50315..52267 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 52257..52772 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015460.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS 52765..53745 product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 53799..55493 product beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015458.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene aftB CDS 55631..56644 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 56804..57949 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 57971..59371 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227712.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 59509..61455 product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015455.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 61458..61889 product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015454.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 61912..62826 product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015453.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 62886..64598 product FadD32-like long-chain-fatty-acid--AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 64678..69384 product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene pks13 CDS 69359..70915 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857874.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS complement(71104..71433) product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857875.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(71430..72446) product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(72447..74600) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015449.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(74613..75206) product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(75207..75983) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015448.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 gene trmB CDS 76333..78156 product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015446.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(78201..78926) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015445.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 78969..80078 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015443.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(79993..81411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015442.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(81401..82555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 82607..83725 product trehalose corynomycolate mycolyl acetyltransferase TmaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015440.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene tmaT CDS complement(83646..86714) product DUF3367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853429.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(86717..86914) product DUF2613 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853449.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(86937..87425) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 87502..88662 product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853452.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 88697..90382 product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 90398..92170 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS 92696..94165 product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286774.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 94551..95267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 95272..96114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 96114..99617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(99696..100625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(100735..100923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 tRNA complement(100971..101044) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 CDS 101110..101673 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853460.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 gene dcd CDS 101716..103038 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(103126..104388) product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015432.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(104441..105670) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(105726..106367) product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(106425..107702) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803746.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(107737..110559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 110810..111385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 111375..111842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 111851..112432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(112451..114388) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776837.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(114388..116130) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(116199..116780) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363464.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(116881..117138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(117193..117453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS 118048..118404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS 118404..119906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 119915..120610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(120616..121035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS 121196..121993 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853541.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 121993..122892 product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015403.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 122892..124175 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862775.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(124172..124360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS complement(124562..125032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(125280..126005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(126086..127177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 127580..128563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS 128587..129177 product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(129230..130603) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(130723..134166) product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(134768..135472) product two component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028838.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 gene absA2 CDS complement(135439..135597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(135688..136878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21600 sequence33 source 1..132807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 151..912 product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973420.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 912..2486 product urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401683.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 2476..4257 product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266443.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 4320..4946 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537996.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(4943..5713) product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(5713..6876) product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 6758..6967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(7064..7834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 8217..9260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013567.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(9440..10639) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138635.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene galK CDS complement(10632..11726) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230058.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene galT CDS complement(11726..11968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(11979..13628) product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(13640..14539) product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230161.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(14735..15190) product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013839.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 15309..16298 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 16295..17839 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014233.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 17836..18777 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854749.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 18790..19704 product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 19701..20609 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015041.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 20602..20976 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene rbsD CDS complement(21175..21675) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene purE CDS complement(21700..22902) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013836.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 22895..23626 product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene alsD CDS complement(23604..24029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(24082..24951) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 24987..25988 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013851.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 26150..27403 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013850.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS 27526..28530 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013848.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 28530..29351 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013847.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 29351..29536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013846.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 29533..31023 product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396061.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 gene treS CDS complement(31136..31714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(31717..32289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(32322..33590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS 33941..35401 product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863615.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 35410..35619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 35619..36206 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013831.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 36238..36654 product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013829.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 36670..37410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(37453..38346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(38434..39501) product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 39744..40607 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013827.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 40763..42526 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013826.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS 42549..42992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 43032..43613 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014540.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 43610..44632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS 44774..45151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS 45148..46272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(46449..49880) product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013816.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 50309..50626 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462187.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 50613..51467 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229213.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 51470..52153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 CDS complement(52229..53386) product bifunctional 2-methylcitrate synthase/citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013797.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(53401..54333) product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265603.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene prpB CDS complement(54333..55844) product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104208.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 56012..57325 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013825.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(57395..58822) product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(58893..60083) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013814.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(60177..60533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(60600..61274) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene upp CDS 61293..61571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 61572..62516 product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013812.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 62568..63806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013811.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(63909..64109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(64136..65167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(65168..65845) product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS complement(65857..66756) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031554.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS 66787..67980 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013810.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(67943..68875) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013809.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(68931..70010) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(70113..71138) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene trpS CDS complement(71257..71448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(71500..72471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(72471..73388) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860808.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(73410..74663) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854698.