>Feature sequence1 732 893 gene locus_tag LOCUS_00010 732 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1532 1643 gene locus_tag LOCUS_r00010 1532 1643 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2230 1802 gene locus_tag LOCUS_00020 2230 1802 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921478.1 protein_id gnl|my_center|LOCUS_00020 2655 2338 gene locus_tag LOCUS_00030 2655 2338 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259906.1 protein_id gnl|my_center|LOCUS_00030 2777 4183 gene locus_tag LOCUS_00040 2777 4183 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227543.1 protein_id gnl|my_center|LOCUS_00040 4224 5390 gene locus_tag LOCUS_00050 4224 5390 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100954.1 protein_id gnl|my_center|LOCUS_00050 5776 6234 gene locus_tag LOCUS_00060 gene ctsR 5776 6234 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244565.1 protein_id gnl|my_center|LOCUS_00060 6285 6806 gene locus_tag LOCUS_00070 gene mcsA 6285 6806 CDS product protein-arginine kinase activator protein McsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966297.1 protein_id gnl|my_center|LOCUS_00070 6819 7883 gene locus_tag LOCUS_00080 6819 7883 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235007.1 protein_id gnl|my_center|LOCUS_00080 7923 10391 gene locus_tag LOCUS_00090 gene clpC 7923 10391 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_00090 10545 11237 gene locus_tag LOCUS_00100 10545 11237 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694093.1 protein_id gnl|my_center|LOCUS_00100 11247 12368 gene locus_tag LOCUS_00110 11247 12368 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397690.1 protein_id gnl|my_center|LOCUS_00110 12489 13424 gene locus_tag LOCUS_00120 12489 13424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093836.1 protein_id gnl|my_center|LOCUS_00120 13437 14555 gene locus_tag LOCUS_00130 13437 14555 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020136.1 protein_id gnl|my_center|LOCUS_00130 14558 15703 gene locus_tag LOCUS_00140 14558 15703 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651900.1 protein_id gnl|my_center|LOCUS_00140 15860 17230 gene locus_tag LOCUS_00150 gene radA 15860 17230 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_00150 17245 18339 gene locus_tag LOCUS_00160 gene disA 17245 18339 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392163.1 protein_id gnl|my_center|LOCUS_00160 18485 19225 gene locus_tag LOCUS_00170 gene pssA 18485 19225 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285417.1 protein_id gnl|my_center|LOCUS_00170 20113 19718 gene locus_tag LOCUS_00180 20113 19718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048365.1 protein_id gnl|my_center|LOCUS_00180 20389 21492 gene locus_tag LOCUS_00190 20389 21492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21540 22364 gene locus_tag LOCUS_00200 gene ispD 21540 22364 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_00200 22361 22840 gene locus_tag LOCUS_00210 gene ispF 22361 22840 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488386.1 protein_id gnl|my_center|LOCUS_00210 22866 24359 gene locus_tag LOCUS_00220 gene gltX 22866 24359 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415154.1 protein_id gnl|my_center|LOCUS_00220 25717 24590 gene locus_tag LOCUS_00230 25717 24590 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104859673.1 protein_id gnl|my_center|LOCUS_00230 26651 27466 gene locus_tag LOCUS_00240 gene cysE 26651 27466 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_00240 27473 28876 gene locus_tag LOCUS_00250 gene cysS 27473 28876 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152268.1 protein_id gnl|my_center|LOCUS_00250 28873 29358 gene locus_tag LOCUS_00260 28873 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 29355 30500 gene locus_tag LOCUS_00270 29355 30500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30487 31038 gene locus_tag LOCUS_00280 gene rae1 30487 31038 CDS product ribosome-dependent mRNA decay endonuclease Rae1/YacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235032.1 protein_id gnl|my_center|LOCUS_00280 31271 31921 gene locus_tag LOCUS_00290 gene sigH 31271 31921 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_00290 32309 32458 gene locus_tag LOCUS_00300 gene rpmG 32309 32458 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_00300 32479 32688 gene locus_tag LOCUS_00310 gene secE 32479 32688 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810200.1 protein_id gnl|my_center|LOCUS_00310 32715 33248 gene locus_tag LOCUS_00320 gene nusG 32715 33248 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_00320 33357 33782 gene locus_tag LOCUS_00330 gene rplK 33357 33782 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 protein_id gnl|my_center|LOCUS_00330 33891 34586 gene locus_tag LOCUS_00340 gene rplA 33891 34586 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987630.1 protein_id gnl|my_center|LOCUS_00340 34862 35365 gene locus_tag LOCUS_00350 gene rplJ 34862 35365 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048716.1 protein_id gnl|my_center|LOCUS_00350 35442 35801 gene locus_tag LOCUS_00360 gene rplL 35442 35801 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159736.1 protein_id gnl|my_center|LOCUS_00360 35883 36488 gene locus_tag LOCUS_00370 35883 36488 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 protein_id gnl|my_center|LOCUS_00370 36966 40508 gene locus_tag LOCUS_00380 gene rpoB 36966 40508 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147554.1 protein_id gnl|my_center|LOCUS_00380 40648 44265 gene locus_tag LOCUS_00390 gene rpoC 40648 44265 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567936.1 protein_id gnl|my_center|LOCUS_00390 44473 44829 gene locus_tag LOCUS_00400 44473 44829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45153 46031 gene locus_tag LOCUS_00410 45153 46031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 46034 46738 gene locus_tag LOCUS_00420 46034 46738 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457766.1 protein_id gnl|my_center|LOCUS_00420 46852 47889 gene locus_tag LOCUS_00430 46852 47889 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 protein_id gnl|my_center|LOCUS_00430 47969 48973 gene locus_tag LOCUS_00440 47969 48973 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823047.1 protein_id gnl|my_center|LOCUS_00440 48970 49980 gene locus_tag LOCUS_00450 48970 49980 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613083.1 protein_id gnl|my_center|LOCUS_00450 50124 51242 gene locus_tag LOCUS_00460 50124 51242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51650 51327 gene locus_tag LOCUS_00470 51650 51327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 51649 53073 gene locus_tag LOCUS_00480 51649 53073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53149 55068 gene locus_tag LOCUS_00490 53149 55068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55080 55961 gene locus_tag LOCUS_00500 55080 55961 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908334.1 protein_id gnl|my_center|LOCUS_00500 55974 59270 gene locus_tag LOCUS_00510 55974 59270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 59566 62094 gene locus_tag LOCUS_00520 59566 62094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 62209 67782 gene locus_tag LOCUS_00530 62209 67782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 68085 68339 gene locus_tag LOCUS_00540 68085 68339 CDS product 50S ribosomal protein L7ae-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048355.1 protein_id gnl|my_center|LOCUS_00540 68493 68912 gene locus_tag LOCUS_00550 gene rpsL 68493 68912 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_00550 68971 69441 gene locus_tag LOCUS_00560 gene rpsG 68971 69441 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137493.1 protein_id gnl|my_center|LOCUS_00560 69478 71553 gene locus_tag LOCUS_00570 gene fusA 69478 71553 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235056.1 protein_id gnl|my_center|LOCUS_00570 71648 72838 gene locus_tag LOCUS_00580 gene tuf 71648 72838 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_00580 73103 74767 gene locus_tag LOCUS_00590 gene tlpB 73103 74767 CDS product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243983.1 protein_id gnl|my_center|LOCUS_00590 75122 75430 gene locus_tag LOCUS_00600 gene rpsJ 75122 75430 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_00600 75487 76107 gene locus_tag LOCUS_00610 gene rplC 75487 76107 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_00610 76138 76761 gene locus_tag LOCUS_00620 gene rplD 76138 76761 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_00620 76761 77054 gene locus_tag LOCUS_00630 gene rplW 76761 77054 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205558.1 protein_id gnl|my_center|LOCUS_00630 77084 77911 gene locus_tag LOCUS_00640 gene rplB 77084 77911 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511583.1 protein_id gnl|my_center|LOCUS_00640 77949 78230 gene locus_tag LOCUS_00650 gene rpsS 77949 78230 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156472.1 protein_id gnl|my_center|LOCUS_00650 78283 78621 gene locus_tag LOCUS_00660 gene rplV 78283 78621 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727697.1 protein_id gnl|my_center|LOCUS_00660 78635 79303 gene locus_tag LOCUS_00670 gene rpsC 78635 79303 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235068.1 protein_id gnl|my_center|LOCUS_00670 79306 79743 gene locus_tag LOCUS_00680 gene rplP 79306 79743 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_00680 79730 79930 gene locus_tag LOCUS_00690 gene rpmC 79730 79930 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000855718.1 protein_id gnl|my_center|LOCUS_00690 79974 80237 gene locus_tag LOCUS_00700 gene rpsQ 79974 80237 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225804.1 protein_id gnl|my_center|LOCUS_00700 80274 80642 gene locus_tag LOCUS_00710 gene rplN 80274 80642 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_00710 80685 81038 gene locus_tag LOCUS_00720 gene rplX 80685 81038 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_00720 81074 81616 gene locus_tag LOCUS_00730 gene rplE 81074 81616 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_00730 81672 81857 gene locus_tag LOCUS_00740 gene rpsN 81672 81857 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156488.1 protein_id gnl|my_center|LOCUS_00740 81888 82286 gene locus_tag LOCUS_00750 gene rpsH 81888 82286 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241998.1 protein_id gnl|my_center|LOCUS_00750 82316 82858 gene locus_tag LOCUS_00760 gene rplF 82316 82858 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399690.1 protein_id gnl|my_center|LOCUS_00760 82966 83331 gene locus_tag LOCUS_00770 gene rplR 82966 83331 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_00770 83359 83856 gene locus_tag LOCUS_00780 gene rpsE 83359 83856 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_00780 83869 84048 gene locus_tag LOCUS_00790 gene rpmD 83869 84048 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356220.1 protein_id gnl|my_center|LOCUS_00790 84099 84542 gene locus_tag LOCUS_00800 gene rplO 84099 84542 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766074.1 protein_id gnl|my_center|LOCUS_00800 84542 85840 gene locus_tag LOCUS_00810 gene secY 84542 85840 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_00810 85878 86522 gene locus_tag LOCUS_00820 85878 86522 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399686.1 protein_id gnl|my_center|LOCUS_00820 86529 87281 gene locus_tag LOCUS_00830 gene map 86529 87281 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225828.1 protein_id gnl|my_center|LOCUS_00830 87291 87599 gene locus_tag LOCUS_00840 87291 87599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 87596 87817 gene locus_tag LOCUS_00850 gene infA 87596 87817 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_00850 88038 88406 gene locus_tag LOCUS_00860 gene rpsM 88038 88406 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_00860 88426 88824 gene locus_tag LOCUS_00870 gene rpsK 88426 88824 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_00870 89012 89956 gene locus_tag LOCUS_00880 gene rpoA 89012 89956 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_00880 90001 90366 gene locus_tag LOCUS_00890 gene rplQ 90001 90366 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331490.1 protein_id gnl|my_center|LOCUS_00890 90589 91392 gene locus_tag LOCUS_00900 gene truA 90589 91392 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_00900 91647 92084 gene locus_tag LOCUS_00910 gene rplM 91647 92084 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_00910 92105 92497 gene locus_tag LOCUS_00920 gene rpsI 92105 92497 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_00920 92649 93341 gene locus_tag LOCUS_00930 92649 93341 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244757.1 protein_id gnl|my_center|LOCUS_00930 93372 94550 gene locus_tag LOCUS_00940 gene sat 93372 94550 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245745.1 protein_id gnl|my_center|LOCUS_00940 94621 95427 gene locus_tag LOCUS_00950 94621 95427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 95534 96658 gene locus_tag LOCUS_00960 95534 96658 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829773.1 protein_id gnl|my_center|LOCUS_00960 97409 96711 gene locus_tag LOCUS_00970 97409 96711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 97542 98165 gene locus_tag LOCUS_00980 gene kbaA 97542 98165 CDS product KinB signaling pathway activation protein KbaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088527.1 protein_id gnl|my_center|LOCUS_00980 98962 98177 gene locus_tag LOCUS_00990 gene pdaB 98962 98177 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464710.1 protein_id gnl|my_center|LOCUS_00990 99083 99691 gene locus_tag LOCUS_01000 99083 99691 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188542542.1 protein_id gnl|my_center|LOCUS_01000 99806 100030 gene locus_tag LOCUS_01010 99806 100030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 100373 101923 gene locus_tag LOCUS_r00020 100373 101923 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 102012 102123 gene locus_tag LOCUS_r00030 102012 102123 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 102185 102261 gene locus_tag LOCUS_t00010 102185 102261 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 102288 102363 gene locus_tag LOCUS_t00020 102288 102363 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 102599 105641 gene locus_tag LOCUS_r00040 102599 105641 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 105749 105824 gene locus_tag LOCUS_t00030 105749 105824 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 105832 105906 gene locus_tag LOCUS_t00040 105832 105906 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 105914 105989 gene locus_tag LOCUS_t00050 105914 105989 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 106007 106081 gene locus_tag LOCUS_t00060 106007 106081 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 106117 106199 gene locus_tag LOCUS_t00070 106117 106199 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 106291 107697 gene locus_tag LOCUS_01020 106291 107697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 108495 107821 gene locus_tag LOCUS_01030 108495 107821 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_01030 108713 109558 gene locus_tag LOCUS_01040 108713 109558 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_01040 109548 110459 gene locus_tag LOCUS_01050 109548 110459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 110456 111037 gene locus_tag LOCUS_01060 110456 111037 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582545.1 protein_id gnl|my_center|LOCUS_01060 111215 113347 gene locus_tag LOCUS_01070 111215 113347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 113439 115850 gene locus_tag LOCUS_01080 113439 115850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 116722 115961 gene locus_tag LOCUS_01090 116722 115961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 117065 118018 gene locus_tag LOCUS_01100 gene rihA 117065 118018 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207538.1 protein_id gnl|my_center|LOCUS_01100 118011 119597 gene locus_tag LOCUS_01110 118011 119597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 119683 120144 gene locus_tag LOCUS_01120 119683 120144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 120186 121091 gene locus_tag LOCUS_01130 120186 121091 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260027.1 protein_id gnl|my_center|LOCUS_01130 121111 121938 gene locus_tag LOCUS_01140 121111 121938 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_01140 122841 124607 gene locus_tag LOCUS_01150 122841 124607 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929086.1 protein_id gnl|my_center|LOCUS_01150 124604 126439 gene locus_tag LOCUS_01160 124604 126439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142714.1 protein_id gnl|my_center|LOCUS_01160 126464 127219 gene locus_tag LOCUS_01170 126464 127219 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994060.1 protein_id gnl|my_center|LOCUS_01170 127447 127521 gene locus_tag LOCUS_t00080 127447 127521 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 127528 127604 gene locus_tag LOCUS_t00090 127528 127604 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 127620 127696 gene locus_tag LOCUS_t00100 127620 127696 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 129248 127866 gene locus_tag LOCUS_01180 129248 127866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 129518 130894 gene locus_tag LOCUS_01190 129518 130894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 130992 131861 gene locus_tag LOCUS_01200 130992 131861 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_01200 131903 132730 gene locus_tag LOCUS_01210 131903 132730 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192007.1 protein_id gnl|my_center|LOCUS_01210 132761 133606 gene locus_tag LOCUS_01220 132761 133606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 133599 134342 gene locus_tag LOCUS_01230 133599 134342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 134339 135163 gene locus_tag LOCUS_01240 134339 135163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 135208 138891 gene locus_tag LOCUS_01250 135208 138891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 139023 139934 gene locus_tag LOCUS_01260 139023 139934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 140511 140585 gene locus_tag LOCUS_t00110 140511 140585 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 140592 140668 gene locus_tag LOCUS_t00120 140592 140668 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 140684 140760 gene locus_tag LOCUS_t00130 140684 140760 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 140769 140842 gene locus_tag LOCUS_t00140 140769 140842 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 140899 140973 gene locus_tag LOCUS_t00150 140899 140973 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 142249 141536 gene locus_tag LOCUS_01270 gene gamR 142249 141536 CDS product transcriptional regulator GamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234841.1 protein_id gnl|my_center|LOCUS_01270 142543 142707 gene locus_tag LOCUS_01280 142543 142707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 142701 144065 gene locus_tag LOCUS_01290 142701 144065 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396179.1 protein_id gnl|my_center|LOCUS_01290 144081 145010 gene locus_tag LOCUS_01300 144081 145010 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_01300 145026 145955 gene locus_tag LOCUS_01310 145026 145955 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174518.1 protein_id gnl|my_center|LOCUS_01310 146031 147359 gene locus_tag LOCUS_01320 146031 147359 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089165.1 protein_id gnl|my_center|LOCUS_01320 147356 148171 gene locus_tag LOCUS_01330 gene nagB 147356 148171 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_01330 148357 150111 gene locus_tag LOCUS_01340 148357 150111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 150124 152679 gene locus_tag LOCUS_01350 150124 152679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 153345 153701 gene locus_tag LOCUS_01360 153345 153701 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_01360 154476 153745 gene locus_tag LOCUS_01370 154476 153745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 154787 157579 gene locus_tag LOCUS_01380 gene ppc 154787 157579 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259010.1 protein_id gnl|my_center|LOCUS_01380 157927 158493 gene locus_tag LOCUS_01390 gene sigW 157927 158493 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_01390 158608 159216 gene locus_tag LOCUS_01400 158608 159216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 159399 160244 gene locus_tag LOCUS_01410 gene cdaA 159399 160244 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_01410 160237 161694 gene locus_tag LOCUS_01420 160237 161694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 161753 163093 gene locus_tag LOCUS_01430 gene glmM 161753 163093 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_01430 163717 165549 gene locus_tag LOCUS_01440 gene glmS 163717 165549 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808420.1 protein_id gnl|my_center|LOCUS_01440 165750 165977 gene locus_tag LOCUS_01450 165750 165977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 166433 166579 gene locus_tag LOCUS_01460 166433 166579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 166623 166970 gene locus_tag LOCUS_01470 166623 166970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 167635 167384 gene locus_tag LOCUS_01480 167635 167384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 168522 168046 gene locus_tag LOCUS_01490 168522 168046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 168908 169111 gene locus_tag LOCUS_01500 168908 169111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 169750 169463 gene locus_tag LOCUS_01510 169750 169463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 170462 170746 gene locus_tag LOCUS_01520 170462 170746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 171236 172297 gene locus_tag LOCUS_01530 171236 172297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 172290 173969 gene locus_tag LOCUS_01540 172290 173969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 173966 174427 gene locus_tag LOCUS_01550 173966 174427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 175899 175729 gene locus_tag LOCUS_01560 175899 175729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 176386 176583 gene locus_tag LOCUS_01570 176386 176583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 176886 177923 gene locus_tag LOCUS_01580 176886 177923 CDS product Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987126.1 protein_id gnl|my_center|LOCUS_01580 178080 179558 gene locus_tag LOCUS_01590 178080 179558 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061775.1 protein_id gnl|my_center|LOCUS_01590 179608 179868 gene locus_tag LOCUS_01600 179608 179868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 179885 182254 gene locus_tag LOCUS_01610 179885 182254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 182396 186190 gene locus_tag LOCUS_01620 182396 186190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 186404 187363 gene locus_tag LOCUS_01630 186404 187363 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_01630 187380 188279 gene locus_tag LOCUS_01640 187380 188279 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_01640 188319 189833 gene locus_tag LOCUS_01650 188319 189833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_01650 192227 189903 gene locus_tag LOCUS_01660 192227 189903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 192522 193493 gene locus_tag LOCUS_01670 192522 193493 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_01670 193522 194397 gene locus_tag LOCUS_01680 193522 194397 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_01680 194580 194437 gene locus_tag LOCUS_01690 194580 194437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 194570 195976 gene locus_tag LOCUS_01700 194570 195976 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_01700 196035 197081 gene locus_tag LOCUS_01710 196035 197081 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974658.1 protein_id gnl|my_center|LOCUS_01710 197142 198026 gene locus_tag LOCUS_01720 197142 198026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 198023 198844 gene locus_tag LOCUS_01730 198023 198844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 198841 199893 gene locus_tag LOCUS_01740 198841 199893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 200129 200617 gene locus_tag LOCUS_01750 200129 200617 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391513.1 protein_id gnl|my_center|LOCUS_01750 202896 200818 gene locus_tag LOCUS_01760 202896 200818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 203047 204306 gene locus_tag LOCUS_01770 203047 204306 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087075.1 protein_id gnl|my_center|LOCUS_01770 204299 205738 gene locus_tag LOCUS_01780 gene abgB 204299 205738 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156451.1 protein_id gnl|my_center|LOCUS_01780 205780 206463 gene locus_tag LOCUS_01790 gene sdaAB 205780 206463 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 protein_id gnl|my_center|LOCUS_01790 206485 207360 gene locus_tag LOCUS_01800 gene sdaAA 206485 207360 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232049.1 protein_id gnl|my_center|LOCUS_01800 207726 209540 gene locus_tag LOCUS_01810 207726 209540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 209726 212119 gene locus_tag LOCUS_01820 209726 212119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 212519 212244 gene locus_tag LOCUS_01830 212519 212244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 212884 212531 gene locus_tag LOCUS_01840 212884 212531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 213710 212907 gene locus_tag LOCUS_01850 213710 212907 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207439.1 protein_id gnl|my_center|LOCUS_01850 214707 213784 gene locus_tag LOCUS_01860 214707 213784 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_01860 214931 216415 gene locus_tag LOCUS_01870 214931 216415 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582926.1 protein_id gnl|my_center|LOCUS_01870 216646 220959 gene locus_tag LOCUS_01880 216646 220959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 221753 221022 gene locus_tag LOCUS_01890 221753 221022 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970620.1 protein_id gnl|my_center|LOCUS_01890 221902 222264 gene locus_tag LOCUS_01900 221902 222264 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391916.1 protein_id gnl|my_center|LOCUS_01900 222343 223356 gene locus_tag LOCUS_01910 222343 223356 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014369585.1 protein_id gnl|my_center|LOCUS_01910 223437 224381 gene locus_tag LOCUS_01920 223437 224381 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_01920 224396 225280 gene locus_tag LOCUS_01930 224396 225280 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_01930 225388 227049 gene locus_tag LOCUS_01940 225388 227049 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_01940 227149 229428 gene locus_tag LOCUS_01950 227149 229428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 229446 231920 gene locus_tag LOCUS_01960 229446 231920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 232053 238268 gene locus_tag LOCUS_01970 232053 238268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 239162 238332 gene locus_tag LOCUS_01980 239162 238332 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948696.1 protein_id gnl|my_center|LOCUS_01980 239278 240930 gene locus_tag LOCUS_01990 239278 240930 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203728.1 protein_id gnl|my_center|LOCUS_01990 240967 243177 gene locus_tag LOCUS_02000 240967 243177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 243246 244670 gene locus_tag LOCUS_02010 243246 244670 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_02010 244896 245132 gene locus_tag LOCUS_02020 244896 245132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 245211 246278 gene locus_tag LOCUS_02030 245211 246278 CDS product FxsB family radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229894.1 protein_id gnl|my_center|LOCUS_02030 246495 246824 gene locus_tag LOCUS_02040 246495 246824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 247729 246896 gene locus_tag LOCUS_02050 247729 246896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 248727 247834 gene locus_tag LOCUS_02060 248727 247834 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973947.1 protein_id gnl|my_center|LOCUS_02060 250493 248838 gene locus_tag LOCUS_02070 gene pucR 250493 248838 CDS product purine catabolism transcriptional regulator PucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244351.1 protein_id gnl|my_center|LOCUS_02070 250691 251893 gene locus_tag LOCUS_02080 250691 251893 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181867.1 protein_id gnl|my_center|LOCUS_02080 251907 252854 gene locus_tag LOCUS_02090 251907 252854 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_02090 252869 253750 gene locus_tag LOCUS_02100 252869 253750 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988998.1 protein_id gnl|my_center|LOCUS_02100 253822 255315 gene locus_tag LOCUS_02110 253822 255315 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_02110 255349 256329 gene locus_tag LOCUS_02120 255349 256329 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_02120 256326 257291 gene locus_tag LOCUS_02130 256326 257291 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085528.1 protein_id gnl|my_center|LOCUS_02130 257566 258336 gene locus_tag LOCUS_02140 257566 258336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 258375 258611 gene locus_tag LOCUS_02150 258375 258611 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356543.1 protein_id gnl|my_center|LOCUS_02150 258642 258920 gene locus_tag LOCUS_02160 258642 258920 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405647.1 protein_id gnl|my_center|LOCUS_02160 259308 262391 gene locus_tag LOCUS_02170 259308 262391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942800.1 protein_id gnl|my_center|LOCUS_02170 262415 263500 gene locus_tag LOCUS_02180 262415 263500 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810004.1 protein_id gnl|my_center|LOCUS_02180 263628 266657 gene locus_tag LOCUS_02190 263628 266657 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_02190 266650 267768 gene locus_tag LOCUS_02200 266650 267768 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 protein_id gnl|my_center|LOCUS_02200 267871 271845 gene locus_tag LOCUS_02210 267871 271845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 271908 272222 gene locus_tag LOCUS_02220 271908 272222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 272197 272379 gene locus_tag LOCUS_02230 272197 272379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 272372 272791 gene locus_tag LOCUS_02240 272372 272791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 273292 274425 gene locus_tag LOCUS_02250 273292 274425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 274450 275598 gene locus_tag LOCUS_02260 274450 275598 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392037.1 protein_id gnl|my_center|LOCUS_02260 276063 275611 gene locus_tag LOCUS_02270 276063 275611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 276227 278899 gene locus_tag LOCUS_02280 276227 278899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 279157 287562 gene locus_tag LOCUS_02290 279157 287562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 289143 287662 gene locus_tag LOCUS_02300 289143 287662 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975618.1 protein_id gnl|my_center|LOCUS_02300 289303 289890 gene locus_tag LOCUS_02310 289303 289890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 290878 289943 gene locus_tag LOCUS_02320 290878 289943 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013485.1 protein_id gnl|my_center|LOCUS_02320 292613 291414 gene locus_tag LOCUS_02330 292613 291414 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 protein_id gnl|my_center|LOCUS_02330 293476 292646 gene locus_tag LOCUS_02340 293476 292646 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_02340 294351 293476 gene locus_tag LOCUS_02350 294351 293476 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257563.1 protein_id gnl|my_center|LOCUS_02350 295799 294441 gene locus_tag LOCUS_02360 295799 294441 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531926.1 protein_id gnl|my_center|LOCUS_02360 296653 295970 gene locus_tag LOCUS_02370 296653 295970 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965838.1 protein_id gnl|my_center|LOCUS_02370 297262 297582 gene locus_tag LOCUS_02380 297262 297582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 297776 297561 gene locus_tag LOCUS_02390 297776 297561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 297726 298514 gene locus_tag LOCUS_02400 297726 298514 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_02400 298913 300730 gene locus_tag LOCUS_02410 298913 300730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 300772 302352 gene locus_tag LOCUS_02420 300772 302352 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_02420 302441 302695 gene locus_tag LOCUS_02430 302441 302695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 302729 303634 gene locus_tag LOCUS_02440 gene rmgP 302729 303634 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_02440 303637 304506 gene locus_tag LOCUS_02450 303637 304506 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_02450 304580 306163 gene locus_tag LOCUS_02460 304580 306163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 306260 309025 gene locus_tag LOCUS_02470 306260 309025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 309902 309048 gene locus_tag LOCUS_02480 309902 309048 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548912.1 protein_id gnl|my_center|LOCUS_02480 310082 312142 gene locus_tag LOCUS_02490 310082 312142 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031640.1 protein_id gnl|my_center|LOCUS_02490 313044 312625 gene locus_tag LOCUS_02500 313044 312625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 314144 313305 gene locus_tag LOCUS_02510 314144 313305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 314258 315256 gene locus_tag LOCUS_02520 314258 315256 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_02520 315302 316258 gene locus_tag LOCUS_02530 315302 316258 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_02530 318103 316859 gene locus_tag LOCUS_02540 318103 316859 CDS product IS4-like element ISDha3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458871.1 protein_id gnl|my_center|LOCUS_02540 319507 318674 gene locus_tag LOCUS_02550 319507 318674 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_02550 319688 321076 gene locus_tag LOCUS_02560 319688 321076 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_02560 321693 321148 gene locus_tag LOCUS_02570 321693 321148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 323550 321913 gene locus_tag LOCUS_02580 323550 321913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_02580 325149 323614 gene locus_tag LOCUS_02590 325149 323614 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_02590 325395 326753 gene locus_tag LOCUS_02600 325395 326753 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_02600 326830 327699 gene locus_tag LOCUS_02610 326830 327699 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_02610 327712 328548 gene locus_tag LOCUS_02620 327712 328548 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_02620 328705 335214 gene locus_tag LOCUS_02630 328705 335214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 335216 336733 gene locus_tag LOCUS_02640 335216 336733 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_02640 336730 338451 gene locus_tag LOCUS_02650 336730 338451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 339218 341683 gene locus_tag LOCUS_02660 339218 341683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 341970 343427 gene locus_tag LOCUS_02670 341970 343427 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_02670 344102 343596 gene locus_tag LOCUS_02680 344102 343596 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023672.1 protein_id gnl|my_center|LOCUS_02680 344334 344729 gene locus_tag LOCUS_02690 344334 344729 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031500121.1 protein_id gnl|my_center|LOCUS_02690 344846 345781 gene locus_tag LOCUS_02700 344846 345781 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849327.1 protein_id gnl|my_center|LOCUS_02700 345812 346300 gene locus_tag LOCUS_02710 345812 346300 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285028.1 protein_id gnl|my_center|LOCUS_02710 346588 348960 gene locus_tag LOCUS_02720 346588 348960 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584086.1 protein_id gnl|my_center|LOCUS_02720 349986 349117 gene locus_tag LOCUS_02730 349986 349117 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_02730 350109 351164 gene locus_tag LOCUS_02740 gene aroC 350109 351164 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258378.1 protein_id gnl|my_center|LOCUS_02740 352723 351434 gene locus_tag LOCUS_02750 352723 351434 CDS product glycoside hydrolase family 27 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776921.1 protein_id gnl|my_center|LOCUS_02750 353726 352839 gene locus_tag LOCUS_02760 353726 352839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 354623 353757 gene locus_tag LOCUS_02770 354623 353757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 354748 356283 gene locus_tag LOCUS_02780 354748 356283 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112254.1 protein_id gnl|my_center|LOCUS_02780 356760 356927 gene locus_tag LOCUS_02790 356760 356927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 356933 357433 gene locus_tag LOCUS_02800 356933 357433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 357524 359659 gene locus_tag LOCUS_02810 357524 359659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 359735 360391 gene locus_tag LOCUS_02820 359735 360391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 360544 361536 gene locus_tag LOCUS_02830 360544 361536 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733112.1 protein_id gnl|my_center|LOCUS_02830 361675 362115 gene locus_tag LOCUS_02840 361675 362115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 362257 363027 gene locus_tag LOCUS_02850 362257 363027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 364483 363365 gene locus_tag LOCUS_02860 364483 363365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 364667 365350 gene locus_tag LOCUS_02870 364667 365350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 365613 365410 gene locus_tag LOCUS_02880 365613 365410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 365685 365888 gene locus_tag LOCUS_02890 365685 365888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 366153 367601 gene locus_tag LOCUS_02900 366153 367601 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_02900 368961 367654 gene locus_tag LOCUS_02910 368961 367654 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029495.1 protein_id gnl|my_center|LOCUS_02910 369120 369548 gene locus_tag LOCUS_02920 369120 369548 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965781.1 protein_id gnl|my_center|LOCUS_02920 370280 369618 gene locus_tag LOCUS_02930 370280 369618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 370765 370265 gene locus_tag LOCUS_02940 370765 370265 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_02940 370966 371454 gene locus_tag LOCUS_02950 370966 371454 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254296.1 protein_id gnl|my_center|LOCUS_02950 371466 372032 gene locus_tag LOCUS_02960 371466 372032 CDS product rRNA adenine N-6-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_02960 372059 372745 gene locus_tag LOCUS_02970 372059 372745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929888.1 protein_id gnl|my_center|LOCUS_02970 372855 373844 gene locus_tag LOCUS_02980 372855 373844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 373940 374263 gene locus_tag LOCUS_02990 373940 374263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 374459 375025 gene locus_tag LOCUS_03000 374459 375025 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658049.1 protein_id gnl|my_center|LOCUS_03000 375957 375709 gene locus_tag LOCUS_03010 375957 375709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 376259 376786 gene locus_tag LOCUS_03020 376259 376786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 376902 377540 gene locus_tag LOCUS_03030 376902 377540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 377533 378291 gene locus_tag LOCUS_03040 377533 378291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 378469 379023 gene locus_tag LOCUS_03050 378469 379023 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243497.1 protein_id gnl|my_center|LOCUS_03050 380801 379197 gene locus_tag LOCUS_03060 380801 379197 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_03060 382591 380801 gene locus_tag LOCUS_03070 382591 380801 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_03070 382837 384186 gene locus_tag LOCUS_03080 382837 384186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 384207 385136 gene locus_tag LOCUS_03090 384207 385136 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226352.1 protein_id gnl|my_center|LOCUS_03090 385137 385946 gene locus_tag LOCUS_03100 385137 385946 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_03100 385974 387272 gene locus_tag LOCUS_03110 385974 387272 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_03110 387269 389584 gene locus_tag LOCUS_03120 387269 389584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 389625 394784 gene locus_tag LOCUS_03130 389625 394784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 394980 396200 gene locus_tag LOCUS_03140 394980 396200 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_03140 396759 397619 gene locus_tag LOCUS_03150 396759 397619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 397754 398743 gene locus_tag LOCUS_03160 397754 398743 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976087.1 protein_id gnl|my_center|LOCUS_03160 398791 400176 gene locus_tag LOCUS_03170 398791 400176 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242500.1 protein_id gnl|my_center|LOCUS_03170 400195 400974 gene locus_tag LOCUS_03180 400195 400974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243784.1 protein_id gnl|my_center|LOCUS_03180 401050 402102 gene locus_tag LOCUS_03190 401050 402102 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276931.1 protein_id gnl|my_center|LOCUS_03190 402122 402895 gene locus_tag LOCUS_03200 402122 402895 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_03200 403071 403925 gene locus_tag LOCUS_03210 403071 403925 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 protein_id gnl|my_center|LOCUS_03210 404370 405857 gene locus_tag LOCUS_03220 404370 405857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 405964 407322 gene locus_tag LOCUS_03230 405964 407322 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_03230 407264 407794 gene locus_tag LOCUS_03240 407264 407794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 408230 408526 gene locus_tag LOCUS_03250 408230 408526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 410569 408653 gene locus_tag LOCUS_03260 410569 408653 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836488.1 protein_id gnl|my_center|LOCUS_03260 410788 411291 gene locus_tag LOCUS_03270 410788 411291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 412282 411428 gene locus_tag LOCUS_03280 412282 411428 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_03280 413031 412384 gene locus_tag LOCUS_03290 413031 412384 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_03290 413727 413062 gene locus_tag LOCUS_03300 413727 413062 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185713.1 protein_id gnl|my_center|LOCUS_03300 413914 414999 gene locus_tag LOCUS_03310 413914 414999 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244365.1 protein_id gnl|my_center|LOCUS_03310 415129 415611 gene locus_tag LOCUS_03320 415129 415611 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966557.1 protein_id gnl|my_center|LOCUS_03320 415637 416398 gene locus_tag LOCUS_03330 415637 416398 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878068.1 