COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..4155451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1335 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 1635..2735 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 2815..3915 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 4046..6511 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035262.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene gyrB CDS 6635..7441 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035264.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 7568..8782 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035265.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 8934..9608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 9682..10434 product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene exbB CDS 10484..10903 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS 10919..11335 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 11586..11999 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(12179..12943) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(12987..13460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(13563..13826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(13938..15374) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035272.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene cls CDS 15482..16573 product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS complement(16587..18374) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275246.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 18494..19630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 19630..20064 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(20149..20874) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(20945..22354) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22580..23620) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035354.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(23665..24753) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062636588.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(24771..25205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 25150..25323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 25341..26072 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038968.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 26069..27439 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063940.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 27522..28922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 28996..29676 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(29771..31282) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 31428..31808 product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094051.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene crcB CDS complement(31903..32535) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035367.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(32532..33623) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035366.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 33792..34499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 34633..36048 product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275186.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(36347..37240) product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035413.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene phhA CDS 37361..37837 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035414.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(37839..38519) product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038955.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene fabR CDS 38679..39704 product ferredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204243849.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 39706..40851 product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038953.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(41033..42100) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(42233..43258) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035417.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(43540..44241) product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815911.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(44313..45974) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920680.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(46047..46622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768758.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(46672..47439) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039294.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS 47593..48762 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 48915..50471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(50582..51793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(51947..52222) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(52224..52892) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(52889..53446) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039270.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 gene mlaD CDS complement(53533..54282) product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(54282..55070) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039268.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 55306..58623 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene recC CDS 58620..62228 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039260.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene recB CDS 62225..64042 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039259.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene recD CDS complement(64115..64885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(65085..66170) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 66282..66614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 66611..67639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 67636..68829 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036629.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 68964..72143 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036630.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 72232..72978 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS 72972..74474 product multidrug efflux RND transporter outer membrane subunit OprN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113303.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 gene oprN CDS 74674..75264 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene folE CDS 75281..75904 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(75906..76499) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(76878..77999) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035516.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene zapE CDS complement(77996..78688) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(78737..80425) product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053209.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(80609..81124) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035509.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(81286..81555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 82811..84898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 85030..85992 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS 86852..87355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(87352..87621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(87661..88017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(88330..89487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(89633..89902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(90012..90194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(90888..91085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(91210..91503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS complement(91511..91837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(92679..93122) product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967562.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS 94083..94775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 94801..95193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 95427..95639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 95808..96923 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046464042.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(96927..97286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 97629..97868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 note possible pseudo, frameshifted CDS 98841..99176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 99825..100046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 100085..100372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(100423..100782) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036384.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 100990..101193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(101692..101874) product DUF3606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037452.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(102226..103260) product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 103432..103992 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(104477..105292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 105692..106468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS complement(106618..106884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(107014..107904) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383468.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(107915..108271) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383469.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 108393..109070 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS 109187..109747 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 109951..110406 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116491597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(110642..111073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 note possible pseudo, frameshifted CDS complement(111160..111357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 111654..112226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(112303..112698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(112808..113278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 113438..114598 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 114591..115115 product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933904.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(115732..116574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(117061..117441) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355729.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(117607..118311) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036320.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(118345..118779) product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088026.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(119031..119306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS 119396..120040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS 120077..120391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 tRNA complement(120901..120977) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 121145..122053 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035644.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene ubiA CDS complement(122056..122565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 122465..122689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(122731..123111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS 123052..123402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS 123509..124552 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene bioB CDS 124571..125794 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035641.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 gene bioF CDS 125791..126195 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS 126233..127006 product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene bioH CDS 127120..128040 product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene bioC CDS 128037..129029 product multidrug resistance efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644594.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 129691..129867 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 130091..130702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(130710..132194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(132280..132705) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035635.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(132822..133586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(133799..134770) product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS complement(134787..135749) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 135937..136503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 137033..138922 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035631.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene mnmG CDS 139497..140822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 140819..141247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(141711..142214) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704403.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(142287..146231) product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(146239..148119) product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019238119.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 148323..151070 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895598.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(151113..152666) product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(152669..154771) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene glyS CDS complement(154973..156040) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039156.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene glyQ CDS 156086..156763 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 156842..157780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(157788..158465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(158462..159256) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039160.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene tatC CDS complement(159253..159846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(159877..160116) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene tatA CDS complement(160222..161130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 161440..162468 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921524.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene hemH CDS 162475..163347 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(163372..164175) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275488.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(164299..165204) product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(165313..166209) product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039168.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene ttcA CDS 166275..166484 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS complement(166577..169372) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039197.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 gene plsB CDS complement(169396..170379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942118.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 170739..171251 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 171392..172057 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 172054..174744 product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 174815..175834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(175890..176009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 176089..176538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(176608..177513) product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039204.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(177592..178083) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531271.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(178080..178472) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707273.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(178489..180468) product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039208.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 180616..181398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 181430..182167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 182249..183124 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 183207..183827 product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039212.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(183831..186659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(186782..187237) product ECF-type sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 187175..187387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(187479..188306) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene mutM CDS 188368..189237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 189373..190560 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035419.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS 190569..191051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 191231..192037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(192245..193693) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205562.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 193762..194229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 194321..196684 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037300.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 196919..198226 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 198355..199671 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS complement(199769..200395) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035439.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(200485..202557) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(202664..203143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038071.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS complement(203283..204281) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(204349..205155) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035436.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(205272..205709) product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035435.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(205915..206097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(206139..206327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(206674..208704) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(208731..209351) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035433.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(209342..209818) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035432.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(209890..210522) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(210645..211556) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035429.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS 211664..213151 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 213321..214463 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227077.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(214464..216104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(216106..217818) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 gene ggt CDS complement(218029..218658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(218880..221273) product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918335.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS complement(221392..224046) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038067.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(224207..225226) product glucokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 225591..226901 product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 227000..228058 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038510.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 228353..229669 product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 229972..230334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(230621..231247) product 2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243294.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(231431..233257) product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327377.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene edd CDS complement(233263..234012) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527053.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene pgl CDS complement(234002..235540) product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene zwf CDS 235768..236511 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639963.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 236516..237559 product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 237704..238840 product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038508.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene nagA CDS complement(239006..239188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 239118..242804 product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035427.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 243134..243511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(243911..245575) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS complement(245587..247053) product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042595882.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 247274..249226 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039129.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene acs CDS 249242..249910 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039130.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS 250029..251339 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038724.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(251358..254828) product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(254923..256341) product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629072.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene cls CDS 256567..257460 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 257491..260400 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164741614.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(260687..260851) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809462.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene rpmG CDS complement(260865..261185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(261376..261651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS complement(261704..263485) product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039109.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(263857..264198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(264222..264563) product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(264574..265314) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(265319..266302) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS complement(266326..266751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(266775..267683) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038925.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(267680..268492) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(268725..269384) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039110.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene rsmG CDS complement(269457..270077) product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 270162..271553 product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene xanA2 CDS complement(272265..273062) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene xth CDS 273136..274152 product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112603.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene ltaE CDS complement(274268..275719) product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384711.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 275837..276376 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035602.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 276459..276974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 277063..277632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 277632..278312 product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463673.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS 278464..279474 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 279471..281207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 281204..282340 product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150453795.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 282363..283358 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 283364..284692 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112779.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS complement(285154..285414) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035600.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(285426..286301) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039025.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene aroE CDS 286396..287277 product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039026.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(287690..288442) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815396.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(288471..288914) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206190.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(288917..289846) product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027069842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 gene hemB CDS complement(289974..291197) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(291160..292017) product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084239.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene cysW CDS complement(292010..292879) product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene cysT CDS complement(293067..294077) product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036154.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(294112..295572) product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403196.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(295819..297483) product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035924.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(297480..297884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS complement(298185..298433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(298424..298702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(299081..300106) product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(300103..301554) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 301712..301981 product xanthomonadin biosynthesis acyl carrier protein XanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039083.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene xanC CDS 301978..302706 product ketosynthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039082.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 302748..303044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039080.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 303041..304033 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039079.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 303939..304613 product fatty acyl CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994205.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 304625..306967 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039076.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 306964..307419 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039075.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS 307416..308159 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039074.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene fabG CDS 308237..308740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(308798..309622) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039071.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(309619..310395) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039070.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS complement(310392..311615) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(311938..313764) product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275500.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 313918..319599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS complement(319668..321923) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(321920..322615) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 322778..323332 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(323446..324450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 324515..326707 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039097.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene uvrD CDS complement(326981..327223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(327340..328080) product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(328077..328820) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918595.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS complement(328912..329208) product DUF2782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039092.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS 329336..332110 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene polA CDS complement(332804..333760) product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039090.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene hemF CDS 333876..335498 product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 335536..336432 product DUF2950 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095600.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 336522..336902 product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(337018..339390) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994129.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 339548..340951 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037939.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 340951..341964 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene cydB CDS complement(341927..342313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 342369..342695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 342688..346017 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039067.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(346325..348154) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 348329..349177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057678768.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(349246..350928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(351236..351586) product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene trxA CDS 351859..353574 product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038857.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene rhlB CDS 353715..354401 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003484499.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene ftsE CDS 354398..355351 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038856.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene ftsX CDS 355348..356187 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506371.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 356184..356900 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038854.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene ung CDS 357167..358042 product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038853.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rpoH CDS 358182..358643 product DUF1203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385570.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(358630..359910) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(359907..361316) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097074.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(361420..362370) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368356.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene tal CDS 362521..363300 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 363357..364130 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 364127..366628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(366622..368820) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038847.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS 369266..370258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038846.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 370281..370883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS complement(370999..372558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 372636..374030 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 374151..376034 product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038843.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene sppA CDS complement(376115..376342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS 376412..377212 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 377493..379466 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531531.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 379576..381684 product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene tssI CDS 381696..382499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 382607..383251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 383440..384063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS 384069..385802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(385855..387753) product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(387870..388484) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038840.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(388484..389224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038839.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS complement(389309..389872) product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(389888..392389) product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS complement(392589..393512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(393623..394111) product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS complement(394196..395362) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene dprA CDS complement(395444..396607) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038832.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS 396809..397324 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene def CDS 397432..398349 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene fmt CDS 398352..399671 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275458.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene rsmB CDS 399739..401412 product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038828.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(401544..402404) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS complement(402755..403633) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893217.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS complement(403630..404904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS complement(405040..405891) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 406055..407068 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038491.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 407109..408161 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 408180..409220 product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038825.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(409234..410745) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038824.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(410732..411280) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038823.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(411277..412224) product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 tRNA 412001..412092 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 412319..412759 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene dtd CDS 412834..414693 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038818.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene rpoD CDS complement(414885..415256) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532858.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(415348..415725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(415805..417190) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(417190..418419) product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS complement(418416..419411) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(419408..420694) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene fucP CDS complement(420691..421749) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 421891..424245 product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036281.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 tRNA 424462..424537 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 424606..424947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(425019..425591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 425967..427184 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 427344..427562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 427627..428121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(428175..429761) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092223.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 429992..430717 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930182.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 431012..439570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 439567..442944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 442955..443950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 444110..444682 product YjfI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092612.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 444679..445407 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092609.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS 445404..446051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100672.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 446116..448146 product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113833.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 448208..448468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 448580..453961 product DNA repair ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113834.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS 453976..454641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 454638..455741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS 455750..456445 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100680.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 456512..456907 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532891.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(456913..457803) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 457928..458755 product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(458777..459217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS complement(459311..460252) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026161017.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 460349..461470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS complement(461454..462317) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530054.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(462381..463580) product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 463722..464609 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 465017..465253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 465538..465933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 466079..467062 product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525053.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 467179..467358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(468155..469714) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(469784..470128) product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(470245..472050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS 472261..472545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 472644..473150 product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene msrA CDS 473375..474919 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 475467..477521 product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819543.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(477704..478531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 478807..479682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 479679..480110 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS 480133..481515 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS 481863..483707 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033190.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 483811..486333 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 486415..488127 product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550348.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 488043..488303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04240 note possible pseudo, frameshifted CDS complement(488305..488460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(488471..488653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969369.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS complement(488780..489211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(489401..490156) product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035409.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene kduD CDS complement(490202..491368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(491546..492640) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS complement(492781..494064) product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005989684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS complement(494064..494573) product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275128.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS complement(494582..495592) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(495589..496422) product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035403.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 496528..497904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(498062..498817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(498911..499918) product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS complement(500125..501462) product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 501495..501653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(501704..504508) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 504816..505823 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 505834..506445 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096096.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS 506638..507021 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037886.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(507142..507756) product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(507767..508774) product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(508887..512066) product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS complement(512056..513306) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275505.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(513303..514580) product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039107.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(514635..515018) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 515171..516052 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039039.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 516088..516795 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509047.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 516879..517616 product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068574319.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 517637..518626 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038603.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene hemC CDS 518785..519153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(519172..519834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(519931..520905) product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533671.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(520915..521682) product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533670.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(521691..521903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(521900..524764) product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171192.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(524788..525381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 525514..526482 product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 526663..526962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 527063..529183 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 529263..531401 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275248.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS 531515..531928 product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038593.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 531965..532249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 532262..533107 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038591.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 gene dapF CDS 533100..533774 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 533805..534719 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275252.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 gene xerC CDS 534853..535053 product DUF3079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111981.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS 535171..535722 product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038588.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene hslV CDS 535829..537217 product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038587.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene hslU CDS complement(537500..537946) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033743.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(537994..539073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(539115..539822) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919375.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 540358..540825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 note possible pseudo, frameshifted CDS complement(540844..541245) product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene arr CDS complement(541405..541860) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038585.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(541857..542342) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038584.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(542365..543465) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038583.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(543462..545126) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010202254.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 545218..546009 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509029.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 gene ubiE CDS complement(546157..547800) product alpha,alpha-trehalase TreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053678.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 gene treA CDS 547916..549859 product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 549983..550960 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 550957..551682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038578.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 552017..552484 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946939.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(552574..553506) product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 553806..554852 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003482734.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 555045..556121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 556118..556603 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038565.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene mreD CDS 556605..558659 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038564.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene mrdA CDS 558656..559768 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 gene rodA CDS 559858..561087 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene mltB CDS 561084..562283 product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038555.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 562397..563563 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038554.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(563627..563893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 564079..564357 product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038551.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 564345..565034 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038550.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 gene lipB CDS 565096..566109 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038549.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene lipA CDS 566370..568631 product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 568715..569563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(569878..570372) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 570615..571565 product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038991.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene yedA CDS 571562..572473 product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038990.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rarD CDS 572484..572999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(573269..574600) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439496.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(574614..575771) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(575924..576619) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038986.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS complement(576678..577928) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275499.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(578584..579963) product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(579960..580676) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(580857..581990) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038977.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(581987..582502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(582519..583067) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038975.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(583077..583541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(583613..585043) product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 585629..587782 product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 587988..588596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 588694..589485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 589558..590943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 591462..591872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 592281..592541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 592792..593223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(593313..593591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 593783..594115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268497.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS complement(594119..594670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 594926..595768 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 595797..595967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 596296..597831 product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036931.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 gene xylB CDS 597878..599209 product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene xylA CDS 599485..600915 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571269.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(600958..602028) product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 602127..604334 product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 604338..606344 product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 606341..607609 product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 607779..609443 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994209.