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 74880..77093 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013800.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 77152..78141 product DUF4132 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027634.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 78134..82678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 82675..87279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 87276..88376 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977648.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 88373..91750 product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031106.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 91747..93333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 93441..94259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 note possible pseudo, internal stop codon CDS complement(94396..95679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 95846..95995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 96836..97018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 97048..99081 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015021.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(99419..99586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(100068..100193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(100228..100530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 note possible pseudo, internal stop codon, frameshifted CDS complement(100493..100960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 note possible pseudo, internal stop codon CDS complement(101187..101879) product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013889.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 gene pdxT CDS complement(101873..102775) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858119.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 gene pdxS CDS 102857..104161 product pyridoxine biosynthesis transcriptional regulator PdxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013887.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene pdxR CDS 104199..104348 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 104471..105787 product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854667.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 105784..106902 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013793.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(107016..107996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(108122..108436) product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013790.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(108433..109281) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 109305..109775 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854647.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(109759..111072) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS complement(111069..111518) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 111642..112190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 112183..112401 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899126.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 112444..112707 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS 112707..113204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(113201..116320) product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013785.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 116458..117321 product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 117392..118429 product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854632.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS 118426..119106 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(119138..119998) product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 120109..120666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013768.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(120663..122186) product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(122183..122785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS 122910..123329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013764.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 123466..124503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(124570..126144) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013761.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene guaA CDS 126178..126549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(126661..127824) product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013758.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(127832..129352) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013757.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene guaB CDS 129436..129843 product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447882.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS complement(129847..130602) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS complement(130668..131240) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013755.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 131547..131849 product WhiB family transcriptional regulator WhcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854562.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene whcB CDS complement(131859..132203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS complement(132151..132768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 sequence34 source 1..85348 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 492..1802 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123926043.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 2135..3454 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067910.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(3719..4009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS complement(4067..5386) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071199.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(5548..5889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(5965..7356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(7859..8596) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731052.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS complement(8642..9304) product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013855.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS complement(9330..10961) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013861.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 11086..11985 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013862.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS 12087..13181 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013863.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 13693..13995 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(14078..14548) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 14693..15112 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863575.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 15167..16534 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863574.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS complement(16531..17886) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015406.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 18097..19815 product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015405.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 19812..20063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 20075..20761 product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015402.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 20755..21804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(21910..22647) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014811.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene cobA CDS 22662..23711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863573.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS 23718..24947 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 gene manA CDS complement(25190..25978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 26226..26579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858196.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 26661..27275 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 27279..27971 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene mtrA CDS 28040..29818 product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458538.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene mtrB CDS 29821..31554 product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene lpqB CDS 31591..32217 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564913.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 32362..33006 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858182.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 gene raiA CDS 33232..35817 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013871.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 gene secA CDS 35964..36782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(36805..37212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS 37239..37775 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863558.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS 37775..38290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858173.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 38308..38556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(38553..39578) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863555.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene rsgA CDS complement(39571..40872) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 gene aroA CDS 40871..41518 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511933.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(41504..42007) product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186633.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene ybaK CDS 42045..42647 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 42647..42919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(43344..43604) product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056343.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS 44102..44590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS complement(44664..45902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013875.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS complement(45899..47224) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013876.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS 47296..47520 product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013877.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 47582..48520 product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858148.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 48530..49315 product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858145.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 49312..52455 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013879.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 52448..55627 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013880.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 55751..56818 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 56819..57550 product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013881.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 57543..59600 product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013882.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS complement(59578..60465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 60528..61049 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013884.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS complement(61046..62467) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858132.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 62561..63625 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013885.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(63631..64302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(64349..64885) product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858126.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(64945..65178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 65078..67966 product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013886.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 tRNA 68118..68194 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 68346..69221 product Fe(3+) dicitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214661.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 69353..70183 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705153.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 70197..71156 product Fe(3+)-citrate ABC transporter permease YfmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243506.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene yfmE CDS 71159..71971 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 71996..72703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS complement(72771..73214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS 73364..74452 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454783.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 74716..74961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS 74961..76883 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 gene feoB CDS 76880..77140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(77137..77919) product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013898.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene hisN CDS complement(77912..78748) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 78809..79912 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863507.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 gene prfB CDS complement(79996..81615) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 81692..82414 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858089.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene ftsE CDS 82411..83313 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858086.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 gene ftsX CDS 83319..83861 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858084.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene smpB CDS 83854..84210 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013900.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 tmRNA 84273..84652 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010