protein_id gnl|my_center|LOCUS_03330 416883 416590 gene locus_tag LOCUS_03340 416883 416590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 417750 417001 gene locus_tag LOCUS_03350 417750 417001 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245309.1 protein_id gnl|my_center|LOCUS_03350 417957 418553 gene locus_tag LOCUS_03360 417957 418553 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073335.1 protein_id gnl|my_center|LOCUS_03360 418736 420211 gene locus_tag LOCUS_03370 418736 420211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469364.1 protein_id gnl|my_center|LOCUS_03370 420519 420157 gene locus_tag LOCUS_03380 420519 420157 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_03380 420679 421314 gene locus_tag LOCUS_03390 420679 421314 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535752.1 protein_id gnl|my_center|LOCUS_03390 421386 422117 gene locus_tag LOCUS_03400 421386 422117 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623605.1 protein_id gnl|my_center|LOCUS_03400 422139 422924 gene locus_tag LOCUS_03410 422139 422924 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067343.1 protein_id gnl|my_center|LOCUS_03410 422950 424578 gene locus_tag LOCUS_03420 422950 424578 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_03420 425289 424651 gene locus_tag LOCUS_03430 425289 424651 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226319270.1 protein_id gnl|my_center|LOCUS_03430 425409 425768 gene locus_tag LOCUS_03440 gene merR 425409 425768 CDS product Hg(II)-responsive transcriptional regulator MerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425271.1 protein_id gnl|my_center|LOCUS_03440 425828 426166 gene locus_tag LOCUS_03450 425828 426166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 426370 426936 gene locus_tag LOCUS_03460 426370 426936 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_03460 427065 427310 gene locus_tag LOCUS_03470 427065 427310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 427384 427773 gene locus_tag LOCUS_03480 427384 427773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 427806 428168 gene locus_tag LOCUS_03490 427806 428168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 428211 428588 gene locus_tag LOCUS_03500 428211 428588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 428613 428987 gene locus_tag LOCUS_03510 428613 428987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 429049 429525 gene locus_tag LOCUS_03520 429049 429525 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151333.1 protein_id gnl|my_center|LOCUS_03520 429633 430451 gene locus_tag LOCUS_03530 429633 430451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 430923 431432 gene locus_tag LOCUS_03540 430923 431432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231066.1 protein_id gnl|my_center|LOCUS_03540 431560 432000 gene locus_tag LOCUS_03550 431560 432000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 432036 432569 gene locus_tag LOCUS_03560 432036 432569 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_03560 432607 433224 gene locus_tag LOCUS_03570 432607 433224 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528144.1 protein_id gnl|my_center|LOCUS_03570 433298 433771 gene locus_tag LOCUS_03580 433298 433771 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459634.1 protein_id gnl|my_center|LOCUS_03580 433925 435166 gene locus_tag LOCUS_03590 433925 435166 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816831.1 protein_id gnl|my_center|LOCUS_03590 435403 435762 gene locus_tag LOCUS_03600 435403 435762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 435818 436000 gene locus_tag LOCUS_03610 435818 436000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 436030 436260 gene locus_tag LOCUS_03620 436030 436260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 436377 436751 gene locus_tag LOCUS_03630 436377 436751 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_03630 436757 437188 gene locus_tag LOCUS_03640 436757 437188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 438057 437221 gene locus_tag LOCUS_03650 438057 437221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 439460 438087 gene locus_tag LOCUS_03660 439460 438087 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986544.1 protein_id gnl|my_center|LOCUS_03660 439581 440447 gene locus_tag LOCUS_03670 439581 440447 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234225.1 protein_id gnl|my_center|LOCUS_03670 440492 441151 gene locus_tag LOCUS_03680 440492 441151 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263126.1 protein_id gnl|my_center|LOCUS_03680 441489 441298 gene locus_tag LOCUS_03690 441489 441298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 441594 442511 gene locus_tag LOCUS_03700 441594 442511 CDS product streptomycin 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729101.1 protein_id gnl|my_center|LOCUS_03700 443398 442547 gene locus_tag LOCUS_03710 gene aiiB 443398 442547 CDS product N-acyl homoserine lactonase AiiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974862.1 protein_id gnl|my_center|LOCUS_03710 443542 443955 gene locus_tag LOCUS_03720 443542 443955 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226716.1 protein_id gnl|my_center|LOCUS_03720 444152 444826 gene locus_tag LOCUS_03730 444152 444826 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_03730 444845 445636 gene locus_tag LOCUS_03740 444845 445636 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970645.1 protein_id gnl|my_center|LOCUS_03740 445661 446884 gene locus_tag LOCUS_03750 445661 446884 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970647.1 protein_id gnl|my_center|LOCUS_03750 446943 447809 gene locus_tag LOCUS_03760 446943 447809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 450771 447898 gene locus_tag LOCUS_03770 450771 447898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 450979 451806 gene locus_tag LOCUS_03780 450979 451806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 451867 453618 gene locus_tag LOCUS_03790 451867 453618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 453628 455055 gene locus_tag LOCUS_03800 453628 455055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 455147 456832 gene locus_tag LOCUS_03810 455147 456832 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_03810 456847 457737 gene locus_tag LOCUS_03820 456847 457737 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_03820 457754 458641 gene locus_tag LOCUS_03830 457754 458641 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_03830 458685 460844 gene locus_tag LOCUS_03840 458685 460844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 460896 463031 gene locus_tag LOCUS_03850 460896 463031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 463888 463307 gene locus_tag LOCUS_03860 463888 463307 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973650.1 protein_id gnl|my_center|LOCUS_03860 464088 465485 gene locus_tag LOCUS_03870 gene lpdA 464088 465485 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_03870 465589 465957 gene locus_tag LOCUS_03880 465589 465957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 465941 467113 gene locus_tag LOCUS_03890 465941 467113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 467685 467110 gene locus_tag LOCUS_03900 467685 467110 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049681146.1 protein_id gnl|my_center|LOCUS_03900 468562 467690 gene locus_tag LOCUS_03910 468562 467690 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812933.1 protein_id gnl|my_center|LOCUS_03910 469103 468567 gene locus_tag LOCUS_03920 469103 468567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 469322 469741 gene locus_tag LOCUS_03930 469322 469741 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172523.1 protein_id gnl|my_center|LOCUS_03930 470654 469761 gene locus_tag LOCUS_03940 470654 469761 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_03940 471268 470657 gene locus_tag LOCUS_03950 471268 470657 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083415.1 protein_id gnl|my_center|LOCUS_03950 472213 471323 gene locus_tag LOCUS_03960 472213 471323 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 protein_id gnl|my_center|LOCUS_03960 472714 472346 gene locus_tag LOCUS_03970 472714 472346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 472879 472724 gene locus_tag LOCUS_03980 472879 472724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 473169 473495 gene locus_tag LOCUS_03990 473169 473495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 473705 474286 gene locus_tag LOCUS_04000 473705 474286 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328266.1 protein_id gnl|my_center|LOCUS_04000 474318 475499 gene locus_tag LOCUS_04010 474318 475499 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114757.1 protein_id gnl|my_center|LOCUS_04010 476254 475850 gene locus_tag LOCUS_04020 476254 475850 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974464.1 protein_id gnl|my_center|LOCUS_04020 479625 476395 gene locus_tag LOCUS_04030 479625 476395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 480511 479822 gene locus_tag LOCUS_04040 480511 479822 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_04040 480729 484193 gene locus_tag LOCUS_04050 480729 484193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 484215 492479 gene locus_tag LOCUS_04060 484215 492479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 494258 493320 gene locus_tag LOCUS_04070 494258 493320 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_04070 494768 494301 gene locus_tag LOCUS_04080 494768 494301 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645037.1 protein_id gnl|my_center|LOCUS_04080 494941 495279 gene locus_tag LOCUS_04090 494941 495279 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511515.1 protein_id gnl|my_center|LOCUS_04090 495732 497075 gene locus_tag LOCUS_04100 495732 497075 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106497.1 protein_id gnl|my_center|LOCUS_04100 497414 498118 gene locus_tag LOCUS_04110 497414 498118 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206332.1 protein_id gnl|my_center|LOCUS_04110 498143 498793 gene locus_tag LOCUS_04120 498143 498793 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096803.1 protein_id gnl|my_center|LOCUS_04120 498842 502483 gene locus_tag LOCUS_04130 gene uca 498842 502483 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138224727.1 protein_id gnl|my_center|LOCUS_04130 502480 504444 gene locus_tag LOCUS_04140 gene atzF 502480 504444 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_04140 505386 506591 gene locus_tag LOCUS_04150 505386 506591 CDS product Bcr/CflA family efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234132.1 protein_id gnl|my_center|LOCUS_04150 506650 506955 gene locus_tag LOCUS_04160 506650 506955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 507087 510065 gene locus_tag LOCUS_04170 507087 510065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 510250 510717 gene locus_tag LOCUS_04180 510250 510717 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948763.1 protein_id gnl|my_center|LOCUS_04180 510714 511082 gene locus_tag LOCUS_04190 510714 511082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 512005 511070 gene locus_tag LOCUS_04200 512005 511070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 512169 512588 gene locus_tag LOCUS_04210 512169 512588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 512576 512968 gene locus_tag LOCUS_04220 512576 512968 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926507.1 protein_id gnl|my_center|LOCUS_04220 513038 513394 gene locus_tag LOCUS_04230 513038 513394 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609854.1 protein_id gnl|my_center|LOCUS_04230 514233 514739 gene locus_tag LOCUS_04240 514233 514739 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285028.1 protein_id gnl|my_center|LOCUS_04240 514979 517231 gene locus_tag LOCUS_04250 514979 517231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 517720 519363 gene locus_tag LOCUS_04260 517720 519363 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_04260 519457 520359 gene locus_tag LOCUS_04270 519457 520359 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_04270 520387 521259 gene locus_tag LOCUS_04280 520387 521259 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_04280 521256 522275 gene locus_tag LOCUS_04290 521256 522275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 522272 524026 gene locus_tag LOCUS_04300 522272 524026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 524145 526463 gene locus_tag LOCUS_04310 524145 526463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 526535 528397 gene locus_tag LOCUS_04320 gene iolD 526535 528397 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268320.1 protein_id gnl|my_center|LOCUS_04320 528437 529366 gene locus_tag LOCUS_04330 gene iolE 528437 529366 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356924.1 protein_id gnl|my_center|LOCUS_04330 529372 530385 gene locus_tag LOCUS_04340 gene iolC 529372 530385 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 protein_id gnl|my_center|LOCUS_04340 530432 531898 gene locus_tag LOCUS_04350 530432 531898 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_04350 532031 533092 gene locus_tag LOCUS_04360 gene iolG 532031 533092 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_04360 533115 533924 gene locus_tag LOCUS_04370 gene iolB 533115 533924 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528375.1 protein_id gnl|my_center|LOCUS_04370 534427 534239 gene locus_tag LOCUS_04380 534427 534239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 534629 535105 gene locus_tag LOCUS_04390 534629 535105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 535102 536091 gene locus_tag LOCUS_04400 535102 536091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04400 536105 536857 gene locus_tag LOCUS_04410 536105 536857 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180933263.1 protein_id gnl|my_center|LOCUS_04410 536847 537851 gene locus_tag LOCUS_04420 536847 537851 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_04420 537871 538695 gene locus_tag LOCUS_04430 537871 538695 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 protein_id gnl|my_center|LOCUS_04430 538718 539767 gene locus_tag LOCUS_04440 538718 539767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529688.1 protein_id gnl|my_center|LOCUS_04440 539793 541004 gene locus_tag LOCUS_04450 539793 541004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 541001 541840 gene locus_tag LOCUS_04460 541001 541840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211226.1 protein_id gnl|my_center|LOCUS_04460 543615 541861 gene locus_tag LOCUS_04470 543615 541861 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_04470 545195 543612 gene locus_tag LOCUS_04480 545195 543612 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387242.1 protein_id gnl|my_center|LOCUS_04480 545438 546397 gene locus_tag LOCUS_04490 gene rmgP 545438 546397 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_04490 546424 547308 gene locus_tag LOCUS_04500 546424 547308 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_04500 547357 548973 gene locus_tag LOCUS_04510 547357 548973 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_04510 548984 550291 gene locus_tag LOCUS_04520 548984 550291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 550306 552552 gene locus_tag LOCUS_04530 550306 552552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 554631 553174 gene locus_tag LOCUS_04540 554631 553174 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_04540 555751 554777 gene locus_tag LOCUS_04550 gene cmrA 555751 554777 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_04550 555929 556666 gene locus_tag LOCUS_04560 555929 556666 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816333.1 protein_id gnl|my_center|LOCUS_04560 556757 558883 gene locus_tag LOCUS_04570 556757 558883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 559545 558859 gene locus_tag LOCUS_04580 559545 558859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964764.1 protein_id gnl|my_center|LOCUS_04580 559750 562758 gene locus_tag LOCUS_04590 559750 562758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 562765 565371 gene locus_tag LOCUS_04600 562765 565371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 566410 565517 gene locus_tag LOCUS_04610 566410 565517 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421915.1 protein_id gnl|my_center|LOCUS_04610 566525 567913 gene locus_tag LOCUS_04620 566525 567913 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243939.1 protein_id gnl|my_center|LOCUS_04620 569873 568629 gene locus_tag LOCUS_04630 569873 568629 CDS product IS4-like element ISDha3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458871.1 protein_id gnl|my_center|LOCUS_04630 570285 570482 gene locus_tag LOCUS_04640 570285 570482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 570945 571187 gene locus_tag LOCUS_04650 570945 571187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 572452 571289 gene locus_tag LOCUS_04660 572452 571289 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983707.1 protein_id gnl|my_center|LOCUS_04660 572622 575360 gene locus_tag LOCUS_04670 572622 575360 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285985.1 protein_id gnl|my_center|LOCUS_04670 575653 576600 gene locus_tag LOCUS_04680 575653 576600 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_04680 576612 577499 gene locus_tag LOCUS_04690 576612 577499 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027800.1 protein_id gnl|my_center|LOCUS_04690 577554 579158 gene locus_tag LOCUS_04700 577554 579158 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_04700 579259 582609 gene locus_tag LOCUS_04710 579259 582609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 582714 585983 gene locus_tag LOCUS_04720 582714 585983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 586070 588733 gene locus_tag LOCUS_04730 586070 588733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 588730 589926 gene locus_tag LOCUS_04740 588730 589926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_04740 589963 590910 gene locus_tag LOCUS_04750 589963 590910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 592800 591289 gene locus_tag LOCUS_04760 gene abfA 592800 591289 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_04760 592944 593846 gene locus_tag LOCUS_04770 592944 593846 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_04770 594359 595744 gene locus_tag LOCUS_04780 594359 595744 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525207.1 protein_id gnl|my_center|LOCUS_04780 595814 596695 gene locus_tag LOCUS_04790 595814 596695 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_04790 596692 597528 gene locus_tag LOCUS_04800 596692 597528 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398630.1 protein_id gnl|my_center|LOCUS_04800 597659 598996 gene locus_tag LOCUS_04810 597659 598996 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256270.1 protein_id gnl|my_center|LOCUS_04810 599268 604727 gene locus_tag LOCUS_04820 599268 604727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 605558 605737 gene locus_tag LOCUS_04830 605558 605737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 605865 607637 gene locus_tag LOCUS_04840 605865 607637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 607640 609118 gene locus_tag LOCUS_04850 607640 609118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 609115 610467 gene locus_tag LOCUS_04860 609115 610467 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256270.1 protein_id gnl|my_center|LOCUS_04860 610697 612274 gene locus_tag LOCUS_04870 610697 612274 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102178.1 protein_id gnl|my_center|LOCUS_04870 613011 612826 gene locus_tag LOCUS_04880 613011 612826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 613382 614134 gene locus_tag LOCUS_04890 613382 614134 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_04890 614201 615037 gene locus_tag LOCUS_04900 614201 615037 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122269.1 protein_id gnl|my_center|LOCUS_04900 615298 615702 gene locus_tag LOCUS_04910 615298 615702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04910 615727 617052 gene locus_tag LOCUS_04920 615727 617052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 617055 617660 gene locus_tag LOCUS_04930 617055 617660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 617965 618387 gene locus_tag LOCUS_04940 617965 618387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 618566 618964 gene locus_tag LOCUS_04950 618566 618964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 619473 619195 gene locus_tag LOCUS_04960 619473 619195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 619436 619624 gene locus_tag LOCUS_04970 619436 619624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 619742 619921 gene locus_tag LOCUS_04980 619742 619921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 620507 620148 gene locus_tag LOCUS_04990 620507 620148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 620730 621905 gene locus_tag LOCUS_05000 620730 621905 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_05000 621921 622907 gene locus_tag LOCUS_05010 621921 622907 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035552.1 protein_id gnl|my_center|LOCUS_05010 623070 623786 gene locus_tag LOCUS_05020 623070 623786 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_05020 623808 624659 gene locus_tag LOCUS_05030 623808 624659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 624985 624647 gene locus_tag LOCUS_05040 624985 624647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 624984 626321 gene locus_tag LOCUS_05050 624984 626321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 626350 627273 gene locus_tag LOCUS_05060 626350 627273 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_05060 627270 628094 gene locus_tag LOCUS_05070 627270 628094 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_05070 628120 629499 gene locus_tag LOCUS_05080 628120 629499 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_05080 629954 630448 gene locus_tag LOCUS_05090 629954 630448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 631615 630656 gene locus_tag LOCUS_05100 gene rbsK 631615 630656 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077610.1 protein_id gnl|my_center|LOCUS_05100 632306 631620 gene locus_tag LOCUS_05110 gene rpe 632306 631620 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969559.1 protein_id gnl|my_center|LOCUS_05110 632547 634316 gene locus_tag LOCUS_05120 632547 634316 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_05120 634322 635803 gene locus_tag LOCUS_05130 634322 635803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 635930 637258 gene locus_tag LOCUS_05140 635930 637258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 637322 638206 gene locus_tag LOCUS_05150 637322 638206 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582766.1 protein_id gnl|my_center|LOCUS_05150 638220 639041 gene locus_tag LOCUS_05160 638220 639041 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_05160 639088 641328 gene locus_tag LOCUS_05170 639088 641328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 641353 642417 gene locus_tag LOCUS_05180 gene gutB 641353 642417 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_05180 642951 643406 gene locus_tag LOCUS_05190 642951 643406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05190 643462 643836 gene locus_tag LOCUS_05200 643462 643836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 643836 644216 gene locus_tag LOCUS_05210 643836 644216 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251099.1 protein_id gnl|my_center|LOCUS_05210 644213 644905 gene locus_tag LOCUS_05220 644213 644905 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_05220 646819 645005 gene locus_tag LOCUS_05230 646819 645005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 648246 646816 gene locus_tag LOCUS_05240 648246 646816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 648511 649452 gene locus_tag LOCUS_05250 gene rmgP 648511 649452 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_05250 649478 650377 gene locus_tag LOCUS_05260 649478 650377 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_05260 650460 652103 gene locus_tag LOCUS_05270 650460 652103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 652238 654265 gene locus_tag LOCUS_05280 652238 654265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 654969 654391 gene locus_tag LOCUS_05290 654969 654391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05290 655191 655018 gene locus_tag LOCUS_05300 655191 655018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05300 656020 655205 gene locus_tag LOCUS_05310 656020 655205 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_05310 656786 656244 gene locus_tag LOCUS_05320 656786 656244 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_05320 657409 656810 gene locus_tag LOCUS_05330 657409 656810 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_05330 657635 658831 gene locus_tag LOCUS_05340 657635 658831 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272496.1 protein_id gnl|my_center|LOCUS_05340 659525 658962 gene locus_tag LOCUS_05350 659525 658962 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071745902.1 protein_id gnl|my_center|LOCUS_05350 659737 660711 gene locus_tag LOCUS_05360 gene tdh 659737 660711 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_05360 660746 661927 gene locus_tag LOCUS_05370 660746 661927 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_05370 662057 663022 gene locus_tag LOCUS_05380 662057 663022 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_05380 663166 663909 gene locus_tag LOCUS_05390 663166 663909 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971351.1 protein_id gnl|my_center|LOCUS_05390 664362 663943 gene locus_tag LOCUS_05400 664362 663943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 665004 664366 gene locus_tag LOCUS_05410 665004 664366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 667623 666037 gene locus_tag LOCUS_05420 667623 666037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 667918 668352 gene locus_tag LOCUS_05430 667918 668352 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086910.1 protein_id gnl|my_center|LOCUS_05430 668349 669641 gene locus_tag LOCUS_05440 668349 669641 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525075.1 protein_id gnl|my_center|LOCUS_05440 669695 670501 gene locus_tag LOCUS_05450 669695 670501 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_05450 670544 670984 gene locus_tag LOCUS_05460 670544 670984 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529094.1 protein_id gnl|my_center|LOCUS_05460 671031 671372 gene locus_tag LOCUS_05470 671031 671372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 671511 672113 gene locus_tag LOCUS_05480 671511 672113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 672309 673574 gene locus_tag LOCUS_05490 672309 673574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 674758 674940 gene locus_tag LOCUS_05500 674758 674940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 674940 677612 gene locus_tag LOCUS_05510 gene ppdK 674940 677612 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460835.1 protein_id gnl|my_center|LOCUS_05510 677751 678404 gene locus_tag LOCUS_05520 677751 678404 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392142.1 protein_id gnl|my_center|LOCUS_05520 678702 679757 gene locus_tag LOCUS_05530 678702 679757 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226239.1 protein_id gnl|my_center|LOCUS_05530 679818 682964 gene locus_tag LOCUS_05540 679818 682964 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989870.1 protein_id gnl|my_center|LOCUS_05540 683080 683319 gene locus_tag LOCUS_05550 683080 683319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 683429 685078 gene locus_tag LOCUS_05560 683429 685078 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724033.1 protein_id gnl|my_center|LOCUS_05560 685163 686113 gene locus_tag LOCUS_05570 685163 686113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278786.1 protein_id gnl|my_center|LOCUS_05570 686118 686963 gene locus_tag LOCUS_05580 686118 686963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989353.1 protein_id gnl|my_center|LOCUS_05580 687084 688196 gene locus_tag LOCUS_05590 687084 688196 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291145.1 protein_id gnl|my_center|LOCUS_05590 688189 689091 gene locus_tag LOCUS_05600 688189 689091 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_05600 689209 689667 gene locus_tag LOCUS_05610 689209 689667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 689798 690394 gene locus_tag LOCUS_05620 689798 690394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 690526 691323 gene locus_tag LOCUS_05630 690526 691323 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_05630 693359 691413 gene locus_tag LOCUS_05640 693359 691413 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176119.1 protein_id gnl|my_center|LOCUS_05640 694161 693394 gene locus_tag LOCUS_05650 694161 693394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722374.1 protein_id gnl|my_center|LOCUS_05650 694356 695033 gene locus_tag LOCUS_05660 694356 695033 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674592.1 protein_id gnl|my_center|LOCUS_05660 695030 696049 gene locus_tag LOCUS_05670 695030 696049 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989801.1 protein_id gnl|my_center|LOCUS_05670 696136 697344 gene locus_tag LOCUS_05680 gene egsA 696136 697344 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229504.1 protein_id gnl|my_center|LOCUS_05680 698395 697499 gene locus_tag LOCUS_05690 698395 697499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 698582 699664 gene locus_tag LOCUS_05700 698582 699664 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_05700 700719 699937 gene locus_tag LOCUS_05710 700719 699937 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729455.1 protein_id gnl|my_center|LOCUS_05710 701490 700735 gene locus_tag LOCUS_05720 gene lutR 701490 700735 CDS product L-lactate utilization/bacilysin biosynthesis transcriptional regulator LutR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968191.1 protein_id gnl|my_center|LOCUS_05720 701901 701725 gene locus_tag LOCUS_05730 701901 701725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 702059 703474 gene locus_tag LOCUS_05740 gene glcD 702059 703474 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890729.1 protein_id gnl|my_center|LOCUS_05740 703467 704864 gene locus_tag LOCUS_05750 703467 704864 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229519.1 protein_id gnl|my_center|LOCUS_05750 704952 705152 gene locus_tag LOCUS_05760 704952 705152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 705337 705474 gene locus_tag LOCUS_05770 705337 705474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 705963 706802 gene locus_tag LOCUS_05780 705963 706802 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973395.1 protein_id gnl|my_center|LOCUS_05780 706802 707965 gene locus_tag LOCUS_05790 706802 707965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 707968 709167 gene locus_tag LOCUS_05800 707968 709167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 709597 710148 gene locus_tag LOCUS_05810 709597 710148 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583077.1 protein_id gnl|my_center|LOCUS_05810 710226 711281 gene locus_tag LOCUS_05820 710226 711281 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787047.1 protein_id gnl|my_center|LOCUS_05820 711321 712088 gene locus_tag LOCUS_05830 711321 712088 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_05830 712220 712636 gene locus_tag LOCUS_05840 712220 712636 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819713.1 protein_id gnl|my_center|LOCUS_05840 713179 712754 gene locus_tag LOCUS_05850 713179 712754 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600363.1 protein_id gnl|my_center|LOCUS_05850 713343 714596 gene locus_tag LOCUS_05860 713343 714596 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359496.1 protein_id gnl|my_center|LOCUS_05860 714603 715364 gene locus_tag LOCUS_05870 714603 715364 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391974.1 protein_id gnl|my_center|LOCUS_05870 716822 715806 gene locus_tag LOCUS_05880 716822 715806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 717458 716850 gene locus_tag LOCUS_05890 717458 716850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 717718 718413 gene locus_tag LOCUS_05900 717718 718413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 718895 719443 gene locus_tag LOCUS_05910 718895 719443 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642469.1 protein_id gnl|my_center|LOCUS_05910 719627 720814 gene locus_tag LOCUS_05920 719627 720814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 721256 720924 gene locus_tag LOCUS_05930 gene csaA 721256 720924 CDS product chaperone CsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399582.1 protein_id gnl|my_center|LOCUS_05930 721741 721292 gene locus_tag LOCUS_05940 721741 721292 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183068.1 protein_id gnl|my_center|LOCUS_05940 721914 722765 gene locus_tag LOCUS_05950 721914 722765 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_05950 723344 722862 gene locus_tag LOCUS_05960 723344 722862 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722787.1 protein_id gnl|my_center|LOCUS_05960 724810 723494 gene locus_tag LOCUS_05970 724810 723494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 724974 725828 gene locus_tag LOCUS_05980 724974 725828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 726324 730370 gene locus_tag LOCUS_05990 726324 730370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 730483 739545 gene locus_tag LOCUS_06000 730483 739545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 741073 739880 gene locus_tag LOCUS_06010 741073 739880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 744597 741259 gene locus_tag LOCUS_06020 744597 741259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 745104 744769 gene locus_tag LOCUS_06030 745104 744769 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_06030 745665 745153 gene locus_tag LOCUS_06040 745665 745153 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141436.1 protein_id gnl|my_center|LOCUS_06040 745890 753941 gene locus_tag LOCUS_06050 745890 753941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 754137 754739 gene locus_tag LOCUS_06060 754137 754739 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040540526.1 protein_id gnl|my_center|LOCUS_06060 754672 754878 gene locus_tag LOCUS_06070 754672 754878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 754909 755484 gene locus_tag LOCUS_06080 754909 755484 CDS product HAD family acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668224.1 protein_id gnl|my_center|LOCUS_06080 757265 755622 gene locus_tag LOCUS_06090 757265 755622 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229647.1 protein_id gnl|my_center|LOCUS_06090 757448 758245 gene locus_tag LOCUS_06100 757448 758245 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722653.1 protein_id gnl|my_center|LOCUS_06100 758242 758808 gene locus_tag LOCUS_06110 758242 758808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 759370 759140 gene locus_tag LOCUS_06120 759370 759140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 760061 759645 gene locus_tag LOCUS_06130 760061 759645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 761214 760189 gene locus_tag LOCUS_06140 761214 760189 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_06140 761360 764089 gene locus_tag LOCUS_06150 761360 764089 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_06150 765225 764323 gene locus_tag LOCUS_06160 765225 764323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 765470 768340 gene locus_tag LOCUS_06170 765470 768340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 768543 770210 gene locus_tag LOCUS_06180 768543 770210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 770721 770521 gene locus_tag LOCUS_06190 770721 770521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06190 770869 771582 gene locus_tag LOCUS_06200 770869 771582 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_06200 771760 773418 gene locus_tag LOCUS_06210 771760 773418 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_06210 773424 774527 gene locus_tag LOCUS_06220 773424 774527 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392526.1 protein_id gnl|my_center|LOCUS_06220 774517 775770 gene locus_tag LOCUS_06230 774517 775770 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_06230 775798 775998 gene locus_tag LOCUS_06240 775798 775998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 776185 776649 gene locus_tag LOCUS_06250 776185 776649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 776810 778039 gene locus_tag LOCUS_06260 776810 778039 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676812.1 protein_id gnl|my_center|LOCUS_06260 778131 779204 gene locus_tag LOCUS_06270 778131 779204 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_06270 781493 779271 gene locus_tag LOCUS_06280 gene secDF 781493 779271 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 protein_id gnl|my_center|LOCUS_06280 781730 783559 gene locus_tag LOCUS_06290 781730 783559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 783719 785551 gene locus_tag LOCUS_06300 783719 785551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 785575 785763 gene locus_tag LOCUS_06310 785575 785763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 786258 788630 gene locus_tag LOCUS_06320 786258 788630 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_06320 788755 789252 gene locus_tag LOCUS_06330 788755 789252 CDS product DUF3052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929556.1 protein_id gnl|my_center|LOCUS_06330 789434 790309 gene locus_tag LOCUS_06340 gene gmuE 789434 790309 CDS product fructokinase GmuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234095.1 protein_id gnl|my_center|LOCUS_06340 790320 791276 gene locus_tag LOCUS_06350 790320 791276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 791315 792364 gene locus_tag LOCUS_06360 791315 792364 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533013.1 protein_id gnl|my_center|LOCUS_06360 792723 793385 gene locus_tag LOCUS_06370 792723 793385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965552.1 protein_id gnl|my_center|LOCUS_06370 793372 796680 gene locus_tag LOCUS_06380 793372 796680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 798200 797436 gene locus_tag LOCUS_06390 798200 797436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 798138 798389 gene locus_tag LOCUS_06400 798138 798389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 799101 798496 gene locus_tag LOCUS_06410 799101 798496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 799577 799242 gene locus_tag LOCUS_06420 799577 799242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 799701 801557 gene locus_tag LOCUS_06430 gene yesM 799701 801557 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_06430 801547 802716 gene locus_tag LOCUS_06440 801547 802716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 802862 804217 gene locus_tag LOCUS_06450 802862 804217 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227575.1 protein_id gnl|my_center|LOCUS_06450 804297 805184 gene locus_tag LOCUS_06460 804297 805184 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567523.1 protein_id gnl|my_center|LOCUS_06460 805181 806095 gene locus_tag LOCUS_06470 805181 806095 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_06470 806092 807810 gene locus_tag LOCUS_06480 806092 807810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 807953 808978 gene locus_tag LOCUS_06490 807953 808978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 809266 809033 gene locus_tag LOCUS_06500 809266 809033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 810900 809395 gene locus_tag LOCUS_06510 810900 809395 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199987.1 protein_id gnl|my_center|LOCUS_06510 811023 811946 gene locus_tag LOCUS_06520 811023 811946 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_06520 812575 812036 gene locus_tag LOCUS_06530 812575 812036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 812663 812881 gene locus_tag LOCUS_06540 812663 812881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 812896 813657 gene locus_tag LOCUS_06550 812896 813657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 813700 813990 gene locus_tag LOCUS_06560 813700 813990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 814043 814366 gene locus_tag LOCUS_06570 814043 814366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 814644 816191 gene locus_tag LOCUS_06580 814644 816191 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_06580 816188 817432 gene locus_tag LOCUS_06590 816188 817432 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393536.1 protein_id gnl|my_center|LOCUS_06590 817414 818523 gene locus_tag LOCUS_06600 817414 818523 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943959.1 protein_id gnl|my_center|LOCUS_06600 818520 818744 gene locus_tag LOCUS_06610 818520 818744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 819098 819394 gene locus_tag LOCUS_06620 819098 819394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 819434 819952 gene locus_tag LOCUS_06630 819434 819952 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640212.1 protein_id gnl|my_center|LOCUS_06630 819970 820470 gene locus_tag LOCUS_06640 819970 820470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 820684 823560 gene locus_tag LOCUS_06650 820684 823560 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030298.1 protein_id gnl|my_center|LOCUS_06650 824172 823660 gene locus_tag LOCUS_06660 gene chrS 824172 823660 CDS product chromate efflux transcriptional regulator ChrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242900.1 protein_id gnl|my_center|LOCUS_06660 824492 825661 gene locus_tag LOCUS_06670 824492 825661 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_06670 825678 826661 gene locus_tag LOCUS_06680 825678 826661 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979027.1 protein_id gnl|my_center|LOCUS_06680 827897 826818 gene locus_tag LOCUS_06690 827897 826818 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_06690 828993 827890 gene locus_tag LOCUS_06700 828993 827890 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583801.1 protein_id gnl|my_center|LOCUS_06700 830178 828994 gene locus_tag LOCUS_06710 830178 828994 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_06710 830540 831589 gene locus_tag LOCUS_06720 830540 831589 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171504.1 protein_id gnl|my_center|LOCUS_06720 831656 832792 gene locus_tag LOCUS_06730 gene desK 831656 832792 CDS product two-component sensor histidine kinase DesK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231271.1 protein_id gnl|my_center|LOCUS_06730 832789 833388 gene locus_tag LOCUS_06740 gene desR 832789 833388 CDS product two-component system response regulator DesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399356.1 protein_id gnl|my_center|LOCUS_06740 833473 835077 gene locus_tag LOCUS_06750 833473 835077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 835169 836188 gene locus_tag LOCUS_06760 835169 836188 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243725.1 protein_id gnl|my_center|LOCUS_06760 836840 836331 gene locus_tag LOCUS_06770 836840 836331 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328577.1 protein_id gnl|my_center|LOCUS_06770 837746 836868 gene locus_tag LOCUS_06780 837746 836868 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_06780 841786 838334 gene locus_tag LOCUS_06790 841786 838334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 843113 842202 gene locus_tag LOCUS_06800 843113 842202 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287299.1 protein_id gnl|my_center|LOCUS_06800 843457 844992 gene locus_tag LOCUS_06810 gene abfA 843457 844992 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_06810 846144 845044 gene locus_tag LOCUS_06820 846144 845044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 847921 846137 gene locus_tag LOCUS_06830 gene lbuL 847921 846137 CDS product linear/branched/unsaturated fatty acid:CoA ligase LbuL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030732.1 protein_id gnl|my_center|LOCUS_06830 848986 848108 gene locus_tag LOCUS_06840 