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 609456..612164 product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 612354..613811 product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(613904..614938) product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(614958..616139) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275490.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(616136..618877) product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039185.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene galB CDS complement(618874..620289) product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039186.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene uxaC CDS complement(620368..623223) product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(623220..624224) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039187.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(624256..625557) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 625867..628842 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039189.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 628965..630446 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039190.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 630476..631507 product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 631497..632309 product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029144.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS 632585..633439 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene motA CDS 633441..634430 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene motB CDS 634499..634990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 635121..635330 product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(635539..636309) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506728.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 636472..636852 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790920.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 636861..637859 product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 637856..639445 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036483.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 639591..639806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 639915..640466 product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037571.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 640548..640964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05610 note possible pseudo, frameshifted CDS 641183..642088 product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 gene gnd CDS 642175..642957 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(643024..644307) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038890.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(644456..644989) product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751961.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 645324..645605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 645924..646688 product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070077129.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene fnr CDS complement(646708..647448) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(647438..647623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(647620..650025) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(650035..650544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS complement(650541..652097) product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818562.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene ccoG CDS complement(652109..652402) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(652425..653357) product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087292.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene ccoP CDS complement(653354..653494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS complement(653496..654110) product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene ccoO CDS complement(654121..655572) product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072351.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene ccoN CDS complement(655749..655955) product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(655957..656295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 656410..657816 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809135.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(657813..659207) product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037247.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene hemN CDS 659360..660151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05820 CDS complement(660155..660652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038891.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 660861..661322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 661325..661513 product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038881.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 661815..662195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 662382..663101 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 663225..663704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 663707..664453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 664478..665017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 665262..666689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(666686..667534) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206252.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS complement(667599..667817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 669288..669593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 669590..670465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS 671021..671464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 671777..671974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 672214..672714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 672701..674218 product P-type conjugative transfer protein TrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815842.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene trbL CDS 674234..674974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 675033..675260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(675159..675377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 675475..677193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 677177..677986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 678362..683578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 683662..684630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 684618..685046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS complement(685461..686513) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 686669..687625 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039017.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene dusA CDS 687622..688533 product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711578.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 688628..689044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 689109..689792 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 689985..691346 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS complement(691487..692236) product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039012.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(692258..692614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 692942..693931 product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene birA CDS 693928..694668 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039010.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 694678..695418 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039009.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 tRNA 695468..695543 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 695561..696484 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039000.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene rocF CDS 696590..696724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 696920..697051 product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 697233..697385 product entericidin A/B family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038999.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 697608..697808 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038998.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 698067..699383 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043922084.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 699380..699691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 699784..700761 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS 700853..701953 product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259351.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(702089..702475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS complement(702660..704072) product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035680.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(704181..704543) product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(704548..705576) product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448747.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(705576..706646) product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035683.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene pdhA CDS complement(706997..710251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 710464..711354 product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035685.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS 711372..711788 product pyrimidine (deoxy)nucleoside triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 711946..713454 product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS complement(713710..714231) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS 714341..715435 product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689502.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene hppD CDS 715523..715936 product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035690.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 715933..717237 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035691.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene hmgA CDS complement(717263..717517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 717501..717965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 note possible pseudo, frameshifted CDS 718022..718990 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 719094..720296 product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166980.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene nhaA CDS 720301..721173 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035700.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(721175..722062) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 722233..723000 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS complement(723029..723535) product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035701.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(723653..724573) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050911213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS 724734..725069 product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035707.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 725095..725769 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237199.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene rpe CDS 725766..726239 product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706822.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 726475..727419 product lipid kinase YegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035711.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 gene yegS CDS 727553..729052 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035712.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene trpE CDS 729227..729928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 730290..730484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 730578..731255 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 731252..732667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 732914..733504 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035720.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 733609..734655 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035722.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene trpD CDS 734655..735011 product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878203.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 735008..735799 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437196.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene trpC CDS 735796..736584 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(736600..736974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(737000..737464) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817659.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(737469..738125) product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035725.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene crp CDS 738401..739195 product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990692.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene speD CDS complement(739297..739941) product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035727.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene coq7 CDS complement(739951..741150) product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene glcF CDS 741322..741750 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene rplM CDS 741777..742169 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035728.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene rpsI tRNA 742197..742271 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 742503..743492 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035835.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 743552..744217 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192028266.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene maiA CDS complement(744371..745483) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439300.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 745713..745970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 745967..746851 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035839.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 747241..747459 product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237985.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 747718..749094 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035841.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 749094..750038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(750039..751052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 751120..752295 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 752403..753098 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184046096.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 753098..754351 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103412.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 754351..757494 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(757607..758740) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001340422.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 gene wecB CDS complement(758772..759602) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(759713..760459) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 760684..762096 product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(762156..763070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 763211..763930 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192091.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 763956..764591 product succinyl-CoA--3-ketoacid CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035871.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 764605..765579 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938655.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene galE CDS complement(765625..767247) product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035873.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 767396..767992 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275445.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(768008..768706) product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035875.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(768703..769644) product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035876.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(769649..770500) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035877.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(770506..771624) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035878.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 771753..773003 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(773417..773785) product H-NS family nucleoid-associated regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035880.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(773985..775733) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035881.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS complement(775845..776261) product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439261.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 776468..777262 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035883.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene pssA CDS 777259..777678 product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 777675..778169 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene rimI CDS 778230..778751 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(778824..781601) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS complement(781711..782133) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(782248..783726) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035890.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 784046..785152 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035891.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene lptF CDS 785149..786249 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035892.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene lptG CDS complement(786630..787046) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035894.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 787127..788080 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035895.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene xerD CDS 788825..789679 product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035896.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 789783..793724 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035897.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene purL CDS complement(793931..794464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 794638..796359 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691812.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene gspE CDS 796484..797701 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035901.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 798222..798521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS 798500..798934 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035902.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene gspG CDS 798954..799406 product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035903.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 799403..799912 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035904.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 799909..800568 product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_244625321.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 800565..801467 product type II secretion system protein GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035906.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 801464..802681 product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035907.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 802671..803342 product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene gspM CDS 803332..804171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 804180..806417 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035910.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene gspD CDS 806414..807271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035911.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS 807255..808124 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035916.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS complement(808128..809465) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 809757..811490 product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920273.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 811500..812945 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(813242..814057) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194144.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene pyrF CDS complement(814208..815869) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035928.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene ettA CDS complement(816136..817041) product lipid A hydroxylase LpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene lpxO CDS 817208..818461 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035930.1 transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 818567..819088 product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997276.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene nrdR CDS 819088..820188 product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene ribD CDS 820224..820985 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943419.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 821463..822062 product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 822073..823185 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035935.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene ribB CDS 823319..823786 product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035936.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene ribH CDS 823783..824244 product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene nusB CDS 824315..825283 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035938.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene thiL CDS 825518..825703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(825707..827089) product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(827086..827619) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035948.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS complement(827621..828538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS complement(828682..829023) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035949.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(829046..830398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 830509..831387 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene rsmI CDS 832510..832956 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005910933.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene mraZ CDS 832953..834062 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047697615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene rsmH CDS 834059..834328 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene ftsL CDS 834325..836280 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042597405.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 836277..837749 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 837746..839134 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035959.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene murF CDS 839124..840209 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035960.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene mraY CDS 840209..841540 product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027080830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene ftsW CDS 841540..842631 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene murG CDS 842628..844082 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene murC CDS 844079..845071 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035964.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 845068..845805 product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 845802..847037 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003485272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene ftsA CDS 847213..848436 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035966.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene ftsZ CDS 848721..849635 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035967.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene lpxC CDS complement(849855..850313) product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035968.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 850345..851235 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 851609..854341 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035970.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene secA CDS 854420..855424 product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035972.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(855446..856063) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene coaE CDS complement(856117..856980) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(857026..858297) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038215.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(858301..860022) product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene pilB CDS complement(860123..863167) product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(863266..863703) product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038214.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(864181..865635) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594919.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS complement(865719..867344) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 867563..868729 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038209.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene sucC CDS 868744..869619 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038208.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene sucD CDS 869951..871939 product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054176.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(872422..873204) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038204.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 873347..874333 product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene rluD CDS 874337..875092 product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038202.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 gene pgeF CDS 875089..875637 product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038201.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 875627..876043 product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS 876058..876486 product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437623.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 876611..878215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038191.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 878271..878798 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268127.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene gloA CDS complement(878945..880315) product alpha,alpha-trehalose-phosphate synthase (UDP-forming) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038197.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene otsA CDS complement(880312..882108) product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(882150..882899) product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038195.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene otsB CDS 883059..885644 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038185.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene clpB CDS 886132..887988 product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene btuB CDS 888015..888596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038181.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 888611..889219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038180.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 889216..889842 product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038179.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene cobO CDS 889845..891137 product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038178.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 891134..892054 product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038177.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene cbiB CDS 892047..893042 product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112352.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene cobD CDS 893039..894511 product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 894499..895020 product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038175.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene cobU CDS 895017..896063 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038174.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene cobT CDS 896060..896611 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038173.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 896611..897357 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(897360..898004) product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039205.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(898015..899703) product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038163.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 gene ybaL CDS 899907..901751 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038157.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(902001..902897) product PhzF family isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 903123..903428 product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038148.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 903535..905334 product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene aspS CDS 905337..905615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 905618..906127 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 906213..906860 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 906898..907626 product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 907654..908181 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038141.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene ruvC CDS 908199..908768 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene ruvA CDS 908816..910738 product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS 910877..911905 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene ruvB CDS 911907..912341 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene ybgC CDS 912450..913235 product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038137.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 gene tolQ CDS 913374..913838 product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene tolR CDS 913838..914809 product cell envelope integrity protein TolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038135.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene tolA CDS 914962..916284 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene tolB CDS 916365..916874 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene pal CDS 916881..917687 product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene ybgF CDS 917705..918382 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene queE CDS 918424..919122 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene queC tRNA 919240..919315 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(919421..919744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(920096..920290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(920477..920749) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261491.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(920840..921313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(921414..921803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(922345..922779) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389897.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(922809..923213) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071172.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(923320..925134) product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038070.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene recQ CDS complement(925290..925844) product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038069.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 925938..929876 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105494.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene hrpA CDS complement(929897..930373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(930438..930929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 931010..933184 product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275520.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 933253..934914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054319.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(934911..936299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(936296..937684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS 937684..940077 product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038055.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene mrcB CDS 940077..940613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038054.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 940812..942965 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 CDS 942983..943810 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene tsaB CDS complement(943959..944834) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(944890..945840) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038049.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene gshB CDS 946296..946694 product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene pilG CDS 946713..947078 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038047.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 947090..947692 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508568.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 947689..949710 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038045.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 949790..956302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 956295..958034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 958052..958567 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038042.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 958564..959715 product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 959736..960074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS complement(960098..960835) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(960826..962244) product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038009.1 transl_table 11 codon_start 1 locus_tag LOCUS_08620 gene bioA CDS 962325..962876 product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216848.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 gene nudE CDS 962873..963688 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 gene cysQ CDS 963899..964720 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene mazG CDS 964743..965045 product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192500.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(965556..965897) product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036007.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 966004..966720 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506728.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 966730..968007 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036016.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 968253..969809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 969806..970519 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 970516..971757 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 972087..973079 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS complement(973281..973751) product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene phnB CDS complement(973825..974127) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061280.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(974241..974423) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 974422..974802 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS 974821..975555 product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 975798..976457 product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036019.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 976480..977388 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275437.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 977431..977919 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275436.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 978001..978882 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036022.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene lgt CDS 978898..979692 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036023.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 979695..980189 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036024.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(980854..981864) product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036025.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(981875..982285) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036026.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene apaG CDS complement(982331..983155) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036027.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene rsmA CDS complement(983163..984155) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036028.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene pdxA CDS complement(984168..985529) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036029.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(985526..987979) product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036030.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene lptD CDS 988126..988545 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene msrB CDS complement(988561..989472) product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036031.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(989486..990040) product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(990051..990677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921973.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 990731..992035 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036034.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene ubiH CDS 992032..993225 product UbiH/UbiF family hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036035.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(993280..993978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(994100..995170) product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036052.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene rlmM CDS complement(995184..995759) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(995759..996211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(996232..997998) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036057.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 998141..998416 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 998545..998985 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037427.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS complement(999096..1000031) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS complement(1000134..1001720) product alkyl hydroperoxide reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389171.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene ahpF CDS complement(1001932..1002495) product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705621.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene ahpC CDS 1002714..1003574 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036071.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene prmC CDS complement(1003644..1004267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 1004433..1005377 product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036072.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene pip CDS 1005520..1006920 product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133829731.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS complement(1006971..1007537) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(1007575..1008525) product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1008510..1009112) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036076.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 1009256..1011529 product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(1011905..1013047) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223977.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(1013189..1013644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(1013646..1014053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(1014050..1014679) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506786.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(1014664..1014969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 1014857..1015156 product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 1015153..1016544 product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(1016633..1017106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(1017199..1017720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(1017708..1018547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(1018753..1019271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 1019397..1020836 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389678.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(1020838..1021290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036084.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 1021489..1021992 product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene sufT CDS 1022503..1024596 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 1024798..1026408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 1026667..1028742 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036087.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(1028788..1029276) product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(1029410..1029742) product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS complement(1029739..1030332) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene wrbA CDS 1030417..1031682 product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 1031684..1032289 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036097.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 1032286..1032555 product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036098.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(1032568..1033353) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036100.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene ppk2 CDS complement(1033353..1033739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(1033802..1034323) product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036101.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene moaB CDS complement(1034353..1036044) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(1036041..1036499) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233166.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(1036642..1037727) product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene prfA CDS complement(1037785..1039086) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036104.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene hemA CDS 1039191..1040888 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036105.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 1040885..1041520 product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036106.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene lolB CDS 1041517..1042410 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036107.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene ispE tRNA 1042424..1042500 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 1042604..1043563 product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036108.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 1043670..1044323 product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036109.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 1044377..1044955 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036110.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene pth CDS 1045034..1046125 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036111.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene ychF tRNA 1046254..1046339 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 1046422..1046495 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 1046531..1046606 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 1046656..1047846 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene tuf tRNA 1048001..1048076 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 1048166..1048543 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450619.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene secE CDS 1048548..1049117 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036113.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene nusG CDS 1049293..1049721 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene rplK CDS 1049731..1050423 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036115.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene rplA CDS 1050870..1051400 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036116.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene rplJ CDS 1051463..1051834 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene rplL CDS 1052294..1056463 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115576597.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene rpoB CDS 1056559..1060785 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene rpoC CDS 1061107..1061481 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003469157.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 gene rpsL CDS 1061538..1062005 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993356.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene rpsG CDS 1062153..1064273 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036120.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene fusA CDS 1064355..1065545 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036112.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene tuf CDS 1065947..1066258 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036122.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene rpsJ CDS 1066269..1066922 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036123.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rplC CDS 1066935..1067540 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 gene rplD CDS 1067537..1067833 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811694.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene rplW CDS 1067844..1068671 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene rplB CDS 1068678..1068947 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993369.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene rpsS CDS 1068958..1069293 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rplV CDS 1069308..1070039 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene rpsC CDS 1070043..1070456 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036127.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 gene rplP CDS 1070456..1070641 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rpmC CDS 1070653..1070922 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036129.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene rpsQ CDS 1070936..1071304 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486699.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene rplN CDS 1071318..1071632 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008571669.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 gene rplX CDS 1071644..1072186 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371090.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene rplE CDS 1072202..1072507 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005917137.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rpsN CDS 1072666..1073064 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010371096.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene rpsH CDS 1073078..1073605 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036130.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 gene rplF CDS 1073635..1073988 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993383.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 gene rplR CDS 1074219..1074692 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486682.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene rpsE CDS 1074685..1074885 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450646.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene rpmD CDS 1074891..1075328 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439114.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene rplO CDS 1075336..1076700 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036132.1 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene secY CDS 1076933..1077289 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036133.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 gene rpsM CDS 1077301..1077693 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486671.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene rpsK CDS 1077708..1078337 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811641.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene rpsD CDS 1078357..1079355 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene rpoA CDS 1079637..1080011 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene rplQ CDS 1080217..1080720 product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036135.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1080838..1082226 product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(1082291..1083946) product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS complement(1084009..1084491) product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104616959.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS complement(1084509..1086338) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036140.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene typA CDS 1086543..1087040 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 1087352..1088557 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 1088667..1089650 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036142.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 1089793..1091685 product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene prpE CDS 1092201..1093088 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene prpB CDS 1093336..1094487 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036232.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene prpC CDS 1094580..1095107 product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439617.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(1095177..1097804) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206610.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1098158..1098709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1098779..1099390) product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(1099525..1099983) product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS complement(1100444..1102519) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036147.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 1102566..1102829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(1102839..1103189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089897.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1103381..1104913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 1104910..1105644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 1105637..1108444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1108455..1109234 product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 CDS complement(1109414..1110433) product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036148.