848986 848108 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 protein_id gnl|my_center|LOCUS_06840 849104 850162 gene locus_tag LOCUS_06850 849104 850162 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_06850 850198 851052 gene locus_tag LOCUS_06860 850198 851052 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_06860 851120 851998 gene locus_tag LOCUS_06870 851120 851998 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375198.1 protein_id gnl|my_center|LOCUS_06870 852136 853023 gene locus_tag LOCUS_06880 852136 853023 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391719.1 protein_id gnl|my_center|LOCUS_06880 853132 853467 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcgagcatgatcgccttctgtagagaaggc 853611 854726 gene locus_tag LOCUS_06890 853611 854726 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320739.1 protein_id gnl|my_center|LOCUS_06890 854716 855522 gene locus_tag LOCUS_06900 854716 855522 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721372.1 protein_id gnl|my_center|LOCUS_06900 855519 856322 gene locus_tag LOCUS_06910 855519 856322 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721373.1 protein_id gnl|my_center|LOCUS_06910 856319 857392 gene locus_tag LOCUS_06920 856319 857392 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721374.1 protein_id gnl|my_center|LOCUS_06920 857492 858406 gene locus_tag LOCUS_06930 gene msrB 857492 858406 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_06930 858558 859259 gene locus_tag LOCUS_06940 858558 859259 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038813.1 protein_id gnl|my_center|LOCUS_06940 859249 860331 gene locus_tag LOCUS_06950 859249 860331 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243299.1 protein_id gnl|my_center|LOCUS_06950 860638 861717 gene locus_tag LOCUS_06960 860638 861717 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530504.1 protein_id gnl|my_center|LOCUS_06960 861720 864185 gene locus_tag LOCUS_06970 861720 864185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 864229 864993 gene locus_tag LOCUS_06980 864229 864993 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389893.1 protein_id gnl|my_center|LOCUS_06980 865110 867452 gene locus_tag LOCUS_06990 865110 867452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 868355 869257 gene locus_tag LOCUS_07000 868355 869257 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_07000 869269 870177 gene locus_tag LOCUS_07010 869269 870177 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_07010 870254 871861 gene locus_tag LOCUS_07020 870254 871861 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_07020 872184 871936 gene locus_tag LOCUS_07030 872184 871936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 872084 877741 gene locus_tag LOCUS_07040 872084 877741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 877837 880446 gene locus_tag LOCUS_07050 877837 880446 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030755.1 protein_id gnl|my_center|LOCUS_07050 881617 880514 gene locus_tag LOCUS_07060 881617 880514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 882047 882140 gene locus_tag LOCUS_t00160 882047 882140 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 883594 882416 gene locus_tag LOCUS_07070 gene alr 883594 882416 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390600.1 protein_id gnl|my_center|LOCUS_07070 884679 883588 gene locus_tag LOCUS_07080 884679 883588 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_07080 885186 884884 gene locus_tag LOCUS_07090 885186 884884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 885481 886644 gene locus_tag LOCUS_07100 885481 886644 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228869.1 protein_id gnl|my_center|LOCUS_07100 886656 887495 gene locus_tag LOCUS_07110 gene hisJ 886656 887495 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732654.1 protein_id gnl|my_center|LOCUS_07110 888160 896004 gene locus_tag LOCUS_07120 888160 896004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 896163 897380 gene locus_tag LOCUS_07130 896163 897380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 897483 897662 gene locus_tag LOCUS_07140 897483 897662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 897643 897810 gene locus_tag LOCUS_07150 897643 897810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 897964 898914 gene locus_tag LOCUS_07160 gene deoR 897964 898914 CDS product DNA-binding transcriptional repressor DeoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227124.1 protein_id gnl|my_center|LOCUS_07160 898935 899636 gene locus_tag LOCUS_07170 gene deoC 898935 899636 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017437.1 protein_id gnl|my_center|LOCUS_07170 899839 900831 gene locus_tag LOCUS_07180 899839 900831 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_07180 901345 903141 gene locus_tag LOCUS_07190 901345 903141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 903155 904471 gene locus_tag LOCUS_07200 903155 904471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 904565 905488 gene locus_tag LOCUS_07210 904565 905488 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_07210 905485 906354 gene locus_tag LOCUS_07220 905485 906354 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972133.1 protein_id gnl|my_center|LOCUS_07220 906551 908014 gene locus_tag LOCUS_07230 906551 908014 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972131.1 protein_id gnl|my_center|LOCUS_07230 909307 908618 gene locus_tag LOCUS_07240 909307 908618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 909783 912233 gene locus_tag LOCUS_07250 909783 912233 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989370.1 protein_id gnl|my_center|LOCUS_07250 912472 913494 gene locus_tag LOCUS_07260 912472 913494 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_07260 913578 914303 gene locus_tag LOCUS_07270 913578 914303 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404711.1 protein_id gnl|my_center|LOCUS_07270 915847 914378 gene locus_tag LOCUS_07280 915847 914378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 916015 916740 gene locus_tag LOCUS_07290 916015 916740 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_07290 917200 916922 gene locus_tag LOCUS_07300 917200 916922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 917190 918713 gene locus_tag LOCUS_07310 917190 918713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 918794 919693 gene locus_tag LOCUS_07320 918794 919693 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_07320 919713 920594 gene locus_tag LOCUS_07330 919713 920594 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_07330 920633 921484 gene locus_tag LOCUS_07340 920633 921484 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_07340 921498 922523 gene locus_tag LOCUS_07350 921498 922523 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_07350 922557 923684 gene locus_tag LOCUS_07360 922557 923684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 923729 926776 gene locus_tag LOCUS_07370 923729 926776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 926819 928006 gene locus_tag LOCUS_07380 926819 928006 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_07380 928003 928392 gene locus_tag LOCUS_07390 928003 928392 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_07390 928389 929132 gene locus_tag LOCUS_07400 928389 929132 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876891.1 protein_id gnl|my_center|LOCUS_07400 929151 930173 gene locus_tag LOCUS_07410 929151 930173 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722159.1 protein_id gnl|my_center|LOCUS_07410 930198 931073 gene locus_tag LOCUS_07420 930198 931073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 931081 933780 gene locus_tag LOCUS_07430 931081 933780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 933931 935406 gene locus_tag LOCUS_07440 933931 935406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 936723 935479 gene locus_tag LOCUS_07450 936723 935479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 936981 937811 gene locus_tag LOCUS_07460 936981 937811 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969317.1 protein_id gnl|my_center|LOCUS_07460 938815 945537 gene locus_tag LOCUS_07470 938815 945537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 945778 949545 gene locus_tag LOCUS_07480 945778 949545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 949561 949803 gene locus_tag LOCUS_07490 949561 949803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 950850 950203 gene locus_tag LOCUS_07500 950850 950203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 951864 951007 gene locus_tag LOCUS_07510 951864 951007 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 protein_id gnl|my_center|LOCUS_07510 952202 951948 gene locus_tag LOCUS_07520 952202 951948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 952407 953390 gene locus_tag LOCUS_07530 gene cmrA 952407 953390 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_07530 954874 953324 gene locus_tag LOCUS_07540 954874 953324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 956653 954881 gene locus_tag LOCUS_07550 gene yesM 956653 954881 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_07550 956873 958249 gene locus_tag LOCUS_07560 956873 958249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 958337 959218 gene locus_tag LOCUS_07570 958337 959218 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_07570 959220 960038 gene locus_tag LOCUS_07580 959220 960038 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_07580 960090 964661 gene locus_tag LOCUS_07590 960090 964661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 964741 965082 gene locus_tag LOCUS_07600 964741 965082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 965277 965417 gene locus_tag LOCUS_07610 965277 965417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 965395 966111 gene locus_tag LOCUS_07620 965395 966111 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242345.1 protein_id gnl|my_center|LOCUS_07620 966089 966670 gene locus_tag LOCUS_07630 966089 966670 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074925.1 protein_id gnl|my_center|LOCUS_07630 967145 968005 gene locus_tag LOCUS_07640 gene catE 967145 968005 CDS product catechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233597.1 protein_id gnl|my_center|LOCUS_07640 968719 970047 gene locus_tag LOCUS_07650 gene ltrA 968719 970047 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 protein_id gnl|my_center|LOCUS_07650 970878 970129 gene locus_tag LOCUS_07660 gene map 970878 970129 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356886.1 protein_id gnl|my_center|LOCUS_07660 971178 971735 gene locus_tag LOCUS_07670 gene chrB 971178 971735 CDS product chromate efflux transporter subunit ChrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227843.1 protein_id gnl|my_center|LOCUS_07670 971882 972538 gene locus_tag LOCUS_07680 971882 972538 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134266015.1 protein_id gnl|my_center|LOCUS_07680 972633 973730 gene locus_tag LOCUS_07690 gene araR 972633 973730 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_07690 973977 974120 gene locus_tag LOCUS_07700 973977 974120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 974215 975846 gene locus_tag LOCUS_07710 974215 975846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 975843 977630 gene locus_tag LOCUS_07720 975843 977630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 977748 978653 gene locus_tag LOCUS_07730 977748 978653 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_07730 978667 979551 gene locus_tag LOCUS_07740 978667 979551 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_07740 979628 981430 gene locus_tag LOCUS_07750 979628 981430 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_07750 981557 983926 gene locus_tag LOCUS_07760 981557 983926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 983956 985635 gene locus_tag LOCUS_07770 983956 985635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 985848 986549 gene locus_tag LOCUS_07780 gene araD 985848 986549 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 protein_id gnl|my_center|LOCUS_07780 986634 988307 gene locus_tag LOCUS_07790 gene araB 986634 988307 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_07790 988548 990341 gene locus_tag LOCUS_07800 gene yesM 988548 990341 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_07800 990345 991682 gene locus_tag LOCUS_07810 990345 991682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 992812 991679 gene locus_tag LOCUS_07820 992812 991679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 992992 994323 gene locus_tag LOCUS_07830 992992 994323 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129728335.1 protein_id gnl|my_center|LOCUS_07830 994546 994379 gene locus_tag LOCUS_07840 994546 994379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 994524 995432 gene locus_tag LOCUS_07850 994524 995432 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_07850 995446 996285 gene locus_tag LOCUS_07860 995446 996285 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_07860 996291 998579 gene locus_tag LOCUS_07870 996291 998579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 998576 1000252 gene locus_tag LOCUS_07880 gene araB 998576 1000252 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_07880 1001235 1000333 gene locus_tag LOCUS_07890 1001235 1000333 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614448.1 protein_id gnl|my_center|LOCUS_07890 1001439 1001930 gene locus_tag LOCUS_07900 1001439 1001930 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080055.1 protein_id gnl|my_center|LOCUS_07900 1003970 1002039 gene locus_tag LOCUS_07910 1003970 1002039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1004233 1005243 gene locus_tag LOCUS_07920 gene degA 1004233 1005243 CDS product transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245813.1 protein_id gnl|my_center|LOCUS_07920 1006371 1010084 gene locus_tag LOCUS_07930 1006371 1010084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1010090 1012804 gene locus_tag LOCUS_07940 1010090 1012804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1012847 1015084 gene locus_tag LOCUS_07950 1012847 1015084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1015186 1016940 gene locus_tag LOCUS_07960 1015186 1016940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1016933 1017988 gene locus_tag LOCUS_07970 1016933 1017988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1018307 1019239 gene locus_tag LOCUS_07980 1018307 1019239 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_07980 1019265 1020146 gene locus_tag LOCUS_07990 1019265 1020146 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359877.1 protein_id gnl|my_center|LOCUS_07990 1020234 1021961 gene locus_tag LOCUS_08000 1020234 1021961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1021968 1022870 gene locus_tag LOCUS_08010 1021968 1022870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1022968 1023630 gene locus_tag LOCUS_08020 1022968 1023630 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_08020 1024833 1023700 gene locus_tag LOCUS_08030 1024833 1023700 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703474.1 protein_id gnl|my_center|LOCUS_08030 1025834 1024941 gene locus_tag LOCUS_08040 1025834 1024941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1025941 1027062 gene locus_tag LOCUS_08050 1025941 1027062 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520822.1 protein_id gnl|my_center|LOCUS_08050 1027136 1027777 gene locus_tag LOCUS_08060 1027136 1027777 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229468.1 protein_id gnl|my_center|LOCUS_08060 1028182 1027862 gene locus_tag LOCUS_08070 1028182 1027862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1028394 1028134 gene locus_tag LOCUS_08080 1028394 1028134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1028314 1028493 gene locus_tag LOCUS_08090 1028314 1028493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1029681 1028917 gene locus_tag LOCUS_08100 1029681 1028917 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013857.1 protein_id gnl|my_center|LOCUS_08100 1029916 1030377 gene locus_tag LOCUS_08110 1029916 1030377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1030462 1031115 gene locus_tag LOCUS_08120 1030462 1031115 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198408415.1 protein_id gnl|my_center|LOCUS_08120 1031108 1032226 gene locus_tag LOCUS_08130 1031108 1032226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1033323 1032379 gene locus_tag LOCUS_08140 1033323 1032379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1033774 1034301 gene locus_tag LOCUS_08150 1033774 1034301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1034465 1035013 gene locus_tag LOCUS_08160 1034465 1035013 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236362.1 protein_id gnl|my_center|LOCUS_08160 1035124 1037730 gene locus_tag LOCUS_08170 gene adhE 1035124 1037730 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260509.1 protein_id gnl|my_center|LOCUS_08170 1037762 1040032 gene locus_tag LOCUS_08180 gene pflB 1037762 1040032 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195472.1 protein_id gnl|my_center|LOCUS_08180 1040181 1040924 gene locus_tag LOCUS_08190 gene pflA 1040181 1040924 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238461.1 protein_id gnl|my_center|LOCUS_08190 1041067 1041690 gene locus_tag LOCUS_08200 1041067 1041690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1041822 1044137 gene locus_tag LOCUS_08210 1041822 1044137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1044573 1044241 gene locus_tag LOCUS_08220 1044573 1044241 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_08220 1044998 1044573 gene locus_tag LOCUS_08230 1044998 1044573 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437765.1 protein_id gnl|my_center|LOCUS_08230 1046501 1045356 gene locus_tag LOCUS_08240 1046501 1045356 CDS product conserved virulence factor C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398677.1 protein_id gnl|my_center|LOCUS_08240 1046711 1047682 gene locus_tag LOCUS_08250 1046711 1047682 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129615.1 protein_id gnl|my_center|LOCUS_08250 1047679 1049298 gene locus_tag LOCUS_08260 1047679 1049298 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633864.1 protein_id gnl|my_center|LOCUS_08260 1049541 1051364 gene locus_tag LOCUS_08270 1049541 1051364 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_08270 1051339 1053003 gene locus_tag LOCUS_08280 1051339 1053003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1053290 1053075 gene locus_tag LOCUS_08290 1053290 1053075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1053189 1053443 gene locus_tag LOCUS_08300 1053189 1053443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1053663 1054577 gene locus_tag LOCUS_08310 1053663 1054577 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972768.1 protein_id gnl|my_center|LOCUS_08310 1054584 1055426 gene locus_tag LOCUS_08320 1054584 1055426 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_08320 1055568 1056926 gene locus_tag LOCUS_08330 1055568 1056926 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972769.1 protein_id gnl|my_center|LOCUS_08330 1057064 1058707 gene locus_tag LOCUS_08340 1057064 1058707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1058720 1059631 gene locus_tag LOCUS_08350 1058720 1059631 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_08350 1060862 1059633 gene locus_tag LOCUS_08360 1060862 1059633 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233743.1 protein_id gnl|my_center|LOCUS_08360 1061754 1060864 gene locus_tag LOCUS_08370 1061754 1060864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1062049 1061819 gene locus_tag LOCUS_08380 1062049 1061819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1062448 1063812 gene locus_tag LOCUS_08390 1062448 1063812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1065016 1063877 gene locus_tag LOCUS_08400 1065016 1063877 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_08400 1065198 1065581 gene locus_tag LOCUS_08410 1065198 1065581 CDS product kinase-associated lipoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209350.1 protein_id gnl|my_center|LOCUS_08410 1065709 1066305 gene locus_tag LOCUS_08420 1065709 1066305 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233204.1 protein_id gnl|my_center|LOCUS_08420 1066393 1068498 gene locus_tag LOCUS_08430 1066393 1068498 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 protein_id gnl|my_center|LOCUS_08430 1069571 1068783 gene locus_tag LOCUS_08440 1069571 1068783 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_08440 1069521 1069736 gene locus_tag LOCUS_08450 1069521 1069736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1070035 1069715 gene locus_tag LOCUS_08460 1070035 1069715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1070788 1073031 gene locus_tag LOCUS_08470 1070788 1073031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1074478 1073174 gene locus_tag LOCUS_08480 1074478 1073174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1074834 1079429 gene locus_tag LOCUS_08490 gene gltB 1074834 1079429 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_08490 1079904 1080059 gene locus_tag LOCUS_08500 1079904 1080059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1080499 1080128 gene locus_tag LOCUS_08510 1080499 1080128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1083368 1080702 gene locus_tag LOCUS_08520 1083368 1080702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1086358 1083467 gene locus_tag LOCUS_08530 1086358 1083467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1086566 1088551 gene locus_tag LOCUS_08540 1086566 1088551 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388575.1 protein_id gnl|my_center|LOCUS_08540 1088683 1089660 gene locus_tag LOCUS_08550 1088683 1089660 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389035.1 protein_id gnl|my_center|LOCUS_08550 1089657 1089974 gene locus_tag LOCUS_08560 1089657 1089974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1089961 1090437 gene locus_tag LOCUS_08570 1089961 1090437 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390771.1 protein_id gnl|my_center|LOCUS_08570 1090434 1091639 gene locus_tag LOCUS_08580 1090434 1091639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1091636 1093435 gene locus_tag LOCUS_08590 1091636 1093435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_08590 1093802 1094569 gene locus_tag LOCUS_08600 1093802 1094569 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_08600 1094569 1095219 gene locus_tag LOCUS_08610 1094569 1095219 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_08610 1095440 1096330 gene locus_tag LOCUS_08620 gene galU 1095440 1096330 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 protein_id gnl|my_center|LOCUS_08620 1096340 1097035 gene locus_tag LOCUS_08630 1096340 1097035 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_08630 1097065 1098432 gene locus_tag LOCUS_08640 gene tuaD 1097065 1098432 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_08640 1098491 1099561 gene locus_tag LOCUS_08650 1098491 1099561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1099576 1101054 gene locus_tag LOCUS_08660 1099576 1101054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1101051 1102166 gene locus_tag LOCUS_08670 1101051 1102166 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942893.1 protein_id gnl|my_center|LOCUS_08670 1102191 1103501 gene locus_tag LOCUS_08680 1102191 1103501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1103530 1104492 gene locus_tag LOCUS_08690 1103530 1104492 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_08690 1104489 1105673 gene locus_tag LOCUS_08700 1104489 1105673 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041322924.1 protein_id gnl|my_center|LOCUS_08700 1105670 1106836 gene locus_tag LOCUS_08710 gene pimB 1105670 1106836 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411369.1 protein_id gnl|my_center|LOCUS_08710 1106842 1107522 gene locus_tag LOCUS_08720 1106842 1107522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1107519 1108256 gene locus_tag LOCUS_08730 1107519 1108256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1108253 1109437 gene locus_tag LOCUS_08740 1108253 1109437 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544567.1 protein_id gnl|my_center|LOCUS_08740 1109434 1111785 gene locus_tag LOCUS_08750 1109434 1111785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1111782 1113155 gene locus_tag LOCUS_08760 1111782 1113155 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_08760 1113359 1113889 gene locus_tag LOCUS_08770 1113359 1113889 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287389.1 protein_id gnl|my_center|LOCUS_08770 1113922 1114398 gene locus_tag LOCUS_08780 1113922 1114398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1114584 1114811 gene locus_tag LOCUS_08790 1114584 1114811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1114917 1115501 gene locus_tag LOCUS_08800 1114917 1115501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120061.1 protein_id gnl|my_center|LOCUS_08800 1115706 1116629 gene locus_tag LOCUS_08810 1115706 1116629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245448.1 protein_id gnl|my_center|LOCUS_08810 1116622 1117428 gene locus_tag LOCUS_08820 1116622 1117428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233421.1 protein_id gnl|my_center|LOCUS_08820 1117621 1123713 gene locus_tag LOCUS_08830 1117621 1123713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1123881 1125311 gene locus_tag LOCUS_08840 1123881 1125311 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_08840 1126232 1125336 gene locus_tag LOCUS_08850 1126232 1125336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1126480 1126710 gene locus_tag LOCUS_08860 1126480 1126710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1127653 1126802 gene locus_tag LOCUS_08870 1127653 1126802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1129063 1128059 gene locus_tag LOCUS_08880 1129063 1128059 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886496.1 protein_id gnl|my_center|LOCUS_08880 1129201 1129386 gene locus_tag LOCUS_08890 1129201 1129386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1129383 1129559 gene locus_tag LOCUS_08900 1129383 1129559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1129787 1129548 gene locus_tag LOCUS_08910 1129787 1129548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1130592 1129753 gene locus_tag LOCUS_08920 1130592 1129753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1130929 1131129 gene locus_tag LOCUS_08930 1130929 1131129 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160420.1 protein_id gnl|my_center|LOCUS_08930 1131304 1131750 gene locus_tag LOCUS_08940 1131304 1131750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1132089 1131880 gene locus_tag LOCUS_08950 1132089 1131880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1132316 1133746 gene locus_tag LOCUS_08960 1132316 1133746 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454902.1 protein_id gnl|my_center|LOCUS_08960 1134418 1133858 gene locus_tag LOCUS_08970 1134418 1133858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1134658 1135200 gene locus_tag LOCUS_08980 gene tsaE 1134658 1135200 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234079.1 protein_id gnl|my_center|LOCUS_08980 1135184 1135987 gene locus_tag LOCUS_08990 gene tsaB 1135184 1135987 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865740.1 protein_id gnl|my_center|LOCUS_08990 1135984 1136472 gene locus_tag LOCUS_09000 gene rimI 1135984 1136472 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_09000 1136469 1137506 gene locus_tag LOCUS_09010 gene tsaD 1136469 1137506 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_09010 1137758 1138468 gene locus_tag LOCUS_09020 1137758 1138468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1141122 1139188 gene locus_tag LOCUS_09030 1141122 1139188 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602146.1 protein_id gnl|my_center|LOCUS_09030 1141315 1141950 gene locus_tag LOCUS_09040 1141315 1141950 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792977.1 protein_id gnl|my_center|LOCUS_09040 1141950 1142438 gene locus_tag LOCUS_09050 gene moaC 1141950 1142438 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094151.1 protein_id gnl|my_center|LOCUS_09050 1142497 1142991 gene locus_tag LOCUS_09060 1142497 1142991 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_09060 1142991 1144019 gene locus_tag LOCUS_09070 1142991 1144019 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938852.1 protein_id gnl|my_center|LOCUS_09070 1144194 1144421 gene locus_tag LOCUS_09080 1144194 1144421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1144552 1145343 gene locus_tag LOCUS_09090 gene tatC 1144552 1145343 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_09090 1145838 1147115 gene locus_tag LOCUS_09100 1145838 1147115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 1147358 1147642 gene locus_tag LOCUS_09110 gene groES 1147358 1147642 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_09110 1147727 1149361 gene locus_tag LOCUS_09120 gene groL 1147727 1149361 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_09120 1149508 1150167 gene locus_tag LOCUS_09130 1149508 1150167 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_09130 1150264 1151265 gene locus_tag LOCUS_09140 1150264 1151265 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795124.1 protein_id gnl|my_center|LOCUS_09140 1151357 1152571 gene locus_tag LOCUS_09150 1151357 1152571 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890714.1 protein_id gnl|my_center|LOCUS_09150 1152568 1153494 gene locus_tag LOCUS_09160 1152568 1153494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1153636 1154499 gene locus_tag LOCUS_09170 1153636 1154499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1154678 1155208 gene locus_tag LOCUS_09180 1154678 1155208 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_09180 1155365 1156213 gene locus_tag LOCUS_09190 1155365 1156213 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366218.1 protein_id gnl|my_center|LOCUS_09190 1156317 1157726 gene locus_tag LOCUS_09200 1156317 1157726 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_09200 1157984 1157796 gene locus_tag LOCUS_09210 1157984 1157796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1158025 1158747 gene locus_tag LOCUS_09220 1158025 1158747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1158822 1159097 gene locus_tag LOCUS_09230 1158822 1159097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1159296 1160210 gene locus_tag LOCUS_09240 gene rbsK 1159296 1160210 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113483.1 protein_id gnl|my_center|LOCUS_09240 1161537 1160563 gene locus_tag LOCUS_09250 gene lytH 1161537 1160563 CDS product L-Ala--D-Glu endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243462.1 protein_id gnl|my_center|LOCUS_09250 1161715 1162647 gene locus_tag LOCUS_09260 gene lipA 1161715 1162647 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166375.1 protein_id gnl|my_center|LOCUS_09260 1162732 1163913 gene locus_tag LOCUS_09270 1162732 1163913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1164624 1165952 gene locus_tag LOCUS_09280 gene ltrA 1164624 1165952 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 protein_id gnl|my_center|LOCUS_09280 1165858 1166142 gene locus_tag LOCUS_09290 1165858 1166142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1167354 1166479 gene locus_tag LOCUS_09300 1167354 1166479 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673190.1 protein_id gnl|my_center|LOCUS_09300 1168623 1167445 gene locus_tag LOCUS_09310 gene spoVV 1168623 1167445 CDS product dipicolinic acid transporter SpoVV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245492.1 protein_id gnl|my_center|LOCUS_09310 1168833 1170332 gene locus_tag LOCUS_09320 gene pepD 1168833 1170332 CDS product beta-Ala-His dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287556.1 protein_id gnl|my_center|LOCUS_09320 1170446 1170613 gene locus_tag LOCUS_09330 1170446 1170613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1170787 1171164 gene locus_tag LOCUS_09340 1170787 1171164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043386.1 protein_id gnl|my_center|LOCUS_09340 1171215 1171916 gene locus_tag LOCUS_09350 1171215 1171916 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393240.1 protein_id gnl|my_center|LOCUS_09350 1172159 1171923 gene locus_tag LOCUS_09360 1172159 1171923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1172287 1174083 gene locus_tag LOCUS_09370 1172287 1174083 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287387.1 protein_id gnl|my_center|LOCUS_09370 1174582 1174998 gene locus_tag LOCUS_09380 1174582 1174998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1175476 1175060 gene locus_tag LOCUS_09390 1175476 1175060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1175655 1175473 gene locus_tag LOCUS_09400 1175655 1175473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1175594 1175770 gene locus_tag LOCUS_09410 1175594 1175770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1176814 1177821 gene locus_tag LOCUS_09420 gene trpS 1176814 1177821 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_09420 1178060 1177875 gene locus_tag LOCUS_09430 1178060 1177875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1178165 1178389 gene locus_tag LOCUS_09440 gene sasP 1178165 1178389 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517671.1 protein_id gnl|my_center|LOCUS_09440 1179534 1178551 gene locus_tag LOCUS_09450 1179534 1178551 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244136.1 protein_id gnl|my_center|LOCUS_09450 1179630 1179914 gene locus_tag LOCUS_09460 1179630 1179914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1180245 1179922 gene locus_tag LOCUS_09470 1180245 1179922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1180214 1180498 gene locus_tag LOCUS_09480 1180214 1180498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1180778 1181647 gene locus_tag LOCUS_09490 gene cyoE 1180778 1181647 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232818.1 protein_id gnl|my_center|LOCUS_09490 1181655 1182377 gene locus_tag LOCUS_09500 1181655 1182377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1182835 1182476 gene locus_tag LOCUS_09510 1182835 1182476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 1183029 1184792 gene locus_tag LOCUS_09520 1183029 1184792 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966041.1 protein_id gnl|my_center|LOCUS_09520 1184770 1186686 gene locus_tag LOCUS_09530 1184770 1186686 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_09530 1188140 1186881 gene locus_tag LOCUS_09540 1188140 1186881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1188336 1188719 gene locus_tag LOCUS_09550 1188336 1188719 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392689.1 protein_id gnl|my_center|LOCUS_09550 1188725 1189471 gene locus_tag LOCUS_09560 1188725 1189471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436372.1 protein_id gnl|my_center|LOCUS_09560 1189468 1191084 gene locus_tag LOCUS_09570 1189468 1191084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1191157 1191603 gene locus_tag LOCUS_09580 1191157 1191603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1191600 1192721 gene locus_tag LOCUS_09590 1191600 1192721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1192969 1193133 gene locus_tag LOCUS_09600 1192969 1193133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1193291 1195315 gene locus_tag LOCUS_09610 1193291 1195315 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903359.1 protein_id gnl|my_center|LOCUS_09610 1195469 1196167 gene locus_tag LOCUS_09620 1195469 1196167 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_09620 1196157 1197626 gene locus_tag LOCUS_09630 1196157 1197626 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475803.1 protein_id gnl|my_center|LOCUS_09630 1197727 1198839 gene locus_tag LOCUS_09640 1197727 1198839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1199020 1202334 gene locus_tag LOCUS_09650 1199020 1202334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1202490 1212866 gene locus_tag LOCUS_09660 1202490 1212866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1213019 1215067 gene locus_tag LOCUS_09670 1213019 1215067 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903359.1 protein_id gnl|my_center|LOCUS_09670 1215222 1215965 gene locus_tag LOCUS_09680 1215222 1215965 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234424.1 protein_id gnl|my_center|LOCUS_09680 1215973 1216452 gene locus_tag LOCUS_09690 1215973 1216452 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398518.1 protein_id gnl|my_center|LOCUS_09690 1216474 1218144 gene locus_tag LOCUS_09700 1216474 1218144 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_09700 1218690 1218271 gene locus_tag LOCUS_09710 1218690 1218271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1218792 1219631 gene locus_tag LOCUS_09720 1218792 1219631 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024388.1 protein_id gnl|my_center|LOCUS_09720 1219628 1220035 gene locus_tag LOCUS_09730 1219628 1220035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1221411 1220065 gene locus_tag LOCUS_09740 1221411 1220065 CDS product DUF2515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546382.1 protein_id gnl|my_center|LOCUS_09740 1221538 1223094 gene locus_tag LOCUS_09750 1221538 1223094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 1223223 1223573 gene locus_tag LOCUS_09760 1223223 1223573 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838193.1 protein_id gnl|my_center|LOCUS_09760 1223983 1224966 gene locus_tag LOCUS_09770 gene ctaA 1223983 1224966 CDS product heme A synthase CtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245869.1 protein_id gnl|my_center|LOCUS_09770 1224985 1226760 gene locus_tag LOCUS_09780 1224985 1226760 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873545.1 protein_id gnl|my_center|LOCUS_09780 1226821 1227633 gene locus_tag LOCUS_09790 1226821 1227633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1229180 1227729 gene locus_tag LOCUS_09800 gene cls 1229180 1227729 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243311.1 protein_id gnl|my_center|LOCUS_09800 1230783 1229227 gene locus_tag LOCUS_09810 1230783 1229227 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_09810 1231162 1230920 gene locus_tag LOCUS_09820 1231162 1230920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1231348 1232070 gene locus_tag LOCUS_09830 1231348 1232070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1232084 1232881 gene locus_tag LOCUS_09840 1232084 1232881 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398521.1 protein_id gnl|my_center|LOCUS_09840 1233206 1232952 gene locus_tag LOCUS_09850 1233206 1232952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1233284 1233550 gene locus_tag LOCUS_09860 1233284 1233550 CDS product YuzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595027.1 protein_id gnl|my_center|LOCUS_09860 1234633 1233572 gene locus_tag LOCUS_09870 1234633 1233572 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242518.1 protein_id gnl|my_center|LOCUS_09870 1235752 1234649 gene locus_tag LOCUS_09880 gene mqnE 1235752 1234649 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172898.1 protein_id gnl|my_center|LOCUS_09880 1236024 1236491 gene locus_tag LOCUS_09890 1236024 1236491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1237739 1237143 gene locus_tag LOCUS_09900 1237739 1237143 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020556.1 protein_id gnl|my_center|LOCUS_09900 1237891 1238253 gene locus_tag LOCUS_09910 1237891 1238253 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_09910 1238807 1238382 gene locus_tag LOCUS_09920 1238807 1238382 CDS product DUF3997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758789.1 protein_id gnl|my_center|LOCUS_09920 1239776 1239285 gene locus_tag LOCUS_09930 1239776 1239285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1240292 1239846 gene locus_tag LOCUS_09940 1240292 1239846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1240575 1240339 gene locus_tag LOCUS_09950 1240575 1240339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1244055 1240663 gene locus_tag LOCUS_09960 1244055 1240663 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011074.1 protein_id gnl|my_center|LOCUS_09960 1244392 1245063 gene locus_tag LOCUS_09970 1244392 1245063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1245900 1247093 gene locus_tag LOCUS_09980 1245900 1247093 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241220.1 protein_id gnl|my_center|LOCUS_09980 1247093 1247374 gene locus_tag LOCUS_09990 1247093 1247374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1247520 1249310 gene locus_tag LOCUS_10000 1247520 1249310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1249303 1250715 gene locus_tag LOCUS_10010 1249303 1250715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1250978 1251886 gene locus_tag LOCUS_10020 1250978 1251886 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_10020 1251887 1252813 gene locus_tag LOCUS_10030 1251887 1252813 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_10030 1252862 1254529 gene locus_tag LOCUS_10040 1252862 1254529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1254696 1256495 gene locus_tag LOCUS_10050 1254696 1256495 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767406.1 protein_id gnl|my_center|LOCUS_10050 1256970 1257992 gene locus_tag LOCUS_10060 1256970 1257992 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805139.1 protein_id gnl|my_center|LOCUS_10060 1258227 1260356 gene locus_tag LOCUS_10070 1258227 1260356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1260603 1262468 gene locus_tag LOCUS_10080 gene iolD 1260603 1262468 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268320.1 protein_id gnl|my_center|LOCUS_10080 1262481 1263401 gene locus_tag LOCUS_10090 gene iolE 1262481 1263401 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704223.1 protein_id gnl|my_center|LOCUS_10090 1263398 1264456 gene locus_tag LOCUS_10100 gene iolC 1263398 1264456 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068622.1 protein_id gnl|my_center|LOCUS_10100 1264495 1265940 gene locus_tag LOCUS_10110 1264495 1265940 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218124.1 protein_id gnl|my_center|LOCUS_10110 1265971 1266996 gene locus_tag LOCUS_10120 gene iolG 1265971 1266996 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_10120 1267001 1267810 gene locus_tag LOCUS_10130 gene iolB 1267001 1267810 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397477.1 protein_id gnl|my_center|LOCUS_10130 1267823 1270354 gene locus_tag LOCUS_10140 1267823 1270354 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_10140 1270351 1271742 gene locus_tag LOCUS_10150 1270351 1271742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1272246 1274009 gene locus_tag LOCUS_10160 1272246 1274009 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_10160 1273984 1275072 gene locus_tag LOCUS_10170 1273984 1275072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1275075 1275326 gene locus_tag LOCUS_10180 1275075 1275326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1275293 1276972 gene locus_tag LOCUS_10190 1275293 1276972 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_10190 1277013 1277909 gene locus_tag LOCUS_10200 1277013 1277909 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_10200 1277929 1278807 gene locus_tag LOCUS_10210 1277929 1278807 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_10210 1278937 1280235 gene locus_tag LOCUS_10220 gene melA 1278937 1280235 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_10220 1281105 1280359 gene locus_tag LOCUS_10230 1281105 1280359 CDS product heme-dependent peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242896.1 protein_id gnl|my_center|LOCUS_10230 1281273 1281557 gene locus_tag LOCUS_10240 1281273 1281557 CDS product YuiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243877.1 protein_id gnl|my_center|LOCUS_10240 1281557 1281976 gene locus_tag LOCUS_10250 1281557 1281976 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393838.1 protein_id gnl|my_center|LOCUS_10250 1284125 1282038 gene locus_tag LOCUS_10260 1284125 1282038 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181612.1 protein_id gnl|my_center|LOCUS_10260 1284634 1284143 gene locus_tag LOCUS_10270 1284634 1284143 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989756.1 protein_id gnl|my_center|LOCUS_10270 1284840 1285397 gene locus_tag LOCUS_10280 1284840 1285397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1285381 1285911 gene locus_tag LOCUS_10290 1285381 1285911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1285922 1287715 gene locus_tag LOCUS_10300 1285922 1287715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1295115 1287805 gene locus_tag LOCUS_10310 1295115 1287805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1295457 1297094 gene locus_tag LOCUS_10320 1295457 1297094 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_10320 1297112 1298167 gene locus_tag LOCUS_10330 1297112 1298167 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944641.1 protein_id gnl|my_center|LOCUS_10330 1298167 1299375 gene locus_tag LOCUS_10340 1298167 1299375 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_10340 1299487 1299975 gene locus_tag LOCUS_10350 1299487 1299975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1300048 1300806 gene locus_tag LOCUS_10360 1300048 1300806 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886586.1 protein_id gnl|my_center|LOCUS_10360 1300825 1302336 gene locus_tag LOCUS_10370 1300825 1302336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1302308 1302931 gene locus_tag LOCUS_10380 1302308 1302931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1303072 1304577 gene locus_tag LOCUS_10390 1303072 1304577 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003579580.1 protein_id gnl|my_center|LOCUS_10390 1304693 1305640 gene locus_tag LOCUS_10400 gene dnaI 1304693 1305640 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229466.1 protein_id gnl|my_center|LOCUS_10400 1305888 1307021 gene locus_tag LOCUS_10410 gene sbp 1305888 1307021 CDS product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 protein_id gnl|my_center|LOCUS_10410 1307058 1307894 gene locus_tag LOCUS_10420 gene cysT 1307058 1307894 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_10420 1307907 1308791 gene locus_tag LOCUS_10430 gene cysW 1307907 1308791 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813328.1 protein_id gnl|my_center|LOCUS_10430 1308894 1309097 gene locus_tag LOCUS_10440 1308894 1309097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1309321 1309500 gene locus_tag LOCUS_10450 1309321 1309500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1309819 1311195 gene locus_tag LOCUS_10460 1309819 1311195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976583.1 protein_id gnl|my_center|LOCUS_10460 1311379 1312311 gene locus_tag LOCUS_10470 1311379 1312311 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_10470 1312314 1313153 gene locus_tag LOCUS_10480 1312314 1313153 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_10480 1313346 1315169 gene locus_tag LOCUS_10490 1313346 1315169 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_10490 1315162 1316700 gene locus_tag LOCUS_10500 1315162 1316700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1316693 1317940 gene locus_tag LOCUS_10510 1316693 1317940 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105221568.1 protein_id gnl|my_center|LOCUS_10510 1318155 1320461 gene locus_tag LOCUS_10520 1318155 1320461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1320778 1320629 gene locus_tag LOCUS_10530 1320778 1320629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1320948 1323017 gene locus_tag LOCUS_10540 1320948 1323017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1323110 1323691 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcgtgcaccattctggtgcacga 1323840 1324820 gene locus_tag LOCUS_10550 1323840 1324820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775038.1 protein_id gnl|my_center|LOCUS_10550 1325321 1325680 gene locus_tag LOCUS_10560 1325321 1325680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1325631 1325933 gene locus_tag LOCUS_10570 1325631 1325933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1327606 1325930 gene locus_tag LOCUS_10580 1327606 1325930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1328108 1329451 gene locus_tag LOCUS_10590 1328108 1329451 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_10590 1329477 1330820 gene locus_tag LOCUS_10600 1329477 1330820 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_10600 1330839 1331501 gene locus_tag LOCUS_10610 1330839 1331501 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719245.1 protein_id gnl|my_center|LOCUS_10610 1331582 1332421 gene locus_tag LOCUS_10620 1331582 1332421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1332429 1332584 gene locus_tag LOCUS_10630 1332429 1332584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1333214 1332576 gene locus_tag LOCUS_10640 1333214 1332576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1334316 1333408 gene locus_tag LOCUS_10650 1334316 1333408 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_10650 1334472 1335137 gene locus_tag LOCUS_10660 gene sdhC 1334472 1335137 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_10660 1335156 1336913 gene locus_tag LOCUS_10670 gene sdhA 1335156 1336913 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676737.1 protein_id gnl|my_center|LOCUS_10670 1336917 1337690 gene locus_tag LOCUS_10680 gene sdhB 1336917 1337690 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_10680 1338022 1337780 gene locus_tag LOCUS_10690 1338022 1337780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1338127 1341000 gene locus_tag LOCUS_10700 gene sucA 1338127 1341000 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399330.1 protein_id gnl|my_center|LOCUS_10700 1341007 1342269 gene locus_tag LOCUS_10710 gene odhB 1341007 1342269 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399364.1 protein_id gnl|my_center|LOCUS_10710 1343854 1342829 gene locus_tag LOCUS_10720 1343854 1342829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1344063 1344416 gene locus_tag LOCUS_10730 1344063 1344416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1344359 1344643 gene locus_tag LOCUS_10740 1344359 1344643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1344666 1345142 gene locus_tag LOCUS_10750 1344666 1345142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1345142 1346941 gene locus_tag LOCUS_10760 1345142 1346941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_10760 1346960 1347436 gene locus_tag LOCUS_10770 1346960 1347436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1347402 1347605 gene locus_tag LOCUS_10780 1347402 1347605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1347683 1348243 gene locus_tag LOCUS_10790 1347683 1348243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1348224 1348718 gene locus_tag LOCUS_10800 1348224 1348718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 1348752 1349552 gene locus_tag LOCUS_10810 1348752 1349552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1349942 1349634 gene locus_tag LOCUS_10820 1349942 1349634 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357080.1 protein_id gnl|my_center|LOCUS_10820 1351012 1350053 gene locus_tag LOCUS_10830 1351012 1350053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1352007 1351192 gene locus_tag LOCUS_10840 gene hisJ 1352007 1351192 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227864.1 protein_id gnl|my_center|LOCUS_10840 1352953 1352051 gene locus_tag LOCUS_10850 1352953 1352051 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_10850 1353159 1354712 gene locus_tag LOCUS_10860 1353159 1354712 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445737.1 protein_id gnl|my_center|LOCUS_10860 1354717 1355325 gene locus_tag LOCUS_10870 1354717 1355325 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062063.1 protein_id gnl|my_center|LOCUS_10870 1355791 1357056 gene locus_tag LOCUS_10880 1355791 1357056 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968391.1 protein_id gnl|my_center|LOCUS_10880 1358022 1357081 gene locus_tag LOCUS_10890 1358022 1357081 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_10890 1358267 1358725 gene locus_tag LOCUS_10900 1358267 1358725 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082082.1 protein_id gnl|my_center|LOCUS_10900 1358925 1359710 gene locus_tag LOCUS_10910 1358925 1359710 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_10910 1359751 1361616 gene locus_tag LOCUS_10920 1359751 1361616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1361840 1362625 gene locus_tag LOCUS_10930 gene ecsA 1361840 1362625 CDS product ABC transporter ATP-binding protein EcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292603.1 protein_id gnl|my_center|LOCUS_10930 1362618 1363886 gene locus_tag LOCUS_10940 1362618 1363886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1364079 1365629 gene locus_tag LOCUS_10950 1364079 1365629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 1367024 1365711 gene locus_tag LOCUS_10960 1367024 1365711 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_10960 1367789 1367175 gene locus_tag LOCUS_10970 1367789 1367175 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943628.1 protein_id gnl|my_center|LOCUS_10970 1367902 1369593 gene locus_tag LOCUS_10980 1367902 1369593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 1369586 1370371 gene locus_tag LOCUS_10990 1369586 1370371 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_10990 1370770 1371708 gene locus_tag LOCUS_11000 1370770 1371708 CDS product IS1595-like element ISXca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037261.1 protein_id gnl|my_center|LOCUS_11000 1373105 1372305 gene locus_tag LOCUS_11010 1373105 1372305 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255010.1 protein_id gnl|my_center|LOCUS_11010 1373348 1374496 gene locus_tag LOCUS_11020 gene cotSA 1373348 1374496 CDS product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 protein_id gnl|my_center|LOCUS_11020 1375925 1374576 gene locus_tag LOCUS_11030 1375925 1374576 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721929.1 protein_id gnl|my_center|LOCUS_11030 1376146 1382619 gene locus_tag LOCUS_11040 1376146 1382619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1383016 1383717 gene locus_tag LOCUS_11050 1383016 1383717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1383714 1384907 gene locus_tag LOCUS_11060 1383714 1384907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1384873 1385532 gene locus_tag LOCUS_11070 1384873 1385532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1385546 1386271 gene locus_tag LOCUS_11080 1385546 1386271 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676164.1 protein_id gnl|my_center|LOCUS_11080 1386385 1387272 gene locus_tag LOCUS_11090 1386385 1387272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 1387317 1388684 gene locus_tag LOCUS_11100 1387317 1388684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1388630 1388836 gene locus_tag LOCUS_11110 1388630 1388836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1389184 1389471 gene locus_tag LOCUS_11120 1389184 1389471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1389502 1389840 gene locus_tag LOCUS_11130 1389502 1389840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1389837 1390127 gene locus_tag LOCUS_11140 1389837 1390127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1390288 1390575 gene locus_tag LOCUS_11150 1390288 1390575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1390964 1392160 gene locus_tag LOCUS_11160 1390964 1392160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1393266 1398299 gene locus_tag LOCUS_11170 1393266 1398299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1398661 1399650 gene locus_tag LOCUS_11180 1398661 1399650 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512068.1 protein_id gnl|my_center|LOCUS_11180 1399643 1400788 gene locus_tag LOCUS_11190 1399643 1400788 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678143.1 protein_id gnl|my_center|LOCUS_11190 1400815 1402410 gene locus_tag LOCUS_11200 1400815 1402410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1402415 1403506 gene locus_tag LOCUS_11210 gene wecB 1402415 1403506 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390550.1 protein_id gnl|my_center|LOCUS_11210 1403499 1404482 gene locus_tag LOCUS_11220 1403499 1404482 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932614.1 protein_id gnl|my_center|LOCUS_11220 1404479 1405396 gene locus_tag LOCUS_11230 1404479 1405396 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992747.1 protein_id gnl|my_center|LOCUS_11230 1405396 1406325 gene locus_tag LOCUS_11240 1405396 1406325 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739077.1 protein_id gnl|my_center|LOCUS_11240 1406472 1407254 gene locus_tag LOCUS_11250 1406472 1407254 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_11250 1408123 1407404 gene locus_tag LOCUS_11260 1408123 1407404 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_11260 1409233 1408250 gene locus_tag LOCUS_11270 1409233 1408250 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086311.1 protein_id gnl|my_center|LOCUS_11270 1409661 1410173 gene locus_tag LOCUS_11280 1409661 1410173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1410192 1410668 gene locus_tag LOCUS_11290 1410192 1410668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1410730 1411221 gene locus_tag LOCUS_11300 1410730 1411221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1411244 1411420 gene locus_tag LOCUS_11310 1411244 1411420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1411568 1411747 gene locus_tag LOCUS_11320 1411568 1411747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1412360 1412584 gene locus_tag LOCUS_11330 gene tatA 1412360 1412584 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631606.1 protein_id gnl|my_center|LOCUS_11330 1412687 1413463 gene locus_tag LOCUS_11340 gene tatC 1412687 1413463 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431523.1 protein_id gnl|my_center|LOCUS_11340 1413765 1414772 gene locus_tag LOCUS_11350 1413765 1414772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1414769 1415761 gene locus_tag LOCUS_11360 gene bchC 1414769 1415761 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720428.1 protein_id gnl|my_center|LOCUS_11360 1415821 1418196 gene locus_tag LOCUS_11370 1415821 1418196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1418225 1420210 gene locus_tag LOCUS_11380 1418225 1420210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1420243 1421709 gene locus_tag LOCUS_11390 1420243 1421709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1421784 1422692 gene locus_tag LOCUS_11400 1421784 1422692 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_11400 1422706 1423536 gene locus_tag LOCUS_11410 1422706 1423536 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210833.1 protein_id gnl|my_center|LOCUS_11410 1423560 1424723 gene locus_tag LOCUS_11420 1423560 1424723 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_11420 1425646 1424747 gene locus_tag LOCUS_11430 1425646 1424747 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 protein_id gnl|my_center|LOCUS_11430 1425767 1426480 gene locus_tag LOCUS_11440 1425767 1426480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1426716 1427099 gene locus_tag LOCUS_11450 1426716 1427099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1428085 1427870 gene locus_tag LOCUS_11460 1428085 1427870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1428279 1433000 gene locus_tag LOCUS_11470 1428279 1433000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1433225 1432965 gene locus_tag LOCUS_11480 1433225 1432965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1433405 1434346 gene locus_tag LOCUS_11490 1433405 1434346 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_11490 1434393 1435229 gene locus_tag LOCUS_11500 1434393 1435229 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_11500 1435251 1435424 gene locus_tag LOCUS_11510 1435251 1435424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1435345 1436709 gene locus_tag LOCUS_11520 1435345 1436709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1436790 1438541 gene locus_tag LOCUS_11530 1436790 1438541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1438513 1440129 gene locus_tag LOCUS_11540 1438513 1440129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1440250 1442337 gene locus_tag LOCUS_11550 1440250 1442337 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194904324.1 protein_id gnl|my_center|LOCUS_11550 1442638 1442390 gene locus_tag LOCUS_11560 1442638 1442390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1442571 1443074 gene locus_tag LOCUS_11570 1442571 1443074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1444136 1443093 gene locus_tag LOCUS_11580 1444136 1443093 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969217.1 protein_id gnl|my_center|LOCUS_11580 1444257 1445609 gene locus_tag LOCUS_11590 1444257 1445609 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_11590 1445668 1447494 gene locus_tag LOCUS_11600 1445668 1447494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1447578 1448363 gene locus_tag LOCUS_11610 1447578 1448363 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_11610 1448771 1448977 gene locus_tag LOCUS_11620 1448771 1448977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1449489 1449190 gene locus_tag LOCUS_11630 1449489 1449190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1449502 1449714 gene locus_tag LOCUS_11640 1449502 1449714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1450027 1449782 gene locus_tag LOCUS_11650 1450027 1449782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1450586 1450344 gene locus_tag LOCUS_11660 1450586 1450344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1450686 1452455 gene locus_tag LOCUS_11670 1450686 1452455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1452430 1454112 gene locus_tag LOCUS_11680 1452430 1454112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1454220 1455905 gene locus_tag LOCUS_11690 1454220 1455905 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_11690 1456010 1457056 gene locus_tag LOCUS_11700 1456010 1457056 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972726.1 protein_id gnl|my_center|LOCUS_11700 1457162 1458358 gene locus_tag LOCUS_11710 1457162 1458358 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_11710 1458371 1458748 gene locus_tag LOCUS_11720 1458371 1458748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1458762 1459661 gene locus_tag LOCUS_11730 1458762 1459661 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_11730 1459670 1460563 gene locus_tag LOCUS_11740 1459670 1460563 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_11740 1460591 1462627 gene locus_tag LOCUS_11750 1460591 1462627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1462681 1467624 gene locus_tag LOCUS_11760 1462681 1467624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1467753 1470347 gene locus_tag LOCUS_11770 1467753 1470347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1470529 1471551 gene locus_tag LOCUS_11780 1470529 1471551 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521613.1 protein_id gnl|my_center|LOCUS_11780 1471677 1473005 gene locus_tag LOCUS_11790 1471677 1473005 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525207.1 protein_id gnl|my_center|LOCUS_11790 1473089 1473967 gene locus_tag LOCUS_11800 1473089 1473967 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_11800 1473964 1474788 gene locus_tag LOCUS_11810 1473964 1474788 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_11810 1474854 1477100 gene locus_tag LOCUS_11820 1474854 1477100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1477186 1480635 gene locus_tag LOCUS_11830 1477186 1480635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1481880 1480729 gene locus_tag LOCUS_11840 1481880 1480729 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_11840 1482916 1481981 gene locus_tag LOCUS_11850 1482916 1481981 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_11850 1483133 1485310 gene locus_tag LOCUS_11860 1483133 1485310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1485819 1485649 gene locus_tag LOCUS_11870 1485819 1485649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1487965 1486223 gene locus_tag LOCUS_11880 1487965 1486223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1489829 1487967 gene locus_tag LOCUS_11890 1489829 1487967 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015253363.1 protein_id gnl|my_center|LOCUS_11890 1490025 1491452 gene locus_tag LOCUS_11900 1490025 1491452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1491561 1492439 gene locus_tag LOCUS_11910 1491561 1492439 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_11910 1492441 1493340 gene locus_tag LOCUS_11920 1492441 1493340 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015137.1 protein_id gnl|my_center|LOCUS_11920 1493377 1495551 gene locus_tag LOCUS_11930 1493377 1495551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 1495613 1499080 gene locus_tag LOCUS_11940 1495613 1499080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1499147 1500748 gene locus_tag LOCUS_11950 1499147 1500748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1500871 1503120 gene locus_tag LOCUS_11960 1500871 1503120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1503319 1506297 gene locus_tag LOCUS_11970 1503319 1506297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1506496 1507407 gene locus_tag LOCUS_11980 1506496 1507407 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_11980 1507422 1508312 gene locus_tag LOCUS_11990 1507422 1508312 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_11990 1508377 1509912 gene locus_tag LOCUS_12000 1508377 1509912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800385.1 protein_id gnl|my_center|LOCUS_12000 1509925 1510971 gene locus_tag LOCUS_12010 1509925 1510971 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989598.1 protein_id gnl|my_center|LOCUS_12010 1511065 1515879 gene locus_tag LOCUS_12020 1511065 1515879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1519394 1516710 gene locus_tag LOCUS_12030 gene mprF 1519394 1516710 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010869.1 protein_id gnl|my_center|LOCUS_12030 1519594 1520880 gene locus_tag LOCUS_12040 1519594 1520880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1523404 1521533 gene locus_tag LOCUS_12050 1523404 1521533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1523831 1524784 gene locus_tag LOCUS_12060 1523831 1524784 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_12060 1524801 1525670 gene locus_tag LOCUS_12070 1524801 1525670 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_12070 1525742 1527328 gene locus_tag LOCUS_12080 1525742 1527328 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_12080 1527467 1529809 gene locus_tag LOCUS_12090 1527467 1529809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1529985 1532699 gene locus_tag LOCUS_12100 1529985 1532699 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_12100 1532696 1533676 gene locus_tag LOCUS_12110 1532696 1533676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1533691 1539060 gene locus_tag LOCUS_12120 1533691 1539060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1539057 1540322 gene locus_tag LOCUS_12130 1539057 1540322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 1541322 1540912 gene locus_tag LOCUS_12140 1541322 1540912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1542250 1541552 gene locus_tag LOCUS_12150 1542250 1541552 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943121.1 protein_id gnl|my_center|LOCUS_12150 1543835 1542243 gene locus_tag LOCUS_12160 1543835 1542243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1544458 1544865 gene locus_tag LOCUS_12170 1544458 1544865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1545116 1546798 gene locus_tag LOCUS_12180 gene kdpA 1545116 1546798 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161471071.1 protein_id gnl|my_center|LOCUS_12180 1546818 1548854 gene locus_tag LOCUS_12190 gene kdpB 1546818 1548854 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248019.1 protein_id gnl|my_center|LOCUS_12190 1548902 1549525 gene locus_tag LOCUS_12200 gene kdpC 1548902 1549525 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412605.1 protein_id gnl|my_center|LOCUS_12200 1549686 1550504 gene locus_tag LOCUS_12210 1549686 1550504 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459674.1 protein_id gnl|my_center|LOCUS_12210 1550501 1552825 gene locus_tag LOCUS_12220 1550501 1552825 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110899006.1 protein_id gnl|my_center|LOCUS_12220 1553147 1552899 gene locus_tag LOCUS_12230 1553147 1552899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1554376 1553144 gene locus_tag LOCUS_12240 gene gerKC 1554376 1553144 CDS product spore germination protein GerKC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246578.1 protein_id gnl|my_center|LOCUS_12240 1555472 1554357 gene locus_tag LOCUS_12250 1555472 1554357 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392526.1 protein_id gnl|my_center|LOCUS_12250 1557016 1555469 gene locus_tag LOCUS_12260 gene gerKA 1557016 1555469 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_12260 1558113 1557013 gene locus_tag LOCUS_12270 gene gerKB 1558113 1557013 CDS product spore germination protein GerKB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234509.1 protein_id gnl|my_center|LOCUS_12270 1558477 1558325 gene locus_tag LOCUS_12280 1558477 1558325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1559150 1558725 gene locus_tag LOCUS_12290 1559150 1558725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1561689 1559314 gene locus_tag LOCUS_12300 1561689 1559314 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224133.1 protein_id gnl|my_center|LOCUS_12300 1562409 1561738 gene locus_tag LOCUS_12310 1562409 1561738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1562623 1564287 gene locus_tag LOCUS_12320 1562623 1564287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1564300 1566072 gene locus_tag LOCUS_12330 1564300 1566072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1566514 1567431 gene locus_tag LOCUS_12340 1566514 1567431 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228683.1 protein_id gnl|my_center|LOCUS_12340 1567428 1568306 gene locus_tag LOCUS_12350 1567428 1568306 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582589.1 protein_id gnl|my_center|LOCUS_12350 1568417 1569877 gene locus_tag LOCUS_12360 1568417 1569877 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228682.1 protein_id gnl|my_center|LOCUS_12360 1569896 1571038 gene locus_tag LOCUS_12370 1569896 1571038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1571076 1573385 gene locus_tag LOCUS_12380 1571076 1573385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 1573598 1574569 gene locus_tag LOCUS_12390 1573598 1574569 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 protein_id gnl|my_center|LOCUS_12390 1574598 1575488 gene locus_tag LOCUS_12400 1574598 1575488 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_12400 1575576 1577312 gene locus_tag LOCUS_12410 1575576 1577312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_12410 1577409 1579304 gene locus_tag LOCUS_12420 1577409 1579304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1579304 1580884 gene locus_tag LOCUS_12430 1579304 1580884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1580974 1581348 gene locus_tag LOCUS_12440 1580974 1581348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1581596 1582510 gene locus_tag LOCUS_12450 1581596 1582510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1582583 1583350 gene locus_tag LOCUS_12460 1582583 1583350 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_12460 1583322 1584074 gene locus_tag LOCUS_12470 1583322 1584074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1584085 1585635 gene locus_tag LOCUS_12480 1584085 1585635 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 protein_id gnl|my_center|LOCUS_12480 1585562 1586248 gene locus_tag LOCUS_12490 1585562 1586248 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001993852.1 protein_id gnl|my_center|LOCUS_12490 1587410 1586283 gene locus_tag LOCUS_12500 gene rmgQ 1587410 1586283 CDS product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 protein_id gnl|my_center|LOCUS_12500 1587537 1588376 gene locus_tag LOCUS_12510 1587537 1588376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1588526 1589500 gene locus_tag LOCUS_12520 1588526 1589500 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963508.1 protein_id gnl|my_center|LOCUS_12520 1590906 1590013 gene locus_tag LOCUS_12530 gene cmrA 1590906 1590013 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_12530 1591135 1591986 gene locus_tag LOCUS_12540 1591135 1591986 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174448.1 protein_id gnl|my_center|LOCUS_12540 1592615 1592220 gene locus_tag LOCUS_12550 1592615 1592220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12550 1593301 1592891 gene locus_tag LOCUS_12560 1593301 1592891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1596304 1594031 gene locus_tag LOCUS_12570 1596304 1594031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1596540 1597520 gene locus_tag LOCUS_12580 1596540 1597520 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_12580 1597649 1598554 gene locus_tag LOCUS_12590 gene rmgP 1597649 1598554 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_12590 1598574 1599440 gene locus_tag LOCUS_12600 1598574 1599440 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_12600 1599491 1601065 gene locus_tag LOCUS_12610 1599491 1601065 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_12610 1601153 1606480 gene locus_tag LOCUS_12620 1601153 1606480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1606799 1607140 gene locus_tag LOCUS_12630 1606799 1607140 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419063.1 protein_id gnl|my_center|LOCUS_12630 1607137 1607979 gene locus_tag LOCUS_12640 1607137 1607979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1609215 1608265 gene locus_tag LOCUS_12650 1609215 1608265 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028064.1 protein_id gnl|my_center|LOCUS_12650 1609400 1610278 gene locus_tag LOCUS_12660 1609400 1610278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12660 1610297 1610665 gene locus_tag LOCUS_12670 1610297 1610665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 1610721 1611260 gene locus_tag LOCUS_12680 1610721 1611260 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512998.1 protein_id gnl|my_center|LOCUS_12680 1611353 1612225 gene locus_tag LOCUS_12690 1611353 1612225 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_12690 1612940 1612347 gene locus_tag LOCUS_12700 1612940 1612347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12700 1613244 1613065 gene locus_tag LOCUS_12710 1613244 1613065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1613840 1613220 gene locus_tag LOCUS_12720 1613840 1613220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12720 1613995 1613858 gene locus_tag LOCUS_12730 1613995 1613858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1614172 1614960 gene locus_tag LOCUS_12740 1614172 1614960 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_12740 1615236 1616216 gene locus_tag LOCUS_12750 1615236 1616216 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387131.1 protein_id gnl|my_center|LOCUS_12750 1616235 1616399 gene locus_tag LOCUS_12760 1616235 1616399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1616701 1617195 gene locus_tag LOCUS_12770 1616701 1617195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1617197 1617850 gene locus_tag LOCUS_12780 gene pspA 1617197 1617850 CDS product phage shock protein PspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388973.1 protein_id gnl|my_center|LOCUS_12780 1618056 1618898 gene locus_tag LOCUS_12790 1618056 1618898 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_12790 1618958 1620043 gene locus_tag LOCUS_12800 1618958 1620043 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027022.1 protein_id gnl|my_center|LOCUS_12800 1621344 1620097 gene locus_tag LOCUS_12810 1621344 1620097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1621683 1622771 gene locus_tag LOCUS_12820 1621683 1622771 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128021.1 protein_id gnl|my_center|LOCUS_12820 1623231 1622764 gene locus_tag LOCUS_12830 1623231 1622764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1624001 1623450 gene locus_tag LOCUS_12840 1624001 1623450 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_12840 1625618 1624131 gene locus_tag LOCUS_12850 1625618 1624131 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246604.1 protein_id gnl|my_center|LOCUS_12850 1625847 1626470 gene locus_tag LOCUS_12860 1625847 1626470 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 protein_id gnl|my_center|LOCUS_12860 1627471 1626464 gene locus_tag LOCUS_12870 1627471 1626464 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_12870 1628546 1627506 gene locus_tag LOCUS_12880 1628546 1627506 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027778.1 protein_id gnl|my_center|LOCUS_12880 1629774 1628962 gene locus_tag LOCUS_12890 1629774 1628962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1630600 1629845 gene locus_tag LOCUS_12900 1630600 1629845 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_12900 1631621 1630725 gene locus_tag LOCUS_12910 1631621 1630725 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 protein_id gnl|my_center|LOCUS_12910 1631778 1632623 gene locus_tag LOCUS_12920 1631778 1632623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1632634 1633635 gene locus_tag LOCUS_12930 1632634 1633635 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_12930 1633837 1634421 gene locus_tag LOCUS_12940 1633837 1634421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1634660 1635427 gene locus_tag LOCUS_12950 1634660 1635427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1635629 1635853 gene locus_tag LOCUS_12960 gene gerE 1635629 1635853 CDS product spore germination transcription factor GerE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003184172.1 protein_id gnl|my_center|LOCUS_12960 1636041 1637120 gene locus_tag LOCUS_12970 1636041 1637120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1637346 1639148 gene locus_tag LOCUS_12980 1637346 1639148 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285995.1 protein_id gnl|my_center|LOCUS_12980 1639435 1640022 gene locus_tag LOCUS_12990 1639435 1640022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1641421 1640072 gene locus_tag LOCUS_13000 1641421 1640072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1641570 1642916 gene locus_tag LOCUS_13010 1641570 1642916 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201572.1 protein_id gnl|my_center|LOCUS_13010 1643202 1642888 gene locus_tag LOCUS_13020 1643202 1642888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1643809 1643279 gene locus_tag LOCUS_13030 1643809 1643279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1644111 1643785 gene locus_tag LOCUS_13040 1644111 1643785 CDS product YtrH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948898.1 protein_id gnl|my_center|LOCUS_13040 1644212 1648021 gene locus_tag LOCUS_13050 1644212 1648021 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_13050 1648253 1648014 gene locus_tag LOCUS_13060 1648253 1648014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1648813 1649001 gene locus_tag LOCUS_13070 1648813 1649001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459626.1 protein_id gnl|my_center|LOCUS_13070 1649174 1650061 gene locus_tag LOCUS_13080 gene accD 1649174 1650061 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223544.1 protein_id gnl|my_center|LOCUS_13080 1650051 1651016 gene locus_tag LOCUS_13090 1650051 1651016 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 protein_id gnl|my_center|LOCUS_13090 1651176 1652930 gene locus_tag LOCUS_13100 gene pyk 1651176 1652930 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_13100 1653018 1653482 gene locus_tag LOCUS_13110 1653018 1653482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1653647 1654054 gene locus_tag LOCUS_13120 gene fxsA 1653647 1654054 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246085.1 protein_id gnl|my_center|LOCUS_13120 1654201 1656294 gene locus_tag LOCUS_13130 1654201 1656294 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913524.1 protein_id gnl|my_center|LOCUS_13130 1656376 1656537 gene locus_tag LOCUS_13140 1656376 1656537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1658149 1656614 gene locus_tag LOCUS_13150 1658149 1656614 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002198132.1 protein_id gnl|my_center|LOCUS_13150 1658334 1658645 gene locus_tag LOCUS_13160 1658334 1658645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1658962 1660074 gene locus_tag LOCUS_13170 gene citZ 1658962 1660074 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_13170 1660220 1661515 gene locus_tag LOCUS_13180 gene icd 1660220 1661515 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_13180 1661952 1662896 gene locus_tag LOCUS_13190 gene mdh 1661952 1662896 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153230.1 protein_id gnl|my_center|LOCUS_13190 1662996 1664120 gene locus_tag LOCUS_13200 gene pepQ 1662996 1664120 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994047.1 protein_id gnl|my_center|LOCUS_13200 1664134 1665366 gene locus_tag LOCUS_13210 1664134 1665366 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007344.1 protein_id gnl|my_center|LOCUS_13210 1665514 1665939 gene locus_tag LOCUS_13220 1665514 1665939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1666782 1666111 gene locus_tag LOCUS_13230 gene yfbR 1666782 1666111 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705878.1 protein_id gnl|my_center|LOCUS_13230 1666940 1668778 gene locus_tag LOCUS_13240 1666940 1668778 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_13240 1668842 1669624 gene locus_tag LOCUS_13250 1668842 1669624 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640997.1 protein_id gnl|my_center|LOCUS_13250 1669723 1671804 gene locus_tag LOCUS_13260 1669723 1671804 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399552.1 protein_id gnl|my_center|LOCUS_13260 1672056 1672454 gene locus_tag LOCUS_13270 1672056 1672454 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896119.1 protein_id gnl|my_center|LOCUS_13270 1672427 1673131 gene locus_tag LOCUS_13280 1672427 1673131 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082164.1 protein_id gnl|my_center|LOCUS_13280 1673286 1674236 gene locus_tag LOCUS_13290 gene trxB 1673286 1674236 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_13290 1674314 1674877 gene locus_tag LOCUS_13300 1674314 1674877 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143150.1 protein_id gnl|my_center|LOCUS_13300 1675046 1675792 gene locus_tag LOCUS_13310 gene nfsA 1675046 1675792 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004543.1 protein_id gnl|my_center|LOCUS_13310 1675916 1676554 gene locus_tag LOCUS_13320 1675916 1676554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1676688 1677239 gene locus_tag LOCUS_13330 gene ssuE 1676688 1677239 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771200.1 protein_id gnl|my_center|LOCUS_13330 1677462 1678433 gene locus_tag LOCUS_13340 1677462 1678433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1678795 1678490 gene locus_tag LOCUS_13350 1678795 1678490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1678955 1679374 gene locus_tag LOCUS_13360 1678955 1679374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1679571 1681193 gene locus_tag LOCUS_13370 gene ycnJ 1679571 1681193 CDS product copper transporter YcnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246637.1 protein_id gnl|my_center|LOCUS_13370 1681239 1682108 gene locus_tag LOCUS_13380 1681239 1682108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1682077 1682790 gene locus_tag LOCUS_13390 1682077 1682790 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_13390 1682968 1684764 gene locus_tag LOCUS_13400 1682968 1684764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1684757 1686313 gene locus_tag LOCUS_13410 1684757 1686313 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_13410 1686492 1687460 gene locus_tag LOCUS_13420 1686492 1687460 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_13420 1687475 1688380 gene locus_tag LOCUS_13430 1687475 1688380 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_13430 1688478 1690217 gene locus_tag LOCUS_13440 1688478 1690217 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_13440 1690355 1690972 gene locus_tag LOCUS_13450 1690355 1690972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1692003 1693757 gene locus_tag LOCUS_13460 gene thiC 1692003 1693757 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233473.1 protein_id gnl|my_center|LOCUS_13460 1693750 1694916 gene locus_tag LOCUS_13470 1693750 1694916 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922490.1 protein_id gnl|my_center|LOCUS_13470 1694913 1696001 gene locus_tag LOCUS_13480 1694913 1696001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1696005 1696820 gene locus_tag LOCUS_13490 gene thiG 1696005 1696820 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886483.1 protein_id gnl|my_center|LOCUS_13490 1696817 1697989 gene locus_tag LOCUS_13500 1696817 1697989 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122080.1 protein_id gnl|my_center|LOCUS_13500 1697986 1698858 gene locus_tag LOCUS_13510 gene thiD 1697986 1698858 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228119.1 protein_id gnl|my_center|LOCUS_13510 1698989 1700395 gene locus_tag LOCUS_13520 1698989 1700395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1700636 1701763 gene locus_tag LOCUS_13530 1700636 1701763 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111696510.1 protein_id gnl|my_center|LOCUS_13530 1701786 1702604 gene locus_tag LOCUS_13540 1701786 1702604 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898971.1 protein_id gnl|my_center|LOCUS_13540 1702683 1703876 gene locus_tag LOCUS_13550 1702683 1703876 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_13550 1703860 1704345 gene locus_tag LOCUS_13560 1703860 1704345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 1704445 1704669 gene locus_tag LOCUS_13570 1704445 1704669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1704790 1705824 gene locus_tag LOCUS_13580 gene pheS 1704790 1705824 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_13580 1705878 1708331 gene locus_tag LOCUS_13590 gene pheT 1705878 1708331 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498186.1 protein_id gnl|my_center|LOCUS_13590 1708434 1712666 gene locus_tag LOCUS_13600 1708434 1712666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1713136 1712765 gene locus_tag LOCUS_13610 1713136 1712765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1713369 1714373 gene locus_tag LOCUS_13620 1713369 1714373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989509.1 protein_id gnl|my_center|LOCUS_13620 1714566 1716104 gene locus_tag LOCUS_13630 1714566 1716104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1716517 1716161 gene locus_tag LOCUS_13640 1716517 1716161 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392117.1 protein_id gnl|my_center|LOCUS_13640 1716671 1719040 gene locus_tag LOCUS_13650 1716671 1719040 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_13650 1719058 1719489 gene locus_tag LOCUS_13660 1719058 1719489 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003237674.1 protein_id gnl|my_center|LOCUS_13660 1719603 1720172 gene locus_tag LOCUS_13670 1719603 1720172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1720183 1721103 gene locus_tag LOCUS_13680 gene cysK 1720183 1721103 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762272.1 protein_id gnl|my_center|LOCUS_13680 1721481 1721705 gene locus_tag LOCUS_13690 1721481 1721705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1721735 1722103 gene locus_tag LOCUS_13700 1721735 1722103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1722245 1722736 gene locus_tag LOCUS_13710 1722245 1722736 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_13710 1722778 1723989 gene locus_tag LOCUS_13720 1722778 1723989 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_13720 1724084 1724344 gene locus_tag LOCUS_13730 1724084 1724344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1724471 1725076 gene locus_tag LOCUS_13740 gene cobU 1724471 1725076 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_13740 1725094 1725726 gene locus_tag LOCUS_13750 1725094 1725726 