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(1110463..1111488) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1111608..1112852) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037802.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 1112968..1113870 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1113949..1114740) product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038749.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1114937..1116349 product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS 1116534..1117631 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 1117896..1118978 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 1119222..1120307 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036149.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS 1120478..1120975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036150.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 1120972..1121772 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036151.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS 1121897..1122337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1122430..1123623) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036153.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 gene kbl CDS complement(1123635..1124669) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666275.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene tdh CDS 1124814..1126979 product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 1127168..1129309 product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(1129551..1129949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 1130104..1130745 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036162.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 1130891..1132195 product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene folC CDS 1132277..1133323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1133349..1133927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS 1133969..1135435 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036167.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene purF CDS 1135437..1135793 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079563.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1135798..1136601 product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS complement(1136892..1137629) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene lpxH CDS 1137719..1139125 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037816.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene gltX CDS 1139156..1139650 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037815.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(1139774..1140145) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(1140142..1141386) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037790.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(1141383..1141754) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(1141936..1144107) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1144142..1144597 product MerC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037787.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1144782..1144973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(1145066..1146265) product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222927961.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(1146297..1147565) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene hutI CDS 1147522..1148949 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389057.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(1149097..1149597) product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(1149594..1151189) product AlkA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037782.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1151341..1153038 product lysine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(1153083..1154339) product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037784.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 1154453..1155013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1155114..1155476 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1155483..1155959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(1155964..1156560) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920198.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 1156721..1158385 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene hutU CDS 1158493..1159560 product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS 1159659..1161092 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 1161094..1161774 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191850760.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1161845..1162372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(1162422..1163315) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS complement(1163478..1164398) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1164439..1165404 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226787.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 1165582..1167252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1167415..1168578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037781.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1168862..1170565) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037727.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 1170708..1172006 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037726.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1172452..1173003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(1173007..1173495) product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1173495..1174370) product subclass B3 metallo-beta-lactamase BJP-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088970.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene blaBJP CDS complement(1174446..1174871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS 1174989..1175600 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1175597..1176097 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(1176236..1176916) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037714.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(1177052..1177609) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037713.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 1177702..1178181 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037712.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS 1178263..1179699 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037711.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 1179731..1180966 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 1180997..1182346 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037709.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene gorA CDS 1182367..1183164 product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene hutG CDS complement(1183209..1183568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(1183741..1185648) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055568.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene parE CDS 1185924..1186160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS 1186341..1188005 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036874.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1188156..1188989 product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene kdsA CDS 1189174..1190460 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036877.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene eno CDS 1190479..1190823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1190820..1191524 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036879.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene ispD CDS 1191604..1192083 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036880.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene ispF CDS 1192134..1193132 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene truD CDS 1193281..1193523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1193555..1194121) product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS 1194302..1195105 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene surE CDS 1195102..1195779 product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036884.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 1195841..1196455 product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036885.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 1196593..1197318 product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963283.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1197375..1198208 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275354.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(1198205..1198588) product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1198695..1199000) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036888.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene yhbY CDS 1199134..1199721 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene rlmE CDS 1199810..1201708 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene ftsH CDS 1201941..1202840 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275372.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene folP CDS 1203638..1204612 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036892.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene miaA CDS 1204749..1205024 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene hfq CDS 1205141..1206457 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036894.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene hflX CDS 1206570..1207685 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene hflK CDS 1207682..1208545 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 1208565..1208753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS complement(1208681..1209001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 1209025..1210317 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(1210388..1212499) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035531.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1212624..1213265) product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS complement(1213249..1214586) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 1214865..1215491 product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036867.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 1215630..1216757 product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036868.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1216867..1217277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 1217317..1217775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1217863..1218519 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1218717..1220732) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037706.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(1220905..1223013) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1223319..1224446 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361893.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1224473..1224796 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523720.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 1224845..1225921 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083251.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 1226014..1226322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 1226374..1227762 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932285.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1227823..1229649) product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037333.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 1229994..1231304 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(1231371..1231811) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225462.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(1231828..1232865) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036507.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1233049..1233810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS 1233843..1236887 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1237019..1237789) product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036974.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1238277..1240103) product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS complement(1240305..1242128) product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036537.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1242290..1243099) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1243139..1243846) product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1243920..1245926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS complement(1246099..1246767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS complement(1246768..1247649) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037752.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene trxA CDS 1247752..1248372 product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037751.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1248483..1249805) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1249986..1252751 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057355.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 gene leuS CDS 1253181..1253756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 1253756..1254823 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037747.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene holA CDS 1254836..1255513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 1255552..1255980 product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037745.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene rsfS CDS complement(1256160..1256660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 note possible pseudo, internal stop codon CDS complement(1256781..1257701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 note possible pseudo, internal stop codon CDS 1257832..1258302 product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037743.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene rlmH CDS complement(1258508..1261771) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150547447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1261919..1262179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1262119..1262583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1262742..1262936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1262939..1263688) product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037741.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1263817..1264413 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 1264410..1265903 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037739.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene rng CDS 1266080..1269940 product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037738.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1270126..1271568 product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037736.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene tldD CDS complement(1271744..1272322) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037735.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 gene yjgA CDS 1272456..1273847 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene pmbA CDS 1273953..1274399 product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS complement(1274588..1275463) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1275456..1275755) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037729.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(1275787..1277106) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994173.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene tilS CDS 1277181..1278281 product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(1278402..1279361) product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS 1279542..1281998 product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS complement(1282380..1285958) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036550.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene dnaE CDS complement(1286167..1286799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(1287166..1287804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS 1287946..1290204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS 1290279..1290731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(1290715..1291392) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036551.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(1291382..1292623) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629001.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene lpxB CDS complement(1292763..1293548) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036553.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene lpxA CDS complement(1293553..1294008) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036554.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene fabZ CDS complement(1294164..1295177) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036555.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene lpxD CDS complement(1295186..1297672) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237827.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene bamA CDS complement(1297771..1299135) product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036558.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene rseP CDS complement(1299178..1300344) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036559.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1300398..1301249) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036560.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(1301246..1302013) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921694.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene uppS CDS complement(1302035..1302592) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036562.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene frr CDS complement(1302702..1303709) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS complement(1303923..1304648) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene pyrH CDS 1304879..1305739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1305736..1306716 product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1306859..1309702 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114864.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS complement(1310224..1311105) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036566.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene tsf CDS complement(1311238..1312044) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene rpsB CDS 1312375..1313169 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036574.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene map CDS 1313166..1315802 product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036575.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 1315803..1316702 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438809.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene dapD note possible pseudo, frameshifted CDS 1316707..1317075 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036578.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 1317068..1318216 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941552.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene dapE CDS complement(1318403..1320751) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS 1320793..1320978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 1321084..1322772 product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036581.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene asnB CDS 1322891..1323379 product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036585.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 gene bfr CDS complement(1323488..1324147) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(1324349..1326592) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036587.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene parC CDS complement(1326674..1327087) product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706600.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene rnk tRNA 1327337..1327421 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 1327855..1329180 product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 1329200..1330084 product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533207.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 1330081..1331007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(1330985..1332349) product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850092.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(1332346..1333413) product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850091.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 1333431..1334069 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014086.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 1334596..1335630 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975318.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 1335617..1336768 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 1336765..1337871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 1337868..1338827 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS 1338902..1339837 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456580.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 1339827..1340966 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 1340963..1342096 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338286.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS 1342089..1343183 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975133.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS 1343183..1344343 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 1344306..1344584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243574.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS 1344581..1345354 product TIGR04290 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 CDS 1345397..1347913 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116922455.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene rnr CDS 1348234..1348980 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036704.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 gene rlmB CDS 1349111..1352074 product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036705.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 1352199..1352516 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111167.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene sugE CDS complement(1352638..1353204) product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942408.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS complement(1353201..1353845) product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036706.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene rnt CDS complement(1354095..1354856) product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113019.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1354849..1355712) product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113017.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1355785..1356141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113016.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1356759..1357457) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036708.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene phoU CDS complement(1357576..1358436) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036709.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene pstB CDS complement(1358429..1359328) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036710.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene pstA CDS complement(1359328..1360299) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036711.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene pstC CDS complement(1360721..1361818) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036712.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene pstS CDS complement(1362145..1363164) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438693.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene pstS CDS complement(1363447..1364733) product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036714.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(1365114..1365830) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene nth CDS complement(1365827..1366219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1366219..1367001) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036719.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 1367222..1367905 product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004429231.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 1368236..1368421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 note possible pseudo, frameshifted CDS 1368427..1369053 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036720.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 note possible pseudo, frameshifted CDS 1369050..1369913 product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 1370066..1371358 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1371448..1372221) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS 1372317..1372760 product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423235.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(1372972..1373499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1373496..1376489) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036348.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene uvrA CDS complement(1376731..1377588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(1377667..1379745) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036087.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 1380388..1380696 product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005989959.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene rplU CDS 1380713..1380967 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 gene rpmA CDS 1381106..1382245 product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036350.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 gene obgE CDS complement(1382367..1382636) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002807888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene rpsT CDS 1382774..1384366 product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036351.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene murJ CDS 1384475..1385371 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 1385381..1388257 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036353.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene ileS CDS 1388257..1388763 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036354.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene lspA CDS 1388774..1389724 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036355.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene ispH tRNA 1389821..1389896 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 1390031..1390696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1390978..1391265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 1391339..1392739 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438953.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene radA CDS complement(1392750..1393235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1393311..1393757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1393808..1394659) product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088696.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene purU CDS complement(1394917..1396503) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036592.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(1396679..1397878) product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036591.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(1397875..1399380) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112617.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(1399383..1399841) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1399942..1400784) product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036390.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene ccsA CDS 1400852..1402219 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036391.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene ffh CDS 1402485..1402742 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 gene rpsP CDS 1402778..1403317 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 gene rimM CDS 1403444..1404271 product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036398.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 gene trmD CDS 1404316..1404750 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036399.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene rplS CDS 1404920..1405894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(1405904..1407370) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS 1407524..1407934 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036401.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(1407957..1408568) product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036403.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(1408711..1410228) product catalase KatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene katA CDS complement(1410673..1413249) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095574877.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene mutS CDS 1413318..1413878 product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1413954..1414610 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036898.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene lexA CDS 1414853..1415890 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene recA CDS 1415931..1416437 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036900.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene recX CDS 1416762..1419395 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036901.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene alaS CDS 1419534..1419740 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene csrA tRNA 1419806..1419898 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 1420101..1420177 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS complement(1420460..1421512) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057042.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1421509..1422891) product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene tviB CDS 1423110..1423886 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198283.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1424025..1425419 product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(1425631..1426323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1426413..1426679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 1426766..1434049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 1434073..1440171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 1440168..1440977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1440971..1441855 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1441860..1443353 product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257386.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1443709..1445658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 1445657..1446403 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS complement(1446400..1447647) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(1447647..1448780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1448777..1449538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(1449562..1450599) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(1450596..1451954) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(1451935..1453104) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(1453112..1454317) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(1454283..1455641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1455687..1456454) product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476420.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1456451..1458058) product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1458055..1458684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS 1458860..1460017 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene galE CDS complement(1460073..1461824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(1462017..1462874) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1462867..1463688) product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275371.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene thiD CDS complement(1463685..1464365) product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462033.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1464644..1466209) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036911.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1466220..1466702) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036912.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1466732..1467394) product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036914.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 1467529..1468434 product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036915.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene dapA CDS 1468453..1468953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036916.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(1469085..1469408) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 tRNA complement(1469584..1469659) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 1469652..1471103 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036939.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene pcnB CDS 1471100..1471630 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036940.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene folK CDS 1471658..1472476 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036941.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene panB CDS 1472511..1473359 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036942.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene panC CDS 1473508..1473888 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036943.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1473895..1475406 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036944.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 gene pgi CDS complement(1475519..1476616) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene queG CDS 1476642..1478159 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037445.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1478156..1478629 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene tsaE CDS 1478717..1480411 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275349.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 1480547..1482382 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 gene mutL CDS 1482382..1483326 product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 1483344..1484381 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1484598..1484999) product Rnf electron transport complex subunit RnfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036529.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 gene rnfB CDS complement(1485087..1487174) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036531.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene metG CDS complement(1487395..1487844) product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1487980..1490736) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1490964..1492046 product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040941024.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene apbC CDS 1492179..1492751 product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene dcd CDS 1492890..1493684 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209967.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(1493745..1494404) product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209662.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene pcp CDS complement(1494401..1495366) product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021671.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1495353..1496081) product DUF969 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919083.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 CDS complement(1496078..1496833) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(1496854..1497018) product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037698.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1497044..1497985) product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815130.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS complement(1497985..1498710) product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene pxpB CDS complement(1498707..1499135) product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(1499132..1499800) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037696.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1499934..1501265 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene rimO CDS complement(1501346..1502584) product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(1502618..1503085) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072248.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1503082..1503582) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037693.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene greB CDS complement(1503819..1504325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(1504364..1505893) product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037688.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 1506115..1507671 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275325.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 1507729..1508376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1508373..1509026 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479123.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(1509129..1509974) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037685.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene asd CDS complement(1510065..1510721) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037684.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 1510811..1511749 product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037683.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene prmB CDS 1511961..1513064 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037681.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene aroC CDS 1513057..1514079 product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037680.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS 1514123..1514524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 1514610..1515635 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037679.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 1515759..1517663 product FimV/HubP family polar landmark protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994017.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 1517859..1518695 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037676.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene truA CDS 1518692..1519333 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037675.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1519363..1520250) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037674.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 1520330..1521538 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037673.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene trpB CDS 1521672..1522490 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037671.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene trpA CDS 1522590..1523477 product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037670.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene accD CDS 1523474..1524814 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037669.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene glmM CDS complement(1524872..1526719) product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957366.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 1526895..1527845 product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1527857..1528348) product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033534649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS 1528490..1529242 product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene tpiA CDS 1529302..1529799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 tRNA 1529937..1530021 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 1530191..1530547 product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037659.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 1530538..1531110 product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944318.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 1531112..1531855 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037657.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 1531852..1533159 product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS 1533190..1533717 product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 gene nuoE CDS 1533730..1535097 product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene nuoF CDS 1535094..1537322 product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037653.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene nuoG CDS 1537326..1538375 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037652.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene nuoH CDS 1538385..1538873 product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508211.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene nuoI CDS 1538887..1539519 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944316.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 1539516..1539842 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914274.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene nuoK CDS 1539998..1542196 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037649.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene nuoL CDS 1542216..1543745 product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 1543757..1545211 product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene nuoN tRNA 1545290..1545366 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 1545678..1546253 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037646.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene rimP CDS 1546313..1547800 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037645.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene nusA CDS 1547890..1550502 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene infB CDS 1550614..1550994 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216910.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene rbfA CDS 1551188..1552144 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037642.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene truB CDS 1552366..1552626 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037641.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene rpsO CDS 1552820..1554928 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene pnp CDS 1555216..1555857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 1555854..1556288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 1556376..1557251 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198106.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1557296..1557769) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198107.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS complement(1557854..1558270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(1558338..1559609) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036321.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(1559606..1560310) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036320.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 1560555..1561331 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036318.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1561328..1563004 product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 1563244..1563585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1563700..1564803) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035828.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene dinB CDS complement(1564984..1565352) product HPF/RaiA family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 1565476..1568178 product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 1568925..1570613 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 1571120..1571374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1571731..1573128) product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190513.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS 1573377..1575611 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 1576106..1579459 product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039145.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS 1579741..1580049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(1580077..1580742) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 1580834..1582642 product D-(-)-3-hydroxybutyrate oligomer hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532230.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS 1582952..1583569 product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1583641..1584663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 1584663..1585739 product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 1585852..1586544 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036017.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1586544..1586933 product YfeK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 1586979..1587176 product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037304.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS 1587217..1587660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037303.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1587668..1588609) product DedA family protein/thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036907.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1588721..1589509) product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 1589691..1589897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 1589936..1590445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(1590494..1590718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 tRNA complement(1590876..1590962) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS complement(1591005..1591463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1591569..1592165) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS complement(1592244..1593374) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037373.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1593478..1594509) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 tRNA complement(1594558..1594644) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(1594973..1595527) product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1595524..1597587) product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037369.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1597588..1598061) product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene ccmE CDS complement(1598089..1598256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(1598253..1599005) product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037366.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1599139..1599831) product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037365.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 gene ccmB CDS complement(1599828..1600517) product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037364.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 gene ccmA CDS complement(1600638..1601195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS 1601261..1602409 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037363.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 1602591..1603388 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037362.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1603697..1604173 product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933541.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 1604287..1606515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1606549..1607520) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598699.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1607517..1609958) product fimbria/pilus outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004543968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1610028..1610744) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525015.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(1610760..1611317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(1611346..1611852) product spore coat U domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526328.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1611907..1612173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(1612382..1614064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(1614057..1615112) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994036.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene scpB CDS complement(1615223..1616137) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 1616548..1616847 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037356.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 1616844..1617128 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 1617298..1618332 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 1618516..1621407 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 1621515..1623146 product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 1623143..1624435 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 1624432..1625331 product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 1625328..1626149 product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS 1626152..1629334 product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275353.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 1629422..1630447 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176748033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(1630556..1631692) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(1631689..1634898) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS 1635168..1636115 product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene cmrA CDS complement(1636724..1637464) product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037289.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene pgl CDS complement(1637508..1638497) product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene glk CDS 1638852..1639952 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 gene ugpC CDS complement(1639956..1641104) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036137.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 1641368..1644871 product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036749.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene smc CDS 1644918..1645661 product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036750.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene zipA CDS 1645978..1648329 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036752.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene ligA CDS 1648333..1649304 product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene epmA CDS 1649388..1650113 product DUF3011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507405.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 1650204..1650983 product DUF3011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 1651092..1652150 product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036755.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene mtnA CDS 1652536..1655229 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036756.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene gyrA CDS complement(1655476..1656270) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1656331..1657329) product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918935.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS 1657477..1662438 product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994092.