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781294.1 protein_id gnl|my_center|LOCUS_13750 1725732 1726712 gene locus_tag LOCUS_13760 1725732 1726712 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_13760 1726746 1727111 gene locus_tag LOCUS_13770 1726746 1727111 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222779.1 protein_id gnl|my_center|LOCUS_13770 1727095 1728381 gene locus_tag LOCUS_13780 1727095 1728381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1728426 1729616 gene locus_tag LOCUS_13790 1728426 1729616 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_13790 1729715 1730713 gene locus_tag LOCUS_13800 1729715 1730713 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757056.1 protein_id gnl|my_center|LOCUS_13800 1731054 1730791 gene locus_tag LOCUS_13810 1731054 1730791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1731432 1731136 gene locus_tag LOCUS_13820 1731432 1731136 CDS product DUF3055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439025.1 protein_id gnl|my_center|LOCUS_13820 1732569 1731457 gene locus_tag LOCUS_13830 gene nosA 1732569 1731457 CDS product nitric oxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243309.1 protein_id gnl|my_center|LOCUS_13830 1732856 1733860 gene locus_tag LOCUS_13840 1732856 1733860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1733989 1735374 gene locus_tag LOCUS_13850 1733989 1735374 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233074.1 protein_id gnl|my_center|LOCUS_13850 1736396 1735461 gene locus_tag LOCUS_13860 gene corA 1736396 1735461 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965157.1 protein_id gnl|my_center|LOCUS_13860 1737019 1737936 gene locus_tag LOCUS_13870 gene metA 1737019 1737936 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_13870 1738047 1739213 gene locus_tag LOCUS_13880 1738047 1739213 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817365.1 protein_id gnl|my_center|LOCUS_13880 1739210 1740379 gene locus_tag LOCUS_13890 gene metC 1739210 1740379 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244787.1 protein_id gnl|my_center|LOCUS_13890 1740648 1742030 gene locus_tag LOCUS_13900 1740648 1742030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 1742143 1743279 gene locus_tag LOCUS_13910 gene mqnC 1742143 1743279 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_13910 1743684 1744565 gene locus_tag LOCUS_13920 1743684 1744565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1745042 1746982 gene locus_tag LOCUS_13930 gene thrS 1745042 1746982 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786083.1 protein_id gnl|my_center|LOCUS_13930 1747052 1747585 gene locus_tag LOCUS_13940 1747052 1747585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1747669 1748205 gene locus_tag LOCUS_13950 1747669 1748205 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_13950 1748340 1749785 gene locus_tag LOCUS_13960 1748340 1749785 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393525.1 protein_id gnl|my_center|LOCUS_13960 1749881 1750222 gene locus_tag LOCUS_13970 1749881 1750222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1751845 1750307 gene locus_tag LOCUS_13980 1751845 1750307 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_13980 1751974 1752849 gene locus_tag LOCUS_13990 1751974 1752849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1752871 1754661 gene locus_tag LOCUS_14000 gene yesM 1752871 1754661 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_14000 1754665 1756272 gene locus_tag LOCUS_14010 1754665 1756272 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_14010 1756398 1757984 gene locus_tag LOCUS_14020 1756398 1757984 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_14020 1758106 1759068 gene locus_tag LOCUS_14030 1758106 1759068 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_14030 1759084 1759977 gene locus_tag LOCUS_14040 1759084 1759977 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_14040 1760019 1762052 gene locus_tag LOCUS_14050 1760019 1762052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1762049 1763809 gene locus_tag LOCUS_14060 1762049 1763809 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_14060 1765242 1763965 gene locus_tag LOCUS_14070 1765242 1763965 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_14070 1765497 1766675 gene locus_tag LOCUS_14080 1765497 1766675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1766682 1767722 gene locus_tag LOCUS_14090 gene liaS 1766682 1767722 CDS product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 protein_id gnl|my_center|LOCUS_14090 1767729 1768406 gene locus_tag LOCUS_14100 1767729 1768406 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 protein_id gnl|my_center|LOCUS_14100 1768660 1769073 gene locus_tag LOCUS_14110 1768660 1769073 CDS product YugN-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612334.1 protein_id gnl|my_center|LOCUS_14110 1769292 1771004 gene locus_tag LOCUS_14120 1769292 1771004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1771075 1771761 gene locus_tag LOCUS_14130 1771075 1771761 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_14130 1771765 1773297 gene locus_tag LOCUS_14140 1771765 1773297 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_14140 1773328 1774278 gene locus_tag LOCUS_14150 gene ispH 1773328 1774278 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706669.1 protein_id gnl|my_center|LOCUS_14150 1774326 1774832 gene locus_tag LOCUS_14160 1774326 1774832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1774980 1776041 gene locus_tag LOCUS_14170 gene aroF 1774980 1776041 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_14170 1784977 1776971 gene locus_tag LOCUS_14180 1784977 1776971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1785640 1784981 gene locus_tag LOCUS_14190 1785640 1784981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1787023 1785875 gene locus_tag LOCUS_14200 1787023 1785875 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 protein_id gnl|my_center|LOCUS_14200 1787171 1788193 gene locus_tag LOCUS_14210 1787171 1788193 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244349.1 protein_id gnl|my_center|LOCUS_14210 1788514 1789938 gene locus_tag LOCUS_14220 gene glnA 1788514 1789938 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057427.1 protein_id gnl|my_center|LOCUS_14220 1790626 1789991 gene locus_tag LOCUS_14230 gene thpR 1790626 1789991 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418986.1 protein_id gnl|my_center|LOCUS_14230 1790753 1791841 gene locus_tag LOCUS_14240 gene serC 1790753 1791841 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_14240 1791968 1792435 gene locus_tag LOCUS_14250 gene trmL 1791968 1792435 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538147.1 protein_id gnl|my_center|LOCUS_14250 1792595 1792837 gene locus_tag LOCUS_14260 1792595 1792837 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047831.1 protein_id gnl|my_center|LOCUS_14260 1793145 1793026 gene locus_tag LOCUS_14270 1793145 1793026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1793282 1794403 gene locus_tag LOCUS_14280 1793282 1794403 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028898.1 protein_id gnl|my_center|LOCUS_14280 1794715 1794407 gene locus_tag LOCUS_14290 1794715 1794407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1795707 1794712 gene locus_tag LOCUS_14300 1795707 1794712 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967136.1 protein_id gnl|my_center|LOCUS_14300 1795877 1797772 gene locus_tag LOCUS_14310 1795877 1797772 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353273.1 protein_id gnl|my_center|LOCUS_14310 1798068 1799984 gene locus_tag LOCUS_14320 1798068 1799984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533061.1 protein_id gnl|my_center|LOCUS_14320 1800005 1801291 gene locus_tag LOCUS_14330 1800005 1801291 CDS product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064440.1 protein_id gnl|my_center|LOCUS_14330 1801296 1802717 gene locus_tag LOCUS_14340 1801296 1802717 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975268.1 protein_id gnl|my_center|LOCUS_14340 1802805 1803668 gene locus_tag LOCUS_14350 1802805 1803668 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969407.1 protein_id gnl|my_center|LOCUS_14350 1803685 1804749 gene locus_tag LOCUS_14360 1803685 1804749 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533060.1 protein_id gnl|my_center|LOCUS_14360 1805316 1805969 gene locus_tag LOCUS_14370 1805316 1805969 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243016.1 protein_id gnl|my_center|LOCUS_14370 1806017 1807345 gene locus_tag LOCUS_14380 1806017 1807345 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_14380 1807423 1808769 gene locus_tag LOCUS_14390 1807423 1808769 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943751.1 protein_id gnl|my_center|LOCUS_14390 1809741 1808845 gene locus_tag LOCUS_14400 1809741 1808845 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479707.1 protein_id gnl|my_center|LOCUS_14400 1810014 1810940 gene locus_tag LOCUS_14410 1810014 1810940 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_14410 1811656 1810931 gene locus_tag LOCUS_14420 1811656 1810931 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222616.1 protein_id gnl|my_center|LOCUS_14420 1813566 1811662 gene locus_tag LOCUS_14430 1813566 1811662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1813462 1813833 gene locus_tag LOCUS_14440 1813462 1813833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1813757 1815115 gene locus_tag LOCUS_14450 1813757 1815115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1815204 1816076 gene locus_tag LOCUS_14460 1815204 1816076 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_14460 1816073 1816894 gene locus_tag LOCUS_14470 1816073 1816894 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115716.1 protein_id gnl|my_center|LOCUS_14470 1816923 1818272 gene locus_tag LOCUS_14480 1816923 1818272 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 protein_id gnl|my_center|LOCUS_14480 1818302 1819375 gene locus_tag LOCUS_14490 1818302 1819375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1819398 1821809 gene locus_tag LOCUS_14500 1819398 1821809 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_14500 1823258 1821858 gene locus_tag LOCUS_14510 gene spoVR 1823258 1821858 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202710.1 protein_id gnl|my_center|LOCUS_14510 1823601 1823849 gene locus_tag LOCUS_14520 1823601 1823849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1823767 1824222 gene locus_tag LOCUS_14530 1823767 1824222 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614818.1 protein_id gnl|my_center|LOCUS_14530 1824337 1824936 gene locus_tag LOCUS_14540 1824337 1824936 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121595.1 protein_id gnl|my_center|LOCUS_14540 1824965 1825546 gene locus_tag LOCUS_14550 1824965 1825546 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146731.1 protein_id gnl|my_center|LOCUS_14550 1825566 1826141 gene locus_tag LOCUS_14560 1825566 1826141 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003241242.1 protein_id gnl|my_center|LOCUS_14560 1826218 1827507 gene locus_tag LOCUS_14570 1826218 1827507 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103358.1 protein_id gnl|my_center|LOCUS_14570 1827532 1828323 gene locus_tag LOCUS_14580 1827532 1828323 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025696.1 protein_id gnl|my_center|LOCUS_14580 1828426 1829631 gene locus_tag LOCUS_14590 1828426 1829631 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_14590 1829699 1830952 gene locus_tag LOCUS_14600 1829699 1830952 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454526.1 protein_id gnl|my_center|LOCUS_14600 1830945 1832087 gene locus_tag LOCUS_14610 1830945 1832087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 1832084 1832908 gene locus_tag LOCUS_14620 1832084 1832908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028306.1 protein_id gnl|my_center|LOCUS_14620 1832928 1833941 gene locus_tag LOCUS_14630 1832928 1833941 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031094.1 protein_id gnl|my_center|LOCUS_14630 1833999 1834727 gene locus_tag LOCUS_14640 1833999 1834727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1834746 1835861 gene locus_tag LOCUS_14650 1834746 1835861 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137402.1 protein_id gnl|my_center|LOCUS_14650 1836948 1836166 gene locus_tag LOCUS_14660 1836948 1836166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1837480 1836935 gene locus_tag LOCUS_14670 1837480 1836935 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438330.1 protein_id gnl|my_center|LOCUS_14670 1837626 1838858 gene locus_tag LOCUS_14680 1837626 1838858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1838991 1841375 gene locus_tag LOCUS_14690 gene helD 1838991 1841375 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035473.1 protein_id gnl|my_center|LOCUS_14690 1841602 1843449 gene locus_tag LOCUS_14700 gene recQ 1841602 1843449 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948677.1 protein_id gnl|my_center|LOCUS_14700 1843622 1844269 gene locus_tag LOCUS_14710 1843622 1844269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 1844986 1844549 gene locus_tag LOCUS_14720 1844986 1844549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14720 1845722 1844991 gene locus_tag LOCUS_14730 1845722 1844991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14730 1845908 1847359 gene locus_tag LOCUS_14740 1845908 1847359 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048527824.1 protein_id gnl|my_center|LOCUS_14740 1847379 1848485 gene locus_tag LOCUS_14750 gene gerLB 1847379 1848485 CDS product spore germination protein GerLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802005.1 protein_id gnl|my_center|LOCUS_14750 1848478 1849668 gene locus_tag LOCUS_14760 gene gerLC 1848478 1849668 CDS product spore germination protein GerLC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139362486.1 protein_id gnl|my_center|LOCUS_14760 1849691 1849813 gene locus_tag LOCUS_14770 1849691 1849813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 1849887 1850714 gene locus_tag LOCUS_14780 1849887 1850714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1850753 1851520 gene locus_tag LOCUS_14790 1850753 1851520 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_14790 1851587 1852078 gene locus_tag LOCUS_14800 1851587 1852078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1852075 1852560 gene locus_tag LOCUS_14810 1852075 1852560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1852630 1854081 gene locus_tag LOCUS_14820 1852630 1854081 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802296.1 protein_id gnl|my_center|LOCUS_14820 1854094 1855182 gene locus_tag LOCUS_14830 1854094 1855182 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815826.1 protein_id gnl|my_center|LOCUS_14830 1855185 1856309 gene locus_tag LOCUS_14840 1855185 1856309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 1856415 1857704 gene locus_tag LOCUS_14850 1856415 1857704 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_14850 1857933 1859042 gene locus_tag LOCUS_14860 gene aguA 1857933 1859042 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104504.1 protein_id gnl|my_center|LOCUS_14860 1859185 1860225 gene locus_tag LOCUS_14870 1859185 1860225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1860229 1861227 gene locus_tag LOCUS_14880 1860229 1861227 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_14880 1861341 1862732 gene locus_tag LOCUS_14890 1861341 1862732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1868155 1862855 gene locus_tag LOCUS_14900 1868155 1862855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1868592 1871774 gene locus_tag LOCUS_14910 1868592 1871774 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_14910 1871807 1874017 gene locus_tag LOCUS_14920 1871807 1874017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1874405 1874548 gene locus_tag LOCUS_14930 1874405 1874548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1874545 1876134 gene locus_tag LOCUS_14940 1874545 1876134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1876212 1877120 gene locus_tag LOCUS_14950 1876212 1877120 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_14950 1877133 1877999 gene locus_tag LOCUS_14960 1877133 1877999 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_14960 1878141 1879100 gene locus_tag LOCUS_14970 1878141 1879100 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944018.1 protein_id gnl|my_center|LOCUS_14970 1879142 1881172 gene locus_tag LOCUS_14980 1879142 1881172 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836949.1 protein_id gnl|my_center|LOCUS_14980 1882871 1881237 gene locus_tag LOCUS_14990 1882871 1881237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 1883066 1883203 gene locus_tag LOCUS_15000 1883066 1883203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1883395 1883216 gene locus_tag LOCUS_15010 1883395 1883216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1884621 1883476 gene locus_tag LOCUS_15020 gene yhbH 1884621 1883476 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233432.1 protein_id gnl|my_center|LOCUS_15020 1884821 1885150 gene locus_tag LOCUS_15030 1884821 1885150 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_15030 1885164 1886837 gene locus_tag LOCUS_15040 1885164 1886837 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_15040 1887793 1886948 gene locus_tag LOCUS_15050 1887793 1886948 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_15050 1888711 1887806 gene locus_tag LOCUS_15060 1888711 1887806 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_15060 1890188 1888794 gene locus_tag LOCUS_15070 1890188 1888794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1891600 1890317 gene locus_tag LOCUS_15080 1891600 1890317 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_15080 1892627 1891641 gene locus_tag LOCUS_15090 1892627 1891641 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242341.1 protein_id gnl|my_center|LOCUS_15090 1894417 1892630 gene locus_tag LOCUS_15100 1894417 1892630 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_15100 1896042 1894324 gene locus_tag LOCUS_15110 1896042 1894324 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_15110 1896303 1898948 gene locus_tag LOCUS_15120 1896303 1898948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1899368 1899760 gene locus_tag LOCUS_15130 1899368 1899760 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_15130 1899904 1901730 gene locus_tag LOCUS_15140 1899904 1901730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1902184 1901762 gene locus_tag LOCUS_15150 1902184 1901762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1902372 1902698 gene locus_tag LOCUS_15160 1902372 1902698 CDS product YunC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242587.1 protein_id gnl|my_center|LOCUS_15160 1903839 1902760 gene locus_tag LOCUS_15170 gene mtnA 1903839 1902760 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392493.1 protein_id gnl|my_center|LOCUS_15170 1905090 1903876 gene locus_tag LOCUS_15180 gene mtnK 1905090 1903876 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244973.1 protein_id gnl|my_center|LOCUS_15180 1905318 1906754 gene locus_tag LOCUS_15190 1905318 1906754 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_15190 1906751 1908118 gene locus_tag LOCUS_15200 1906751 1908118 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922487.1 protein_id gnl|my_center|LOCUS_15200 1908378 1908953 gene locus_tag LOCUS_15210 1908378 1908953 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_15210 1909147 1909926 gene locus_tag LOCUS_15220 gene sufC 1909147 1909926 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_15220 1909951 1911249 gene locus_tag LOCUS_15230 gene sufD 1909951 1911249 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438995.1 protein_id gnl|my_center|LOCUS_15230 1911250 1912467 gene locus_tag LOCUS_15240 gene sufS 1911250 1912467 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228604.1 protein_id gnl|my_center|LOCUS_15240 1912464 1912919 gene locus_tag LOCUS_15250 1912464 1912919 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831954.1 protein_id gnl|my_center|LOCUS_15250 1912970 1914367 gene locus_tag LOCUS_15260 gene sufB 1912970 1914367 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 protein_id gnl|my_center|LOCUS_15260 1914896 1915621 gene locus_tag LOCUS_15270 1914896 1915621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1915753 1916724 gene locus_tag LOCUS_15280 1915753 1916724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1917830 1916784 gene locus_tag LOCUS_15290 1917830 1916784 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_15290 1919028 1917946 gene locus_tag LOCUS_15300 1919028 1917946 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922490.1 protein_id gnl|my_center|LOCUS_15300 1919777 1919025 gene locus_tag LOCUS_15310 1919777 1919025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1919918 1920922 gene locus_tag LOCUS_15320 gene moaA 1919918 1920922 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722673.1 protein_id gnl|my_center|LOCUS_15320 1920937 1922379 gene locus_tag LOCUS_15330 1920937 1922379 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139019776.1 protein_id gnl|my_center|LOCUS_15330 1922624 1923724 gene locus_tag LOCUS_15340 1922624 1923724 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_15340 1923835 1924989 gene locus_tag LOCUS_15350 gene yfkAB 1923835 1924989 CDS product radical SAM/CxCxxxxC motif protein YfkAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233655.1 protein_id gnl|my_center|LOCUS_15350 1925065 1926417 gene locus_tag LOCUS_15360 1925065 1926417 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000353728.1 protein_id gnl|my_center|LOCUS_15360 1926473 1927510 gene locus_tag LOCUS_15370 gene ytvI 1926473 1927510 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944296.1 protein_id gnl|my_center|LOCUS_15370 1927676 1927897 gene locus_tag LOCUS_15380 1927676 1927897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1927897 1928223 gene locus_tag LOCUS_15390 gene cotJB 1927897 1928223 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_15390 1928239 1928808 gene locus_tag LOCUS_15400 gene cotJC 1928239 1928808 CDS product spore coat protein CotJC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233850.1 protein_id gnl|my_center|LOCUS_15400 1929462 1929070 gene locus_tag LOCUS_15410 1929462 1929070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1929441 1929746 gene locus_tag LOCUS_15420 1929441 1929746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1930413 1930225 gene locus_tag LOCUS_15430 1930413 1930225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1930572 1930724 gene locus_tag LOCUS_15440 1930572 1930724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1930799 1931479 gene locus_tag LOCUS_15450 1930799 1931479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1933072 1931714 gene locus_tag LOCUS_15460 gene spaC 1933072 1931714 CDS product spore coat associated protein SpaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245845.1 protein_id gnl|my_center|LOCUS_15460 1934309 1933131 gene locus_tag LOCUS_15470 1934309 1933131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1935682 1934309 gene locus_tag LOCUS_15480 gene yheD 1935682 1934309 CDS product spore coat associated protein YheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245015.1 protein_id gnl|my_center|LOCUS_15480 1936907 1935591 gene locus_tag LOCUS_15490 1936907 1935591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1938249 1936882 gene locus_tag LOCUS_15500 1938249 1936882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1939251 1938706 gene locus_tag LOCUS_15510 1939251 1938706 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287163.1 protein_id gnl|my_center|LOCUS_15510 1939421 1940503 gene locus_tag LOCUS_15520 gene gerM 1939421 1940503 CDS product spore germination protein GerM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126760.1 protein_id gnl|my_center|LOCUS_15520 1941635 1940538 gene locus_tag LOCUS_15530 1941635 1940538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1942786 1941632 gene locus_tag LOCUS_15540 1942786 1941632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1944137 1942812 gene locus_tag LOCUS_15550 1944137 1942812 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_15550 1944323 1945069 gene locus_tag LOCUS_15560 1944323 1945069 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261764.1 protein_id gnl|my_center|LOCUS_15560 1945066 1945728 gene locus_tag LOCUS_15570 1945066 1945728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1948004 1946151 gene locus_tag LOCUS_15580 gene asnB 1948004 1946151 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_15580 1948154 1948504 gene locus_tag LOCUS_15590 1948154 1948504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1948541 1948675 gene locus_tag LOCUS_15600 1948541 1948675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1948769 1949713 gene locus_tag LOCUS_15610 1948769 1949713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1950147 1949719 gene locus_tag LOCUS_15620 1950147 1949719 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209647.1 protein_id gnl|my_center|LOCUS_15620 1950276 1950866 gene locus_tag LOCUS_15630 1950276 1950866 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129492.1 protein_id gnl|my_center|LOCUS_15630 1951035 1951187 gene locus_tag LOCUS_15640 1951035 1951187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1952360 1951377 gene locus_tag LOCUS_15650 1952360 1951377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1952989 1952357 gene locus_tag LOCUS_15660 gene gmhA 1952989 1952357 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_15660 1954005 1953100 gene locus_tag LOCUS_15670 1954005 1953100 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804145.1 protein_id gnl|my_center|LOCUS_15670 1954079 1954348 gene locus_tag LOCUS_15680 1954079 1954348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1954512 1954436 gene locus_tag LOCUS_t00170 1954512 1954436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1955152 1954562 gene locus_tag LOCUS_15690 1955152 1954562 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619543.1 protein_id gnl|my_center|LOCUS_15690 1955309 1955236 gene locus_tag LOCUS_t00180 1955309 1955236 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1955449 1956363 gene locus_tag LOCUS_15700 1955449 1956363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1956474 1957763 gene locus_tag LOCUS_15710 gene tig 1956474 1957763 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_15710 1957963 1958553 gene locus_tag LOCUS_15720 gene clpP 1957963 1958553 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_15720 1958565 1959821 gene locus_tag LOCUS_15730 gene clpX 1958565 1959821 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472282.1 protein_id gnl|my_center|LOCUS_15730 1959915 1961054 gene locus_tag LOCUS_15740 gene ispG 1959915 1961054 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_15740 1961248 1961622 gene locus_tag LOCUS_15750 1961248 1961622 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966950.1 protein_id gnl|my_center|LOCUS_15750 1961748 1963535 gene locus_tag LOCUS_15760 gene lonB 1961748 1963535 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816883.1 protein_id gnl|my_center|LOCUS_15760 1963708 1966131 gene locus_tag LOCUS_15770 gene lon 1963708 1966131 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_15770 1966151 1966795 gene locus_tag LOCUS_15780 gene yihA 1966151 1966795 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_15780 1966949 1967539 gene locus_tag LOCUS_15790 1966949 1967539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1967829 1968227 gene locus_tag LOCUS_15800 gene speH1 1967829 1968227 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456824.1 protein_id gnl|my_center|LOCUS_15800 1968510 1969916 gene locus_tag LOCUS_15810 gene hemA 1968510 1969916 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399038.1 protein_id gnl|my_center|LOCUS_15810 1969966 1970787 gene locus_tag LOCUS_15820 1969966 1970787 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222575.1 protein_id gnl|my_center|LOCUS_15820 1970803 1971453 gene locus_tag LOCUS_15830 1970803 1971453 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943893.1 protein_id gnl|my_center|LOCUS_15830 1971595 1972533 gene locus_tag LOCUS_15840 gene hemC 1971595 1972533 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886587.1 protein_id gnl|my_center|LOCUS_15840 1972536 1974086 gene locus_tag LOCUS_15850 gene cobA 1972536 1974086 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_15850 1974106 1975095 gene locus_tag LOCUS_15860 gene hemB 1974106 1975095 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087062.1 protein_id gnl|my_center|LOCUS_15860 1975126 1975769 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagcggcaaaaagtgccgctaatgtgc 1976477 1975815 gene locus_tag LOCUS_15870 1976477 1975815 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546542.1 protein_id gnl|my_center|LOCUS_15870 1976558 1977859 gene locus_tag LOCUS_15880 gene hemL 1976558 1977859 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_15880 1978027 1979703 gene locus_tag LOCUS_15890 1978027 1979703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1980260 1979877 gene locus_tag LOCUS_15900 1980260 1979877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1980250 1982901 gene locus_tag LOCUS_15910 gene valS 1980250 1982901 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072238.1 protein_id gnl|my_center|LOCUS_15910 1982901 1984355 gene locus_tag LOCUS_15920 1982901 1984355 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723235.1 protein_id gnl|my_center|LOCUS_15920 1984411 1985751 gene locus_tag LOCUS_15930 gene murC 1984411 1985751 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_15930 1986248 1986069 gene locus_tag LOCUS_15940 1986248 1986069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1986668 1986363 gene locus_tag LOCUS_15950 1986668 1986363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1986885 1987775 gene locus_tag LOCUS_15960 1986885 1987775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1987964 1988227 gene locus_tag LOCUS_15970 1987964 1988227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1988277 1988888 gene locus_tag LOCUS_15980 1988277 1988888 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_15980 1989022 1989711 gene locus_tag LOCUS_15990 gene radC 1989022 1989711 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013390.1 protein_id gnl|my_center|LOCUS_15990 1989751 1990776 gene locus_tag LOCUS_16000 gene mreB 1989751 1990776 CDS product cell shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466737.1 protein_id gnl|my_center|LOCUS_16000 1990816 1991688 gene locus_tag LOCUS_16010 gene mreC 1990816 1991688 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_16010 1991685 1992221 gene locus_tag LOCUS_16020 1991685 1992221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1992307 1992969 gene locus_tag LOCUS_16030 gene minC 1992307 1992969 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391521.1 protein_id gnl|my_center|LOCUS_16030 1992974 1993768 gene locus_tag LOCUS_16040 gene minD 1992974 1993768 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398624.1 protein_id gnl|my_center|LOCUS_16040 1993775 1994923 gene locus_tag LOCUS_16050 gene rodA 1993775 1994923 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048028.1 protein_id gnl|my_center|LOCUS_16050 1994931 1995110 gene locus_tag LOCUS_16060 1994931 1995110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1995065 1996258 gene locus_tag LOCUS_16070 1995065 1996258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1996251 1997126 gene locus_tag LOCUS_16080 gene spoIVFB 1996251 1997126 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398649.1 protein_id gnl|my_center|LOCUS_16080 1997208 1998443 gene locus_tag LOCUS_16090 1997208 1998443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1998617 1998928 gene locus_tag LOCUS_16100 gene rplU 1998617 1998928 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_16100 1998939 1999256 gene locus_tag LOCUS_16110 1998939 1999256 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181870.1 protein_id gnl|my_center|LOCUS_16110 1999282 1999590 gene locus_tag LOCUS_16120 gene rpmA 1999282 1999590 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_16120 1999711 2000487 gene locus_tag LOCUS_16130 1999711 2000487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2000540 2001883 gene locus_tag LOCUS_16140 gene obgE 2000540 2001883 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_16140 2002053 2002490 gene locus_tag LOCUS_16150 2002053 2002490 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_16150 2002553 2003839 gene locus_tag LOCUS_16160 2002553 2003839 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228694.1 protein_id gnl|my_center|LOCUS_16160 2003885 2004895 gene locus_tag LOCUS_16170 gene thrB 2003885 2004895 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889016.1 protein_id gnl|my_center|LOCUS_16170 2004892 2005788 gene locus_tag LOCUS_16180 gene pheA 2004892 2005788 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621730.1 protein_id gnl|my_center|LOCUS_16180 2005813 2006694 gene locus_tag LOCUS_16190 gene ilvE 2005813 2006694 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005486.1 protein_id gnl|my_center|LOCUS_16190 2006720 2006848 gene locus_tag LOCUS_16200 2006720 2006848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2006928 2007800 gene locus_tag LOCUS_16210 2006928 2007800 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_16210 2007813 2008004 gene locus_tag LOCUS_16220 2007813 2008004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943033.1 protein_id gnl|my_center|LOCUS_16220 2008182 2010344 gene locus_tag LOCUS_16230 2008182 2010344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2010411 2011118 gene locus_tag LOCUS_16240 2010411 2011118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2011279 2011782 gene locus_tag LOCUS_16250 gene ruvC 2011279 2011782 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_16250 2011779 2012396 gene locus_tag LOCUS_16260 gene ruvA 2011779 2012396 CDS product Holliday junction DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464511.1 protein_id gnl|my_center|LOCUS_16260 2012420 2013427 gene locus_tag LOCUS_16270 gene ruvB 2012420 2013427 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_16270 2013424 2013888 gene locus_tag LOCUS_16280 2013424 2013888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2013885 2015993 gene locus_tag LOCUS_16290 2013885 2015993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 2015990 2017039 gene locus_tag LOCUS_16300 gene queA 2015990 2017039 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355747.1 protein_id gnl|my_center|LOCUS_16300 2017082 2018218 gene locus_tag LOCUS_16310 gene tgt 2017082 2018218 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125365.1 protein_id gnl|my_center|LOCUS_16310 2018248 2018562 gene locus_tag LOCUS_16320 gene yajC 2018248 2018562 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_16320 2020033 2019161 gene locus_tag LOCUS_16330 2020033 2019161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 2020529 2020122 gene locus_tag LOCUS_16340 2020529 2020122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2020703 2021389 gene locus_tag LOCUS_16350 2020703 2021389 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398801.1 protein_id gnl|my_center|LOCUS_16350 2022997 2021399 gene locus_tag LOCUS_16360 gene spoVB 2022997 2021399 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198301.1 protein_id gnl|my_center|LOCUS_16360 2023215 2023484 gene locus_tag LOCUS_16370 2023215 2023484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2023652 2024902 gene locus_tag LOCUS_16380 2023652 2024902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16380 2024892 2025800 gene locus_tag LOCUS_16390 2024892 2025800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16390 2025832 2026761 gene locus_tag LOCUS_16400 2025832 2026761 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_16400 2026829 2029255 gene locus_tag LOCUS_16410 gene recJ 2026829 2029255 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246110.1 protein_id gnl|my_center|LOCUS_16410 2029294 2029806 gene locus_tag LOCUS_16420 2029294 2029806 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229745.1 protein_id gnl|my_center|LOCUS_16420 2030016 2030699 gene locus_tag LOCUS_16430 2030016 2030699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807742.1 protein_id gnl|my_center|LOCUS_16430 2030696 2032273 gene locus_tag LOCUS_16440 2030696 2032273 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807737.1 protein_id gnl|my_center|LOCUS_16440 2032612 2034324 gene locus_tag LOCUS_16450 2032612 2034324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2034326 2035030 gene locus_tag LOCUS_16460 2034326 2035030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_16460 2035027 2036193 gene locus_tag LOCUS_16470 2035027 2036193 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_16470 2036229 2036909 gene locus_tag LOCUS_16480 2036229 2036909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_16480 2036906 2038348 gene locus_tag LOCUS_16490 2036906 2038348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2038466 2040664 gene locus_tag LOCUS_16500 gene relA 2038466 2040664 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_16500 2040741 2041184 gene locus_tag LOCUS_16510 gene dtd 2040741 2041184 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_16510 2041334 2041477 gene locus_tag LOCUS_16520 2041334 2041477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2042745 2041696 gene locus_tag LOCUS_16530 2042745 2041696 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078275.1 protein_id gnl|my_center|LOCUS_16530 2043317 2044597 gene locus_tag LOCUS_16540 gene hisS 2043317 2044597 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027084.1 protein_id gnl|my_center|LOCUS_16540 2044594 2046447 gene locus_tag LOCUS_16550 gene aspS 2044594 2046447 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229758.1 protein_id gnl|my_center|LOCUS_16550 2046480 2047238 gene locus_tag LOCUS_16560 2046480 2047238 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903177.1 protein_id gnl|my_center|LOCUS_16560 2047856 2047503 gene locus_tag LOCUS_16570 2047856 2047503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2047783 2048016 gene locus_tag LOCUS_16580 2047783 2048016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2048240 2049283 gene locus_tag LOCUS_16590 gene cotH 2048240 2049283 CDS product spore coat protein CotH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003159093.1 protein_id gnl|my_center|LOCUS_16590 2049385 2050701 gene locus_tag LOCUS_16600 2049385 2050701 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_16600 2050934 2052325 gene locus_tag LOCUS_16610 2050934 2052325 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964731.1 protein_id gnl|my_center|LOCUS_16610 2052566 2052357 gene locus_tag LOCUS_16620 2052566 2052357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2053719 2052559 gene locus_tag LOCUS_16630 2053719 2052559 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 protein_id gnl|my_center|LOCUS_16630 2055056 2053716 gene locus_tag LOCUS_16640 2055056 2053716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2055170 2055547 gene locus_tag LOCUS_16650 2055170 2055547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 2055577 2056656 gene locus_tag LOCUS_16660 gene tbcS 2055577 2056656 CDS product tetraprenyl-beta-curcumene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399076.1 protein_id gnl|my_center|LOCUS_16660 2056731 2057645 gene locus_tag LOCUS_16670 gene pfkA 2056731 2057645 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_16670 2058955 2057741 gene locus_tag LOCUS_16680 2058955 2057741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2059472 2061127 gene locus_tag LOCUS_16690 gene cshA 2059472 2061127 CDS product ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246685.1 protein_id gnl|my_center|LOCUS_16690 2061209 2061967 gene locus_tag LOCUS_16700 2061209 2061967 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886435.1 protein_id gnl|my_center|LOCUS_16700 2062314 2062697 gene locus_tag LOCUS_16710 2062314 2062697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2063309 2062791 gene locus_tag LOCUS_16720 gene tpx 2063309 2062791 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223506.1 protein_id gnl|my_center|LOCUS_16720 2063417 2064019 gene locus_tag LOCUS_16730 2063417 2064019 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246687.1 protein_id gnl|my_center|LOCUS_16730 2064043 2064945 gene locus_tag LOCUS_16740 gene gltC 2064043 2064945 CDS product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 protein_id gnl|my_center|LOCUS_16740 2065705 2065025 gene locus_tag LOCUS_16750 2065705 2065025 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228889.1 protein_id gnl|my_center|LOCUS_16750 2066214 2065756 gene locus_tag LOCUS_16760 2066214 2065756 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285639.1 protein_id gnl|my_center|LOCUS_16760 2066613 2067992 gene locus_tag LOCUS_16770 2066613 2067992 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256890.1 protein_id gnl|my_center|LOCUS_16770 2068046 2069128 gene locus_tag LOCUS_16780 2068046 2069128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2069134 2069871 gene locus_tag LOCUS_16790 2069134 2069871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2070170 2069868 gene locus_tag LOCUS_16800 2070170 2069868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2070434 2071024 gene locus_tag LOCUS_16810 2070434 2071024 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719879.1 protein_id gnl|my_center|LOCUS_16810 2072872 2071259 gene locus_tag LOCUS_16820 gene cimA 2072872 2071259 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_16820 2073062 2074345 gene locus_tag LOCUS_16830 2073062 2074345 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_16830 2074490 2074726 gene locus_tag LOCUS_16840 2074490 2074726 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151997.1 protein_id gnl|my_center|LOCUS_16840 2074894 2076774 gene locus_tag LOCUS_16850 2074894 2076774 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_16850 2076866 2078443 gene locus_tag LOCUS_16860 2076866 2078443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2078594 2080138 gene locus_tag LOCUS_16870 2078594 2080138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2080291 2080148 gene locus_tag LOCUS_16880 2080291 2080148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2080489 2081583 gene locus_tag LOCUS_16890 2080489 2081583 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887146.1 protein_id gnl|my_center|LOCUS_16890 2081659 2082462 gene locus_tag LOCUS_16900 2081659 2082462 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417310.1 protein_id gnl|my_center|LOCUS_16900 2082668 2084299 gene locus_tag LOCUS_16910 gene rsmF 2082668 2084299 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_16910 2084343 2085242 gene locus_tag LOCUS_16920 2084343 2085242 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_16920 2085239 2086048 gene locus_tag LOCUS_16930 gene yidA 2085239 2086048 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723485.1 protein_id gnl|my_center|LOCUS_16930 2087767 2086385 gene locus_tag LOCUS_16940 gene rsmF 2087767 2086385 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_16940 2088945 2087782 gene locus_tag LOCUS_16950 2088945 2087782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2089102 2090244 gene locus_tag LOCUS_16960 2089102 2090244 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582960.1 protein_id gnl|my_center|LOCUS_16960 2090287 2091567 gene locus_tag LOCUS_16970 2090287 2091567 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815696.1 protein_id gnl|my_center|LOCUS_16970 2091815 2095234 gene locus_tag LOCUS_16980 2091815 2095234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 2096364 2095297 gene locus_tag LOCUS_16990 2096364 2095297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 protein_id gnl|my_center|LOCUS_16990 2097064 2096456 gene locus_tag LOCUS_17000 2097064 2096456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2097287 2097859 gene locus_tag LOCUS_17010 2097287 2097859 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392241.1 protein_id gnl|my_center|LOCUS_17010 2097969 2098295 gene locus_tag LOCUS_17020 2097969 2098295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2098397 2098669 gene locus_tag LOCUS_17030 2098397 2098669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2098798 2098885 gene locus_tag LOCUS_t00190 2098798 2098885 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2100745 2099024 gene locus_tag LOCUS_17040 gene yvrG 2100745 2099024 CDS product two-component system sensor histidine kinase YvrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243980.1 protein_id gnl|my_center|LOCUS_17040 2101494 2100760 gene locus_tag LOCUS_17050 gene yvrH 2101494 2100760 CDS product two-component system response regulator YvrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243545.1 protein_id gnl|my_center|LOCUS_17050 2101666 2104659 gene locus_tag LOCUS_17060 2101666 2104659 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375594.1 protein_id gnl|my_center|LOCUS_17060 2104681 2104995 gene locus_tag LOCUS_17070 2104681 2104995 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462608.1 protein_id gnl|my_center|LOCUS_17070 2105094 2105435 gene locus_tag LOCUS_17080 2105094 2105435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2105594 2107123 gene locus_tag LOCUS_17090 2105594 2107123 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_17090 2107128 2108309 gene locus_tag LOCUS_17100 2107128 2108309 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_17100 2108333 2108557 gene locus_tag LOCUS_17110 2108333 2108557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2108598 2109701 gene locus_tag LOCUS_17120 2108598 2109701 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393537.1 protein_id gnl|my_center|LOCUS_17120 2109786 2109873 gene locus_tag LOCUS_t00200 2109786 2109873 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2109930 2110115 gene locus_tag LOCUS_17130 2109930 2110115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2111030 2110110 gene locus_tag LOCUS_17140 2111030 2110110 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192798.1 protein_id gnl|my_center|LOCUS_17140 2111209 2112021 gene locus_tag LOCUS_17150 2111209 2112021 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156746.1 protein_id gnl|my_center|LOCUS_17150 2113673 2112186 gene locus_tag LOCUS_17160 gene abfB 2113673 2112186 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_17160 2113810 2114634 gene locus_tag LOCUS_17170 2113810 2114634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2114793 2115431 gene locus_tag LOCUS_17180 2114793 2115431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2115606 2115953 gene locus_tag LOCUS_17190 2115606 2115953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2115940 2116377 gene locus_tag LOCUS_17200 2115940 2116377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2116334 2117458 gene locus_tag LOCUS_17210 2116334 2117458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 2117814 2117530 gene locus_tag LOCUS_17220 2117814 2117530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2118658 2118819 gene locus_tag LOCUS_17230 2118658 2118819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 2119669 2119935 gene locus_tag LOCUS_17240 2119669 2119935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2120209 2120376 gene locus_tag LOCUS_17250 2120209 2120376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2120841 2121248 gene locus_tag LOCUS_17260 2120841 2121248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2121478 2122533 gene locus_tag LOCUS_17270 2121478 2122533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2123629 2122553 gene locus_tag LOCUS_17280 2123629 2122553 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_17280 2124711 2123626 gene locus_tag LOCUS_17290 2124711 2123626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 2126032 2124704 gene locus_tag LOCUS_17300 2126032 2124704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2127286 2126132 gene locus_tag LOCUS_17310 2127286 2126132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 2127460 2127547 gene locus_tag LOCUS_t00210 2127460 2127547 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2128576 2127746 gene locus_tag LOCUS_17320 2128576 2127746 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531924.1 protein_id gnl|my_center|LOCUS_17320 2129451 2128576 gene locus_tag LOCUS_17330 2129451 2128576 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257563.1 protein_id gnl|my_center|LOCUS_17330 2130887 2129541 gene locus_tag LOCUS_17340 2130887 2129541 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531926.1 protein_id gnl|my_center|LOCUS_17340 2133334 2131001 gene locus_tag LOCUS_17350 2133334 2131001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2133464 2134408 gene locus_tag LOCUS_17360 2133464 2134408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 2134412 2134540 gene locus_tag LOCUS_17370 2134412 2134540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2134525 2135463 gene locus_tag LOCUS_17380 2134525 2135463 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901419.1 protein_id gnl|my_center|LOCUS_17380 2135547 2136608 gene locus_tag LOCUS_17390 2135547 2136608 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_17390 2136850 2137875 gene locus_tag LOCUS_17400 2136850 2137875 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082403.1 protein_id gnl|my_center|LOCUS_17400 2138011 2139342 gene locus_tag LOCUS_17410 2138011 2139342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2139459 2140334 gene locus_tag LOCUS_17420 2139459 2140334 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_17420 2140352 2141182 gene locus_tag LOCUS_17430 2140352 2141182 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_17430 2141222 2143024 gene locus_tag LOCUS_17440 2141222 2143024 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_17440 2143032 2144573 gene locus_tag LOCUS_17450 2143032 2144573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2144601 2146931 gene locus_tag LOCUS_17460 2144601 2146931 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027130.1 protein_id gnl|my_center|LOCUS_17460 2146928 2147773 gene locus_tag LOCUS_17470 2146928 2147773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2149202 2147865 gene locus_tag LOCUS_17480 2149202 2147865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2150497 2149253 gene locus_tag LOCUS_17490 2150497 2149253 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_17490 2152299 2150497 gene locus_tag LOCUS_17500 2152299 2150497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2154052 2152418 gene locus_tag LOCUS_17510 2154052 2152418 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_17510 2155022 2154153 gene locus_tag LOCUS_17520 2155022 2154153 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_17520 2156003 2155053 gene locus_tag LOCUS_17530 2156003 2155053 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_17530 2157696 2155981 gene locus_tag LOCUS_17540 2157696 2155981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127588486.1 protein_id gnl|my_center|LOCUS_17540 2159346 2157946 gene locus_tag LOCUS_17550 2159346 2157946 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903469.1 protein_id gnl|my_center|LOCUS_17550 2159537 2160406 gene locus_tag LOCUS_17560 gene dapA 2159537 2160406 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_17560 2160442 2161098 gene locus_tag LOCUS_17570 2160442 2161098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 2161188 2162612 gene locus_tag LOCUS_17580 2161188 2162612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974902.1 protein_id gnl|my_center|LOCUS_17580 2163416 2162631 gene locus_tag LOCUS_17590 2163416 2162631 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391955.1 protein_id gnl|my_center|LOCUS_17590 2163618 2165498 gene locus_tag LOCUS_17600 2163618 2165498 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251419.1 protein_id gnl|my_center|LOCUS_17600 2165528 2166826 gene locus_tag LOCUS_17610 2165528 2166826 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436698.1 protein_id gnl|my_center|LOCUS_17610 2166864 2167238 gene locus_tag LOCUS_17620 2166864 2167238 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038342.1 protein_id gnl|my_center|LOCUS_17620 2167258 2168007 gene locus_tag LOCUS_17630 gene fabG 2167258 2168007 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395025.1 protein_id gnl|my_center|LOCUS_17630 2168034 2169134 gene locus_tag LOCUS_17640 2168034 2169134 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173644.1 protein_id gnl|my_center|LOCUS_17640 2169135 2170040 gene locus_tag LOCUS_17650 2169135 2170040 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228493.1 protein_id gnl|my_center|LOCUS_17650 2170055 2170945 gene locus_tag LOCUS_17660 2170055 2170945 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223727.1 protein_id gnl|my_center|LOCUS_17660 2170962 2172011 gene locus_tag LOCUS_17670 2170962 2172011 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_17670 2172354 2173061 gene locus_tag LOCUS_17680 2172354 2173061 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_17680 2173058 2173987 gene locus_tag LOCUS_17690 2173058 2173987 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942346.1 protein_id gnl|my_center|LOCUS_17690 2174001 2175593 gene locus_tag LOCUS_17700 2174001 2175593 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_17700 2175616 2177940 gene locus_tag LOCUS_17710 gene yesS 2175616 2177940 CDS product transcriptional regulator YesS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966769.1 protein_id gnl|my_center|LOCUS_17710 2178063 2179007 gene locus_tag LOCUS_17720 gene rmgP 2178063 2179007 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_17720 2179027 2179917 gene locus_tag LOCUS_17730 2179027 2179917 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_17730 2179984 2181627 gene locus_tag LOCUS_17740 2179984 2181627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 2181649 2182983 gene locus_tag LOCUS_17750 2181649 2182983 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_17750 2183296 2189301 gene locus_tag LOCUS_17760 2183296 2189301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 2189419 2193723 gene locus_tag LOCUS_17770 2189419 2193723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2194138 2195568 gene locus_tag LOCUS_17780 2194138 2195568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2197355 2195727 gene locus_tag LOCUS_17790 2197355 2195727 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_17790 2198313 2197435 gene locus_tag LOCUS_17800 2198313 2197435 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_17800 2199291 2198329 gene locus_tag LOCUS_17810 2199291 2198329 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_17810 2200452 2199370 gene locus_tag LOCUS_17820 2200452 2199370 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776531.1 protein_id gnl|my_center|LOCUS_17820 2200927 2204403 gene locus_tag LOCUS_17830 2200927 2204403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2206338 2204512 gene locus_tag LOCUS_17840 2206338 2204512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2206631 2208355 gene locus_tag LOCUS_17850 2206631 2208355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127588486.1 protein_id gnl|my_center|LOCUS_17850 2208358 2209605 gene locus_tag LOCUS_17860 2208358 2209605 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_17860 2214240 2209831 gene locus_tag LOCUS_17870 2214240 2209831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 2215703 2214354 gene locus_tag LOCUS_17880 2215703 2214354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2216268 2217908 gene locus_tag LOCUS_17890 2216268 2217908 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_17890 2218020 2218967 gene locus_tag LOCUS_17900 2218020 2218967 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_17900 2218984 2219862 gene locus_tag LOCUS_17910 2218984 2219862 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_17910 2219878 2221650 gene locus_tag LOCUS_17920 2219878 2221650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127588486.1 protein_id gnl|my_center|LOCUS_17920 2221629 2222285 gene locus_tag LOCUS_17930 2221629 2222285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 2222649 2230376 gene locus_tag LOCUS_17940 2222649 2230376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 2230651 2230962 gene locus_tag LOCUS_17950 2230651 2230962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 2231565 2230990 gene locus_tag LOCUS_17960 2231565 2230990 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 protein_id gnl|my_center|LOCUS_17960 2231715 2232746 gene locus_tag LOCUS_17970 2231715 2232746 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_17970 2233071 2233580 gene locus_tag LOCUS_17980 2233071 2233580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2233711 2234343 gene locus_tag LOCUS_17990 2233711 2234343 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229197.1 protein_id gnl|my_center|LOCUS_17990 2235409 2234489 gene locus_tag LOCUS_18000 2235409 2234489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027166.1 protein_id gnl|my_center|LOCUS_18000 2235801 2237396 gene locus_tag LOCUS_18010 2235801 2237396 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094095353.1 protein_id gnl|my_center|LOCUS_18010 2237393 2239159 gene locus_tag LOCUS_18020 gene yesM 2237393 2239159 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_18020 2239445 2239248 gene locus_tag LOCUS_18030 2239445 2239248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2239474 2240751 gene locus_tag LOCUS_18040 2239474 2240751 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_18040 2240845 2241732 gene locus_tag LOCUS_18050 2240845 2241732 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_18050 2241729 2242559 gene locus_tag LOCUS_18060 2241729 2242559 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803781.1 protein_id gnl|my_center|LOCUS_18060 2242564 2244426 gene locus_tag LOCUS_18070 2242564 2244426 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_18070 2244475 2246394 gene locus_tag LOCUS_18080 2244475 2246394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2246558 2247019 gene locus_tag LOCUS_18090 2246558 2247019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2247268 2248602 gene locus_tag LOCUS_18100 2247268 2248602 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096495.1 protein_id gnl|my_center|LOCUS_18100 2248683 2249915 gene locus_tag LOCUS_18110 gene mdtG 2248683 2249915 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074152.1 protein_id gnl|my_center|LOCUS_18110 2250807 2249980 gene locus_tag LOCUS_18120 2250807 2249980 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112888.1 protein_id gnl|my_center|LOCUS_18120 2251706 2250825 gene locus_tag LOCUS_18130 2251706 2250825 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582771.1 protein_id gnl|my_center|LOCUS_18130 2253323 2251797 gene locus_tag LOCUS_18140 2253323 2251797 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525207.1 protein_id gnl|my_center|LOCUS_18140 2255092 2253482 gene locus_tag LOCUS_18150 2255092 2253482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2256890 2255067 gene locus_tag LOCUS_18160 2256890 2255067 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_18160 2260302 2256955 gene locus_tag LOCUS_18170 2260302 2256955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2260443 2261435 gene locus_tag LOCUS_18180 2260443 2261435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2261779 2261967 gene locus_tag LOCUS_18190 2261779 2261967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2262039 2263082 gene locus_tag LOCUS_18200 2262039 2263082 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_18200 2263086 2264036 gene locus_tag LOCUS_18210 2263086 2264036 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_18210 2264113 2265027 gene locus_tag LOCUS_18220 2264113 2265027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2265194 2266240 gene locus_tag LOCUS_18230 2265194 2266240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2266281 2266979 gene locus_tag LOCUS_18240 2266281 2266979 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822492.1 protein_id gnl|my_center|LOCUS_18240 2266972 2268060 gene locus_tag LOCUS_18250 2266972 2268060 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002596.1 protein_id gnl|my_center|LOCUS_18250 2269043 2268138 gene locus_tag LOCUS_18260 2269043 2268138 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409953.1 protein_id gnl|my_center|LOCUS_18260 2270108 2269065 gene locus_tag LOCUS_18270 2270108 2269065 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418724.1 protein_id gnl|my_center|LOCUS_18270 2270366 2271325 gene locus_tag LOCUS_18280 2270366 2271325 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_18280 2271795 2272754 gene locus_tag LOCUS_18290 gene mntA 2271795 2272754 CDS product manganese ABC transporter substrate-binding protein/adhesin MntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229060.1 protein_id gnl|my_center|LOCUS_18290 2272756 2273493 gene locus_tag LOCUS_18300 gene mntB 2272756 2273493 CDS product manganese ABC transporter ATP-binding protein MntB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398644.1 protein_id gnl|my_center|LOCUS_18300 2273490 2274413 gene locus_tag LOCUS_18310 2273490 2274413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2274410 2275312 gene locus_tag LOCUS_18320 gene mntD 2274410 2275312 CDS product manganese ABC transporter permease MntD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229067.1 protein_id gnl|my_center|LOCUS_18320 2275550 2276977 gene locus_tag LOCUS_18330 2275550 2276977 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989437.1 protein_id gnl|my_center|LOCUS_18330 2277030 2278229 gene locus_tag LOCUS_18340 2277030 2278229 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932014.1 protein_id gnl|my_center|LOCUS_18340 2278255 2279490 gene locus_tag LOCUS_18350 gene efeB 2278255 2279490 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989438.1 protein_id gnl|my_center|LOCUS_18350 2279925 2280830 gene locus_tag LOCUS_18360 2279925 2280830 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_18360 2281021 2283312 gene locus_tag LOCUS_18370 gene metE 2281021 2283312 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007608.1 protein_id gnl|my_center|LOCUS_18370 2283484 2283891 gene locus_tag LOCUS_18380 gene crcB 2283484 2283891 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639324.1 protein_id gnl|my_center|LOCUS_18380 2283888 2284250 gene locus_tag LOCUS_18390 gene crcB 2283888 2284250 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568601.1 protein_id gnl|my_center|LOCUS_18390 2284394 2286706 gene locus_tag LOCUS_18400 2284394 2286706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2286896 2286714 gene locus_tag LOCUS_18410 2286896 2286714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 2286976 2289327 gene locus_tag LOCUS_18420 2286976 2289327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2289632 2290990 gene locus_tag LOCUS_18430 2289632 2290990 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_18430 2291094 2291777 gene locus_tag LOCUS_18440 2291094 2291777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2292448 2291741 gene locus_tag LOCUS_18450 2292448 2291741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2294158 2292581 gene locus_tag LOCUS_18460 2294158 2292581 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641586.1 protein_id gnl|my_center|LOCUS_18460 2295167 2294289 gene locus_tag LOCUS_18470 2295167 2294289 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_18470 2296178 2295186 gene locus_tag LOCUS_18480 2296178 2295186 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_18480 2298779 2296449 gene locus_tag LOCUS_18490 2298779 2296449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2299093 2302566 gene locus_tag LOCUS_18500 2299093 2302566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2302684 2304885 gene locus_tag LOCUS_18510 2302684 2304885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2305142 2304819 gene locus_tag LOCUS_18520 2305142 2304819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 2305131 2307578 gene locus_tag LOCUS_18530 gene nasD 2305131 2307578 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_18530 2307591 2307926 gene locus_tag LOCUS_18540 gene nirD 2307591 2307926 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616671.1 protein_id gnl|my_center|LOCUS_18540 2309095 2307923 gene locus_tag LOCUS_18550 2309095 2307923 CDS product oxalate decarboxylase family bicupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747527.1 protein_id gnl|my_center|LOCUS_18550 2309323 2312676 gene locus_tag LOCUS_18560 2309323 2312676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2312817 2313833 gene locus_tag LOCUS_18570 gene glpX 2312817 2313833 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439090.1 protein_id gnl|my_center|LOCUS_18570 2313994 2314602 gene locus_tag LOCUS_18580 2313994 2314602 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392142.1 protein_id gnl|my_center|LOCUS_18580 2314626 2315432 gene locus_tag LOCUS_18590 2314626 2315432 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_18590 2315697 2315545 gene locus_tag LOCUS_18600 2315697 2315545 CDS product DUF1540 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046095.1 protein_id gnl|my_center|LOCUS_18600 2315964 2316410 gene locus_tag LOCUS_18610 gene mhqR 2315964 2316410 CDS product MarR family transcriptional regulator MhqR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232475.1 protein_id gnl|my_center|LOCUS_18610 2316484 2317449 gene locus_tag LOCUS_18620 2316484 2317449 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245086.1 protein_id gnl|my_center|LOCUS_18620 2317510 2318118 gene locus_tag LOCUS_18630 2317510 2318118 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000975477.1 protein_id gnl|my_center|LOCUS_18630 2318160 2318510 gene locus_tag LOCUS_18640 2318160 2318510 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 protein_id gnl|my_center|LOCUS_18640 2319353 2319111 gene locus_tag LOCUS_18650 2319353 2319111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2319968 2319435 gene locus_tag LOCUS_18660 2319968 2319435 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119547.1 protein_id gnl|my_center|LOCUS_18660 2320156 2321082 gene locus_tag LOCUS_18670 2320156 2321082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2321795 2320989 gene locus_tag LOCUS_18680 2321795 2320989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 2323127 2321898 gene locus_tag LOCUS_18690 2323127 2321898 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246358.1 protein_id gnl|my_center|LOCUS_18690 2323572 2325665 gene locus_tag LOCUS_18700 2323572 2325665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2325719 2327845 gene locus_tag LOCUS_18710 gene nasC 2325719 2327845 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_18710 2327903 2328106 gene locus_tag LOCUS_18720 2327903 2328106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2329048 2328143 gene locus_tag LOCUS_18730 2329048 2328143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2330104 2329175 gene locus_tag LOCUS_18740 2330104 2329175 CDS product YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183964.1 protein_id gnl|my_center|LOCUS_18740 2331766 2330108 gene locus_tag LOCUS_18750 2331766 2330108 CDS product SNF2-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100037.1 protein_id gnl|my_center|LOCUS_18750 2331767 2331961 gene locus_tag LOCUS_18760 2331767 2331961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2332203 2334875 gene locus_tag LOCUS_18770 2332203 2334875 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_18770 2335617 2336195 gene locus_tag LOCUS_18780 2335617 2336195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2336856 2336434 gene locus_tag LOCUS_18790 2336856 2336434 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966773.1 protein_id gnl|my_center|LOCUS_18790 2337037 2338158 gene locus_tag LOCUS_18800 2337037 2338158 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182341.1 protein_id gnl|my_center|LOCUS_18800 2338904 2339743 gene locus_tag LOCUS_18810 2338904 2339743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18810 2339734 2340399 gene locus_tag LOCUS_18820 2339734 2340399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2340986 2340579 gene locus_tag LOCUS_18830 2340986 2340579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18830 2341819 2343198 gene locus_tag LOCUS_18840 2341819 2343198 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_18840 2343550 2344800 gene locus_tag LOCUS_18850 2343550 2344800 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_18850 2344835 2345077 gene locus_tag LOCUS_18860 2344835 2345077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 2345478 2346095 gene locus_tag LOCUS_18870 2345478 2346095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 2347004 2346198 gene locus_tag LOCUS_18880 2347004 2346198 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_18880 2348125 2347001 gene locus_tag LOCUS_18890 2348125 2347001 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_18890 2349165 2348122 gene locus_tag LOCUS_18900 2349165 2348122 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_18900 2349352 2351274 gene locus_tag LOCUS_18910 2349352 2351274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2351388 2352299 gene locus_tag LOCUS_18920 gene rmgP 2351388 2352299 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_18920 2352318 2353196 gene locus_tag LOCUS_18930 2352318 2353196 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_18930 2353282 2354904 gene locus_tag LOCUS_18940 2353282 2354904 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_18940 2354985 2357210 gene locus_tag LOCUS_18950 2354985 2357210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2357249 2359288 gene locus_tag LOCUS_18960 2357249 2359288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 2360200 2359319 gene locus_tag LOCUS_18970 2360200 2359319 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369696.1 protein_id gnl|my_center|LOCUS_18970 2360157 2362067 gene locus_tag LOCUS_18980 2360157 2362067 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_18980 2362060 2362980 gene locus_tag LOCUS_18990 2362060 2362980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2363707 2363066 gene locus_tag LOCUS_19000 2363707 2363066 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065051.1 protein_id gnl|my_center|LOCUS_19000 2364524 2363709 gene locus_tag LOCUS_19010 2364524 2363709 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969400.1 protein_id gnl|my_center|LOCUS_19010 2364668 2365552 gene locus_tag LOCUS_19020 2364668 2365552 CDS product phosphogluconate dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969407.1 protein_id gnl|my_center|LOCUS_19020 2365557 2366621 gene locus_tag LOCUS_19030 2365557 2366621 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119543.1 protein_id gnl|my_center|LOCUS_19030 2366611 2366826 gene locus_tag LOCUS_19040 2366611 2366826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2366846 2367322 gene locus_tag LOCUS_19050 2366846 2367322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2367898 2370084 gene locus_tag LOCUS_19060 2367898 2370084 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_19060 2370258 2372600 gene locus_tag LOCUS_19070 2370258 2372600 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 protein_id gnl|my_center|LOCUS_19070 2372758 2373717 gene locus_tag LOCUS_19080 gene rmgP 2372758 2373717 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_19080 2373730 2374608 gene locus_tag LOCUS_19090 2373730 2374608 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_19090 2374638 2376188 gene locus_tag LOCUS_19100 2374638 2376188 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_19100 2376273 2377598 gene locus_tag LOCUS_19110 2376273 2377598 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922755.1 protein_id gnl|my_center|LOCUS_19110 2377778 2380147 gene locus_tag LOCUS_19120 2377778 2380147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 2380236 2381201 gene locus_tag LOCUS_19130 2380236 2381201 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582676.1 protein_id gnl|my_center|LOCUS_19130 2381316 2382293 gene locus_tag LOCUS_19140 2381316 2382293 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_19140 2382313 2383203 gene locus_tag LOCUS_19150 2382313 2383203 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_19150 2383272 2384885 gene locus_tag LOCUS_19160 2383272 2384885 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_19160 2386585 2384948 gene locus_tag LOCUS_19170 2386585 2384948 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_19170 2388389 2386563 gene locus_tag LOCUS_19180 gene yesM 2388389 2386563 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_19180 2388509 2389849 gene locus_tag LOCUS_19190 2388509 2389849 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256270.1 protein_id gnl|my_center|LOCUS_19190 2389857 2390045 gene locus_tag LOCUS_19200 2389857 2390045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2390172 2390453 gene locus_tag LOCUS_19210 2390172 2390453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2391004 2392629 gene locus_tag LOCUS_19220 2391004 2392629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2392707 2393615 gene locus_tag LOCUS_19230 2392707 2393615 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_19230 2393633 2394505 gene locus_tag LOCUS_19240 2393633 2394505 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_19240 2394549 2395496 gene locus_tag LOCUS_19250 2394549 2395496 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226303.1 protein_id gnl|my_center|LOCUS_19250 2395540 2397012 gene locus_tag LOCUS_19260 2395540 2397012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 2397032 2398267 gene locus_tag LOCUS_19270 2397032 2398267 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440662.1 protein_id gnl|my_center|LOCUS_19270 2398284 2399117 gene locus_tag LOCUS_19280 2398284 2399117 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 protein_id gnl|my_center|LOCUS_19280 2399143 2400624 gene locus_tag LOCUS_19290 2399143 2400624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2400638 2401489 gene locus_tag LOCUS_19300 2400638 2401489 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_19300 2401511 2402971 gene locus_tag LOCUS_19310 gene gtfA 2401511 2402971 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_19310 2402985 2403830 gene locus_tag LOCUS_19320 2402985 2403830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2403949 2405475 gene locus_tag LOCUS_19330 2403949 2405475 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285974.1 protein_id gnl|my_center|LOCUS_19330 2405532 2407265 gene locus_tag LOCUS_19340 gene yesM 2405532 2407265 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_19340 2407298 2408854 gene locus_tag LOCUS_19350 2407298 2408854 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_19350 2409948 2408857 gene locus_tag LOCUS_19360 2409948 2408857 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392526.1 protein_id gnl|my_center|LOCUS_19360 2410237 2410004 gene locus_tag LOCUS_19370 2410237 2410004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 2411424 2410243 gene locus_tag LOCUS_19380 2411424 2410243 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_19380 2412716 2411421 gene locus_tag LOCUS_19390 2412716 2411421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 2412636 2412824 gene locus_tag LOCUS_19400 2412636 2412824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2415008 2413572 gene locus_tag LOCUS_19410 2415008 2413572 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_19410 2416272 2415055 gene locus_tag LOCUS_19420 2416272 2415055 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816635.1 protein_id gnl|my_center|LOCUS_19420 2417202 2416300 gene locus_tag LOCUS_19430 2417202 2416300 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393134.1 protein_id gnl|my_center|LOCUS_19430 2418392 2417355 gene locus_tag LOCUS_19440 2418392 2417355 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_19440 2419650 2418448 gene locus_tag LOCUS_19450 2419650 2418448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2420930 2419866 gene locus_tag LOCUS_19460 2420930 2419866 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396053.1 protein_id gnl|my_center|LOCUS_19460 2421077 2422780 gene locus_tag LOCUS_19470 gene yesM 2421077 2422780 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_19470 2422777 2424450 gene locus_tag LOCUS_19480 2422777 2424450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 2424704 2426062 gene locus_tag LOCUS_19490 2424704 2426062 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529762.1 protein_id gnl|my_center|LOCUS_19490 2426144 2427016 gene locus_tag LOCUS_19500 2426144 2427016 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061268.1 protein_id gnl|my_center|LOCUS_19500 2427017 2427853 gene locus_tag LOCUS_19510 2427017 2427853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 2427853 2428812 gene locus_tag LOCUS_19520 2427853 2428812 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974651.1 protein_id gnl|my_center|LOCUS_19520 2428854 2429747 gene locus_tag LOCUS_19530 gene dapA 2428854 2429747 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564763.1 protein_id gnl|my_center|LOCUS_19530 2429768 2430781 gene locus_tag LOCUS_19540 gene allD 2429768 2430781 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244926.1 protein_id gnl|my_center|LOCUS_19540 2431241 2431630 gene locus_tag LOCUS_19550 2431241 2431630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2433135 2431720 gene locus_tag LOCUS_19560 2433135 2431720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224359.1 protein_id gnl|my_center|LOCUS_19560 2433280 2434254 gene locus_tag LOCUS_19570 2433280 2434254 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943748.1 protein_id gnl|my_center|LOCUS_19570 2435362 2434292 gene locus_tag LOCUS_19580 2435362 2434292 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 protein_id gnl|my_center|LOCUS_19580 2435613 2438249 gene locus_tag LOCUS_19590 2435613 2438249 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_19590 2438360 2440219 gene locus_tag LOCUS_19600 2438360 2440219 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_19600 2440304 2441674 gene locus_tag LOCUS_19610 2440304 2441674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 2441793 2442662 gene locus_tag LOCUS_19620 2441793 2442662 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_19620 2442662 2443480 gene locus_tag LOCUS_19630 2442662 2443480 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_19630 2443572 2445176 gene locus_tag LOCUS_19640 2443572 2445176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 2445193 2446920 gene locus_tag LOCUS_19650 2445193 2446920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2446937 2447620 gene locus_tag LOCUS_19660 2446937 2447620 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_19660 2447617 2448939 gene locus_tag LOCUS_19670 2447617 2448939 CDS product ribulose-bisphosphate carboxylase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064440.1 protein_id gnl|my_center|LOCUS_19670 2448946 2450445 gene locus_tag LOCUS_19680 2448946 2450445 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398926.1 protein_id gnl|my_center|LOCUS_19680 2450450 2453698 gene locus_tag LOCUS_19690 2450450 2453698 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080241138.1 protein_id gnl|my_center|LOCUS_19690 2453948 2454964 gene locus_tag LOCUS_19700 2453948 2454964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293906.1 protein_id gnl|my_center|LOCUS_19700 2455086 2456708 gene locus_tag LOCUS_19710 2455086 2456708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2457597 2456725 gene locus_tag LOCUS_19720 2457597 2456725 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_19720 2457742 2458572 gene locus_tag LOCUS_19730 2457742 2458572 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201854.1 protein_id gnl|my_center|LOCUS_19730 2458595 2459548 gene locus_tag LOCUS_19740 2458595 2459548 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_19740 2459545 2460561 gene locus_tag LOCUS_19750 2459545 2460561 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968302.1 protein_id gnl|my_center|LOCUS_19750 2460956 2460651 gene locus_tag LOCUS_19760 2460956 2460651 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_19760 2461098 2460934 gene locus_tag LOCUS_19770 2461098 2460934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2461306 2461983 gene locus_tag LOCUS_19780 2461306 2461983 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617304.1 protein_id gnl|my_center|LOCUS_19780 2461976 2462272 gene locus_tag LOCUS_19790 2461976 2462272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2463722 2462925 gene locus_tag LOCUS_19800 2463722 2462925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2463849 2466098 gene locus_tag LOCUS_19810 2463849 2466098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2466625 2466260 gene locus_tag LOCUS_19820 2466625 2466260 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021341.1 protein_id gnl|my_center|LOCUS_19820 2467278 2466625 gene locus_tag LOCUS_19830 2467278 2466625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2468125 2467271 gene locus_tag LOCUS_19840 2468125 2467271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890775.1 protein_id gnl|my_center|LOCUS_19840 2468249 2468374 gene locus_tag LOCUS_19850 2468249 2468374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2468552 2470198 gene locus_tag LOCUS_19860 2468552 2470198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2471263 2470310 gene locus_tag LOCUS_19870 2471263 2470310 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059329.1 protein_id gnl|my_center|LOCUS_19870 2471408 2471704 gene locus_tag LOCUS_19880 2471408 2471704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 2471705 2472214 gene locus_tag LOCUS_19890 2471705 2472214 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902885.1 protein_id gnl|my_center|LOCUS_19890 2472385 2472978 gene locus_tag LOCUS_19900 2472385 2472978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2473140 2474105 gene locus_tag LOCUS_19910 2473140 2474105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2474587 2476107 gene locus_tag LOCUS_19920 2474587 2476107 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078186907.1 protein_id gnl|my_center|LOCUS_19920 2476265 2478166 gene locus_tag LOCUS_19930 2476265 2478166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2478267 2479046 gene locus_tag LOCUS_19940 2478267 2479046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2479220 2480524 gene locus_tag LOCUS_19950 gene aldO 2479220 2480524 CDS product alditol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030685.1 protein_id gnl|my_center|LOCUS_19950 2481246 2480521 gene locus_tag LOCUS_19960 2481246 2480521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2481133 2481342 gene locus_tag LOCUS_19970 2481133 2481342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2481509 2483581 gene locus_tag LOCUS_19980 2481509 2483581 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097213.1 protein_id gnl|my_center|LOCUS_19980 2483690 2484802 gene locus_tag LOCUS_19990 2483690 2484802 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_19990 2485021 2485881 gene locus_tag LOCUS_20000 2485021 2485881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 2485956 2486690 gene locus_tag LOCUS_20010 2485956 2486690 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812187.1 protein_id gnl|my_center|LOCUS_20010 2486687 2487433 gene locus_tag LOCUS_20020 2486687 2487433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 2487471 2488943 gene locus_tag LOCUS_20030 2487471 2488943 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023877.1 protein_id gnl|my_center|LOCUS_20030 2488940 2489632 gene locus_tag LOCUS_20040 2488940 2489632 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_20040 2489683 2490330 gene locus_tag LOCUS_20050 2489683 2490330 CDS product DUF2306 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223518.1 protein_id gnl|my_center|LOCUS_20050 2490632 2492059 gene locus_tag LOCUS_20060 gene hpyO 2490632 2492059 CDS product FAD-dependent urate hydroxylase HpyO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035534.1 protein_id gnl|my_center|LOCUS_20060 2493101 2492265 gene locus_tag LOCUS_20070 2493101 2492265 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_20070 2493250 2494008 gene locus_tag LOCUS_20080 2493250 2494008 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_20080 2494036 2495202 gene locus_tag LOCUS_20090 2494036 2495202 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_20090 2495199 2496278 gene locus_tag LOCUS_20100 2495199 2496278 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_20100 2496744 2496379 gene locus_tag LOCUS_20110 2496744 2496379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 2496912 2497817 gene locus_tag LOCUS_20120 2496912 2497817 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425897.1 protein_id gnl|my_center|LOCUS_20120 2498006 2498902 gene locus_tag LOCUS_20130 gene tcyK 2498006 2498902 CDS product sulfur-containing amino acid ABC transporter substrate-binding protein TcyK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399116.1 protein_id gnl|my_center|LOCUS_20130 2498924 2499706 gene locus_tag LOCUS_20140 gene tcyL 2498924 2499706 CDS product sulfur-containing amino acid ABC transporter permease TcyL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399112.1 protein_id gnl|my_center|LOCUS_20140 2499703 2500413 gene locus_tag LOCUS_20150 2499703 2500413 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722586.1 protein_id gnl|my_center|LOCUS_20150 2500410 2501162 gene locus_tag LOCUS_20160 2500410 2501162 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722585.1 protein_id gnl|my_center|LOCUS_20160 2501183 2502202 gene locus_tag LOCUS_20170 2501183 2502202 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187562.1 protein_id gnl|my_center|LOCUS_20170 2502280 2503488 gene locus_tag LOCUS_20180 2502280 2503488 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157892.1 protein_id gnl|my_center|LOCUS_20180 2503485 2504648 gene locus_tag LOCUS_20190 gene solA 2503485 2504648 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170765.1 protein_id gnl|my_center|LOCUS_20190 2504664 2505176 gene locus_tag LOCUS_20200 2504664 2505176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2505182 2505712 gene locus_tag LOCUS_20210 2505182 2505712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 2505761 2507095 gene locus_tag LOCUS_20220 2505761 2507095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2509159 2508041 gene locus_tag LOCUS_20230 2509159 2508041 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524107.1 protein_id gnl|my_center|LOCUS_20230 2509425 2510477 gene locus_tag LOCUS_20240 2509425 2510477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2510565 2510942 gene locus_tag LOCUS_20250 2510565 2510942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2511947 2511033 gene locus_tag LOCUS_20260 2511947 2511033 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715345.1 protein_id gnl|my_center|LOCUS_20260 2512769 2511972 gene locus_tag LOCUS_20270 2512769 2511972 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243563.1 protein_id gnl|my_center|LOCUS_20270 2513013 2513522 gene locus_tag LOCUS_20280 2513013 2513522 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949403.1 protein_id gnl|my_center|LOCUS_20280 2513739 2514845 gene locus_tag LOCUS_20290 2513739 2514845 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_20290 2515904 2515017 gene locus_tag LOCUS_20300 2515904 2515017 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095324.1 protein_id gnl|my_center|LOCUS_20300 2516028 2517341 gene locus_tag LOCUS_20310 2516028 2517341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521091.1 protein_id gnl|my_center|LOCUS_20310 2517440 2518222 gene locus_tag LOCUS_20320 gene fabI 2517440 2518222 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232896.1 protein_id gnl|my_center|LOCUS_20320 2518354 2518794 gene locus_tag LOCUS_20330 2518354 2518794 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461316.1 protein_id gnl|my_center|LOCUS_20330 2518866 2520134 gene locus_tag LOCUS_20340 2518866 2520134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503266.1 protein_id gnl|my_center|LOCUS_20340 2520818 2520138 gene locus_tag LOCUS_20350 2520818 2520138 CDS product CidB/LrgB family autolysis modulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227371.1 protein_id gnl|my_center|LOCUS_20350 2521195 2520815 gene locus_tag LOCUS_20360 2521195 2520815 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707491.1 protein_id gnl|my_center|LOCUS_20360 2521309 2522202 gene locus_tag LOCUS_20370 2521309 2522202 