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1662628..1665045 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036244.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene pbpC CDS complement(1665159..1665644) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036246.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 1665865..1666767 product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036248.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1666847..1667212) product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 gene pilH CDS complement(1667303..1668295) product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(1668321..1668626) product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(1668801..1669394) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(1669426..1670298) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047314084.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1670357..1671799) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036671.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene lpdA CDS complement(1671897..1673126) product dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036672.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene sucB CDS complement(1673224..1676055) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994072.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS complement(1676299..1677207) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036674.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(1677204..1678487) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036675.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(1678484..1678885) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS complement(1678882..1679337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(1679337..1680707) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036678.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene purB CDS 1680851..1682278 product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(1682332..1683015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1683048..1683881) product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036683.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(1683905..1684597) product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994095.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS complement(1684904..1685962) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036684.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(1685959..1686849) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036685.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1686846..1687214) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1687218..1687625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 1688019..1688954 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921707.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1689129..1689917 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS 1690000..1691340 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 1691342..1691581 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 1691678..1692370 product DUF2058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036691.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(1692389..1693105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1693194..1695884) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194931144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene metH CDS complement(1695949..1697046) product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036698.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1697046..1698005) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507354.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1698310..1699479 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 1699727..1704751 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037508.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1705027..1705797 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036730.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS 1706344..1707261 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1707385..1707942) product DUF2939 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036733.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 1708120..1709559 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039281.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1709748..1710584) product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089916.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1710754..1715304 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037460.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1715549..1716232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1716229..1717110 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1717206..1718513 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(1718796..1721003) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994073.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1721164..1723224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 1723522..1725852 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036376.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1726117..1726599 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036604.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(1726648..1727388) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768018.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1727478..1728323) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 1728412..1728942 product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036824.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1728946..1729380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1729727..1730923) product hydrophobic compound transporter HcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene hcuB CDS complement(1730984..1732957) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672901.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1733015..1733596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1733679..1734617) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene xth CDS 1734754..1736559 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS 1736820..1737242 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene rpsF CDS 1737266..1737496 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991243.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene rpsR CDS 1737657..1738109 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005991240.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene rplI CDS 1738272..1738580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1738826..1740178 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036624.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1740268..1740489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 1740557..1740898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 1741051..1742193 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene alr CDS 1742275..1743711 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275393.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 1743860..1745248 product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 1745339..1746052 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036626.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(1746215..1746655) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877747.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(1746664..1747065) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037295.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1747433..1748500 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 1748516..1751989 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1752002..1755115 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS complement(1755327..1756532) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1756684..1757610) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036079.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1757634..1758257) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(1758309..1758866) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1759053..1759940) product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1760054..1761091) product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275355.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1761110..1761439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1761985..1762677 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037341.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene cmk CDS 1762872..1764560 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037340.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene rpsA CDS 1764691..1764993 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 1765089..1765364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 1765368..1766546 product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037337.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 gene lapB CDS 1766550..1767521 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275529.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS 1767628..1769469 product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275356.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS 1769469..1770368 product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037334.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene galU CDS 1770469..1771782 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525369.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 1771779..1772114 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1772178..1772627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1772862..1774070) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037142.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(1774097..1776472) product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS complement(1776513..1777133) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 1777389..1777814 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene ndk CDS 1777839..1779086 product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065467767.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene rlmN CDS 1779106..1779942 product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037146.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene pilW CDS 1779939..1780745 product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037147.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 1780850..1781482 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037148.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1781497..1782681 product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507731.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene bamB CDS 1782898..1784298 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037150.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene der CDS 1784731..1785342 product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213171.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene mobA CDS 1785489..1786556 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1786574..1787710 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057412.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene moeB CDS complement(1787714..1788493) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003906792.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(1788490..1788801) product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037332.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1788910..1789815 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene folD CDS 1790156..1791613 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037330.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene guaB CDS 1791727..1793292 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene guaA CDS complement(1793385..1794572) product 2-methylaconitate cis-trans isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187247.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene prpF CDS complement(1794704..1795153) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207573.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1795208..1797835) product Fe/S-dependent 2-methylisocitrate dehydratase AcnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188189.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene acnD CDS 1798108..1798560 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037315.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene tadA CDS complement(1798702..1799184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 1799269..1799844 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037314.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene orn CDS complement(1799848..1800873) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037313.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(1800979..1803363) product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037312.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene ppsA CDS 1803541..1804362 product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037311.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS 1804500..1805012 product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 tRNA 1805061..1805136 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 1805171..1805246 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS complement(1805427..1805966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1805999..1808416) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204659.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 note possible pseudo, internal stop codon CDS complement(1808547..1809473) product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(1809470..1811305) product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035822.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1811404..1811808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS 1811972..1812613 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(1812697..1813317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(1813504..1815018) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254970.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(1815122..1815544) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(1815686..1816150) product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1816131..1817414) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS complement(1817896..1818489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1818511..1819110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS 1819371..1819589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 1819633..1820352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1820506..1821672 product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1821724..1822707) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene corA CDS complement(1822828..1823076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 1823419..1825848 product catalase HPII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266295.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene katE CDS complement(1826118..1826768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275454.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(1826847..1827224) product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969671.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 1827336..1828292 product TIGR03885 family FMN-dependent LLM class oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969667.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(1828682..1830982) product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1831187..1832242) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613244.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1832502..1833092 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 1833135..1835858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1836136..1836870 product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639909.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1836974..1853962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 1854022..1855656 product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(1855702..1856685) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037155.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(1856850..1857821) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1857865..1858098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(1858113..1858907) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174003.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1858904..1860751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 tRNA complement(1860707..1860795) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1861074..1861697) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161139422.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS complement(1861687..1863627) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066868161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene ctaD CDS complement(1863624..1864631) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525141.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene coxB CDS complement(1864628..1865149) product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971125.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS complement(1865172..1866950) product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525144.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(1867081..1867836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(1867846..1869009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1869279..1870535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 1870674..1871168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 1871178..1871408 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521369.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1871749..1872504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1872504..1873403) product DUF2950 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941869.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1873417..1874817) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1874876..1875646) product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1875807..1877495) product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086259.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(1877520..1878911) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(1878929..1880629) product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063768.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1880687..1883443) product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1883618..1885279) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419441.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(1885329..1886156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1886183..1886860) product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1886857..1887948) product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967349.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene cax CDS complement(1887959..1889422) product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035535025.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(1889430..1890611) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706439.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1890615..1891187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(1891282..1891686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 1891880..1892485 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973728.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(1893345..1895546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1895681..1896961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS 1897085..1898485 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967897.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(1898552..1899358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1899417..1899971) product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035985.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 1900035..1900532 product DUF45 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036494.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1900625..1901935) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931103.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS 1902111..1903172 product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919641.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene cyoA CDS 1903226..1905241 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919640.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene cyoB CDS 1905234..1905863 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970676.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene cyoC CDS 1905860..1906252 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809276.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene cyoD CDS 1906262..1907050 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 1907081..1908433 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531508.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS 1908414..1908959 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082987.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1909115..1910290) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(1910338..1911609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS complement(1911624..1913222) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225412.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(1913360..1913818) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1914313..1914807 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114391.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1915026..1917047 product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037840.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1917096..1918286) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037434.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1918309..1918866) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037433.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1918931..1919278) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003497910.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 1919488..1919775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1919780..1920010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS complement(1920026..1920466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1920595..1921959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1922027..1922236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS 1922413..1922898 product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037432.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1923049..1924077 product HWE histidine kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628883.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 1924088..1924447 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920851.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(1924480..1925352) product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036276.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS complement(1925355..1926119) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS 1926231..1928861 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036288.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1928930..1929451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 1929761..1929964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS 1930028..1932034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1932069..1932449) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268312.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(1932446..1932724) product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771169.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS complement(1932721..1933218) product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771170.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(1933215..1934858) product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(1934855..1935199) product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(1935199..1938126) product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104576.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(1938158..1939042) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS complement(1939199..1939663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(1939701..1941380) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084968.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1941367..1942881) product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084967.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1943147..1943404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 1943642..1945054 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1945098..1945898) product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267511.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1946134..1946589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS 1946605..1947045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1947279..1949060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS 1949191..1949565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS 1949663..1950016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS 1950260..1950625 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141437.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 1950603..1951097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 1951252..1951692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(1951714..1952634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(1952743..1953063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS 1953483..1953827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1954614..1955453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 1955647..1956207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 1956345..1956743 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 1956876..1957160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 1957265..1957666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS 1957817..1958029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 1958132..1958521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 1958660..1958983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 1959092..1959544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1959655..1960116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 1960277..1960606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 1960734..1961039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1961153..1961470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS complement(1961490..1961963) product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(1962124..1963374) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704717.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1963452..1964816) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS 1965199..1966569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(1966649..1968103) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 1968315..1968830 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene rimI CDS complement(1968842..1970968) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035667.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene glgX CDS complement(1971003..1971212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1971209..1973797) product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035665.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene treY CDS complement(1973794..1975776) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035664.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1975773..1977557) product malto-oligosyltrehalose trehalohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035663.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 gene treZ CDS complement(1977554..1979818) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035662.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1979815..1981386) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437158.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 gene glgA CDS complement(1981744..1982496) product OBAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994179.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS complement(1982493..1982864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1982999..1983286) product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528365.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1983389..1984639) product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(1984725..1985165) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812030.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1985398..1986795 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037247.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 gene hemN CDS 1986815..1987570 product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene anr CDS 1987847..1990120 product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527410.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 1990427..1991656 product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS 1991667..1992062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 1992072..1992203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 1992207..1992464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS 1992449..1993720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1993788..1994609 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 1994606..1995628 product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene nadA CDS 1995625..1997058 product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533322.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS complement(1997065..1997946) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(1997959..1998957) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093020.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(1998993..2000504) product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene ubiD CDS complement(2000521..2000784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS complement(2000877..2002961) product TonB-dependent copper receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119294.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 2003189..2004253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 note possible pseudo, frameshifted CDS 2004291..2005079 product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533161.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 2005076..2005675 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200984.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS 2005719..2006177 product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463034.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene azu CDS 2006240..2006473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 CDS 2006560..2007042 product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037408.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 2007169..2009976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 2009973..2010356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 2010353..2011525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 2011539..2012627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 2012624..2014027 product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 2014308..2016470 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206648.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS 2016514..2016828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS 2016841..2018505 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928947.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 2018498..2018836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 2018929..2019783 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 2019785..2020147 product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036369.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 2020151..2020549 product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 2020540..2021532 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036371.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 2021536..2022393 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036372.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 2022393..2024264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS complement(2024298..2024672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(2024767..2026248) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970484.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(2026337..2027788) product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049878083.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 2027850..2028518 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027777.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 2028592..2029368 product BcII family subclass B1 metallo-beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124981.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene bla2 CDS complement(2029426..2030187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS 2030494..2033904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 2034018..2034443 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037194.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 2034440..2035753 product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037195.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(2035853..2036317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS 2036502..2036831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 2036828..2037211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 2037355..2037711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(2037932..2038714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 2039387..2039731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 2039875..2040294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 2040371..2041027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(2041154..2042341) product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 2042651..2043703 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975112.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 2043722..2044228 product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084016.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS 2044245..2045075 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728964.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 2045128..2045904 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(2046374..2047282) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731568.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(2047319..2048398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(2048465..2048962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(2049013..2050023) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240198.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 2050319..2050975 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037323.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 2051043..2051321 product XapX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037215.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 2051318..2053279 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529950.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(2053286..2053912) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 2054131..2054661 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986783.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 2054688..2055119 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183828876.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(2055162..2058146) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(2058450..2059274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(2059301..2059855) product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039192.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(2059857..2060927) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(2060924..2061706) product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036519.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2061703..2062236) product DUF2878 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942967.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(2062236..2063507) product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(2063504..2064310) product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(2064307..2065617) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036523.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(2065619..2066569) product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036524.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 2066810..2067592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2067589..2068218) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2068344..2069921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2069948..2070706) product seryl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140459.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 2071031..2072614 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037563.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(2072744..2073211) product DUF1348 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114444.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(2073262..2074077) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089805.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 2073961..2074215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS 2074379..2074948 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 2075114..2075896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038959.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 2076273..2076698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 2076695..2077573 product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974282.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 2078082..2079908 product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095694375.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS 2083156..2083365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 2083362..2083631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(2083653..2084087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2084177..2085172) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2085202..2085855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(2085884..2086666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(2086897..2087280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(2087314..2087775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS 2088000..2089589 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS 2090208..2102783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS 2102795..2103823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS 2103991..2107152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 2107224..2108996 product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036087.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS 2108997..2109398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS 2109460..2111832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS 2112205..2112621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS 2112757..2113134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 2113131..2113388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 2113389..2113655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS 2113879..2115132 product putative Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 2115415..2115783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 2116003..2116446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS 2116857..2117150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2117298..2117726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 2118021..2120402 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844465.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 2120441..2121199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2121209..2121565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2121811..2121981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS complement(2122032..2122184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS complement(2122856..2123077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS 2123238..2123585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 2124239..2124679 product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967562.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2125077..2125541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2125692..2126201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(2126414..2127751) product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096812.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 2127777..2127962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2128171..2128467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 2128641..2129075 product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088026.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 2129109..2129813 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 2129977..2130324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 2130578..2131552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 2131500..2131940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 2132032..2132466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 2132764..2133189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 2133305..2133694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS 2133815..2134141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 2134156..2134392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2134394..2134678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2134682..2135686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 2135740..2136063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(2136040..2136390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS complement(2136420..2136635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 2137052..2137870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 2137978..2138994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2139206..2144569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187336415.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS complement(2144737..2145789) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992495.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 2145917..2146774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS 2147503..2147724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(2147721..2148260) product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029338.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2149074..2149607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2149604..2149999) product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530547.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2150705..2151127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2151580..2152011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS complement(2152631..2153026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(2153301..2154008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2154126..2154395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(2154606..2155415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815935.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(2155442..2156131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2156283..2157251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2157490..2157825 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(2157810..2158052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 2158042..2159436 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969343.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 2159726..2162080 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 2162242..2164047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 2164081..2165826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 2165823..2167076 product poly-beta-1,6-N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206025.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene pgaC CDS 2167073..2167534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(2167550..2167987) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265636.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(2168088..2169446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS complement(2169490..2170809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(2170987..2171655) product NAAT family transporter MarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885033.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene marC CDS 2172071..2172319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2172339..2173799) product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(2173792..2176950) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972841.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2176947..2178116) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037510.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 2178171..2178692 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918920.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2178991..2180004) product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704412.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 2180161..2181084 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036918.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 2181385..2182530 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919294.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 2182645..2183802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904991.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2183870..2186611 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275368.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 2186611..2188200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2188270..2189007 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532967.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 2189045..2189671 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244779.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2189706..2190854 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267367.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene dgoD CDS 2190860..2191621 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195081.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2191618..2192523 product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009939768.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 2192554..2194116 product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2194119..2195135 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS complement(2195145..2196575) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090058.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS complement(2196619..2197884) product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090045.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene arcA CDS complement(2197933..2199351) product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090046.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2199608..2200942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 2200923..2201381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 2201412..2201927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2201932..2202390) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(2202433..2203473) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095519074.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2203479..2204915) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 2205141..2205599 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098835.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 2205707..2206180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS complement(2206184..2207917) product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085889.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2208058..2209584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(2209752..2210747) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972862.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(2210828..2211037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2210969..2212099 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976318.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2212121..2213149 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198073.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(2213287..2215746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(2215769..2216902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(2216899..2217303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(2217320..2218585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(2218582..2220990) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2221187..2221891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS complement(2222060..2223367) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227167.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2223602..2224291 product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275317.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene paoA CDS 2224288..2225244 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968216.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2225241..2227439 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037857.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(2227432..2227758) product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104617444.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(2227784..2228095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(2228122..2228865) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2229207..2230418 product alpha-lytic protease prodomain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029803.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS complement(2230476..2230859) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237965.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2231142..2231963 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513575.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS 2232110..2232316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 2232479..2233246 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene modA CDS 2233257..2233979 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367643.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene modB CDS 2233966..2234616 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2234606..2235397) product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818535.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 2235588..2236217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 2236284..2236958 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170061.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS 2237228..2237662 product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081161190.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 2237749..2238276 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083846.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2238330..2239070 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252794.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 2239109..2240398 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113022.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS complement(2240442..2241680) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975162.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2242270..2244537 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037048.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 2244652..2245734 product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038445.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2245737..2246144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2246286..2246606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2246608..2247135) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 2247273..2247680 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972013.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 2247677..2248117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 2248131..2248667 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930760.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 2249073..2249525 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507823.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2249544..2250533) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036863.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(2250655..2251113) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 2251242..2252402 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972738.