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_20370 2522364 2525834 gene locus_tag LOCUS_20380 2522364 2525834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 2525852 2526154 gene locus_tag LOCUS_20390 2525852 2526154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231564.1 protein_id gnl|my_center|LOCUS_20390 2527531 2526236 gene locus_tag LOCUS_20400 gene uraA 2527531 2526236 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815817.1 protein_id gnl|my_center|LOCUS_20400 2527724 2528428 gene locus_tag LOCUS_20410 2527724 2528428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2528509 2529501 gene locus_tag LOCUS_20420 gene iolU 2528509 2529501 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_20420 2531427 2529976 gene locus_tag LOCUS_20430 2531427 2529976 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 protein_id gnl|my_center|LOCUS_20430 2531669 2532463 gene locus_tag LOCUS_20440 gene gpmA 2531669 2532463 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594152.1 protein_id gnl|my_center|LOCUS_20440 2533437 2532460 gene locus_tag LOCUS_20450 2533437 2532460 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_20450 2533770 2535122 gene locus_tag LOCUS_20460 2533770 2535122 CDS product maltodextrin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034961.1 protein_id gnl|my_center|LOCUS_20460 2535203 2536507 gene locus_tag LOCUS_20470 2535203 2536507 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166892.1 protein_id gnl|my_center|LOCUS_20470 2536507 2537349 gene locus_tag LOCUS_20480 2536507 2537349 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162661.1 protein_id gnl|my_center|LOCUS_20480 2537430 2543840 gene locus_tag LOCUS_20490 2537430 2543840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2543991 2544662 gene locus_tag LOCUS_20500 2543991 2544662 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_20500 2544848 2546413 gene locus_tag LOCUS_20510 2544848 2546413 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010729380.1 protein_id gnl|my_center|LOCUS_20510 2546410 2548197 gene locus_tag LOCUS_20520 2546410 2548197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2548172 2549779 gene locus_tag LOCUS_20530 2548172 2549779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2550217 2549876 gene locus_tag LOCUS_20540 2550217 2549876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 2550547 2551074 gene locus_tag LOCUS_20550 gene bstA 2550547 2551074 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243944.1 protein_id gnl|my_center|LOCUS_20550 2551262 2551942 gene locus_tag LOCUS_20560 2551262 2551942 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232944.1 protein_id gnl|my_center|LOCUS_20560 2551983 2552612 gene locus_tag LOCUS_20570 2551983 2552612 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723980.1 protein_id gnl|my_center|LOCUS_20570 2553029 2552724 gene locus_tag LOCUS_20580 2553029 2552724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2554158 2553115 gene locus_tag LOCUS_20590 gene add 2554158 2553115 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_20590 2554569 2554195 gene locus_tag LOCUS_20600 2554569 2554195 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382363.1 protein_id gnl|my_center|LOCUS_20600 2554899 2555831 gene locus_tag LOCUS_20610 2554899 2555831 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071727514.1 protein_id gnl|my_center|LOCUS_20610 2555951 2557099 gene locus_tag LOCUS_20620 2555951 2557099 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000730595.1 protein_id gnl|my_center|LOCUS_20620 2557203 2558744 gene locus_tag LOCUS_20630 2557203 2558744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_20630 2558741 2559844 gene locus_tag LOCUS_20640 2558741 2559844 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074497.1 protein_id gnl|my_center|LOCUS_20640 2559828 2560787 gene locus_tag LOCUS_20650 gene nupQ 2559828 2560787 CDS product guanosine ABC transporter permease NupQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228827.1 protein_id gnl|my_center|LOCUS_20650 2560922 2561860 gene locus_tag LOCUS_20660 2560922 2561860 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_20660 2561865 2562485 gene locus_tag LOCUS_20670 2561865 2562485 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701718.1 protein_id gnl|my_center|LOCUS_20670 2563506 2562679 gene locus_tag LOCUS_20680 gene pgoN 2563506 2562679 CDS product glyoxal/methylglyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243374.1 protein_id gnl|my_center|LOCUS_20680 2564539 2563550 gene locus_tag LOCUS_20690 gene lplJ 2564539 2563550 CDS product lipoate--protein ligase LplJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244914.1 protein_id gnl|my_center|LOCUS_20690 2564703 2566439 gene locus_tag LOCUS_20700 2564703 2566439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_20700 2566436 2568355 gene locus_tag LOCUS_20710 2566436 2568355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2568450 2569196 gene locus_tag LOCUS_20720 2568450 2569196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2569372 2570013 gene locus_tag LOCUS_20730 gene eda 2569372 2570013 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_20730 2570010 2570990 gene locus_tag LOCUS_20740 gene kdgK 2570010 2570990 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230727.1 protein_id gnl|my_center|LOCUS_20740 2572202 2571372 gene locus_tag LOCUS_20750 2572202 2571372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 2572319 2574349 gene locus_tag LOCUS_20760 2572319 2574349 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582883.1 protein_id gnl|my_center|LOCUS_20760 2574426 2574656 gene locus_tag LOCUS_20770 2574426 2574656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2574860 2576341 gene locus_tag LOCUS_20780 gene araA 2574860 2576341 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229499.1 protein_id gnl|my_center|LOCUS_20780 2576646 2577920 gene locus_tag LOCUS_20790 2576646 2577920 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410209.1 protein_id gnl|my_center|LOCUS_20790 2578143 2580053 gene locus_tag LOCUS_20800 gene glgB 2578143 2580053 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 protein_id gnl|my_center|LOCUS_20800 2580093 2581256 gene locus_tag LOCUS_20810 gene glgC 2580093 2581256 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_20810 2581256 2582368 gene locus_tag LOCUS_20820 gene glgD 2581256 2582368 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_20820 2582414 2583844 gene locus_tag LOCUS_20830 gene glgA 2582414 2583844 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_20830 2583893 2585878 gene locus_tag LOCUS_20840 2583893 2585878 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_20840 2586035 2586784 gene locus_tag LOCUS_20850 2586035 2586784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 2586824 2587465 gene locus_tag LOCUS_20860 2586824 2587465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 2587733 2589106 gene locus_tag LOCUS_20870 2587733 2589106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2589334 2589215 gene locus_tag LOCUS_20880 2589334 2589215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2589846 2589439 gene locus_tag LOCUS_20890 2589846 2589439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2590048 2589848 gene locus_tag LOCUS_20900 2590048 2589848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2590752 2590054 gene locus_tag LOCUS_20910 2590752 2590054 CDS product spore germination protein GerPC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245548.1 protein_id gnl|my_center|LOCUS_20910 2591011 2590790 gene locus_tag LOCUS_20920 gene gerPB 2591011 2590790 CDS product spore germination protein GerPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233090.1 protein_id gnl|my_center|LOCUS_20920 2591235 2591011 gene locus_tag LOCUS_20930 2591235 2591011 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233088.1 protein_id gnl|my_center|LOCUS_20930 2591425 2591901 gene locus_tag LOCUS_20940 2591425 2591901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2592009 2592209 gene locus_tag LOCUS_20950 2592009 2592209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 2592285 2592545 gene locus_tag LOCUS_20960 gene yidD 2592285 2592545 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809333.1 protein_id gnl|my_center|LOCUS_20960 2592927 2594951 gene locus_tag LOCUS_20970 gene metG 2592927 2594951 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134147.1 protein_id gnl|my_center|LOCUS_20970 2595067 2597670 gene locus_tag LOCUS_20980 2595067 2597670 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836726.1 protein_id gnl|my_center|LOCUS_20980 2597721 2598431 gene locus_tag LOCUS_20990 gene ccdA 2597721 2598431 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 protein_id gnl|my_center|LOCUS_20990 2599518 2598451 gene locus_tag LOCUS_21000 gene splB 2599518 2598451 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879610.1 protein_id gnl|my_center|LOCUS_21000 2599702 2599499 gene locus_tag LOCUS_21010 2599702 2599499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 2599686 2600108 gene locus_tag LOCUS_21020 gene mntR 2599686 2600108 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003236923.1 protein_id gnl|my_center|LOCUS_21020 2600240 2601304 gene locus_tag LOCUS_21030 2600240 2601304 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686815.1 protein_id gnl|my_center|LOCUS_21030 2601670 2601344 gene locus_tag LOCUS_21040 2601670 2601344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2602604 2601696 gene locus_tag LOCUS_21050 2602604 2601696 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807112.1 protein_id gnl|my_center|LOCUS_21050 2602819 2603358 gene locus_tag LOCUS_21060 2602819 2603358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2603458 2603892 gene locus_tag LOCUS_21070 gene aroQ 2603458 2603892 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_21070 2603940 2605019 gene locus_tag LOCUS_21080 gene pepQ 2603940 2605019 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_21080 2605052 2605609 gene locus_tag LOCUS_21090 gene efp 2605052 2605609 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626507.1 protein_id gnl|my_center|LOCUS_21090 2605734 2606987 gene locus_tag LOCUS_21100 2605734 2606987 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_21100 2607160 2607642 gene locus_tag LOCUS_21110 2607160 2607642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2607868 2608131 gene locus_tag LOCUS_21120 2607868 2608131 CDS product YqhV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398639.1 protein_id gnl|my_center|LOCUS_21120 2608255 2609289 gene locus_tag LOCUS_21130 gene spoIIIAA 2608255 2609289 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_21130 2609282 2609800 gene locus_tag LOCUS_21140 gene spoIIIAB 2609282 2609800 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230227.1 protein_id gnl|my_center|LOCUS_21140 2609816 2610019 gene locus_tag LOCUS_21150 gene spoIIIAC 2609816 2610019 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020914.1 protein_id gnl|my_center|LOCUS_21150 2610030 2610431 gene locus_tag LOCUS_21160 gene spoIIIAD 2610030 2610431 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230228.1 protein_id gnl|my_center|LOCUS_21160 2610434 2611771 gene locus_tag LOCUS_21170 gene spoIIIAE 2610434 2611771 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230230.1 protein_id gnl|my_center|LOCUS_21170 2611806 2612516 gene locus_tag LOCUS_21180 2611806 2612516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2612535 2613188 gene locus_tag LOCUS_21190 gene spoIIIAG 2612535 2613188 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368881.1 protein_id gnl|my_center|LOCUS_21190 2613238 2614044 gene locus_tag LOCUS_21200 2613238 2614044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 2614298 2614774 gene locus_tag LOCUS_21210 gene accB 2614298 2614774 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230252.1 protein_id gnl|my_center|LOCUS_21210 2614833 2616200 gene locus_tag LOCUS_21220 gene accC 2614833 2616200 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592876.1 protein_id gnl|my_center|LOCUS_21220 2616348 2616755 gene locus_tag LOCUS_21230 2616348 2616755 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_21230 2616912 2617475 gene locus_tag LOCUS_21240 2616912 2617475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2617491 2617724 gene locus_tag LOCUS_21250 2617491 2617724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2617745 2618248 gene locus_tag LOCUS_21260 gene nusB 2617745 2618248 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_21260 2618245 2619102 gene locus_tag LOCUS_21270 gene folD 2618245 2619102 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_21270 2619121 2620488 gene locus_tag LOCUS_21280 gene xseA 2619121 2620488 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_21280 2620478 2620741 gene locus_tag LOCUS_21290 2620478 2620741 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226409.1 protein_id gnl|my_center|LOCUS_21290 2620750 2621658 gene locus_tag LOCUS_21300 2620750 2621658 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_21300 2622027 2623922 gene locus_tag LOCUS_21310 gene dxs 2622027 2623922 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245985.1 protein_id gnl|my_center|LOCUS_21310 2623927 2624796 gene locus_tag LOCUS_21320 2623927 2624796 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230264.1 protein_id gnl|my_center|LOCUS_21320 2625021 2625491 gene locus_tag LOCUS_21330 2625021 2625491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2625488 2625937 gene locus_tag LOCUS_21340 gene argR 2625488 2625937 CDS product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 protein_id gnl|my_center|LOCUS_21340 2625979 2627676 gene locus_tag LOCUS_21350 gene recN 2625979 2627676 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_21350 2627914 2629125 gene locus_tag LOCUS_21360 gene spoIVB 2627914 2629125 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_21360 2629346 2630170 gene locus_tag LOCUS_21370 gene spo0A 2629346 2630170 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_21370 2630373 2631332 gene locus_tag LOCUS_21380 gene axeA 2630373 2631332 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_21380 2631410 2632594 gene locus_tag LOCUS_21390 2631410 2632594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2632868 2634595 gene locus_tag LOCUS_21400 2632868 2634595 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944619.1 protein_id gnl|my_center|LOCUS_21400 2634632 2635681 gene locus_tag LOCUS_21410 2634632 2635681 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809246.1 protein_id gnl|my_center|LOCUS_21410 2635681 2636703 gene locus_tag LOCUS_21420 2635681 2636703 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948409.1 protein_id gnl|my_center|LOCUS_21420 2639202 2636860 gene locus_tag LOCUS_21430 gene yicI 2639202 2636860 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964400.1 protein_id gnl|my_center|LOCUS_21430 2639331 2640227 gene locus_tag LOCUS_21440 2639331 2640227 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_21440 2640617 2640303 gene locus_tag LOCUS_21450 2640617 2640303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 2641171 2640989 gene locus_tag LOCUS_21460 2641171 2640989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2641315 2642754 gene locus_tag LOCUS_21470 gene lpdA 2641315 2642754 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 protein_id gnl|my_center|LOCUS_21470 2643053 2644081 gene locus_tag LOCUS_21480 gene bfmBAA 2643053 2644081 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852548.1 protein_id gnl|my_center|LOCUS_21480 2644085 2645071 gene locus_tag LOCUS_21490 gene bfmBAB 2644085 2645071 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_21490 2645100 2646551 gene locus_tag LOCUS_21500 2645100 2646551 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257658.1 protein_id gnl|my_center|LOCUS_21500 2646706 2647416 gene locus_tag LOCUS_21510 gene lipB 2646706 2647416 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258689.1 protein_id gnl|my_center|LOCUS_21510 2647563 2648693 gene locus_tag LOCUS_21520 2647563 2648693 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609803.1 protein_id gnl|my_center|LOCUS_21520 2648693 2648842 gene locus_tag LOCUS_21530 2648693 2648842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 2649769 2648801 gene locus_tag LOCUS_21540 2649769 2648801 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346255.1 protein_id gnl|my_center|LOCUS_21540 2651362 2649818 gene locus_tag LOCUS_21550 gene bmr3 2651362 2649818 CDS product multidrug efflux MFS transporter Bmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246377.1 protein_id gnl|my_center|LOCUS_21550 2651947 2651423 gene locus_tag LOCUS_21560 2651947 2651423 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678346.1 protein_id gnl|my_center|LOCUS_21560 2652149 2653117 gene locus_tag LOCUS_21570 2652149 2653117 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259696.1 protein_id gnl|my_center|LOCUS_21570 2653292 2654539 gene locus_tag LOCUS_21580 2653292 2654539 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015138.1 protein_id gnl|my_center|LOCUS_21580 2654647 2655519 gene locus_tag LOCUS_21590 2654647 2655519 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_21590 2655519 2656355 gene locus_tag LOCUS_21600 2655519 2656355 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_21600 2656410 2658062 gene locus_tag LOCUS_21610 gene malL 2656410 2658062 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415207.1 protein_id gnl|my_center|LOCUS_21610 2659261 2658218 gene locus_tag LOCUS_21620 2659261 2658218 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_21620 2660240 2659245 gene locus_tag LOCUS_21630 2660240 2659245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 2661404 2660244 gene locus_tag LOCUS_21640 2661404 2660244 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_21640 2661614 2662216 gene locus_tag LOCUS_21650 2661614 2662216 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977103.1 protein_id gnl|my_center|LOCUS_21650 2662209 2663042 gene locus_tag LOCUS_21660 2662209 2663042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2664266 2663085 gene locus_tag LOCUS_21670 2664266 2663085 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246304.1 protein_id gnl|my_center|LOCUS_21670 2664373 2665317 gene locus_tag LOCUS_21680 2664373 2665317 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434114.1 protein_id gnl|my_center|LOCUS_21680 2665522 2665349 gene locus_tag LOCUS_21690 2665522 2665349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2665655 2666239 gene locus_tag LOCUS_21700 2665655 2666239 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_21700 2666236 2667462 gene locus_tag LOCUS_21710 2666236 2667462 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_21710 2667528 2668148 gene locus_tag LOCUS_21720 gene spoIIM 2667528 2668148 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000269093.1 protein_id gnl|my_center|LOCUS_21720 2668281 2668769 gene locus_tag LOCUS_21730 2668281 2668769 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831103.1 protein_id gnl|my_center|LOCUS_21730 2669354 2668878 gene locus_tag LOCUS_21740 2669354 2668878 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114194.1 protein_id gnl|my_center|LOCUS_21740 2669536 2669997 gene locus_tag LOCUS_21750 2669536 2669997 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035518.1 protein_id gnl|my_center|LOCUS_21750 2670001 2670465 gene locus_tag LOCUS_21760 2670001 2670465 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905907.1 protein_id gnl|my_center|LOCUS_21760 2671785 2670559 gene locus_tag LOCUS_21770 2671785 2670559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2671952 2672185 gene locus_tag LOCUS_21780 2671952 2672185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2672257 2673177 gene locus_tag LOCUS_21790 gene xerD 2672257 2673177 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_21790 2673211 2674386 gene locus_tag LOCUS_21800 gene deoB 2673211 2674386 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_21800 2674419 2675243 gene locus_tag LOCUS_21810 2674419 2675243 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_21810 2675279 2676586 gene locus_tag LOCUS_21820 2675279 2676586 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243952.1 protein_id gnl|my_center|LOCUS_21820 2678090 2679307 gene locus_tag LOCUS_21830 gene dacF 2678090 2679307 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_21830 2679473 2679826 gene locus_tag LOCUS_21840 gene spoIIAA 2679473 2679826 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059135.1 protein_id gnl|my_center|LOCUS_21840 2679823 2680269 gene locus_tag LOCUS_21850 gene spoIIAB 2679823 2680269 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_21850 2680292 2681050 gene locus_tag LOCUS_21860 gene sigF 2680292 2681050 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_21860 2681199 2681831 gene locus_tag LOCUS_21870 gene spoVAA 2681199 2681831 CDS product stage V sporulation protein SpoVAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246053.1 protein_id gnl|my_center|LOCUS_21870 2681824 2682258 gene locus_tag LOCUS_21880 gene spoVAB 2681824 2682258 CDS product stage V sporulation protein SpoVAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572936.1 protein_id gnl|my_center|LOCUS_21880 2682273 2683988 gene locus_tag LOCUS_21890 2682273 2683988 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_21890 2684158 2685489 gene locus_tag LOCUS_21900 gene lysA 2684158 2685489 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_21900 2685633 2686061 gene locus_tag LOCUS_21910 2685633 2686061 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_21910 2686364 2687365 gene locus_tag LOCUS_21920 2686364 2687365 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_21920 2687953 2689059 gene locus_tag LOCUS_21930 gene ribD 2687953 2689059 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_21930 2689063 2689740 gene locus_tag LOCUS_21940 gene ribE 2689063 2689740 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398505.1 protein_id gnl|my_center|LOCUS_21940 2689769 2691055 gene locus_tag LOCUS_21950 gene ribBA 2689769 2691055 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468974.1 protein_id gnl|my_center|LOCUS_21950 2691062 2691532 gene locus_tag LOCUS_21960 gene ribH 2691062 2691532 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230892.1 protein_id gnl|my_center|LOCUS_21960 2691629 2692441 gene locus_tag LOCUS_21970 gene scpA 2691629 2692441 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_21970 2692410 2693162 gene locus_tag LOCUS_21980 2692410 2693162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2693229 2693930 gene locus_tag LOCUS_21990 2693229 2693930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2694086 2694577 gene locus_tag LOCUS_22000 gene ytfJ 2694086 2694577 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398631.1 protein_id gnl|my_center|LOCUS_22000 2694756 2695898 gene locus_tag LOCUS_22010 gene dacB 2694756 2695898 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252638.1 protein_id gnl|my_center|LOCUS_22010 2695925 2696575 gene locus_tag LOCUS_22020 gene spmA 2695925 2696575 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 protein_id gnl|my_center|LOCUS_22020 2696612 2697142 gene locus_tag LOCUS_22030 2696612 2697142 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_22030 2697235 2697963 gene locus_tag LOCUS_22040 gene rluB 2697235 2697963 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_22040 2698096 2698626 gene locus_tag LOCUS_22050 gene resA 2698096 2698626 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742200.1 protein_id gnl|my_center|LOCUS_22050 2698651 2700330 gene locus_tag LOCUS_22060 gene resB 2698651 2700330 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230515.1 protein_id gnl|my_center|LOCUS_22060 2700327 2701586 gene locus_tag LOCUS_22070 gene resC 2700327 2701586 CDS product cytochrome c biogenesis protein ResC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398799.1 protein_id gnl|my_center|LOCUS_22070 2701640 2702353 gene locus_tag LOCUS_22080 gene resD 2701640 2702353 CDS product DNA-binding response regulator ResD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426862.1 protein_id gnl|my_center|LOCUS_22080 2702357 2703787 gene locus_tag LOCUS_22090 2702357 2703787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2705468 2703876 gene locus_tag LOCUS_22100 gene serA 2705468 2703876 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_22100 2706574 2705651 gene locus_tag LOCUS_22110 2706574 2705651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2706670 2707269 gene locus_tag LOCUS_22120 2706670 2707269 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886558.1 protein_id gnl|my_center|LOCUS_22120 2707266 2707571 gene locus_tag LOCUS_22130 2707266 2707571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2708524 2707628 gene locus_tag LOCUS_22140 2708524 2707628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2708699 2709073 gene locus_tag LOCUS_22150 2708699 2709073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 2709308 2709910 gene locus_tag LOCUS_22160 2709308 2709910 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235392.1 protein_id gnl|my_center|LOCUS_22160 2710015 2710704 gene locus_tag LOCUS_22170 gene prsW 2710015 2710704 CDS product glutamic-type intramembrane protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230542.1 protein_id gnl|my_center|LOCUS_22170 2710983 2712362 gene locus_tag LOCUS_22180 gene ypeB 2710983 2712362 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943704.1 protein_id gnl|my_center|LOCUS_22180 2712536 2713192 gene locus_tag LOCUS_22190 2712536 2713192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 2713215 2713409 gene locus_tag LOCUS_22200 2713215 2713409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2713621 2714325 gene locus_tag LOCUS_22210 gene cmk 2713621 2714325 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361252.1 protein_id gnl|my_center|LOCUS_22210 2714329 2714916 gene locus_tag LOCUS_22220 2714329 2714916 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_22220 2715031 2716272 gene locus_tag LOCUS_22230 gene rpsA 2715031 2716272 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229574.1 protein_id gnl|my_center|LOCUS_22230 2716412 2717332 gene locus_tag LOCUS_22240 2716412 2717332 CDS product YIEGIA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141596.1 protein_id gnl|my_center|LOCUS_22240 2717325 2717504 gene locus_tag LOCUS_22250 2717325 2717504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 2717611 2718933 gene locus_tag LOCUS_22260 gene der 2717611 2718933 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_22260 2718946 2719566 gene locus_tag LOCUS_22270 gene plsY 2718946 2719566 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_22270 2719556 2720590 gene locus_tag LOCUS_22280 gene gpsA 2719556 2720590 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230566.1 protein_id gnl|my_center|LOCUS_22280 2720680 2720955 gene locus_tag LOCUS_22290 2720680 2720955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 2721137 2721757 gene locus_tag LOCUS_22300 2721137 2721757 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047745.1 protein_id gnl|my_center|LOCUS_22300 2721954 2722133 gene locus_tag LOCUS_22310 2721954 2722133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 2722163 2722456 gene locus_tag LOCUS_22320 2722163 2722456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 2722470 2723093 gene locus_tag LOCUS_22330 2722470 2723093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 2723083 2723442 gene locus_tag LOCUS_22340 2723083 2723442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2723436 2724239 gene locus_tag LOCUS_22350 2723436 2724239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755475.1 protein_id gnl|my_center|LOCUS_22350 2724498 2725976 gene locus_tag LOCUS_22360 gene spoIVA 2724498 2725976 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230572.1 protein_id gnl|my_center|LOCUS_22360 2726210 2727358 gene locus_tag LOCUS_22370 2726210 2727358 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732065.1 protein_id gnl|my_center|LOCUS_22370 2727445 2728962 gene locus_tag LOCUS_22380 2727445 2728962 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097622.1 protein_id gnl|my_center|LOCUS_22380 2728959 2729945 gene locus_tag LOCUS_22390 2728959 2729945 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049242.1 protein_id gnl|my_center|LOCUS_22390 2730059 2730331 gene locus_tag LOCUS_22400 gene hbs 2730059 2730331 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_22400 2731092 2732420 gene locus_tag LOCUS_22410 gene ltrA 2731092 2732420 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 protein_id gnl|my_center|LOCUS_22410 2732682 2733350 gene locus_tag LOCUS_22420 2732682 2733350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2733340 2733864 gene locus_tag LOCUS_22430 2733340 2733864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 2733861 2733983 gene locus_tag LOCUS_22440 2733861 2733983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 2733980 2734360 gene locus_tag LOCUS_22450 2733980 2734360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2734498 2734574 gene locus_tag LOCUS_t00220 2734498 2734574 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2734694 2734918 gene locus_tag LOCUS_22460 gene mtrB 2734694 2734918 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_22460 2735009 2735527 gene locus_tag LOCUS_22470 2735009 2735527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2735628 2736506 gene locus_tag LOCUS_22480 2735628 2736506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2736512 2737231 gene locus_tag LOCUS_22490 gene menG 2736512 2737231 CDS product 2-heptaprenyl-1,4-naphthoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187667.1 protein_id gnl|my_center|LOCUS_22490 2737228 2738103 gene locus_tag LOCUS_22500 gene ubiA 2737228 2738103 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_22500 2738097 2738720 gene locus_tag LOCUS_22510 2738097 2738720 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941109.1 protein_id gnl|my_center|LOCUS_22510 2738710 2739591 gene locus_tag LOCUS_22520 2738710 2739591 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_22520 2739607 2740581 gene locus_tag LOCUS_22530 gene hepT 2739607 2740581 CDS product heptaprenyl diphosphate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886555.1 protein_id gnl|my_center|LOCUS_22530 2740682 2741125 gene locus_tag LOCUS_22540 gene ndk 2740682 2741125 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723912.1 protein_id gnl|my_center|LOCUS_22540 2741165 2741971 gene locus_tag LOCUS_22550 gene cheR 2741165 2741971 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_22550 2741968 2742216 gene locus_tag LOCUS_22560 2741968 2742216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2742351 2743526 gene locus_tag LOCUS_22570 gene aroC 2742351 2743526 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398727.1 protein_id gnl|my_center|LOCUS_22570 2743528 2744640 gene locus_tag LOCUS_22580 gene aroB 2743528 2744640 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369386.1 protein_id gnl|my_center|LOCUS_22580 2744646 2745017 gene locus_tag LOCUS_22590 gene aroH 2744646 2745017 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967606.1 protein_id gnl|my_center|LOCUS_22590 2745136 2745351 gene locus_tag LOCUS_22600 2745136 2745351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2745357 2746940 gene locus_tag LOCUS_22610 gene trpE 2745357 2746940 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_22610 2746976 2748025 gene locus_tag LOCUS_22620 gene trpD 2746976 2748025 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_22620 2748015 2748827 gene locus_tag LOCUS_22630 gene trpC 2748015 2748827 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_22630 2748824 2749582 gene locus_tag LOCUS_22640 2748824 2749582 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398742.1 protein_id gnl|my_center|LOCUS_22640 2749579 2750781 gene locus_tag LOCUS_22650 gene trpB 2749579 2750781 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943010.1 protein_id gnl|my_center|LOCUS_22650 2750778 2751623 gene locus_tag LOCUS_22660 gene trpA 2750778 2751623 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_22660 2751829 2752926 gene locus_tag LOCUS_22670 gene hisC 2751829 2752926 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_22670 2752930 2754078 gene locus_tag LOCUS_22680 2752930 2754078 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989842.1 protein_id gnl|my_center|LOCUS_22680 2754525 2755130 gene locus_tag LOCUS_22690 2754525 2755130 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_22690 2755127 2755726 gene locus_tag LOCUS_22700 2755127 2755726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2755735 2756307 gene locus_tag LOCUS_22710 2755735 2756307 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_22710 2756563 2757819 gene locus_tag LOCUS_22720 2756563 2757819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2757957 2758136 gene locus_tag LOCUS_22730 2757957 2758136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2758293 2758715 gene locus_tag LOCUS_22740 2758293 2758715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2758959 2759492 gene locus_tag LOCUS_22750 gene qcrA 2758959 2759492 CDS product menaquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290418.1 protein_id gnl|my_center|LOCUS_22750 2759511 2760182 gene locus_tag LOCUS_22760 gene qcrB 2759511 2760182 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932700.1 protein_id gnl|my_center|LOCUS_22760 2760202 2761071 gene locus_tag LOCUS_22770 2760202 2761071 CDS product menaquinol-cytochrome c reductase cytochrome b/c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225562.1 protein_id gnl|my_center|LOCUS_22770 2761145 2761813 gene locus_tag LOCUS_22780 2761145 2761813 CDS product DUF1405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886552.1 protein_id gnl|my_center|LOCUS_22780 2761854 2762708 gene locus_tag LOCUS_22790 2761854 2762708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2763592 2762723 gene locus_tag LOCUS_22800 2763592 2762723 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202121.1 protein_id gnl|my_center|LOCUS_22800 2763681 2764049 gene locus_tag LOCUS_22810 2763681 2764049 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398996.1 protein_id gnl|my_center|LOCUS_22810 2764092 2764643 gene locus_tag LOCUS_22820 2764092 2764643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2764650 2765453 gene locus_tag LOCUS_22830 gene dapB 2764650 2765453 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_22830 2765513 2765935 gene locus_tag LOCUS_22840 gene mgsA 2765513 2765935 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_22840 2765944 2766636 gene locus_tag LOCUS_22850 gene bshB1 2765944 2766636 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015673.1 protein_id gnl|my_center|LOCUS_22850 2766751 2767917 gene locus_tag LOCUS_22860 gene bshA 2766751 2767917 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768305.1 protein_id gnl|my_center|LOCUS_22860 2767969 2769294 gene locus_tag LOCUS_22870 2767969 2769294 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101577.1 protein_id gnl|my_center|LOCUS_22870 2769331 2770338 gene locus_tag LOCUS_22880 2769331 2770338 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230650.1 protein_id gnl|my_center|LOCUS_22880 2770635 2771498 gene locus_tag LOCUS_22890 gene panB 2770635 2771498 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212979991.1 protein_id gnl|my_center|LOCUS_22890 2771495 2772403 gene locus_tag LOCUS_22900 gene panC 2771495 2772403 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_22900 2772403 2772786 gene locus_tag LOCUS_22910 gene panD 2772403 2772786 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_22910 2772857 2773519 gene locus_tag LOCUS_22920 2772857 2773519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 2773611 2776673 gene locus_tag LOCUS_22930 gene dinG 2773611 2776673 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044941.1 protein_id gnl|my_center|LOCUS_22930 2776670 2777422 gene locus_tag LOCUS_22940 2776670 2777422 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772968.1 protein_id gnl|my_center|LOCUS_22940 2777419 2778723 gene locus_tag LOCUS_22950 2777419 2778723 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_22950 2778720 2779244 gene locus_tag LOCUS_22960 2778720 2779244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 2779487 2780020 gene locus_tag LOCUS_22970 2779487 2780020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2780013 2781512 gene locus_tag LOCUS_22980 2780013 2781512 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812900.1 protein_id gnl|my_center|LOCUS_22980 2781700 2782263 gene locus_tag LOCUS_22990 2781700 2782263 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438320.1 protein_id gnl|my_center|LOCUS_22990 2782250 2783512 gene locus_tag LOCUS_23000 2782250 2783512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 2783673 2784890 gene locus_tag LOCUS_23010 gene hisC 2783673 2784890 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_23010 2785060 2785932 gene locus_tag LOCUS_23020 2785060 2785932 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_23020 2785929 2787152 gene locus_tag LOCUS_23030 2785929 2787152 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_23030 2787145 2787870 gene locus_tag LOCUS_23040 2787145 2787870 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392699.1 protein_id gnl|my_center|LOCUS_23040 2787917 2788300 gene locus_tag LOCUS_23050 2787917 2788300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2788527 2788297 gene locus_tag LOCUS_23060 2788527 2788297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2788423 2788815 gene locus_tag LOCUS_23070 2788423 2788815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2789531 2788893 gene locus_tag LOCUS_23080 2789531 2788893 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244782.1 protein_id gnl|my_center|LOCUS_23080 2790210 2789536 gene locus_tag LOCUS_23090 gene mtnX 2790210 2789536 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_23090 2791445 2790207 gene locus_tag LOCUS_23100 gene mtnW 2791445 2790207 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_23100 2792437 2791568 gene locus_tag LOCUS_23110 gene proC 2792437 2791568 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886524.1 protein_id gnl|my_center|LOCUS_23110 2793741 2792494 gene locus_tag LOCUS_23120 2793741 2792494 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_23120 2793214 2793300 gene locus_tag LOCUS_t00230 2793214 2793300 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2794856 2793738 gene locus_tag LOCUS_23130 gene proB 2794856 2793738 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744710.1 protein_id gnl|my_center|LOCUS_23130 2796472 2795294 gene locus_tag LOCUS_23140 2796472 2795294 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765511.1 protein_id gnl|my_center|LOCUS_23140 2796690 2797493 gene locus_tag LOCUS_23150 2796690 2797493 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_23150 2798425 2797523 gene locus_tag LOCUS_23160 2798425 2797523 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_23160 2798564 2799970 gene locus_tag LOCUS_23170 gene leuC 2798564 2799970 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229604.1 protein_id gnl|my_center|LOCUS_23170 2799989 2800597 gene locus_tag LOCUS_23180 gene leuD 2799989 2800597 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_23180 2800822 2800598 gene locus_tag LOCUS_23190 2800822 2800598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 2800821 2802359 gene locus_tag LOCUS_23200 2800821 2802359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 2802404 2805112 gene locus_tag LOCUS_23210 2802404 2805112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2805808 2806482 gene locus_tag LOCUS_23220 gene nth 2805808 2806482 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933025.1 protein_id gnl|my_center|LOCUS_23220 2806479 2810180 gene locus_tag LOCUS_23230 2806479 2810180 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182166.1 protein_id gnl|my_center|LOCUS_23230 2810465 2812249 gene locus_tag LOCUS_23240 2810465 2812249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967136.1 protein_id gnl|my_center|LOCUS_23240 2812246 2814045 gene locus_tag LOCUS_23250 2812246 2814045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232362.1 protein_id gnl|my_center|LOCUS_23250 2814223 2815047 gene locus_tag LOCUS_23260 2814223 2815047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2815065 2816108 gene locus_tag LOCUS_23270 2815065 2816108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207717.1 protein_id gnl|my_center|LOCUS_23270 2816092 2817078 gene locus_tag LOCUS_23280 2816092 2817078 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206490.1 protein_id gnl|my_center|LOCUS_23280 2817184 2817516 gene locus_tag LOCUS_23290 2817184 2817516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 2817698 2819671 gene locus_tag LOCUS_23300 gene parE 2817698 2819671 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062193.1 protein_id gnl|my_center|LOCUS_23300 2819688 2822165 gene locus_tag LOCUS_23310 gene parC 2819688 2822165 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147466.1 protein_id gnl|my_center|LOCUS_23310 2822498 2822322 gene locus_tag LOCUS_23320 2822498 2822322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2822711 2823178 gene locus_tag LOCUS_23330 2822711 2823178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2823415 2824857 gene locus_tag LOCUS_23340 2823415 2824857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 2824871 2826688 gene locus_tag LOCUS_23350 2824871 2826688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 2826691 2827755 gene locus_tag LOCUS_23360 2826691 2827755 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760828.1 protein_id gnl|my_center|LOCUS_23360 2827752 2830136 gene locus_tag LOCUS_23370 2827752 2830136 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109016.1 protein_id gnl|my_center|LOCUS_23370 2830140 2831369 gene locus_tag LOCUS_23380 2830140 2831369 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467385.1 protein_id gnl|my_center|LOCUS_23380 2831540 2832475 gene locus_tag LOCUS_23390 2831540 2832475 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074553996.1 protein_id gnl|my_center|LOCUS_23390 2833402 2832533 gene locus_tag LOCUS_23400 2833402 2832533 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_23400 2834191 2833460 gene locus_tag LOCUS_23410 2834191 2833460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_23410 2834292 2836373 gene locus_tag LOCUS_23420 2834292 2836373 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002081021.1 protein_id gnl|my_center|LOCUS_23420 2836370 2836996 gene locus_tag LOCUS_23430 2836370 2836996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2837330 2836968 gene locus_tag LOCUS_23440 2837330 2836968 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232719.1 protein_id gnl|my_center|LOCUS_23440 2837518 2837997 gene locus_tag LOCUS_23450 2837518 2837997 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392657.1 protein_id gnl|my_center|LOCUS_23450 2838389 2839366 gene locus_tag LOCUS_23460 2838389 2839366 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398762.1 protein_id gnl|my_center|LOCUS_23460 2841721 2839451 gene locus_tag LOCUS_23470 2841721 2839451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 2842001 2842969 gene locus_tag LOCUS_23480 gene rmgP 2842001 2842969 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_23480 2842983 2843855 gene locus_tag LOCUS_23490 2842983 2843855 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_23490 2843959 2845539 gene locus_tag LOCUS_23500 2843959 2845539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2845575 2846729 gene locus_tag LOCUS_23510 2845575 2846729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 2846795 2849374 gene locus_tag LOCUS_23520 2846795 2849374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2849595 2852042 gene locus_tag LOCUS_23530 2849595 2852042 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967094.1 protein_id gnl|my_center|LOCUS_23530 2852388 2852098 gene locus_tag LOCUS_23540 2852388 2852098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2852841 2852395 gene locus_tag LOCUS_23550 2852841 2852395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 2852978 2853538 gene locus_tag LOCUS_23560 2852978 2853538 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230498.1 protein_id gnl|my_center|LOCUS_23560 2854164 2853565 gene locus_tag LOCUS_23570 2854164 2853565 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423380.1 protein_id