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 gene chrA CDS complement(2252415..2254019) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 2254130..2255407 product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037245.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 2255349..2255630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS complement(2255707..2256375) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(2256428..2257168) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037242.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2257225..2257872) product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275406.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2257872..2258381) product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762644.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(2258454..2259647) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080975.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2259785..2260234) product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 gene soxR CDS 2260302..2261297 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973903.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2261297..2262733 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054423.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(2262730..2262933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2263031..2263432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2263485..2264414) product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene cmrA CDS 2264591..2265589 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2265744..2266502 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971202.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(2266505..2266981) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2267053..2267664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(2268058..2268624) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(2268704..2269051) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(2269119..2269490) product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160110.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(2269513..2270469) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(2270466..2271413) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160261.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2271423..2272940) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976039.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(2273040..2274689) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(2274735..2275373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(2275374..2275784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(2276099..2276554) product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463034.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene azu CDS complement(2276635..2277450) product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2277450..2277827) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444835.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2277925..2278470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS 2278513..2278971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 2278964..2280859 product beta-lactam sensor/signal transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118053.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2280908..2281255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2281568..2283235 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2283260..2283526) product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036497.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 2283673..2284773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2284844..2285674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2285810..2286361) product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS complement(2286651..2288090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2288182..2288691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2288706..2289407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(2289404..2289850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(2289982..2291331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2291766..2293151) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037140.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2293385..2294080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2294177..2294803) product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162301084.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene lolA CDS complement(2294896..2297274) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2297519..2298589) product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene ald CDS 2298875..2299828 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037135.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene trxB CDS 2299881..2301038 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037134.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2300927..2301781 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037133.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene aat CDS 2301905..2302123 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037132.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene infA CDS 2302272..2303603 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103877.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2303668..2305953) product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene clpA CDS complement(2306092..2306412) product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene clpS CDS 2306596..2307066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS 2307066..2307545 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 CDS 2307571..2308743 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037128.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene mnmA CDS 2308740..2309360 product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029217215.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene hflD CDS complement(2309387..2309689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS complement(2309884..2310336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(2310434..2313019) product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene acnB tRNA complement(2313360..2313446) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(2313513..2313758) product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037031.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS 2313984..2316749 product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037030.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene acnA CDS complement(2316858..2317295) product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162277122.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS 2317487..2319166 product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS 2319263..2320207 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(2320301..2322472) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037026.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2322479..2323537) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2323828..2325348) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037023.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene lysS CDS complement(2325461..2326534) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100097357.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 gene prfB CDS complement(2326678..2327316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS complement(2327608..2328216) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704956.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2328323..2328868) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 2329028..2332891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2332911..2334566) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027068825.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene recJ CDS complement(2334626..2335588) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(2335597..2336073) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene greA CDS complement(2336295..2339543) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037013.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene carB CDS complement(2339552..2339995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(2339992..2341116) product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037011.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene carA CDS complement(2341324..2342049) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037010.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene dapB CDS complement(2342181..2343302) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036661.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene dnaJ CDS complement(2343441..2345363) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036660.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 gene dnaK CDS complement(2345486..2346022) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507314.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene grpE CDS complement(2346209..2347255) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene hrcA CDS 2347438..2349105 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036657.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene recN CDS complement(2349305..2349712) product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005988392.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene fur CDS 2349822..2350265 product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036655.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene bamE CDS complement(2350304..2350576) product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036654.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2350573..2351022) product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036653.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 2350987..2351598 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS complement(2351781..2354051) product CHASE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122292.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS complement(2354064..2354312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2354454..2354822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 tmRNA 2354927..2355280 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS 2355415..2355753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(2355760..2356863) product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 2356904..2357569 product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036295.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2357583..2357924) product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036296.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2357952..2358224) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2358370..2358840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 2359018..2360763 product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035657.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2360791..2361201) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974546.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS complement(2361237..2361713) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 2361899..2362312 product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088942.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS 2362315..2362968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2363037..2363396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 2363701..2365023 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063841.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 2365020..2365235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2365334..2366704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS complement(2367273..2369051) product transmembrane repetitive protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275360.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2369071..2369667) product NfuA family Fe-S biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037235.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2369788..2370129 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS 2370151..2370570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS complement(2370574..2370873) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(2370910..2371107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21260 note possible pseudo, frameshifted CDS complement(2371262..2372260) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037239.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS 2372711..2375911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2376272..2376919) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 2377032..2377961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 2378017..2378826 product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243725.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2379030..2379650 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036298.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene lexA CDS 2379650..2380291 product translesion DNA synthesis-associated protein ImuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962596.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene imuA CDS 2380301..2381755 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 2381752..2385033 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237880.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 2385127..2385543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 2385861..2386646 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2386643..2386870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2386976..2387314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265779.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2387336..2388421) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063703.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 2388350..2388886 product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 2388942..2389199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2389250..2389957) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(2390006..2391001) product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038316.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2391233..2391514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 2391838..2392374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2392408..2392569) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(2392624..2392812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 2393091..2394326 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938417.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 2394390..2395190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 2395203..2396159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(2396295..2396960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 2397154..2397354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 note possible pseudo, frameshifted CDS 2397375..2397710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2398240..2399331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS complement(2399378..2399689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS complement(2400990..2402132) product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2402442..2403461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2403803..2404228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21590 tRNA complement(2404412..2404501) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(2404689..2405708) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036777.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS 2405822..2406403 product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246309.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(2406676..2407968) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036776.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene serS CDS 2408107..2408757 product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(2408787..2410316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(2410361..2411689) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036773.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 gene aroA CDS complement(2411686..2412861) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 gene hisC CDS complement(2412867..2414054) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275386.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene pheA CDS complement(2414163..2415248) product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036771.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene serC CDS 2415442..2416410 product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036770.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene msrP CDS 2416576..2417220 product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene msrQ CDS complement(2417189..2417986) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036768.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 2418091..2418366 product polyhydroxyalkanoic acid system family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036767.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(2418380..2419135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706121.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 2419237..2420499 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 2420573..2421337 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038620.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2421334..2422224 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2422344..2424110 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036596.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 2424165..2425202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 2425279..2425665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2426014..2426613) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 2426738..2426935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2426929..2427516) product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene thpR CDS complement(2427531..2428064) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923342.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 2428186..2430282 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2430286..2430918) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(2431373..2433250) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037425.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS 2433443..2434351 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038755.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(2434355..2434981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(2435018..2436583) product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037428.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 2436774..2438177 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS 2438387..2440501 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS 2440818..2441684 product EamA/RhaT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275155.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 2441736..2442503 product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116949.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 2442588..2443160 product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036766.1 transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS 2443364..2444344 product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036765.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(2444508..2446502) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029300896.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 2446607..2446915 product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 2446944..2447570 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706125.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2447847..2448701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706124.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(2448715..2449344) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391572.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 tRNA 2449491..2449565 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 2449632..2449985 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 gene arsC CDS complement(2449990..2451264) product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063859.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene tviB CDS complement(2451618..2453054) product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037593.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(2453058..2453684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(2453675..2454427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(2454445..2454822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(2454884..2456062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2456070..2458217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(2458214..2458789) product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216900.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS complement(2458984..2459865) product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644575.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(2459904..2460500) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 tRNA complement(2460690..2460776) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(2460872..2460945) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(2461048..2461123) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(2461276..2461842) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037265.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene pgsA CDS complement(2461839..2463743) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037266.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene uvrC CDS complement(2463942..2464436) product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(2464429..2465208) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057672371.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 gene kdsB CDS complement(2465205..2466248) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037270.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene lpxK CDS complement(2466316..2468064) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037271.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene msbA CDS complement(2468061..2468504) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037272.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2468518..2469153) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037273.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(2469159..2471549) product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(2471553..2472275) product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161961949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene lolD CDS complement(2472268..2473512) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507840.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS complement(2473519..2473884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS complement(2473919..2474173) product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 CDS complement(2474170..2474601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS complement(2474671..2475453) product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037280.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2475469..2477259) product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037281.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene sdhA CDS complement(2477264..2477662) product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 gene sdhD CDS complement(2477659..2477994) product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037283.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene sdhC CDS complement(2478155..2478310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS 2478341..2479210 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037285.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(2479313..2481256) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036622.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene asnB CDS complement(2481260..2483527) product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728359.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(2483577..2484218) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036621.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS complement(2484215..2484772) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918215.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2484786..2485949) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036619.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS complement(2486123..2486929) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036618.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 2487094..2487306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036617.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 2487310..2488077 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(2488074..2488931) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036615.1 transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS 2489011..2489445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 2489606..2490091 product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036613.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2490293..2490502) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483561.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 2490719..2491204 product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 2491284..2492462 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036611.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 2492505..2493620 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207152.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 2493717..2494673 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(2495093..2496649) product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036607.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(2496787..2497125) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507399.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 2497244..2498638 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036745.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene asnS CDS 2498732..2499037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS 2499034..2499342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036742.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS 2499352..2499987 product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036741.1 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 2499989..2500774 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS 2500845..2502269 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene hpaE CDS 2502274..2502957 product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene can CDS 2502954..2503406 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 2503409..2503939 product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 2503956..2504966 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218852484.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS 2504977..2505345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS 2505350..2506642 product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057429.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 gene kynU CDS 2506705..2508072 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036736.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 2508074..2509516 product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036735.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 gene sbcB CDS 2509565..2510251 product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036734.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS complement(2510385..2511527) product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258479.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene cfa CDS complement(2511614..2512498) product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275395.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS complement(2512578..2513297) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037770.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(2513473..2513757) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810239.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(2513797..2514027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 2514017..2514658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 2514775..2514957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2514997..2515605) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2515647..2517272) product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036597.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2517585..2518433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(2518424..2519053) product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036609.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS 2519219..2521804 product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037451.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene ligD CDS 2522282..2523658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(2523827..2524744) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919349.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2524863..2525564 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS 2525860..2526384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 2526508..2527431 product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 2527460..2528320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 note possible pseudo, internal stop codon, frameshifted CDS complement(2528367..2528570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2528497..2528880 product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108222449.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 2529176..2531605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 2531731..2534007 product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268289.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 2534007..2535452 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 2535445..2536518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 2537051..2538259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 2538546..2539739 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS 2539736..2541025 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391442.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 CDS 2541215..2542021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS 2542018..2543088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS 2543093..2543857 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404405.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS 2544021..2545187 product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771202.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2545328..2545984 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706083.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 2546068..2546961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 2547016..2547492 product Dot/Icm type IV secretion system effector PhnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957793.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene phnB CDS 2547660..2548526 product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038778.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 2548561..2549133 product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599338.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(2549215..2549982) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS complement(2550293..2550466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS complement(2550576..2553251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 2553380..2553757 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS complement(2553887..2555320) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2556052..2557449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS complement(2557501..2557854) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974216.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS 2558002..2559180 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS 2559519..2559827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(2559905..2560333) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530756.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(2560360..2560857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS 2561039..2561815 product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275395.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(2561861..2562769) product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382657.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene yghX CDS complement(2563002..2563175) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489471.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(2563327..2564133) product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113852.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 2564072..2565232 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706561.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2565298..2565846 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919545.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS complement(2566307..2567011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 2567143..2567775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(2567800..2568090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(2568159..2569343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(2569423..2570523) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(2570567..2571487) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 CDS complement(2571601..2571861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS complement(2572060..2572617) product DUF3228 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056523.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS complement(2572693..2573235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(2573235..2573849) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS complement(2574061..2574792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2574944..2576503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(2576713..2577858) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 2578119..2579042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(2579681..2581009) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940840.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(2581049..2584492) product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449873.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 2584924..2586189 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 2586394..2587497 product Glu/Leu/Phe/Val dehydrogenase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036492.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 CDS complement(2587658..2587951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS 2587895..2588602 product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262210.1 transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 2588792..2589949 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946749.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS complement(2590026..2592929) product autotransporter serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036491.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2593074..2593685 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531936.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 2593743..2594918 product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 2595041..2595406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 2595723..2596100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2596274..2597899 product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040777.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 2598093..2598701 product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036486.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 2598698..2599060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438863.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(2599143..2599397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2599400..2601319) product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037005.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS complement(2601316..2601576) product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037004.1 transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 2601730..2602512 product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037003.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 2602531..2602914 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083350.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 2602919..2604955 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2604967..2605860 product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037002.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 2605873..2608434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS 2608591..2609361 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037001.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS 2609475..2610041 product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037000.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene yeiP CDS 2610141..2610536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2610594..2612369) product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036998.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(2612420..2612740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(2612992..2614395) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036996.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS 2614530..2615768 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036995.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene serA CDS complement(2616053..2616625) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036993.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS 2616809..2617813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444587.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 2617991..2619475 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036992.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 2619576..2621003 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036991.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 2621146..2621784 product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036990.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 2621781..2622338 product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036989.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 2622519..2623217 product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036988.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene mtnC CDS complement(2623486..2624070) product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975929.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(2624076..2625626) product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS complement(2625735..2626361) product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036985.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene hisIE CDS complement(2626351..2627127) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036984.1 transl_table 11 codon_start 1 locus_tag LOCUS_23720 gene hisF CDS complement(2627121..2627897) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 gene hisA CDS complement(2627894..2628496) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036982.1 transl_table 11 codon_start 1 locus_tag LOCUS_23740 gene hisH CDS complement(2628493..2629572) product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036981.1 transl_table 11 codon_start 1 locus_tag LOCUS_23750 gene hisB CDS complement(2629569..2630669) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036980.1 transl_table 11 codon_start 1 locus_tag LOCUS_23760 gene hisC CDS complement(2630666..2631997) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036979.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 gene hisD CDS complement(2631994..2632908) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 gene hisG CDS complement(2632934..2633260) product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036977.1 transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 2633499..2635331 product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150913023.1 transl_table 11 codon_start 1 locus_tag LOCUS_23800 CDS complement(2635374..2637260) product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 transl_table 11 codon_start 1 locus_tag LOCUS_23810 gene hutH CDS complement(2637402..2638793) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 transl_table 11 codon_start 1 locus_tag LOCUS_23820 gene hisS tRNA 2638974..2639050 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS 2639196..2640044 product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(2640054..2641322) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037382.1 transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS complement(2641319..2642461) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042599274.1 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene proB CDS complement(2642458..2643654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(2643694..2644986) product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037386.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS complement(2645047..2646015) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene argC CDS complement(2646012..2646635) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037388.1 transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(2646643..2647965) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055042.1 transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(2648050..2649135) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037390.1 transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(2649211..2650458) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(2650529..2651548) product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037393.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(2651948..2652445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 2652606..2654162 product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275351.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 gene cysS CDS 2654204..2654656 product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 2654667..2655938 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037397.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 2655955..2656371 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404734.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(2656368..2656826) product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109548.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(2657060..2658166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 2658443..2658691 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037400.1 transl_table 11 codon_start 1 locus_tag LOCUS_24010 gene yidD CDS 2658676..2660022 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 2660019..2660900 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275350.1 transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2661105..2662796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(2662940..2663920) product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 gene folE2 CDS complement(2664016..2664627) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037411.1 transl_table 11 codon_start 1 locus_tag LOCUS_24060 CDS complement(2664735..2665418) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24070 CDS complement(2665418..2666143) product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037413.1 transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS complement(2666205..2667548) product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2667821..2668387) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037416.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 gene efp CDS 2668519..2669544 product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 transl_table 11 codon_start 1 locus_tag LOCUS_24110 gene epmB CDS 2669708..2671780 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037435.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS complement(2672002..2672898) product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 gene htpX CDS 2673006..2673899 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037437.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 gene gluQRS CDS 2673981..2674721 product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507974.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 2674896..2675390 product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037439.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene phaR CDS complement(2675734..2676675) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2676734..2678563) product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275348.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS complement(2678623..2678796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 2678729..2679829 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037450.1 transl_table 11 codon_start 1 locus_tag LOCUS_24200 gene rnd CDS complement(2680002..2680727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24210 note possible pseudo, frameshifted tRNA 2680905..2680980 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(2681069..2681518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS 2681718..2682710 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(2682733..2683443) product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038882.1 transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(2683443..2685002) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(2684992..2686233) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383406.1 transl_table 11 codon_start 1 locus_tag LOCUS_24260 gene lysA CDS complement(2686304..2689210) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039298.1 transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS complement(2689247..2690662) product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 2691029..2692429 product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 2692484..2693581 product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038888.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 CDS 2693603..2694454 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013779.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS 2694467..2695252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038889.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 2695332..2696591 product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026025294.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 tRNA 2696770..2696846 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 CDS 2696947..2698479 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 CDS 2698581..2699639 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036961.1 transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS 2699659..2700699 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036960.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 gene murB CDS 2700712..2701623 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036959.1 transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(2701633..2702361) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036955.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(2702342..2703712) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036954.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 gene ispG CDS 2703728..2705104 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037447.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene xseA CDS 2705165..2706637 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525043.1 transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 2706714..2708441 product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994007.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS complement(2708463..2711345) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052103386.1 transl_table 11 codon_start 1 locus_tag LOCUS_24430 CDS 2711467..2712108 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926777.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS 2712105..2713133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 2713130..2713714 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438728.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 2713814..2715574 product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036668.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(2715667..2717307) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 CDS complement(2717378..2718649) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036480.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(2718747..2718953) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488188.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(2719050..2719817) product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS complement(2719821..2720390) product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036478.1 transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(2720390..2721385) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036477.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 gene nagZ CDS complement(2721492..2722199) product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(2722251..2722766) product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(2722890..2724236) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene rlmD CDS complement(2724466..2725086) product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(2725180..2727168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS 2727244..2728020 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036470.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(2728002..2728751) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036469.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene recO CDS complement(2728842..2729738) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036468.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene era CDS complement(2729788..2730447) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036467.1 transl_table 11 codon_start 1 locus_tag LOCUS_24620 gene rnc CDS complement(2730440..2730820) product DUF4845 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036466.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(2730888..2731673) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036465.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 gene lepB CDS complement(2731893..2733683) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275537.1 transl_table 11 codon_start 1 locus_tag LOCUS_24650 gene lepA CDS complement(2733819..2735363) product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036463.1 transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS complement(2735468..2736406) product sigma-E factor negative regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036462.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(2736403..2737023) product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036461.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 gene rpoE CDS 2737284..2739368 product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036460.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(2739405..2739734) product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(2739737..2740102) product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036225.1 transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(2740099..2741079) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036224.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(2741076..2741714) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771257.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene tmk CDS complement(2741711..2742790) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 gene mltG CDS complement(2742787..2743602) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245844.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 gene pabC CDS complement(2743599..2744966) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS complement(2745294..2746535) product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036221.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 gene fabF CDS complement(2746701..2746940) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002814322.1 transl_table 11 codon_start 1 locus_tag LOCUS_24780 gene acpP CDS complement(2747071..2747814) product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036220.1 transl_table 11 codon_start 1 locus_tag LOCUS_24790 gene fabG CDS complement(2747909..2748865) product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036219.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene fabD CDS complement(2748914..2749135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(2749344..2750324) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(2750532..2750726) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010368401.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 gene rpmF CDS complement(2750745..2751302) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036217.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS 2751356..2751772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 2751769..2752353 product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24860 CDS complement(2752357..2754189) product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275429.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS 2754344..2755297 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 2755301..2756281 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036210.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 2756274..2758244 product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036209.1 transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 2758241..2758726 product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(2758814..2759164) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036207.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(2759222..2759821) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 transl_table 11 codon_start 1 locus_tag LOCUS_24930 gene recR CDS complement(2759895..2760215) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036205.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS complement(2760273..2762240) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036204.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 gene dnaX tRNA 2762326..2762418 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(2763071..2764078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(2764094..2764519) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(2764582..2764821) product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(2764821..2765309) product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 gene moaC CDS complement(2765429..2766463) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275431.1 transl_table 11 codon_start 1 locus_tag LOCUS_25000 gene moaA CDS complement(2766460..2767218) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036198.1 transl_table 11 codon_start 1 locus_tag LOCUS_25010 CDS complement(2767220..2767969) product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036197.1 transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 2767992..2769095 product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25030 tRNA complement(2769187..2769264) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(2769518..2769940) product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 tRNA complement(2770038..2770128) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 2770328..2771032 product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS complement(2771132..2771887) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036193.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 gene dnaQ CDS complement(2771911..2772399) product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036192.1 transl_table 11 codon_start 1 locus_tag LOCUS_25070 gene rnhA CDS complement(2772396..2773067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2773193..2773960 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036190.1 transl_table 11 codon_start 1 locus_tag LOCUS_25090 gene gloB CDS 2773957..2775234 product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036189.1 transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 2775358..2776152 product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814739.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 gene fabI CDS complement(2776391..2778370) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036187.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 tRNA complement(2778562..2778638) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 tRNA complement(2778751..2778827) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(2778870..2778944) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(2779018..2779290) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(2779509..2781947) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036186.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 gene lon CDS complement(2782154..2783443) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036185.1 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene clpX CDS complement(2783607..2784233) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene clpP CDS complement(2784372..2785673) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036183.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 gene tig tRNA complement(2785935..2786019) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA complement(2786150..2786225) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(2786291..2786367) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA complement(2786417..2786493) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA complement(2786559..2786635) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS 2786778..2787542 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(2787619..2788938) product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071333.1 transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(2789258..2790265) product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036181.1 transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(2790449..2790847) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036180.1 transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(2790949..2791251) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506861.1 transl_table 11 codon_start 1 locus_tag LOCUS_25220 gene grxC CDS 2791492..2793141 product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036178.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS 2793205..2793954 product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036177.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 gene phoB CDS 2794010..2795413 product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506859.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 gene phoR CDS 2795410..2797506 product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036175.1 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene ppk1 CDS 2797528..2799123 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944807.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene ppx CDS complement(2799422..2801335) product glucans biosynthesis glucosyltransferase MdoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038607.1 transl_table 11 codon_start 1 locus_tag LOCUS_25280 gene mdoH CDS complement(2801353..2802885) product glucan biosynthesis protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921572.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 CDS 2803081..2804289 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036173.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS 2804286..2804834 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036172.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 CDS complement(2805104..2806021) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 CDS complement(2806018..2806656) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037819.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 CDS complement(2806758..2808080) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037822.1 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene creD CDS complement(2808291..2809724) product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037824.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 gene creC CDS complement(2809721..2810416) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873813.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 gene creB CDS 2810566..2811426 product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037826.1 transl_table 11 codon_start 1 locus_tag LOCUS_25370 gene rlmJ CDS complement(2811692..2812606) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028720.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(2812742..2813086) product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113498.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS 2813206..2813706 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037827.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 CDS 2813875..2814927 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175341.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(2815048..2815473) product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035519.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 CDS complement(2815587..2816111) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035518.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS 2816291..2819764 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123086488.1 transl_table 11 codon_start 1 locus_tag LOCUS_25440 gene mfd CDS 2819785..2820324 product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS complement(2820567..2822144) product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 2822278..2822649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 CDS 2822733..2823593 product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 2823940..2826831 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036312.1 transl_table 11 codon_start 1 locus_tag LOCUS_25490 gene gcvP CDS complement(2827350..2827832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(2828354..2830072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(2830259..2832712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS complement(2832974..2833495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS complement(2833588..2834565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS complement(2834597..2834875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS complement(2834943..2835728) product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 gene arsM CDS 2835903..2836613 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066870803.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS 2836909..2839419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 2839527..2839886 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920851.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(2840175..2842739) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036254.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 2843270..2843692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS complement(2843776..2845476) product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036487.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 CDS 2845651..2846280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(2846648..2847619) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 2847917..2850340 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963454.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 2850337..2851206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 note possible pseudo, internal stop codon, frameshifted CDS 2851487..2851945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 2852137..2852874 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 gene aqpZ CDS complement(2853007..2853327) product DUF3861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114086.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS complement(2853352..2854203) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS complement(2854313..2856484) product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036729.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 gene rlmKL CDS complement(2856495..2857025) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036725.1 transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(2857022..2857537) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS 2857648..2858220 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 CDS 2858562..2859473 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 transl_table 11 codon_start 1 locus_tag LOCUS_25750 gene tesB CDS 2859607..2860464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(2860714..2861337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS 2861477..2862211 product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275418.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 note possible pseudo, frameshifted CDS 2862285..2863526 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(2864370..2864843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(2864851..2866050) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036337.1 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene purT CDS 2866225..2867121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120857.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 2867266..2868141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS 2868149..2868448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 2868450..2868662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 2868659..2868835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 CDS 2868882..2869721 product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327997.1 transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(2869702..2870271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(2870211..2870885) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275419.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 CDS complement(2870895..2871305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 CDS complement(2871485..2872561) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036329.1 transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS complement(2872863..2873504) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036328.1 transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(2873501..2874694) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036327.1 transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 2874879..2875478 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036326.1 transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 2875475..2876266 product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036325.1 transl_table 11 codon_start 1 locus_tag LOCUS_25950 gene minC CDS 2876259..2877101 product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036324.1 transl_table 11 codon_start 1 locus_tag LOCUS_25960 gene minD CDS 2877104..2877370 product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036323.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene minE CDS 2877499..2877993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 2878195..2880228 product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036316.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 2880355..2881803 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(2881908..2882420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 2882972..2884117 product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100557313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS 2884219..2885292 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 transl_table 11 codon_start 1 locus_tag LOCUS_26030 CDS 2885490..2886773 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(2886775..2888028) product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(2888068..2888481) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810412.1 transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(2888638..2890824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(2891180..2891932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26080 note possible pseudo, internal stop codon, frameshifted CDS complement(2892635..2893519) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247449.1 transl_table 11 codon_start 1 locus_tag LOCUS_26090 CDS 2893705..2894763 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018210119.1 transl_table 11 codon_start 1 locus_tag LOCUS_26100 CDS 2894874..2896991 product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530899.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS complement(2897247..2898776) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038532.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS complement(2898787..2899230) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038533.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS complement(2899227..2900987) product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 2901121..2901474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS 2901638..2902768 product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036383.1 transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 2902761..2903141 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036384.1 transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 2903294..2906299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 CDS complement(2906785..2907924) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS complement(2907926..2911027) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(2912355..2913233) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840046.1 transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(2913235..2914320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(2914628..2915659) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506326.1 transl_table 11 codon_start 1 locus_tag LOCUS_26230 CDS 2915835..2916440 product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 transl_table 11 codon_start 1 locus_tag LOCUS_26240 CDS complement(2916576..2916785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS complement(2916906..2917844) product sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036544.1 transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS complement(2917841..2918206) product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944172.1 transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS 2918360..2918953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS 2919100..2920149 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037755.1 transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS 2920535..2920795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26300 CDS complement(2920687..2921271) product spermidine N1-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723772.1 transl_table 11 codon_start 1 locus_tag LOCUS_26310 gene speG CDS 2921384..2921677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS complement(2921712..2922173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 CDS complement(2922280..2923182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 2923321..2925564 product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037497.1 transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 2925561..2925797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 2925794..2926591 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037498.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 gene fdhD CDS complement(2926544..2928490) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS 2928654..2930477 product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 CDS complement(2930761..2931111) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114600.1 transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS 2931247..2931696 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085641.1 transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS 2931699..2932514 product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037768.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS 2932826..2933884 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147026359.1 transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS 2933898..2935220 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929105.1 transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS complement(2935496..2936389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS complement(2936566..2937465) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 CDS complement(2937500..2937943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 2938089..2938973 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037757.1 transl_table 11 codon_start 1 locus_tag LOCUS_26480 CDS 2939172..2939600 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 2939625..2940035 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082839.1 transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS 2940089..2940493 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS 2940526..2940954 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089898.1 transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 2940965..2941504 product K(+)-transporting ATPase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089904.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 gene kdpF CDS 2941706..2943052 product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230367.1 transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(2943021..2943389) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537534.1 transl_table 11 codon_start 1 locus_tag LOCUS_26550 CDS complement(2943458..2944048) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194433.1 transl_table 11 codon_start 1 locus_tag LOCUS_26560 CDS complement(2944789..2945121) product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383518.1 transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(2945258..2947723) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS 2948208..2949194 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037769.1 transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS 2949265..2950581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS 2950586..2951401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS 2951523..2951918 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 transl_table 11 codon_start 1 locus_tag LOCUS_26620 CDS complement(2952235..2952459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26630 CDS complement(2953178..2954593) product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037426.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 gene dbpA CDS 2954684..2955277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400564.1 transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 2955274..2955543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 2955583..2955801 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037775.1 transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS complement(2955811..2956956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(2957038..2957541) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036547.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 CDS 2957651..2958283 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275402.1 transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 2958380..2959645 product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185678.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene phaZ CDS 2959700..2959996 product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533011.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 CDS complement(2960199..2962325) product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037418.1 transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS complement(2962322..2963251) product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037419.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 CDS complement(2963337..2964155) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037420.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 CDS 2964250..2965068 product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037421.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 CDS complement(2966247..2968814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS complement(2969045..2970019) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006448912.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene secF CDS complement(2970038..2971882) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074057269.1 transl_table 11 codon_start 1 locus_tag LOCUS_26790 gene secD CDS complement(2971941..2972282) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037519.1 transl_table 11 codon_start 1 locus_tag LOCUS_26800 gene yajC CDS complement(2972432..2973544) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037520.1 transl_table 11 codon_start 1 locus_tag LOCUS_26810 gene tgt CDS complement(2973541..2974728) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037521.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene queA CDS complement(2974896..2975327) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438075.1 transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS 2975454..2976950 product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(2977220..2978359) product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 2978544..2980889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS 2980981..2981613 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037528.1 transl_table 11 codon_start 1 locus_tag LOCUS_26870 gene upp CDS complement(2981984..2982385) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967545.1 transl_table 11 codon_start 1 locus_tag LOCUS_26880 CDS 2982276..2982605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS complement(2982560..2984164) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275523.1 transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(2984185..2985204) product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390310.1 transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS complement(2985285..2987627) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211632.1 transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS complement(2987666..2987899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(2987961..2989280) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(2989277..2990296) product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531886.1 transl_table 11 codon_start 1 locus_tag LOCUS_26950 CDS complement(2990349..2992325) product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021363.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 CDS 2992207..2992449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26970 CDS 2992580..2993221 product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087077.1 transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS complement(2993413..2994168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26990 CDS complement(2994165..2995055) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 transl_table 11 codon_start 1 locus_tag LOCUS_27000 CDS complement(2995423..2997156) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene ggt CDS complement(2997156..2997410) product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037531.1 transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(2997445..2998215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27030 CDS complement(2998556..2999047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508077.1 transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(2999112..2999615) product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037533.1 transl_table 11 codon_start 1 locus_tag LOCUS_27050 gene coaD CDS complement(2999623..3000312) product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037534.1 transl_table 11 codon_start 1 locus_tag LOCUS_27060 gene rsmD CDS 3000377..3001639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS 3001657..3002922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 3002919..3003989 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037560.1 transl_table 11 codon_start 1 locus_tag LOCUS_27090 gene mutY CDS 3003991..3004266 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037561.1 transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS complement(3004263..3004706) product DUF6491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275334.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 tRNA 3004879..3004954 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 3005136..3005876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 3006128..3007099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(3007914..3008363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 3009528..3011087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27150 CDS complement(3011389..3012312) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970541.1 transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 3012468..3013028 product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS 3013531..3013824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS 3014066..3014548 product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037572.1 transl_table 11 codon_start 1 locus_tag LOCUS_27190 CDS 3014604..3016388 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037573.1 transl_table 11 codon_start 1 locus_tag LOCUS_27200 CDS 3016520..3017134 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 transl_table 11 codon_start 1 locus_tag LOCUS_27210 CDS 3017294..3018436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS 3018531..3020468 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037575.1 transl_table 11 codon_start 1 locus_tag LOCUS_27230 gene dxs CDS 3020626..3021822 product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967024.1 transl_table 11 codon_start 1 locus_tag LOCUS_27240 gene rfbG CDS 3021819..3022676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 CDS 3022663..3023628 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 3023639..3024418 product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene rfbF CDS 3024472..3025452 product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 3025439..3026752 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129220445.1 transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 3026765..3029593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS complement(3029606..3030580) product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275525.1 transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 3030836..3032863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 3033028..3033213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 CDS 3033334..3033888 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329997.1 transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 3033920..3034357 product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080665811.1 transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS complement(3034442..3035614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS 3036237..3037352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 3037625..3037804 product DUF3606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037452.1 transl_table 11 codon_start 1 locus_tag LOCUS_27380 tRNA complement(3037914..3037990) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS complement(3038114..3038470) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005995911.1 transl_table 11 codon_start 1 locus_tag LOCUS_27390 CDS complement(3038463..3038765) product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811076.1 transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS complement(3038784..3041171) product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037596.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene pheT CDS complement(3041269..3042264) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037597.1 transl_table 11 codon_start 1 locus_tag LOCUS_27420 gene pheS CDS complement(3042479..3042838) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 transl_table 11 codon_start 1 locus_tag LOCUS_27430 gene rplT CDS complement(3042852..3043049) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002811096.1 transl_table 11 codon_start 1 locus_tag LOCUS_27440 gene rpmI CDS complement(3043347..3043817) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070690874.1 transl_table 11 codon_start 1 locus_tag LOCUS_27450 gene infC CDS complement(3043938..3045839) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944299.1 transl_table 11 codon_start 1 locus_tag LOCUS_27460 gene thrS tRNA complement(3046187..3046261) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS complement(3046386..3048419) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037621.1 transl_table 11 codon_start 1 locus_tag LOCUS_27470 gene uvrB CDS 3048570..3049100 product Tfp pilus assembly protein FimT/FimU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037622.1 transl_table 11 codon_start 1 locus_tag LOCUS_27480 tRNA 3049150..3049226 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS 3049324..3049827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 3049848..3050213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS complement(3050429..3051022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 CDS complement(3051019..3052020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 CDS 3052079..3053011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS complement(3053261..3053497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 CDS complement(3053579..3053890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27550 CDS complement(3053932..3054801) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27560 CDS complement(3054801..3055682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS complement(3055682..3057868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS complement(3057868..3058890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS complement(3058887..3059894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(3059891..3060322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(3060319..3061260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 CDS complement(3061257..3061862) product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383957.1 transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(3061862..3064513) product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072857.1 transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(3064557..3064970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(3064910..3065218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS complement(3065269..3065916) product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267970.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS complement(3066004..3066363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS complement(3066360..3066890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 CDS complement(3066883..3067236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27700 CDS complement(3067233..3067790) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975492.1 transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS complement(3067794..3067997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(3068066..3069568) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257523.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(3069565..3070260) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193633.1 transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS complement(3070268..3071470) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975496.1 transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(3071473..3073155) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301491.1 transl_table 11 codon_start 1 locus_tag LOCUS_27760 CDS complement(3073159..3073605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(3073667..3074194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(3074194..3074532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(3074505..3075047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27800 CDS complement(3075044..3075229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(3075229..3075726) product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135256.1 transl_table 11 codon_start 1 locus_tag LOCUS_27820 CDS complement(3075719..3075955) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS complement(3076215..3077027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(3077063..3077497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 CDS complement(3077506..3077751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 CDS complement(3077748..3078053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS complement(3078050..3078406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS complement(3078403..3079878) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036624.1 transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(3079875..3080750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(3080750..3080935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(3080937..3081380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(3081377..3081586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS complement(3081659..3081976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS 3082063..3082659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 CDS 3082622..3082969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS complement(3082970..3083530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS 3083681..3084055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS 3084052..3084267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 3084264..3084440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 3084443..3084742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 CDS 3084846..3085085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS complement(3085212..3085427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 3085505..3085693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS 3085690..3086313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 3086474..3086674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS complement(3086687..3086953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 CDS 3087058..3087567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS 3087564..3088418 product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077174050.1 transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 3088415..3088645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 3088629..3089609 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533600.1 transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 3090391..3090828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28120 CDS 3090937..3091245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 CDS complement(3091652..3092104) product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193395465.1 transl_table 11 codon_start 1 locus_tag LOCUS_28140 CDS complement(3092101..3095877) product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082925798.1 transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(3095890..3096345) product PilX N-terminal domain-containing pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037626.1 transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(3096401..3097696) product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037627.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 CDS complement(3097693..3098199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(3098196..3098732) product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037629.1 transl_table 11 codon_start 1 locus_tag LOCUS_28190 CDS 3098950..3099972 product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 transl_table 11 codon_start 1 locus_tag LOCUS_28200 gene algZ CDS complement(3100042..3101439) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054702.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 gene ppnN CDS complement(3101541..3104726) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037631.1 transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(3105017..3105613) product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006450537.1 transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(3105621..3106364) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037632.1 transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS complement(3106361..3106681) product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037633.1 transl_table 11 codon_start 1 locus_tag LOCUS_28250 gene grxD CDS 3106840..3107418 product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094005.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene sodB CDS complement(3107634..3108773) product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037635.1 transl_table 11 codon_start 1 locus_tag LOCUS_28270 CDS complement(3108770..3109336) product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037636.1 transl_table 11 codon_start 1 locus_tag LOCUS_28280 gene purE CDS 3109335..3109604 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 transl_table 11 codon_start 1 locus_tag LOCUS_28290 CDS 3109601..3110467 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037638.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 gene nadC CDS complement(3110488..3111285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 3111411..3111713 product DUF3301 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050912576.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS complement(3112099..3112569) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037463.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 CDS complement(3112718..3113335) product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037464.1 transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS complement(3113503..3114309) product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS complement(3114302..3115561) product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037466.1 transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(3115565..3116188) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037467.1 transl_table 11 codon_start 1 locus_tag LOCUS_28370 gene petA CDS complement(3116381..3116962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS 3116985..3117221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 CDS complement(3117449..3118243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 3118400..3119818 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037471.1 transl_table 11 codon_start 1 locus_tag LOCUS_28410 gene miaB CDS complement(3119865..3120884) product DUF5694 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057374.1 transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS complement(3120999..3122630) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730315.1 transl_table 11 codon_start 1 locus_tag LOCUS_28430 CDS complement(3122872..3124509) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(3124610..3125719) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704459.1 transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(3125716..3126690) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071850.1 transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3126687..3127634) product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462020.1 transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS complement(3127639..3128361) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703860.1 transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS 3128526..3128756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS 3128847..3129830 product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037472.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 3129839..3130318 product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037474.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene ybeY CDS 3130414..3131310 product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037476.1 transl_table 11 codon_start 1 locus_tag LOCUS_28520 CDS 3131321..3132487 product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037477.1 transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS 3132526..3133551 product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037478.1 transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 3133665..3135725 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388012.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 3135697..3135936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS complement(3136075..3137040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS complement(3137159..3138403) product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037853.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 CDS complement(3138496..3140577) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036305.1 transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(3140749..3142692) product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS 3143375..3145144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(3145201..3147039) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073927.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS complement(3147290..3148174) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035867.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene rfbD CDS complement(3148182..3148739) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035866.1 transl_table 11 codon_start 1 locus_tag LOCUS_28640 gene rfbC CDS complement(3148736..3149620) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439277.1 transl_table 11 codon_start 1 locus_tag LOCUS_28650 gene rfbA CDS complement(3149630..3150682) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035864.1 transl_table 11 codon_start 1 locus_tag LOCUS_28660 gene rfbB CDS complement(3150727..3151224) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037865.1 transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(3151364..3151678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28680 CDS complement(3151678..3151965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 3152113..3153129 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS complement(3153154..3154578) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037868.1 transl_table 11 codon_start 1 locus_tag LOCUS_28710 gene murD CDS complement(3154559..3155920) product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 transl_table 11 codon_start 1 locus_tag LOCUS_28720 gene murL CDS complement(3155917..3158496) product bifunctional aspartate kinase/diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037871.1 transl_table 11 codon_start 1 locus_tag LOCUS_28730 CDS 3158681..3159562 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037873.1 transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS complement(3159616..3160251) product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437811.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 CDS complement(3160362..3161054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS complement(3161064..3161501) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037875.1 transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 3161773..3163815 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 gene fusA CDS 3163939..3165150 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS 3165308..3165949 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088199.1 transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS 3166092..3166664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 CDS 3166666..3167361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 3167372..3167869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS complement(3168013..3170259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS complement(3170484..3171293) product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194455.1 transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(3171563..3172159) product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944109.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 3172387..3172842 product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 CDS 3172858..3174321 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037894.1 transl_table 11 codon_start 1 locus_tag LOCUS_28880 gene sufB CDS 3174366..3175130 product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 transl_table 11 codon_start 1 locus_tag LOCUS_28890 gene sufC CDS 3175132..3176433 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037896.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 gene sufD CDS 3176445..3177689 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037897.1 transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS 3177770..3178303 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037898.1 transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 3178300..3178629 product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037899.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS 3178961..3181264 product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037900.1 transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS 3181338..3182024 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037901.1 transl_table 11 codon_start 1 locus_tag LOCUS_28950 CDS 3182035..3182679 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037903.1 transl_table 11 codon_start 1 locus_tag LOCUS_28960 CDS 3182700..3183209 product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037904.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 3183367..3184176 product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037905.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS 3184253..3185182 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 3185179..3186822 product sulfite reductase flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920899.1 transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS complement(3186870..3187493) product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216841.1 transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(3187563..3188048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS 3188332..3189825 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037909.1 transl_table 11 codon_start 1 locus_tag LOCUS_29030 CDS complement(3189896..3191779) product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994000.1 transl_table 11 codon_start 1 locus_tag LOCUS_29040 gene cysN CDS complement(3191779..3192690) product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038279.1 transl_table 11 codon_start 1 locus_tag LOCUS_29050 gene cysD CDS 3192878..3194695 product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038280.1 transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 3194695..3196425 product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038281.1 transl_table 11 codon_start 1 locus_tag LOCUS_29070 gene cysI CDS 3196422..3197156 product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038282.1 transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS 3197243..3197605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 CDS complement(3197648..3198028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(3198065..3199123) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038287.1 transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 3199322..3200770 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930160.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 gene cysG CDS 3200813..3201790 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038289.1 transl_table 11 codon_start 1 locus_tag LOCUS_29130 gene cysK CDS 3201969..3203015 product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037911.1 transl_table 11 codon_start 1 locus_tag LOCUS_29140 CDS 3203034..3203732 product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037912.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 CDS complement(3203844..3204560) product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037913.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 gene hda CDS complement(3204567..3205754) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(3205786..3206901) product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598094.1 transl_table 11 codon_start 1 locus_tag LOCUS_29180 CDS 3207033..3208091 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628894.1 transl_table 11 codon_start 1 locus_tag LOCUS_29190 gene purM CDS 3208186..3208791 product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 CDS 3208791..3209465 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037918.1 transl_table 11 codon_start 1 locus_tag LOCUS_29210 gene purN CDS 3209487..3210257 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS 3210257..3210955 product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037920.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(3211015..3211353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037921.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 CDS complement(3211361..3212638) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037922.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 gene murA CDS complement(3212708..3212944) product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 CDS 3213135..3214166 product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037924.1 transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS 3214262..3214843 product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037925.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 CDS 3214855..3215424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 3215405..3215917 product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037927.1 transl_table 11 codon_start 1 locus_tag LOCUS_29300 gene lptA CDS 3215917..3216636 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037928.1 transl_table 11 codon_start 1 locus_tag LOCUS_29310 gene lptB CDS 3216762..3218147 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037929.1 transl_table 11 codon_start 1 locus_tag LOCUS_29320 CDS 3218301..3218627 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037930.1 transl_table 11 codon_start 1 locus_tag LOCUS_29330 gene raiA CDS 3218658..3219155 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921423.1 transl_table 11 codon_start 1 locus_tag LOCUS_29340 gene ptsN CDS 3219164..3220114 product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 transl_table 11 codon_start 1 locus_tag LOCUS_29350 gene hprK CDS 3220145..3221026 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508477.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 gene rapZ CDS 3221201..3221539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS 3221612..3221932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS 3222132..3222524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 transl_table 11 codon_start 1 locus_tag LOCUS_29390 CDS 3222614..3222883 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037934.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS 3222891..3224618 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037935.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene ptsP CDS 3224733..3226094 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037936.1 transl_table 11 codon_start 1 locus_tag LOCUS_29420 gene mgtE CDS 3226195..3227034 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037937.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 CDS complement(3227050..3227838) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037876.1 transl_table 11 codon_start 1 locus_tag LOCUS_29440 CDS complement(3227973..3228500) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037877.1 transl_table 11 codon_start 1 locus_tag LOCUS_29450 gene ruvX CDS complement(3228500..3229066) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 3229153..3230853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29470 CDS 3231070..3231639 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037880.1 transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(3231649..3234516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS complement(3234630..3234797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS 3235351..3237636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(3238011..3239186) product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005990431.1 transl_table 11 codon_start 1 locus_tag LOCUS_29520 CDS complement(3239316..3240353) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 3240465..3241148 product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037884.1 transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 3241201..3242037 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 gene proC CDS 3242056..3242553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS 3243224..3243415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 CDS complement(3243637..3244434) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(3244431..3244892) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921390.1 transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(3244889..3245491) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037965.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 gene pdxH CDS 3245491..3246327 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS 3246338..3246976 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037966.1 transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS 3246973..3248079 product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037967.1 transl_table 11 codon_start 1 locus_tag LOCUS_29630 gene aroB CDS 3248106..3248360 product WGR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037968.1 transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 3248491..3249561 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037969.1 transl_table 11 codon_start 1 locus_tag LOCUS_29650 gene hemE CDS complement(3249750..3253286) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994010.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 CDS complement(3253428..3253640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29670 CDS 3253567..3254220 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037974.1 transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 3254217..3254807 product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037975.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 3254807..3255361 product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037976.1 transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS complement(3255480..3255731) product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037977.1 transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 3255837..3257234 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037978.1 transl_table 11 codon_start 1 locus_tag LOCUS_29720 CDS 3257597..3259993 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153439072.1 transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS 3260121..3260384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS 3260502..3262529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS complement(3262665..3263000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 3263168..3264184 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037979.1 transl_table 11 codon_start 1 locus_tag LOCUS_29770 CDS complement(3264410..3265504) product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877730.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 CDS complement(3265501..3266691) product O-succinylhomoserine (thiol)-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037981.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(3266688..3267749) product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037982.1 transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(3267927..3268196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 3268156..3269178 product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 CDS 3269183..3270112 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037983.1 transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(3270246..3271328) product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038414.1 transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS 3271615..3273219 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS 3273230..3273514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 CDS complement(3273558..3274184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(3274187..3274843) product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061919.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 3274944..3275681 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS 3275902..3277791 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275308.1 transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS complement(3277862..3278290) product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS complement(3278401..3279414) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057335.1 transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(3279450..3280205) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037989.1 transl_table 11 codon_start 1 locus_tag LOCUS_29930 gene mtgA CDS 3280298..3281218 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037990.1 transl_table 11 codon_start 1 locus_tag LOCUS_29940 CDS 3281324..3282184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037991.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 3282497..3285451 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164741614.1 transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 3285802..3288882 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944144.1 transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 3289113..3292130 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164741614.1 transl_table 11 codon_start 1 locus_tag LOCUS_29980 CDS 3292237..3292896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(3292997..3293914) product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036501.1 transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS complement(3293989..3294507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS complement(3294504..3295100) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036499.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS complement(3295133..3296713) product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS complement(3296710..3297738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(3297765..3298349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS complement(3298357..3300162) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 transl_table 11 codon_start 1 locus_tag LOCUS_30060 CDS complement(3300210..3300890) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037993.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS 3301130..3303598 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037995.1 transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS 3303674..3304141 product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038810.1 transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS complement(3304518..3304862) product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037996.1 transl_table 11 codon_start 1 locus_tag LOCUS_30100 CDS complement(3305083..3306411) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS 3306546..3308201 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198976.1 transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS 3308425..3309798 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 3310104..3310337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 repeat_region 3310541..3310878 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttcttggcggccttcttcgcggtcttctt CDS complement(3311989..3312384) product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30150 gene gcvH CDS complement(3312491..3313708) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038002.1 transl_table 11 codon_start 1 locus_tag LOCUS_30160 gene gcvT CDS complement(3313746..3314294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(3314291..3314731) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038003.1 transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS complement(3314735..3315709) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS 3315819..3316454 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 CDS 3316447..3317205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30210 CDS 3317231..3318448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30220 CDS complement(3318714..3319559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036006.1 transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 3319488..3319754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30240 CDS complement(3319703..3321997) product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036004.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS complement(3322189..3322413) product hemin uptake protein HemP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 CDS complement(3322489..3323565) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036002.1 transl_table 11 codon_start 1 locus_tag LOCUS_30270 CDS 3323773..3324351 product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114372.1 transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS 3324470..3325606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 3325807..3327105 product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 3327144..3328181 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036000.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 3328647..3330788 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074066.1 transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS 3330801..3331889 product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140316.1 transl_table 11 codon_start 1 locus_tag LOCUS_30330 CDS 3331968..3332978 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 transl_table 11 codon_start 1 locus_tag LOCUS_30340 gene dusB CDS 3333194..3334030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 3334272..3334589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS complement(3334769..3335821) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035998.1 transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3336025..3336864) product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS complement(3336861..3338657) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705506.1 transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS 3338842..3340062 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035997.1 transl_table 11 codon_start 1 locus_tag LOCUS_30400 gene metK CDS 3340375..3341820 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035988.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene ahcY CDS complement(3341982..3342698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(3342968..3343552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30430 CDS complement(3343719..3345386) product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705728.1 transl_table 11 codon_start 1 locus_tag LOCUS_30440 gene tssI CDS complement(3345467..3345889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30450 CDS 3346592..3347422 product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035975.1 transl_table 11 codon_start 1 locus_tag LOCUS_30460 gene metF CDS 3347509..3348114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30470 CDS 3348193..3348813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275538.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 CDS 3348897..3349808 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 CDS complement(3350258..3351610) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437598.1 transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS complement(3351615..3352295) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003490678.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 3352313..3352654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS complement(3352771..3353676) product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038222.1 transl_table 11 codon_start 1 locus_tag LOCUS_30530 gene rimK CDS complement(3353673..3354188) product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660269.1 transl_table 11 codon_start 1 locus_tag LOCUS_30540 tRNA complement(3354260..3354333) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 CDS complement(3354432..3356258) product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038255.1 transl_table 11 codon_start 1 locus_tag LOCUS_30550 CDS 3356286..3356627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS 3356977..3357783 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 3357783..3358511 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038258.1 transl_table 11 codon_start 1 locus_tag LOCUS_30580 gene trmB CDS 3358630..3360471 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(3360629..3361033) product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378977.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 CDS complement(3361095..3361487) product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038260.1 transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS 3361548..3361865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038261.1 transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 3361872..3362591 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038262.1 transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS 3362646..3363053 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038263.1 transl_table 11 codon_start 1 locus_tag LOCUS_30640 gene mscL CDS 3363372..3364796 product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038264.1 transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS 3364809..3366545 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037122.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(3366549..3367436) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037407.1 transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 3367577..3368308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 CDS complement(3368392..3370950) product exo 1,3/1,4-beta-D-glucan glucohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036948.1 transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS complement(3371057..3372583) product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037950.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 CDS complement(3372625..3373683) product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037951.1 transl_table 11 codon_start 1 locus_tag LOCUS_30710 CDS complement(3373680..3374417) product SapC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275313.1 transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 3374444..3374632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS complement(3374626..3377763) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275312.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS complement(3378513..3379763) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037121.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 CDS complement(3379930..3380268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037120.1 transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(3380279..3380596) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037119.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 gene flgM CDS complement(3380685..3381374) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037118.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 gene flgA CDS 3381262..3381504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 3381591..3381779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 CDS 3382070..3382996 product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037117.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 3383156..3383572 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037116.1 transl_table 11 codon_start 1 locus_tag LOCUS_30820 gene flgB CDS 3383588..3383995 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037115.1 transl_table 11 codon_start 1 locus_tag LOCUS_30830 gene flgC CDS 3384019..3384687 product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037114.1 transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 3384761..3385984 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 transl_table 11 codon_start 1 locus_tag LOCUS_30850 gene flgE CDS 3386015..3386758 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037112.1 transl_table 11 codon_start 1 locus_tag LOCUS_30860 gene flgF CDS 3386927..3387712 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005994332.1 transl_table 11 codon_start 1 locus_tag LOCUS_30870 gene flgG CDS 3387709..3388404 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037111.1 transl_table 11 codon_start 1 locus_tag LOCUS_30880 gene flgH CDS complement(3388379..3388549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 3388599..3389768 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037110.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS 3390045..3391001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30910 CDS 3391004..3392884 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 transl_table 11 codon_start 1 locus_tag LOCUS_30920 gene flgK CDS 3392881..3394080 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 gene flgL CDS 3394508..3395689 product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037106.1 transl_table 11 codon_start 1 locus_tag LOCUS_30940 CDS 3395858..3397189 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037105.1 transl_table 11 codon_start 1 locus_tag LOCUS_30950 gene fliD CDS 3397202..3397594 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037104.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 gene fliS CDS 3397606..3397896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS 3397893..3398456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30980 CDS 3398772..3399416 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037101.1 transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS complement(3399574..3399909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS 3400274..3400531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS 3400711..3402084 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037100.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene rpoN CDS 3402092..3402475 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005997154.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 CDS 3402472..3403944 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037099.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 CDS 3404145..3404462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 3405276..3405653 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507679.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 gene fliE CDS 3405816..3407513 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037092.1 transl_table 11 codon_start 1 locus_tag LOCUS_31070 gene fliF CDS 3407506..3408510 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 transl_table 11 codon_start 1 locus_tag LOCUS_31080 gene fliG CDS 3408507..3409139 product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037090.1 transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 3409324..3410721 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037089.1 transl_table 11 codon_start 1 locus_tag LOCUS_31100 gene fliI CDS 3410718..3411161 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037088.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 gene fliJ CDS 3411161..3412450 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037087.1 transl_table 11 codon_start 1 locus_tag LOCUS_31120 CDS 3412970..3413464 product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083042.1 transl_table 11 codon_start 1 locus_tag LOCUS_31130 gene fliL CDS 3413487..3414527 product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037085.1 transl_table 11 codon_start 1 locus_tag LOCUS_31140 gene fliM CDS 3414531..3414860 product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037084.1 transl_table 11 codon_start 1 locus_tag LOCUS_31150 gene fliN CDS 3415178..3415699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS 3415844..3416695 product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037082.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 gene fliP CDS 3416706..3416975 product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037081.1 transl_table 11 codon_start 1 locus_tag LOCUS_31180 CDS 3417052..3417957 product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037080.1 transl_table 11 codon_start 1 locus_tag LOCUS_31190 gene fliR CDS 3418116..3419342 product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037076.1 transl_table 11 codon_start 1 locus_tag LOCUS_31200 gene flhB CDS 3419339..3421417 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945277.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 gene flhA CDS 3421561..3423747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 3423731..3424633 product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010374294.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 3424630..3425400 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037072.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 CDS 3425592..3425984 product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007649667.1 transl_table 11 codon_start 1 locus_tag LOCUS_31250 gene cheY CDS 3425981..3426610 product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037071.1 transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 3426788..3428563 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037070.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 CDS 3428801..3429541 product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS 3429561..3430676 product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 transl_table 11 codon_start 1 locus_tag LOCUS_31290 gene motD CDS 3430676..3431455 product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037057.1 transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS 3431565..3432692 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037056.1 transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS 3432689..3433093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 3433116..3433400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS 3433446..3433811 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 3433865..3435868 product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037054.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 CDS 3436018..3436500 product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS 3436747..3438570 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921178.1 transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS 3439386..3440555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712483.1 transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS 3440569..3440994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS 3441082..3443181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(3443138..3443374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 3443824..3445983 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994157.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 CDS 3446364..3446816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS complement(3446924..3447235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 3447614..3450262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31450 CDS 3450458..3451300 product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037038.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 3451305..3451910 product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037037.1 transl_table 11 codon_start 1 locus_tag LOCUS_31470 gene cheD CDS 3451910..3452977 product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 CDS 3453226..3454398 product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 CDS 3454499..3455380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 CDS complement(3456292..3457293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS complement(3457280..3457849) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275297.1 transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS complement(3457949..3459505) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038273.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 CDS complement(3459616..3462756) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038276.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 CDS complement(3462772..3463848) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 CDS 3464223..3465179 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038289.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene cysK CDS 3465366..3465884 product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038291.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS complement(3466230..3466838) product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082412.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 CDS complement(3466838..3467458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31590 CDS complement(3467468..3469960) product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327938.1 transl_table 11 codon_start 1 locus_tag LOCUS_31600 gene napA CDS complement(3469957..3470292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 CDS complement(3470289..3470807) product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705479.1 transl_table 11 codon_start 1 locus_tag LOCUS_31620 gene napF CDS complement(3470809..3470973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS complement(3471244..3472254) product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(3472390..3473076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(3473207..3474673) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508780.1 transl_table 11 codon_start 1 locus_tag LOCUS_31660 gene pyk CDS complement(3474868..3475506) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038294.1 transl_table 11 codon_start 1 locus_tag LOCUS_31670 CDS complement(3475631..3476806) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038295.1 transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS 3477397..3479883 product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030123.1 transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS 3480185..3481204 product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030122.1 transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS 3481331..3481834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS complement(3481881..3483233) product DUF3999 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038296.1 transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(3483230..3485908) product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097121319.1 transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS complement(3486028..3486456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 CDS complement(3486572..3487573) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 transl_table 11 codon_start 1 locus_tag LOCUS_31750 gene gap CDS 3487790..3488413 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038301.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 CDS 3488496..3489296 product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038304.1 transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS 3489378..3490244 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038303.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS 3490253..3490678 product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946442.1 transl_table 11 codon_start 1 locus_tag LOCUS_31790 CDS 3490675..3491106 product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817041.1 transl_table 11 codon_start 1 locus_tag LOCUS_31800 CDS 3491191..3493128 product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275287.1 transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(3493584..3495569) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038323.1 transl_table 11 codon_start 1 locus_tag LOCUS_31820 gene tkt CDS complement(3495824..3497161) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS complement(3497326..3498675) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993997.1 transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(3498727..3500475) product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038325.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS complement(3500472..3502202) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038326.1 transl_table 11 codon_start 1 locus_tag LOCUS_31860 CDS complement(3502199..3503221) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038327.1 transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(3503218..3503703) product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 CDS complement(3503703..3504647) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275283.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS complement(3504756..3505748) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038330.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(3506493..3508430) product type IV pilus secretin PilQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038331.1 transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS complement(3508449..3509000) product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038332.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 CDS complement(3509002..3509676) product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31930 CDS complement(3509673..3510458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31940 CDS complement(3510458..3511516) product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 CDS 3511798..3514290 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095522231.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 3514595..3515158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038337.1 transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(3515165..3515779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31980 CDS complement(3515786..3517090) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038338.1 transl_table 11 codon_start 1 locus_tag LOCUS_31990 CDS complement(3517661..3517909) product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(3517992..3518924) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038340.1 transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS complement(3518961..3519698) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275306.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS complement(3519695..3520702) product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 CDS complement(3520740..3521774) product glucokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038011.1 transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS complement(3521862..3523979) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038341.1 transl_table 11 codon_start 1 locus_tag LOCUS_32050 gene recG CDS complement(3524116..3526530) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(3526633..3527781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 CDS complement(3527778..3529034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 CDS 3529217..3530302 product AraC family transcriptional regulator SphR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114360.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 gene sphR CDS 3530311..3530694 product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975151.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS complement(3530805..3531188) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS complement(3531265..3533457) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038350.1 transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(3533751..3534050) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812428.1 transl_table 11 codon_start 1 locus_tag LOCUS_32130 gene rpoZ CDS complement(3534204..3534830) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038351.1 transl_table 11 codon_start 1 locus_tag LOCUS_32140 gene gmk CDS complement(3534938..3535798) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038352.1 transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 3535889..3536653 product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene rph CDS 3536662..3537051 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974248.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 CDS 3537048..3537647 product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877719.1 transl_table 11 codon_start 1 locus_tag LOCUS_32180 gene rdgB CDS 3537756..3538964 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038356.1 transl_table 11 codon_start 1 locus_tag LOCUS_32190 gene hemW CDS 3539142..3541403 product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038357.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS 3541415..3541765 product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038358.1 transl_table 11 codon_start 1 locus_tag LOCUS_32210 CDS 3541938..3543260 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038359.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 gene pepQ CDS 3543457..3543861 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265752.1 transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(3543890..3545218) product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(3545301..3545849) product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038362.1 transl_table 11 codon_start 1 locus_tag LOCUS_32250 CDS 3545969..3550537 product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070706.1 transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 3550606..3550836 product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 3550844..3551143 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038364.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 3551618..3552205 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038365.1 transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 3552202..3552672 product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 CDS 3552715..3553377 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038367.1 transl_table 11 codon_start 1 locus_tag LOCUS_32310 gene rpiA CDS 3553507..3554976 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 transl_table 11 codon_start 1 locus_tag LOCUS_32320 gene dinB rRNA complement(3555334..3555442) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA complement(3555605..3558464) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 tRNA complement(3558700..3558776) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 tRNA complement(3558851..3558926) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 rRNA complement(3559042..3560582) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 3561176..3561604 product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038368.1 transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(3561623..3561814) product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216955.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS 3561884..3562552 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038371.1 transl_table 11 codon_start 1 locus_tag LOCUS_32350 gene thiE CDS 3562549..3563835 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038374.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene hemL CDS complement(3563893..3565125) product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038384.1 transl_table 11 codon_start 1 locus_tag LOCUS_32370 CDS 3565236..3566108 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038385.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 CDS complement(3566112..3566960) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038387.1 transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS complement(3567027..3567695) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053924.1 transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 3567813..3569825 product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS complement(3569814..3570401) product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038391.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(3570458..3571897) product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038392.1 transl_table 11 codon_start 1 locus_tag LOCUS_32430 gene mpl CDS complement(3572061..3572639) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 3572830..3574086 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038394.1 transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS 3574137..3574787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32460 CDS 3574793..3575263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(3575332..3575868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275517.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS 3576068..3578095 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 CDS 3578361..3578915 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002804918.1 transl_table 11 codon_start 1 locus_tag LOCUS_32500 gene ppa CDS complement(3578967..3579257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS complement(3579254..3580240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(3580453..3583347) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164741614.1 transl_table 11 codon_start 1 locus_tag LOCUS_32530 CDS complement(3583624..3584547) product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038416.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 CDS complement(3584692..3587034) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(3587392..3588075) product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 transl_table 11 codon_start 1 locus_tag LOCUS_32560 CDS complement(3588191..3590068) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038418.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 gene thiC CDS 3590583..3593120 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene thrA CDS 3593117..3594100 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036971.1 transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 3594097..3595380 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036973.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene thrC CDS 3595494..3595685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 3595772..3597526 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228538.1 transl_table 11 codon_start 1 locus_tag LOCUS_32620 gene ilvD CDS 3597567..3598583 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038422.1 transl_table 11 codon_start 1 locus_tag LOCUS_32630 gene ilvC CDS 3598583..3600322 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038423.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 gene ilvG CDS 3600306..3600542 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038424.1 transl_table 11 codon_start 1 locus_tag LOCUS_32650 CDS 3600533..3601489 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 CDS 3601558..3602580 product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038425.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 CDS 3602577..3604154 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 3604182..3605630 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 transl_table 11 codon_start 1 locus_tag LOCUS_32690 gene leuC CDS 3605630..3606229 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 gene leuD CDS 3606219..3607307 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 transl_table 11 codon_start 1 locus_tag LOCUS_32710 gene leuB CDS 3607386..3608000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038147.1 transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS 3608419..3608907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS 3608852..3609175 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 CDS 3609165..3609584 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 3609836..3610258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS 3610627..3610929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 CDS complement(3611088..3614246) product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(3614254..3615384) product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 transl_table 11 codon_start 1 locus_tag LOCUS_32790 gene mexJ CDS 3615462..3616175 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038433.1 transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS 3616315..3616962 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS 3617034..3618452 product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038435.1 transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS complement(3618550..3619458) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039297.1 transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(3619569..3620870) product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038436.1 transl_table 11 codon_start 1 locus_tag LOCUS_32840 gene waaA CDS 3621052..3621918 product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038437.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(3621922..3623226) product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038438.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(3623213..3624334) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038439.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(3624381..3624581) product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(3624664..3625374) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707660.1 transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(3625512..3626093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS complement(3626139..3626738) product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038689.1 transl_table 11 codon_start 1 locus_tag LOCUS_32910 CDS 3626846..3627823 product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038688.1 transl_table 11 codon_start 1 locus_tag LOCUS_32920 CDS complement(3627805..3630642) product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038683.1 transl_table 11 codon_start 1 locus_tag LOCUS_32930 gene glnE CDS complement(3630921..3631529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32940 CDS complement(3631659..3633299) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene groL CDS complement(3633437..3633724) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene groES CDS 3634246..3634653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32970 CDS complement(3634657..3635130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 3635286..3635627 product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 3635620..3638049 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035768.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 3638049..3638645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 3638775..3639230 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 transl_table 11 codon_start 1 locus_tag LOCUS_33020 gene aroQ CDS 3639281..3639751 product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035766.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 gene accB CDS 3639857..3641224 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035764.1 transl_table 11 codon_start 1 locus_tag LOCUS_33040 gene accC CDS 3641292..3642155 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS complement(3642183..3642620) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035763.1 transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(3642617..3643609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035762.1 transl_table 11 codon_start 1 locus_tag LOCUS_33070 CDS 3643792..3644712 product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035761.1 transl_table 11 codon_start 1 locus_tag LOCUS_33080 gene prmA CDS 3644747..3645643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS 3645742..3646014 product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035757.1 transl_table 11 codon_start 1 locus_tag LOCUS_33100 gene fis CDS 3646173..3647903 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035747.1 transl_table 11 codon_start 1 locus_tag LOCUS_33110 gene purH CDS 3648116..3648610 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930780.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(3648638..3650092) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969573.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 CDS 3650278..3651582 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035746.1 transl_table 11 codon_start 1 locus_tag LOCUS_33140 gene purD CDS complement(3651700..3651972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS 3652242..3653963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33160 CDS 3654110..3654367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 CDS complement(3654646..3654813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(3654810..3655235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(3655219..3656169) product DUF6402 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074846341.1 transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(3656175..3656735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 CDS 3657046..3658947 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035742.1 transl_table 11 codon_start 1 locus_tag LOCUS_33220 CDS 3659022..3659378 product CD225/dispanin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035741.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 3659375..3659794 product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS complement(3659891..3660835) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 CDS complement(3660947..3661891) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035738.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 gene nudC CDS complement(3661888..3662262) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035737.1 transl_table 11 codon_start 1 locus_tag LOCUS_33270 gene erpA CDS complement(3662345..3663136) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS complement(3663189..3663605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS complement(3663652..3664383) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 CDS 3664461..3665042 product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035734.1 transl_table 11 codon_start 1 locus_tag LOCUS_33310 CDS complement(3665115..3665585) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035731.1 transl_table 11 codon_start 1 locus_tag LOCUS_33320 gene bfr CDS complement(3665714..3665935) product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035730.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 CDS complement(3666016..3666693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 tRNA 3666717..3666793 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS 3667207..3669258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS 3669248..3671578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS 3671735..3672190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 3672322..3673377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS 3673843..3674982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 3674979..3675521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 CDS 3675526..3675960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS 3675966..3677459 product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035339735.1 transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS complement(3677700..3678920) product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 transl_table 11 codon_start 1 locus_tag LOCUS_33430 CDS complement(3678921..3679355) product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537483.1 transl_table 11 codon_start 1 locus_tag LOCUS_33440 CDS complement(3679361..3680599) product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057142.1 transl_table 11 codon_start 1 locus_tag LOCUS_33450 gene dcm CDS complement(3680692..3682368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(3682372..3682797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS complement(3682794..3684623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS complement(3684610..3685425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33490 CDS complement(3685422..3687077) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 transl_table 11 codon_start 1 locus_tag LOCUS_33500 CDS 3687826..3688518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS complement(3688844..3689335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS complement(3689424..3689627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33530 CDS complement(3689649..3689768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33540 CDS complement(3689765..3690547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042012908.1 transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(3690541..3691536) product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705014.1 transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(3691605..3692561) product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705015.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(3693087..3695405) product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974867.1 transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(3695639..3696631) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146535726.1 transl_table 11 codon_start 1 locus_tag LOCUS_33590 CDS 3696726..3697049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33600 CDS 3697418..3698125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS 3698125..3699399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS 3699518..3700330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS 3700340..3701578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS complement(3701659..3702846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS complement(3703153..3704364) product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530181.1 transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 3705175..3705468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 CDS complement(3705470..3706060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS complement(3706290..3706679) product MbcA/ParS/Xre antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525097.1 transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(3706870..3707097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 3707476..3707982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 CDS complement(3708147..3708599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33720 CDS 3708774..3708980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(3709118..3709729) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390815.1 transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS complement(3709751..3710362) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390814.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 CDS complement(3710446..3711330) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 3711445..3712074 product glutathione transferase GstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765713.1 transl_table 11 codon_start 1 locus_tag LOCUS_33770 gene gstA CDS 3712104..3712403 product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087106.1 transl_table 11 codon_start 1 locus_tag LOCUS_33780 CDS 3712500..3712952 product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730468.1 transl_table 11 codon_start 1 locus_tag LOCUS_33790 CDS complement(3713027..3713335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(3713402..3713827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 CDS complement(3714084..3715004) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 CDS complement(3715098..3716249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(3716456..3717136) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087570.1 transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS complement(3717322..3717837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33850 CDS complement(3717949..3718191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS complement(3718517..3719437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(3719441..3719983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS 3720121..3720612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS 3720588..3720806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS 3720803..3721291 product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 transl_table 11 codon_start 1 locus_tag LOCUS_33910 CDS 3721299..3721739 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 3721736..3722119 product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222673.1 transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS 3722119..3722805 product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398893.1 transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS complement(3722937..3723281) product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 transl_table 11 codon_start 1 locus_tag LOCUS_33950 CDS 3723425..3724102 product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197238.1 transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(3724165..3725310) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 3725399..3725953 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224131.1 transl_table 11 codon_start 1 locus_tag LOCUS_33980 CDS 3726627..3728030 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112138.1 transl_table 11 codon_start 1 locus_tag LOCUS_33990 CDS 3728172..3728918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(3729038..3729334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 3729552..3729818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34020 note possible pseudo, frameshifted CDS 3729842..3730666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 note possible pseudo, frameshifted CDS complement(3730916..3731320) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070494.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 CDS complement(3731394..3731609) product DUF4287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061368.1 transl_table 11 codon_start 1 locus_tag LOCUS_34050 CDS complement(3731852..3732247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 3732310..3732546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS complement(3732947..3733288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS complement(3733364..3733609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(3733736..3734185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS complement(3734261..3734530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 CDS complement(3734983..3735396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34120 CDS complement(3735456..3735779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(3735940..3736242) product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258305.1 transl_table 11 codon_start 1 locus_tag LOCUS_34140 CDS complement(3736921..3737148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS complement(3737196..3737696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 CDS complement(3738165..3738407) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS complement(3738571..3738762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS complement(3738954..3739397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34190 CDS complement(3739509..3739904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS 3740159..3740890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(3740984..3741280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS complement(3741775..3742044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037162.1 transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(3742085..3742540) product PA2169 family four-helix-bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324679.1 transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS 3742743..3743489 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506728.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 3743577..3744116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34260 CDS 3744113..3745816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 CDS 3746216..3747019 product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050980063.1 transl_table 11 codon_start 1 locus_tag LOCUS_34280 CDS 3747016..3747564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS 3747688..3750312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS 3750406..3751359 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063794.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS 3751380..3752183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS 3752183..3753403 product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705471.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 CDS complement(3753413..3753886) product low affinity iron permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113677.1 transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 3754063..3754251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34350 CDS 3754259..3755428 product DUF3182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275498.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 CDS 3755418..3756212 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038960.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(3756426..3757430) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970180.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(3757526..3757891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34390 CDS complement(3758030..3758971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS 3759056..3759409 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene queD CDS complement(3759450..3761741) product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene plpD CDS 3761758..3762345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 3762541..3762921 product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388571.1 transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 3762918..3763463 product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388570.1 transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS 3763576..3763992 product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524062.1 transl_table 11 codon_start 1 locus_tag LOCUS_34460 gene yiaA CDS complement(3764051..3767218) product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037511.1 transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS complement(3767228..3768448) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037510.1 transl_table 11 codon_start 1 locus_tag LOCUS_34480 CDS complement(3768571..3769239) product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035832.1 transl_table 11 codon_start 1 locus_tag LOCUS_34490 gene bioD CDS 3769339..3769824 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945126.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS 3769821..3770213 product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035830.1 transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS 3770790..3772661 product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275301.1 transl_table 11 codon_start 1 locus_tag LOCUS_34520 gene btuB CDS 3772795..3773310 product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038763.1 transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS complement(3773297..3775135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035345.1 transl_table 11 codon_start 1 locus_tag LOCUS_34540 CDS complement(3775132..3777312) product DUF4175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640602.1 transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(3777309..3778469) product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035347.1 transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(3778466..3779380) product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035348.1 transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(3779394..3780389) product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035349.1 transl_table 11 codon_start 1 locus_tag LOCUS_34580 CDS complement(3780494..3781195) product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035350.1 transl_table 11 codon_start 1 locus_tag LOCUS_34590 CDS complement(3781192..3782817) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275119.1 transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(3782833..3784167) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS complement(3784191..3785795) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506028.1 transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS complement(3786317..3788149) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035815.1 transl_table 11 codon_start 1 locus_tag LOCUS_34630 gene glmS CDS 3788345..3789634 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035814.1 transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 3789723..3790454 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035813.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 3790466..3791785 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035812.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 CDS 3791802..3793037 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035811.1 transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 3793163..3794497 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035809.1 transl_table 11 codon_start 1 locus_tag LOCUS_34680 CDS 3794502..3795818 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035808.1 transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(3796131..3797501) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035805.1 transl_table 11 codon_start 1 locus_tag LOCUS_34700 gene glmU CDS 3797616..3798020 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070691708.1 transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS complement(3798421..3798846) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035802.1 transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS complement(3798970..3800370) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035801.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene atpD CDS complement(3800446..3801309) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035800.1 transl_table 11 codon_start 1 locus_tag LOCUS_34740 gene atpG CDS complement(3801412..3802962) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035799.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene atpA CDS complement(3803009..3803536) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035798.1 transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS complement(3803585..3804055) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035797.1 transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS complement(3804145..3804438) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195828.1 transl_table 11 codon_start 1 locus_tag LOCUS_34780 gene atpE CDS complement(3804525..3805364) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene atpB CDS complement(3805366..3805764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035795.1 transl_table 11 codon_start 1 locus_tag LOCUS_34800 CDS 3805993..3806211 product DUF2061 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074324.1 transl_table 11 codon_start 1 locus_tag LOCUS_34810 CDS 3806600..3807406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042594608.1 transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(3807483..3809303) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035792.1 transl_table 11 codon_start 1 locus_tag LOCUS_34830 gene lpdA CDS complement(3809323..3810000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035791.1 transl_table 11 codon_start 1 locus_tag LOCUS_34840 CDS complement(3809997..3811442) product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035790.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 gene aceF CDS complement(3811534..3812352) product YggN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035789.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS 3812671..3813321 product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035787.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS 3813506..3813700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506459.1 transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 3813708..3814613 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038619.1 transl_table 11 codon_start 1 locus_tag LOCUS_34890 CDS complement(3814626..3815513) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038714.1 transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS complement(3815668..3816738) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066795.1 transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 3816899..3817381 product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038715.1 transl_table 11 codon_start 1 locus_tag LOCUS_34920 CDS 3817398..3817934 product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038716.1 transl_table 11 codon_start 1 locus_tag LOCUS_34930 CDS complement(3817939..3818610) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS complement(3818607..3819314) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038721.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(3819326..3820372) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038722.1 transl_table 11 codon_start 1 locus_tag LOCUS_34960 CDS 3820497..3820757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057646379.1 transl_table 11 codon_start 1 locus_tag LOCUS_34970 CDS complement(3820993..3823500) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 transl_table 11 codon_start 1 locus_tag LOCUS_34980 CDS complement(3823497..3824198) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406778.1 transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 3824257..3824979 product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247882.1 transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS 3826184..3827311 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038957.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 CDS 3827365..3828591 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(3828988..3829509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 CDS complement(3829506..3830078) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 transl_table 11 codon_start 1 locus_tag LOCUS_35040 CDS 3830231..3830557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS complement(3830696..3831130) product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402109.1 transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 3831231..3831854 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329018.1 transl_table 11 codon_start 1 locus_tag LOCUS_35070 CDS complement(3831956..3833626) product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038609.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(3833753..3834184) product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275103.1 transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS 3834482..3835756 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037380.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 CDS 3835867..3836067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS 3836145..3836918 product aminotransferase class I and II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530009.1 transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS 3836905..3837315 product DUF3037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142760.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(3837421..3837630) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483561.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 CDS 3837865..3838149 product DUF4031 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038739.1 transl_table 11 codon_start 1 locus_tag LOCUS_35150 CDS 3838241..3838459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35160 CDS complement(3838497..3839216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 3839516..3840058 product DUF3016 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921578.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(3840118..3840879) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS complement(3840876..3841841) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038743.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 CDS complement(3841907..3842176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 CDS 3842360..3842734 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038745.1 transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(3842743..3843627) product helix-turn-helix domain-containing GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109964.1 transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(3843936..3844157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170106.1 transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(3844271..3845581) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175504.1 transl_table 11 codon_start 1 locus_tag LOCUS_35250 CDS 3845929..3846273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS 3846436..3846645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 3846656..3846835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 3846968..3847570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 CDS complement(3847649..3848635) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397470.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 3848815..3849294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35310 CDS complement(3849326..3849484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(3850085..3850483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35330 CDS 3850590..3851306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 CDS complement(3851310..3852476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS 3852635..3853849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(3853951..3855165) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275407.1 transl_table 11 codon_start 1 locus_tag LOCUS_35370 CDS complement(3855332..3855955) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038702.1 transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS 3856018..3856419 product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 transl_table 11 codon_start 1 locus_tag LOCUS_35390 CDS complement(3856594..3857940) product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 transl_table 11 codon_start 1 locus_tag LOCUS_35400 CDS complement(3858195..3858644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS complement(3858657..3859649) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185965189.1 transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS complement(3859892..3860092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 CDS 3860504..3861094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 3861091..3861867 product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105094.1 transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 3861864..3862487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS 3862628..3863059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 3863088..3863996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 3864070..3864954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(3864936..3865751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 CDS complement(3865912..3868611) product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038709.1 transl_table 11 codon_start 1 locus_tag LOCUS_35510 gene aceE CDS complement(3869087..3869425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35520 CDS 3869538..3871622 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 3871694..3872188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35540 CDS 3872277..3872564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 CDS complement(3872720..3875038) product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038443.1 transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(3875149..3876411) product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(3876425..3877567) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038460.1 transl_table 11 codon_start 1 locus_tag LOCUS_35580 gene rsgA CDS 3877785..3879035 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 CDS 3879035..3879664 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 transl_table 11 codon_start 1 locus_tag LOCUS_35600 CDS 3879675..3880370 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038464.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS complement(3880436..3881254) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038465.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 3881611..3882537 product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038466.1 transl_table 11 codon_start 1 locus_tag LOCUS_35630 gene grxD CDS complement(3882730..3883275) product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531871.1 transl_table 11 codon_start 1 locus_tag LOCUS_35640 CDS complement(3883310..3883876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35650 CDS 3884150..3884437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS complement(3884518..3885294) product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761555.1 transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 3885459..3886937 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437413.1 transl_table 11 codon_start 1 locus_tag LOCUS_35680 CDS 3886934..3888334 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275272.1 transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 3888614..3889021 product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 transl_table 11 codon_start 1 locus_tag LOCUS_35700 CDS 3889032..3889676 product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186002.1 transl_table 11 codon_start 1 locus_tag LOCUS_35710 CDS 3889777..3890724 product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038480.1 transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS 3890803..3891147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944410.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS 3891144..3891812 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 CDS complement(3891815..3892645) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038485.1 transl_table 11 codon_start 1 locus_tag LOCUS_35750 gene fghA CDS complement(3892798..3893907) product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008111.1 transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(3893945..3894298) product metal/formaldehyde-sensitive transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038488.1 transl_table 11 codon_start 1 locus_tag LOCUS_35770 CDS complement(3894420..3894983) product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039427.1 transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(3895112..3896602) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038493.1 transl_table 11 codon_start 1 locus_tag LOCUS_35790 CDS complement(3896599..3897306) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216945.1 transl_table 11 codon_start 1 locus_tag LOCUS_35800 CDS complement(3897613..3899271) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 transl_table 11 codon_start 1 locus_tag LOCUS_35810 CDS 3899428..3902169 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035990.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene ppc CDS complement(3902544..3903908) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038494.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 CDS 3904226..3905278 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072259.1 transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS complement(3905288..3906976) product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994018.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 CDS complement(3906987..3908492) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 transl_table 11 codon_start 1 locus_tag LOCUS_35860 CDS complement(3908489..3910783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037604.1 transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS 3910996..3912636 product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037608.1 transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 3912692..3914473 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 3914761..3917538 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275328.1 transl_table 11 codon_start 1 locus_tag LOCUS_35900 CDS complement(3917962..3918576) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038495.1 transl_table 11 codon_start 1 locus_tag LOCUS_35910 gene yihA CDS 3918783..3919649 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437398.1 transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS 3919768..3920418 product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038497.1 transl_table 11 codon_start 1 locus_tag LOCUS_35930 CDS 3920393..3921337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 3921355..3922113 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038499.1 transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS complement(3922293..3925193) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038503.1 transl_table 11 codon_start 1 locus_tag LOCUS_35960 CDS complement(3925528..3926586) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052123654.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 CDS complement(3926638..3929298) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210844.1 transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(3929429..3930163) product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484311.1 transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(3930241..3930807) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113678.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 CDS 3931413..3932792 product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989366.1 transl_table 11 codon_start 1 locus_tag LOCUS_36010 CDS 3933011..3937360 product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704848.1 transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(3937369..3938169) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS 3938412..3940376 product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993987.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS 3940403..3941302 product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 3941372..3941749 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073568.1 transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS 3941749..3942975 product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(3943466..3946081) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038160.1 transl_table 11 codon_start 1 locus_tag LOCUS_36080 CDS complement(3946335..3946751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS complement(3946748..3947980) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014508984.1 transl_table 11 codon_start 1 locus_tag LOCUS_36100 CDS 3948055..3948807 product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(3948990..3949814) product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(3949921..3950427) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038531.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 gene folK CDS complement(3950443..3950796) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 gene folB CDS complement(3950875..3951912) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038897.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 gene tsaD CDS 3952083..3952298 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808376.1 transl_table 11 codon_start 1 locus_tag LOCUS_36160 gene rpsU CDS 3952509..3952955 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038898.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 CDS 3953084..3954853 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 gene dnaG CDS 3954960..3955487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS 3955572..3957563 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928481.1 transl_table 11 codon_start 1 locus_tag LOCUS_36200 CDS complement(3957514..3957846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36210 CDS 3957946..3958509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36220 CDS complement(3958702..3960033) product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS complement(3960059..3960994) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506322.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 gene cyoE CDS complement(3960994..3962169) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038905.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 CDS complement(3962204..3962836) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038906.1 transl_table 11 codon_start 1 locus_tag LOCUS_36260 CDS complement(3962847..3963593) product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038907.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 3963636..3963851 product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038908.1 transl_table 11 codon_start 1 locus_tag LOCUS_36280 CDS complement(3963999..3964877) product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 transl_table 11 codon_start 1 locus_tag LOCUS_36290 CDS complement(3964917..3965534) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038910.1 transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(3965531..3965665) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS complement(3965817..3967433) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038912.1 transl_table 11 codon_start 1 locus_tag LOCUS_36320 gene ctaD CDS complement(3967458..3968393) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038913.1 transl_table 11 codon_start 1 locus_tag LOCUS_36330 gene coxB CDS 3968743..3971964 product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038915.1 transl_table 11 codon_start 1 locus_tag LOCUS_36340 gene putA CDS 3972143..3972307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(3972396..3973748) product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035275.1 transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS 3973996..3974688 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035276.1 transl_table 11 codon_start 1 locus_tag LOCUS_36370 CDS 3974766..3975086 product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035277.1 transl_table 11 codon_start 1 locus_tag LOCUS_36380 CDS 3975110..3975673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36390 CDS complement(3975698..3977035) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275102.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 CDS complement(3977167..3978396) product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196264.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 gene envC CDS complement(3978400..3979995) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene gpmI CDS 3980102..3980764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035281.1 transl_table 11 codon_start 1 locus_tag LOCUS_36430 CDS 3980897..3982654 product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035282.1 transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS 3982753..3983151 product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530008.1 transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS 3983168..3983911 product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640646.1 transl_table 11 codon_start 1 locus_tag LOCUS_36460 rRNA complement(3984248..3984356) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA complement(3984519..3987379) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 tRNA complement(3987615..3987691) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 tRNA complement(3987766..3987841) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 rRNA complement(3987957..3989497) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS complement(3990069..3991310) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038916.1 transl_table 11 codon_start 1 locus_tag LOCUS_36470 gene tyrS CDS 3991593..3992945 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038917.1 transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 3992947..3994116 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038918.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 CDS complement(3994132..3994467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36500 CDS complement(3994496..3995896) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073584.1 transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS complement(3995886..3996659) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038921.1 transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS 3996741..3997277 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480144.1 transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 3997274..3997939 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038922.1 transl_table 11 codon_start 1 locus_tag LOCUS_36540 gene pyrE CDS 3998031..3998711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439447.1 transl_table 11 codon_start 1 locus_tag LOCUS_36550 CDS complement(3998809..4001127) product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275495.1 transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(4001142..4001600) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038933.1 transl_table 11 codon_start 1 locus_tag LOCUS_36570 gene dut CDS complement(4001685..4002353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 note possible pseudo, frameshifted CDS complement(4002350..4002907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 note possible pseudo, frameshifted CDS 4003155..4003850 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038935.1 transl_table 11 codon_start 1 locus_tag LOCUS_36600 gene radC CDS 4003914..4005602 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038936.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 gene argS CDS 4005603..4006466 product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038937.1 transl_table 11 codon_start 1 locus_tag LOCUS_36620 CDS 4006727..4007119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36630 CDS complement(4007126..4007980) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763004.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 CDS complement(4008020..4008292) product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438175.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 CDS complement(4008289..4010178) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038943.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 gene speA CDS complement(4010262..4012112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 CDS 4012268..4013122 product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038944.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 gene speE CDS 4013368..4014024 product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506282.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 CDS complement(4014026..4015138) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038940.1 transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS complement(4015294..4015632) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038947.1 transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS 4015821..4016099 product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 transl_table 11 codon_start 1 locus_tag LOCUS_36720 CDS 4016116..4017630 product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(4017663..4018145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS complement(4018212..4018685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS complement(4018850..4020025) product putative peptide maturation dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053194.1 transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS 4020259..4020606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS complement(4020646..4023129) product putative peptide modification system cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035495.1 transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS complement(4023155..4024117) product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035494.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS complement(4024526..4025827) product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237144.1 transl_table 11 codon_start 1 locus_tag LOCUS_36800 gene aceA CDS complement(4025896..4027500) product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035492.1 transl_table 11 codon_start 1 locus_tag LOCUS_36810 gene aceB CDS 4027611..4028579 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035491.1 transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS complement(4028620..4029225) product lysophosphatidylcholine acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035483.1 transl_table 11 codon_start 1 locus_tag LOCUS_36830 CDS complement(4029298..4029717) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035482.1 transl_table 11 codon_start 1 locus_tag LOCUS_36840 gene arfB CDS complement(4029791..4030552) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275145.1 transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(4030549..4030893) product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565727.1 transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(4030986..4032662) product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035479.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 gene ubiB CDS complement(4032659..4033309) product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 CDS complement(4033454..4033612) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003468167.1 transl_table 11 codon_start 1 locus_tag LOCUS_36890 CDS complement(4033699..4034697) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 transl_table 11 codon_start 1 locus_tag LOCUS_36900 CDS 4034875..4035975 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403656.1 transl_table 11 codon_start 1 locus_tag LOCUS_36910 CDS complement(4035959..4037512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS complement(4037516..4039168) product olefin beta-lactone synthetase OleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035474.1 transl_table 11 codon_start 1 locus_tag LOCUS_36930 gene oleC CDS 4039284..4039667 product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035473.1 transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS complement(4040102..4041001) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035472.1 transl_table 11 codon_start 1 locus_tag LOCUS_36950 CDS complement(4041198..4042220) product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035468.1 transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(4042349..4042747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS 4042677..4042853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36980 CDS complement(4042968..4045823) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038616.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 CDS 4045997..4046707 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 CDS 4046740..4047219 product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035465.1 transl_table 11 codon_start 1 locus_tag LOCUS_37010 CDS complement(4047847..4048710) product META and DUF4377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040034.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS complement(4048788..4049642) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035441.1 transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS 4049946..4051355 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035442.1 transl_table 11 codon_start 1 locus_tag LOCUS_37040 gene glnA CDS 4051652..4052419 product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930529.1 transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 4052446..4052784 product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 4052917..4054398 product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 transl_table 11 codon_start 1 locus_tag LOCUS_37070 gene amt CDS complement(4054469..4055848) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037940.1 transl_table 11 codon_start 1 locus_tag LOCUS_37080 CDS 4055966..4056205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS 4056458..4057498 product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070823.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS 4057669..4058427 product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204243865.1 transl_table 11 codon_start 1 locus_tag LOCUS_37110 CDS 4058424..4059641 product cardiolipin synthase ClsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035545.1 transl_table 11 codon_start 1 locus_tag LOCUS_37120 gene clsB CDS 4059638..4060624 product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367601.1 transl_table 11 codon_start 1 locus_tag LOCUS_37130 CDS 4060811..4066261 product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085385.1 transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS 4066246..4067973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS 4067970..4068662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37160 CDS complement(4068780..4070156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37170 CDS complement(4070269..4071021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS complement(4071257..4071817) product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS 4072255..4072641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 CDS 4072736..4073203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37210 CDS 4073369..4073644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37220 CDS 4073775..4074293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS 4074325..4074849 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37240 CDS complement(4074904..4075953) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112619.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 CDS 4076088..4076492 product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528594.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(4076506..4078650) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038895.1 transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS 4078832..4079893 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014509462.1 transl_table 11 codon_start 1 locus_tag LOCUS_37280 CDS 4079890..4081323 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035445.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 gene ntrC CDS complement(4081334..4081738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37300 CDS 4081626..4082066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 CDS 4082085..4082576 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 4082831..4083136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 4083161..4083589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37340 CDS 4083586..4084023 product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037424.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 CDS complement(4084043..4084276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088225.1 transl_table 11 codon_start 1 locus_tag LOCUS_37360 CDS complement(4084382..4085647) product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039220.1 transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(4085682..4085918) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS 4086127..4090593 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035290.1 transl_table 11 codon_start 1 locus_tag LOCUS_37390 gene gltB CDS 4090718..4092232 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035289.1 transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(4092689..4092844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 CDS complement(4092941..4093837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070689331.1 transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS 4093994..4095271 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035450.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 CDS 4095504..4096061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275141.1 transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(4096173..4097423) product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035452.1 transl_table 11 codon_start 1 locus_tag LOCUS_37450 CDS complement(4097503..4098480) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035453.1 transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS complement(4098540..4099349) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035454.1 transl_table 11 codon_start 1 locus_tag LOCUS_37470 CDS 4099348..4099857 product YiiD C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437013.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 4099886..4100311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035457.1 transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 4100378..4100815 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437015.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 CDS 4101002..4101514 product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035459.1 transl_table 11 codon_start 1 locus_tag LOCUS_37510 gene secB CDS 4101528..4102556 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035460.1 transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(4102623..4103261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 CDS complement(4103393..4104049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035933.1 transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(4104243..4104824) product Ax21 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035461.1 transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS 4105057..4105878 product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038866.1 transl_table 11 codon_start 1 locus_tag LOCUS_37560 gene queF CDS 4105973..4106284 product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038865.1 transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS 4106328..4106831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(4106944..4107360) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039223.1 transl_table 11 codon_start 1 locus_tag LOCUS_37590 CDS 4107429..4108142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 4108359..4110584 product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038863.1 transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(4110722..4111093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 CDS complement(4111142..4111912) product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 CDS complement(4111905..4113170) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634437.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 CDS complement(4113340..4114398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37650 CDS complement(4114517..4115485) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358011.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 CDS complement(4115702..4116526) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095315.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 CDS complement(4116566..4117456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(4117525..4119132) product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035397.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS complement(4119140..4119403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(4119403..4119690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 CDS complement(4119699..4121840) product TonB-dependent ferrichrome receptor FiuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113264.1 transl_table 11 codon_start 1 locus_tag LOCUS_37720 gene fiuA CDS complement(4122080..4122289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS 4122443..4123414 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038862.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 CDS 4123482..4124333 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275157.1 transl_table 11 codon_start 1 locus_tag LOCUS_37750 CDS 4124504..4125037 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035528.1 transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 4125178..4126602 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS complement(4126599..4127588) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 CDS complement(4127585..4128568) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035526.1 transl_table 11 codon_start 1 locus_tag LOCUS_37790 CDS 4128773..4129882 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS complement(4130340..4130744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37810 CDS 4130878..4131543 product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037901.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 CDS complement(4131790..4132899) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401351.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 CDS complement(4132910..4133806) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226787.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 CDS complement(4133806..4133970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37850 CDS complement(4134059..4134895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS complement(4135006..4135995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(4136129..4138669) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275159.1 transl_table 11 codon_start 1 locus_tag LOCUS_37880 gene hrpB CDS 4138697..4139503 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 transl_table 11 codon_start 1 locus_tag LOCUS_37890 CDS 4139585..4139905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37900 CDS complement(4140125..4141066) product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039051.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 gene panE CDS complement(4141066..4141872) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994124.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 CDS complement(4141869..4142876) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039048.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 CDS 4142993..4143760 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994123.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 CDS complement(4143819..4144232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS 4144266..4145792 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 CDS 4145797..4146543 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039041.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 CDS 4146540..4147751 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275547.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 CDS complement(4148234..4149244) product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039039.1 transl_table 11 codon_start 1 locus_tag LOCUS_37990 CDS complement(4149416..4150654) product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 transl_table 11 codon_start 1 locus_tag LOCUS_38000 gene ubiM CDS complement(4150737..4152122) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039299.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 gene mnmE CDS complement(4152368..4154065) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039301.1 transl_table 11 codon_start 1 locus_tag LOCUS_38020 gene yidC CDS complement(4154080..4154514) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039302.1 transl_table 11 codon_start 1 locus_tag LOCUS_38030 gene rnpA CDS complement(4154573..4154713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040