gnl|my_center|LOCUS_23570 2854527 2854180 gene locus_tag LOCUS_23580 2854527 2854180 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226552.1 protein_id gnl|my_center|LOCUS_23580 2854642 2856171 gene locus_tag LOCUS_23590 gene ypwA 2854642 2856171 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215104.1 protein_id gnl|my_center|LOCUS_23590 2857145 2856252 gene locus_tag LOCUS_23600 2857145 2856252 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243004.1 protein_id gnl|my_center|LOCUS_23600 2857265 2858047 gene locus_tag LOCUS_23610 2857265 2858047 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776832.1 protein_id gnl|my_center|LOCUS_23610 2858200 2859369 gene locus_tag LOCUS_23620 2858200 2859369 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983707.1 protein_id gnl|my_center|LOCUS_23620 2859552 2862335 gene locus_tag LOCUS_23630 2859552 2862335 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_23630 2862492 2863748 gene locus_tag LOCUS_23640 2862492 2863748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2863757 2865577 gene locus_tag LOCUS_23650 2863757 2865577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2866360 2867259 gene locus_tag LOCUS_23660 2866360 2867259 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_23660 2867302 2868192 gene locus_tag LOCUS_23670 2867302 2868192 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830948.1 protein_id gnl|my_center|LOCUS_23670 2868239 2869876 gene locus_tag LOCUS_23680 2868239 2869876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 2869892 2870899 gene locus_tag LOCUS_23690 2869892 2870899 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583643.1 protein_id gnl|my_center|LOCUS_23690 2870915 2874730 gene locus_tag LOCUS_23700 2870915 2874730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 2874798 2875871 gene locus_tag LOCUS_23710 2874798 2875871 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_23710 2876047 2877036 gene locus_tag LOCUS_23720 2876047 2877036 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246146.1 protein_id gnl|my_center|LOCUS_23720 2877156 2877713 gene locus_tag LOCUS_23730 gene cotE 2877156 2877713 CDS product outer spore coat protein CotE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231833.1 protein_id gnl|my_center|LOCUS_23730 2877964 2879490 gene locus_tag LOCUS_23740 2877964 2879490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2879968 2882706 gene locus_tag LOCUS_23750 gene mutS 2879968 2882706 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209880066.1 protein_id gnl|my_center|LOCUS_23750 2882709 2884145 gene locus_tag LOCUS_23760 2882709 2884145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2884181 2886292 gene locus_tag LOCUS_23770 gene mutL 2884181 2886292 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_23770 2886289 2887071 gene locus_tag LOCUS_23780 2886289 2887071 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_23780 2887068 2888021 gene locus_tag LOCUS_23790 gene miaA 2887068 2888021 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_23790 2888074 2888316 gene locus_tag LOCUS_23800 gene hfq 2888074 2888316 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 protein_id gnl|my_center|LOCUS_23800 2888476 2891106 gene locus_tag LOCUS_23810 2888476 2891106 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233213.1 protein_id gnl|my_center|LOCUS_23810 2891206 2891646 gene locus_tag LOCUS_23820 2891206 2891646 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460051.1 protein_id gnl|my_center|LOCUS_23820 2891672 2892328 gene locus_tag LOCUS_23830 2891672 2892328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2892325 2892981 gene locus_tag LOCUS_23840 2892325 2892981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 2893071 2894090 gene locus_tag LOCUS_23850 gene spoVK 2893071 2894090 CDS product stage V sporulation protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231746.1 protein_id gnl|my_center|LOCUS_23850 2894155 2895477 gene locus_tag LOCUS_23860 gene hflX 2894155 2895477 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245432.1 protein_id gnl|my_center|LOCUS_23860 2895518 2896825 gene locus_tag LOCUS_23870 2895518 2896825 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460292.1 protein_id gnl|my_center|LOCUS_23870 2896952 2897371 gene locus_tag LOCUS_23880 gene glnR 2896952 2897371 CDS product transcriptional repressor GlnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238341.1 protein_id gnl|my_center|LOCUS_23880 2897405 2898733 gene locus_tag LOCUS_23890 gene glnA 2897405 2898733 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135328.1 protein_id gnl|my_center|LOCUS_23890 2899443 2898820 gene locus_tag LOCUS_23900 gene lexA 2899443 2898820 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_23900 2899609 2900058 gene locus_tag LOCUS_23910 2899609 2900058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2900220 2900417 gene locus_tag LOCUS_23920 2900220 2900417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 2900540 2901058 gene locus_tag LOCUS_23930 2900540 2901058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 2901126 2901926 gene locus_tag LOCUS_23940 2901126 2901926 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398978.1 protein_id gnl|my_center|LOCUS_23940 2902527 2901988 gene locus_tag LOCUS_23950 2902527 2901988 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057305.1 protein_id gnl|my_center|LOCUS_23950 2902704 2906153 gene locus_tag LOCUS_23960 gene metH 2902704 2906153 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_23960 2906547 2908841 gene locus_tag LOCUS_23970 gene mrfA 2906547 2908841 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_23970 2908838 2910298 gene locus_tag LOCUS_23980 gene mrfB 2908838 2910298 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_23980 2910430 2911290 gene locus_tag LOCUS_23990 2910430 2911290 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 protein_id gnl|my_center|LOCUS_23990 2911384 2912202 gene locus_tag LOCUS_24000 gene mutM 2911384 2912202 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114478.1 protein_id gnl|my_center|LOCUS_24000 2912204 2913046 gene locus_tag LOCUS_24010 2912204 2913046 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881054.1 protein_id gnl|my_center|LOCUS_24010 2913048 2913407 gene locus_tag LOCUS_24020 2913048 2913407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 2913404 2913745 gene locus_tag LOCUS_24030 2913404 2913745 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002008881.1 protein_id gnl|my_center|LOCUS_24030 2913732 2914505 gene locus_tag LOCUS_24040 2913732 2914505 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_24040 2914507 2915526 gene locus_tag LOCUS_24050 2914507 2915526 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134749050.1 protein_id gnl|my_center|LOCUS_24050 2915746 2917359 gene locus_tag LOCUS_24060 2915746 2917359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 2917534 2918229 gene locus_tag LOCUS_24070 gene ykoG 2917534 2918229 CDS product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 protein_id gnl|my_center|LOCUS_24070 2918226 2919575 gene locus_tag LOCUS_24080 gene ykoH 2918226 2919575 CDS product two-component system sensor histidine kinase YkoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245526.1 protein_id gnl|my_center|LOCUS_24080 2920177 2919677 gene locus_tag LOCUS_24090 2920177 2919677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2920410 2921270 gene locus_tag LOCUS_24100 2920410 2921270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2921286 2921945 gene locus_tag LOCUS_24110 2921286 2921945 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245627.1 protein_id gnl|my_center|LOCUS_24110 2922303 2924201 gene locus_tag LOCUS_24120 2922303 2924201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 2924433 2926052 gene locus_tag LOCUS_24130 2924433 2926052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2926049 2927863 gene locus_tag LOCUS_24140 gene yesM 2926049 2927863 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_24140 2928164 2932753 gene locus_tag LOCUS_24150 2928164 2932753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 2932832 2933014 gene locus_tag LOCUS_24160 2932832 2933014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2933027 2933971 gene locus_tag LOCUS_24170 2933027 2933971 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_24170 2933998 2934939 gene locus_tag LOCUS_24180 2933998 2934939 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_24180 2935034 2936830 gene locus_tag LOCUS_24190 2935034 2936830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2936935 2939931 gene locus_tag LOCUS_24200 2936935 2939931 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_24200 2939924 2942623 gene locus_tag LOCUS_24210 2939924 2942623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 2942739 2943419 gene locus_tag LOCUS_24220 2942739 2943419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2943472 2944287 gene locus_tag LOCUS_24230 2943472 2944287 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257270.1 protein_id gnl|my_center|LOCUS_24230 2945722 2945204 gene locus_tag LOCUS_24240 2945722 2945204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2947785 2945788 gene locus_tag LOCUS_24250 2947785 2945788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 2948501 2947872 gene locus_tag LOCUS_24260 2948501 2947872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 2948669 2949121 gene locus_tag LOCUS_24270 2948669 2949121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24270 2949136 2949477 gene locus_tag LOCUS_24280 2949136 2949477 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_24280 2949541 2950905 gene locus_tag LOCUS_24290 2949541 2950905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2950922 2953147 gene locus_tag LOCUS_24300 2950922 2953147 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_24300 2953172 2953840 gene locus_tag LOCUS_24310 2953172 2953840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 2953837 2954637 gene locus_tag LOCUS_24320 2953837 2954637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 2954946 2956655 gene locus_tag LOCUS_24330 2954946 2956655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2956726 2957160 gene locus_tag LOCUS_24340 2956726 2957160 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_24340 2957448 2957828 gene locus_tag LOCUS_24350 2957448 2957828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_24350 2957846 2958019 gene locus_tag LOCUS_24360 2957846 2958019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2958028 2958477 gene locus_tag LOCUS_24370 2958028 2958477 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_24370 2958905 2959096 gene locus_tag LOCUS_24380 2958905 2959096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 2959286 2959459 gene locus_tag LOCUS_24390 2959286 2959459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 2960448 2959906 gene locus_tag LOCUS_24400 2960448 2959906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2962942 2963289 gene locus_tag LOCUS_24410 2962942 2963289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 2963304 2963930 gene locus_tag LOCUS_24420 2963304 2963930 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_24420 2963937 2965034 gene locus_tag LOCUS_24430 2963937 2965034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24430 2965031 2965744 gene locus_tag LOCUS_24440 2965031 2965744 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_24440 2965793 2966194 gene locus_tag LOCUS_24450 2965793 2966194 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_24450 2966225 2969320 gene locus_tag LOCUS_24460 2966225 2969320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 2969463 2971754 gene locus_tag LOCUS_24470 2969463 2971754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2971810 2973915 gene locus_tag LOCUS_24480 2971810 2973915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2973965 2975608 gene locus_tag LOCUS_24490 2973965 2975608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2975756 2975965 gene locus_tag LOCUS_24500 2975756 2975965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2978137 2975987 gene locus_tag LOCUS_24510 2978137 2975987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2978496 2978140 gene locus_tag LOCUS_24520 2978496 2978140 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_24520 2978730 2981474 gene locus_tag LOCUS_24530 2978730 2981474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 2981550 2982074 gene locus_tag LOCUS_24540 2981550 2982074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2982090 2985128 gene locus_tag LOCUS_24550 2982090 2985128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2985907 2985251 gene locus_tag LOCUS_24560 2985907 2985251 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830164.1 protein_id gnl|my_center|LOCUS_24560 2986127 2986783 gene locus_tag LOCUS_24570 2986127 2986783 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312272.1 protein_id gnl|my_center|LOCUS_24570 2986786 2987271 gene locus_tag LOCUS_24580 gene yfkJ 2986786 2987271 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243480.1 protein_id gnl|my_center|LOCUS_24580 2988194 2987451 gene locus_tag LOCUS_24590 2988194 2987451 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245358.1 protein_id gnl|my_center|LOCUS_24590 2988483 2989583 gene locus_tag LOCUS_24600 gene pdhA 2988483 2989583 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222294.1 protein_id gnl|my_center|LOCUS_24600 2989743 2990720 gene locus_tag LOCUS_24610 gene pdhB 2989743 2990720 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068166.1 protein_id gnl|my_center|LOCUS_24610 2990740 2992095 gene locus_tag LOCUS_24620 gene pdhC 2990740 2992095 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232311.1 protein_id gnl|my_center|LOCUS_24620 2992099 2993520 gene locus_tag LOCUS_24630 gene lpdA 2992099 2993520 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232309.1 protein_id gnl|my_center|LOCUS_24630 2993848 2993657 gene locus_tag LOCUS_24640 2993848 2993657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 2996360 2994552 gene locus_tag LOCUS_24650 2996360 2994552 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470166.1 protein_id gnl|my_center|LOCUS_24650 2996534 2996695 gene locus_tag LOCUS_24660 2996534 2996695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2996833 2997336 gene locus_tag LOCUS_24670 2996833 2997336 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_24670 2997380 2998174 gene locus_tag LOCUS_24680 gene thyA 2997380 2998174 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704637.1 protein_id gnl|my_center|LOCUS_24680 2998295 2998816 gene locus_tag LOCUS_24690 2998295 2998816 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189313.1 protein_id gnl|my_center|LOCUS_24690 2998921 3000411 gene locus_tag LOCUS_24700 gene gltD 2998921 3000411 CDS product glutamate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231462.1 protein_id gnl|my_center|LOCUS_24700 3000515 3000829 gene locus_tag LOCUS_24710 3000515 3000829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 3000952 3002091 gene locus_tag LOCUS_24720 3000952 3002091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 3002130 3003107 gene locus_tag LOCUS_24730 3002130 3003107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415694.1 protein_id gnl|my_center|LOCUS_24730 3003886 3003149 gene locus_tag LOCUS_24740 3003886 3003149 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038877.1 protein_id gnl|my_center|LOCUS_24740 3004035 3003883 gene locus_tag LOCUS_24750 3004035 3003883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 3003986 3004201 gene locus_tag LOCUS_24760 3003986 3004201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 3004472 3004242 gene locus_tag LOCUS_24770 3004472 3004242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 3004618 3005346 gene locus_tag LOCUS_24780 gene phnC 3004618 3005346 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_24780 3005677 3006366 gene locus_tag LOCUS_24790 3005677 3006366 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262987.1 protein_id gnl|my_center|LOCUS_24790 3006363 3007115 gene locus_tag LOCUS_24800 3006363 3007115 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082464.1 protein_id gnl|my_center|LOCUS_24800 3008062 3007103 gene locus_tag LOCUS_24810 3008062 3007103 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_24810 3008186 3008707 gene locus_tag LOCUS_24820 3008186 3008707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 3008803 3009120 gene locus_tag LOCUS_24830 3008803 3009120 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637511.1 protein_id gnl|my_center|LOCUS_24830 3009185 3010096 gene locus_tag LOCUS_24840 3009185 3010096 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559357.1 protein_id gnl|my_center|LOCUS_24840 3010192 3010866 gene locus_tag LOCUS_24850 3010192 3010866 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_24850 3010942 3011955 gene locus_tag LOCUS_24860 3010942 3011955 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044939.1 protein_id gnl|my_center|LOCUS_24860 3012025 3013122 gene locus_tag LOCUS_24870 3012025 3013122 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815022.1 protein_id gnl|my_center|LOCUS_24870 3013106 3014509 gene locus_tag LOCUS_24880 3013106 3014509 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_24880 3014515 3015648 gene locus_tag LOCUS_24890 3014515 3015648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 3016213 3015722 gene locus_tag LOCUS_24900 3016213 3015722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 3016493 3016756 gene locus_tag LOCUS_24910 3016493 3016756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3017355 3016927 gene locus_tag LOCUS_24920 3017355 3016927 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429665.1 protein_id gnl|my_center|LOCUS_24920 3017461 3019587 gene locus_tag LOCUS_24930 3017461 3019587 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059519.1 protein_id gnl|my_center|LOCUS_24930 3019584 3020738 gene locus_tag LOCUS_24940 3019584 3020738 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_24940 3020745 3021167 gene locus_tag LOCUS_24950 3020745 3021167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 3021273 3021743 gene locus_tag LOCUS_24960 3021273 3021743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 3021701 3022336 gene locus_tag LOCUS_24970 gene tmrB 3021701 3022336 CDS product tunicamycin resistance ATP-binding TmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246258.1 protein_id gnl|my_center|LOCUS_24970 3023870 3022857 gene locus_tag LOCUS_24980 3023870 3022857 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582798.1 protein_id gnl|my_center|LOCUS_24980 3024007 3025797 gene locus_tag LOCUS_24990 3024007 3025797 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614258.1 protein_id gnl|my_center|LOCUS_24990 3025912 3026571 gene locus_tag LOCUS_25000 3025912 3026571 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582812.1 protein_id gnl|my_center|LOCUS_25000 3026587 3028116 gene locus_tag LOCUS_25010 gene rhaB 3026587 3028116 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_25010 3028366 3030048 gene locus_tag LOCUS_25020 3028366 3030048 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459470.1 protein_id gnl|my_center|LOCUS_25020 3031330 3030113 gene locus_tag LOCUS_25030 gene hitS 3031330 3030113 CDS product envelope stress sensor histidine kinase HitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231513.1 protein_id gnl|my_center|LOCUS_25030 3031998 3031327 gene locus_tag LOCUS_25040 gene hitR 3031998 3031327 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612413.1 protein_id gnl|my_center|LOCUS_25040 3032158 3033162 gene locus_tag LOCUS_25050 gene gluQRS 3032158 3033162 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_25050 3033184 3033723 gene locus_tag LOCUS_25060 3033184 3033723 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_25060 3033971 3035251 gene locus_tag LOCUS_25070 3033971 3035251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 3035254 3036276 gene locus_tag LOCUS_25080 3035254 3036276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 3036278 3036595 gene locus_tag LOCUS_25090 3036278 3036595 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018860.1 protein_id gnl|my_center|LOCUS_25090 3037729 3036641 gene locus_tag LOCUS_25100 gene xerS 3037729 3036641 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817875.1 protein_id gnl|my_center|LOCUS_25100 3038281 3037925 gene locus_tag LOCUS_25110 3038281 3037925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3038682 3038503 gene locus_tag LOCUS_25120 3038682 3038503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 3038753 3041071 gene locus_tag LOCUS_25130 3038753 3041071 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621686.1 protein_id gnl|my_center|LOCUS_25130 3041068 3041703 gene locus_tag LOCUS_25140 gene uvrY 3041068 3041703 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216518.1 protein_id gnl|my_center|LOCUS_25140 3041717 3042643 gene locus_tag LOCUS_25150 3041717 3042643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3042836 3043486 gene locus_tag LOCUS_25160 3042836 3043486 CDS product elongation factor G-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989551.1 protein_id gnl|my_center|LOCUS_25160 3044931 3044041 gene locus_tag LOCUS_25170 3044931 3044041 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967756.1 protein_id gnl|my_center|LOCUS_25170 3046566 3045088 gene locus_tag LOCUS_25180 gene gcvPB 3046566 3045088 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230209.1 protein_id gnl|my_center|LOCUS_25180 3047921 3046563 gene locus_tag LOCUS_25190 gene gcvPA 3047921 3046563 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230207.1 protein_id gnl|my_center|LOCUS_25190 3049040 3047931 gene locus_tag LOCUS_25200 gene gcvT 3049040 3047931 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_25200 3049471 3050577 gene locus_tag LOCUS_25210 3049471 3050577 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989410.1 protein_id gnl|my_center|LOCUS_25210 3050635 3051906 gene locus_tag LOCUS_25220 3050635 3051906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3051942 3052109 gene locus_tag LOCUS_25230 3051942 3052109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3053006 3052209 gene locus_tag LOCUS_25240 3053006 3052209 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_25240 3053293 3054261 gene locus_tag LOCUS_25250 gene iolX 3053293 3054261 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244942.1 protein_id gnl|my_center|LOCUS_25250 3054277 3055320 gene locus_tag LOCUS_25260 3054277 3055320 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_25260 3055338 3056861 gene locus_tag LOCUS_25270 gene xylB 3055338 3056861 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_25270 3056955 3057929 gene locus_tag LOCUS_25280 3056955 3057929 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_25280 3057926 3058531 gene locus_tag LOCUS_25290 gene pgiA 3057926 3058531 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250062.1 protein_id gnl|my_center|LOCUS_25290 3058563 3059510 gene locus_tag LOCUS_25300 3058563 3059510 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285055.1 protein_id gnl|my_center|LOCUS_25300 3059507 3060355 gene locus_tag LOCUS_25310 3059507 3060355 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974123.1 protein_id gnl|my_center|LOCUS_25310 3060413 3062203 gene locus_tag LOCUS_25320 3060413 3062203 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582799.1 protein_id gnl|my_center|LOCUS_25320 3062749 3063885 gene locus_tag LOCUS_25330 3062749 3063885 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437792.1 protein_id gnl|my_center|LOCUS_25330 3064760 3063963 gene locus_tag LOCUS_25340 3064760 3063963 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528749.1 protein_id gnl|my_center|LOCUS_25340 3064930 3065409 gene locus_tag LOCUS_25350 3064930 3065409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3065501 3066148 gene locus_tag LOCUS_25360 3065501 3066148 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285911.1 protein_id gnl|my_center|LOCUS_25360 3066325 3071385 gene locus_tag LOCUS_25370 3066325 3071385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 3071791 3071474 gene locus_tag LOCUS_25380 3071791 3071474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 3071754 3073223 gene locus_tag LOCUS_25390 3071754 3073223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 3073346 3074308 gene locus_tag LOCUS_25400 3073346 3074308 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_25400 3074302 3075174 gene locus_tag LOCUS_25410 3074302 3075174 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_25410 3075293 3077149 gene locus_tag LOCUS_25420 3075293 3077149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 3077109 3078737 gene locus_tag LOCUS_25430 3077109 3078737 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_25430 3079972 3078785 gene locus_tag LOCUS_25440 3079972 3078785 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530099.1 protein_id gnl|my_center|LOCUS_25440 3080219 3081448 gene locus_tag LOCUS_25450 3080219 3081448 CDS product diglucosyl diacylglycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594708.1 protein_id gnl|my_center|LOCUS_25450 3081496 3083310 gene locus_tag LOCUS_25460 3081496 3083310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 3083297 3084961 gene locus_tag LOCUS_25470 3083297 3084961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 3085198 3086565 gene locus_tag LOCUS_25480 3085198 3086565 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528982.1 protein_id gnl|my_center|LOCUS_25480 3086673 3087575 gene locus_tag LOCUS_25490 3086673 3087575 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_25490 3087591 3088418 gene locus_tag LOCUS_25500 3087591 3088418 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289647.1 protein_id gnl|my_center|LOCUS_25500 3088537 3088905 gene locus_tag LOCUS_25510 3088537 3088905 CDS product glyoxalase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632398.1 protein_id gnl|my_center|LOCUS_25510 3089398 3088940 gene locus_tag LOCUS_25520 3089398 3088940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 3089546 3090316 gene locus_tag LOCUS_25530 3089546 3090316 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982927.1 protein_id gnl|my_center|LOCUS_25530 3090431 3091192 gene locus_tag LOCUS_25540 3090431 3091192 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258858.1 protein_id gnl|my_center|LOCUS_25540 3091185 3092282 gene locus_tag LOCUS_25550 gene ribD 3091185 3092282 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741110.1 protein_id gnl|my_center|LOCUS_25550 3092298 3093392 gene locus_tag LOCUS_25560 3092298 3093392 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_25560 3093447 3094448 gene locus_tag LOCUS_25570 3093447 3094448 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930477.1 protein_id gnl|my_center|LOCUS_25570 3094627 3096213 gene locus_tag LOCUS_25580 3094627 3096213 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_25580 3096210 3097379 gene locus_tag LOCUS_25590 3096210 3097379 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_25590 3097376 3097603 gene locus_tag LOCUS_25600 3097376 3097603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 3098695 3097592 gene locus_tag LOCUS_25610 3098695 3097592 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943959.1 protein_id gnl|my_center|LOCUS_25610 3098834 3099277 gene locus_tag LOCUS_25620 gene cwlJ 3098834 3099277 CDS product cell wall hydrolase CwlJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246500.1 protein_id gnl|my_center|LOCUS_25620 3100716 3099355 gene locus_tag LOCUS_25630 3100716 3099355 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_25630 3101386 3100988 gene locus_tag LOCUS_25640 3101386 3100988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 3101764 3102531 gene locus_tag LOCUS_25650 3101764 3102531 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_25650 3102727 3103575 gene locus_tag LOCUS_25660 3102727 3103575 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742057.1 protein_id gnl|my_center|LOCUS_25660 3103613 3104674 gene locus_tag LOCUS_25670 3103613 3104674 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254060.1 protein_id gnl|my_center|LOCUS_25670 3104982 3112901 gene locus_tag LOCUS_25680 3104982 3112901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 3112980 3114773 gene locus_tag LOCUS_25690 3112980 3114773 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189855.1 protein_id gnl|my_center|LOCUS_25690 3116788 3115502 gene locus_tag LOCUS_25700 gene hisD 3116788 3115502 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703749.1 protein_id gnl|my_center|LOCUS_25700 3117952 3116942 gene locus_tag LOCUS_25710 3117952 3116942 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311173.1 protein_id gnl|my_center|LOCUS_25710 3118814 3118125 gene locus_tag LOCUS_25720 3118814 3118125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 3120120 3119296 gene locus_tag LOCUS_25730 3120120 3119296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 3120332 3120120 gene locus_tag LOCUS_25740 3120332 3120120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 3120316 3122217 gene locus_tag LOCUS_25750 3120316 3122217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 3122833 3122396 gene locus_tag LOCUS_25760 3122833 3122396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3125174 3123012 gene locus_tag LOCUS_25770 3125174 3123012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 3125900 3125487 gene locus_tag LOCUS_25780 3125900 3125487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 3127909 3126017 gene locus_tag LOCUS_25790 3127909 3126017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 3130620 3127993 gene locus_tag LOCUS_25800 3130620 3127993 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_25800 3132006 3130693 gene locus_tag LOCUS_25810 3132006 3130693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3132881 3132012 gene locus_tag LOCUS_25820 3132881 3132012 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_25820 3134169 3132943 gene locus_tag LOCUS_25830 3134169 3132943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3134228 3134437 gene locus_tag LOCUS_25840 3134228 3134437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 3136092 3134479 gene locus_tag LOCUS_25850 3136092 3134479 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_25850 3137861 3136089 gene locus_tag LOCUS_25860 3137861 3136089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 3139082 3138117 gene locus_tag LOCUS_25870 3139082 3138117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 3139548 3139267 gene locus_tag LOCUS_25880 3139548 3139267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 3140109 3139804 gene locus_tag LOCUS_25890 3140109 3139804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 3140771 3140358 gene locus_tag LOCUS_25900 3140771 3140358 CDS product DUF3052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089880.1 protein_id gnl|my_center|LOCUS_25900 3141402 3140851 gene locus_tag LOCUS_25910 3141402 3140851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 3142200 3141760 gene locus_tag LOCUS_25920 3142200 3141760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 3144612 3143011 gene locus_tag LOCUS_25930 3144612 3143011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3145505 3145086 gene locus_tag LOCUS_25940 3145505 3145086 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082421.1 protein_id gnl|my_center|LOCUS_25940 3146319 3145561 gene locus_tag LOCUS_25950 3146319 3145561 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_25950 3147816 3146350 gene locus_tag LOCUS_25960 3147816 3146350 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040461.1 protein_id gnl|my_center|LOCUS_25960 3149140 3147803 gene locus_tag LOCUS_25970 3149140 3147803 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 protein_id gnl|my_center|LOCUS_25970 3150344 3149247 gene locus_tag LOCUS_25980 3150344 3149247 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537580.1 protein_id gnl|my_center|LOCUS_25980 3150536 3151450 gene locus_tag LOCUS_25990 3150536 3151450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3152386 3151808 gene locus_tag LOCUS_26000 3152386 3151808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 3154966 3152516 gene locus_tag LOCUS_26010 3154966 3152516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 3157785 3155302 gene locus_tag LOCUS_26020 3157785 3155302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 3159580 3158078 gene locus_tag LOCUS_26030 3159580 3158078 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_26030 3160306 3159821 gene locus_tag LOCUS_26040 3160306 3159821 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_26040 3160426 3161310 gene locus_tag LOCUS_26050 gene bsdA 3160426 3161310 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_26050 3162247 3161423 gene locus_tag LOCUS_26060 3162247 3161423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 3162605 3163120 gene locus_tag LOCUS_26070 3162605 3163120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 3164302 3163244 gene locus_tag LOCUS_26080 3164302 3163244 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 protein_id gnl|my_center|LOCUS_26080 3164647 3164536 gene locus_tag LOCUS_r00050 3164647 3164536 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3167828 3164786 gene locus_tag LOCUS_r00060 3167828 3164786 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3169563 3168013 gene locus_tag LOCUS_r00070 3169563 3168013 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3169926 3171590 gene locus_tag LOCUS_26090 3169926 3171590 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838584.1 protein_id gnl|my_center|LOCUS_26090 3172439 3171630 gene locus_tag LOCUS_26100 gene fabG 3172439 3171630 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_26100 3173235 3172474 gene locus_tag LOCUS_26110 gene fabG 3173235 3172474 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_26110 3173684 3173253 gene locus_tag LOCUS_26120 3173684 3173253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 3174686 3173727 gene locus_tag LOCUS_26130 3174686 3173727 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_26130 3174845 3175525 gene locus_tag LOCUS_26140 3174845 3175525 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210059.1 protein_id gnl|my_center|LOCUS_26140 3176418 3175555 gene locus_tag LOCUS_26150 3176418 3175555 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_26150 3176538 3177485 gene locus_tag LOCUS_26160 3176538 3177485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3178569 3177535 gene locus_tag LOCUS_26170 3178569 3177535 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_26170 3180945 3178570 gene locus_tag LOCUS_26180 3180945 3178570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 3183672 3181069 gene locus_tag LOCUS_26190 3183672 3181069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 3186555 3183856 gene locus_tag LOCUS_26200 3186555 3183856 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671005.1 protein_id gnl|my_center|LOCUS_26200 3187733 3186573 gene locus_tag LOCUS_26210 3187733 3186573 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704465.1 protein_id gnl|my_center|LOCUS_26210 3188360 3187746 gene locus_tag LOCUS_26220 3188360 3187746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26220 3188774 3188502 gene locus_tag LOCUS_26230 3188774 3188502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26230 3190395 3188794 gene locus_tag LOCUS_26240 3190395 3188794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 3192058 3190964 gene locus_tag LOCUS_26250 3192058 3190964 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_26250 3193679 3192114 gene locus_tag LOCUS_26260 3193679 3192114 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782652.1 protein_id gnl|my_center|LOCUS_26260 3195389 3193719 gene locus_tag LOCUS_26270 3195389 3193719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 3197544 3195412 gene locus_tag LOCUS_26280 3197544 3195412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 3199453 3197639 gene locus_tag LOCUS_26290 3199453 3197639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 3200430 3199531 gene locus_tag LOCUS_26300 3200430 3199531 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_26300 3201329 3200427 gene locus_tag LOCUS_26310 3201329 3200427 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_26310 3203310 3201478 gene locus_tag LOCUS_26320 3203310 3201478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 3204925 3203282 gene locus_tag LOCUS_26330 3204925 3203282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3206262 3205039 gene locus_tag LOCUS_26340 3206262 3205039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3207020 3206316 gene locus_tag LOCUS_26350 3207020 3206316 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_26350 3208552 3207017 gene locus_tag LOCUS_26360 gene abfA 3208552 3207017 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_26360 3209221 3208805 gene locus_tag LOCUS_26370 3209221 3208805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 3210133 3209513 gene locus_tag LOCUS_26380 3210133 3209513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 3211828 3210224 gene locus_tag LOCUS_26390 3211828 3210224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3212623 3211922 gene locus_tag LOCUS_26400 3212623 3211922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 3212858 3212679 gene locus_tag LOCUS_26410 3212858 3212679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3214859 3212973 gene locus_tag LOCUS_26420 3214859 3212973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 3214926 3215219 gene locus_tag LOCUS_26430 3214926 3215219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 3215656 3215357 gene locus_tag LOCUS_26440 3215656 3215357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 3216393 3215752 gene locus_tag LOCUS_26450 3216393 3215752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016561.1 protein_id gnl|my_center|LOCUS_26450 3216620 3216408 gene locus_tag LOCUS_26460 3216620 3216408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 3221246 3217104 gene locus_tag LOCUS_26470 3221246 3217104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 3221917 3221732 gene locus_tag LOCUS_26480 3221917 3221732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 3221933 3222274 gene locus_tag LOCUS_26490 3221933 3222274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 3223499 3222339 gene locus_tag LOCUS_26500 3223499 3222339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 3224411 3223710 gene locus_tag LOCUS_26510 3224411 3223710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 3224611 3225156 gene locus_tag LOCUS_26520 3224611 3225156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 3225164 3225910 gene locus_tag LOCUS_26530 gene map 3225164 3225910 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 protein_id gnl|my_center|LOCUS_26530 3228518 3225924 gene locus_tag LOCUS_26540 gene ppsA 3228518 3225924 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231379.1 protein_id gnl|my_center|LOCUS_26540 3229118 3228861 gene locus_tag LOCUS_26550 3229118 3228861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012598856.1 protein_id gnl|my_center|LOCUS_26550 3229850 3229260 gene locus_tag LOCUS_26560 3229850 3229260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 3230959 3230165 gene locus_tag LOCUS_26570 3230959 3230165 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364009.1 protein_id gnl|my_center|LOCUS_26570 3232038 3231034 gene locus_tag LOCUS_26580 3232038 3231034 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104858.1 protein_id gnl|my_center|LOCUS_26580 3232693 3232196 gene locus_tag LOCUS_26590 3232693 3232196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 3233246 3232683 gene locus_tag LOCUS_26600 3233246 3232683 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036618527.1 protein_id gnl|my_center|LOCUS_26600 3235056 3233437 gene locus_tag LOCUS_26610 3235056 3233437 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393615.1 protein_id gnl|my_center|LOCUS_26610 3235532 3235053 gene locus_tag LOCUS_26620 3235532 3235053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 3237298 3235529 gene locus_tag LOCUS_26630 gene atzF 3237298 3235529 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140963.1 protein_id gnl|my_center|LOCUS_26630 3238432 3237356 gene locus_tag LOCUS_26640 3238432 3237356 CDS product ring-opening amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393610.1 protein_id gnl|my_center|LOCUS_26640 3239181 3238429 gene locus_tag LOCUS_26650 3239181 3238429 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085620.1 protein_id gnl|my_center|LOCUS_26650 3240005 3239178 gene locus_tag LOCUS_26660 3240005 3239178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240183.1 protein_id gnl|my_center|LOCUS_26660 3241108 3240020 gene locus_tag LOCUS_26670 3241108 3240020 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258396.1 protein_id gnl|my_center|LOCUS_26670 3241816 3241133 gene locus_tag LOCUS_26680 3241816 3241133 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081171.1 protein_id gnl|my_center|LOCUS_26680 3242119 3243633 gene locus_tag LOCUS_26690 3242119 3243633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 3244391 3243702 gene locus_tag LOCUS_26700 3244391 3243702 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965712.1 protein_id gnl|my_center|LOCUS_26700 3244534 3245136 gene locus_tag LOCUS_26710 3244534 3245136 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126313.1 protein_id gnl|my_center|LOCUS_26710 3245774 3245154 gene locus_tag LOCUS_26720 3245774 3245154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 3247114 3245807 gene locus_tag LOCUS_26730 3247114 3245807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3248137 3247160 gene locus_tag LOCUS_26740 gene cmrA 3248137 3247160 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_26740 3248320 3249306 gene locus_tag LOCUS_26750 3248320 3249306 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_26750 3249990 3249376 gene locus_tag LOCUS_26760 3249990 3249376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 3250617 3250105 gene locus_tag LOCUS_26770 3250617 3250105 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244277.1 protein_id gnl|my_center|LOCUS_26770 3251682 3250759 gene locus_tag LOCUS_26780 3251682 3250759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3251823 3252701 gene locus_tag LOCUS_26790 3251823 3252701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 3252803 3253060 gene locus_tag LOCUS_26800 3252803 3253060 CDS product YuzF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220677.1 protein_id gnl|my_center|LOCUS_26800 3253700 3253353 gene locus_tag LOCUS_26810 3253700 3253353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 3255831 3253891 gene locus_tag LOCUS_26820 3255831 3253891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3256284 3255925 gene locus_tag LOCUS_26830 3256284 3255925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 3256349 3257980 gene locus_tag LOCUS_26840 3256349 3257980 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048527824.1 protein_id gnl|my_center|LOCUS_26840 3258003 3259106 gene locus_tag LOCUS_26850 3258003 3259106 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628605.1 protein_id gnl|my_center|LOCUS_26850 3259099 3260295 gene locus_tag LOCUS_26860 3259099 3260295 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680791.1 protein_id gnl|my_center|LOCUS_26860 3261553 3260324 gene locus_tag LOCUS_26870 gene zinU 3261553 3260324 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_26870 3264183 3262360 gene locus_tag LOCUS_26880 3264183 3262360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 3264966 3264208 gene locus_tag LOCUS_26890 3264966 3264208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 3265262 3266011 gene locus_tag LOCUS_26900 3265262 3266011 CDS product DUF2935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554487.1 protein_id gnl|my_center|LOCUS_26900 3268520 3266025 gene locus_tag LOCUS_26910 3268520 3266025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 3269383 3268493 gene locus_tag LOCUS_26920 3269383 3268493 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_26920 3269910 3269380 gene locus_tag LOCUS_26930 3269910 3269380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 3270054 3270239 gene locus_tag LOCUS_26940 3270054 3270239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3272008 3270371 gene locus_tag LOCUS_26950 3272008 3270371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3272324 3273775 gene locus_tag LOCUS_26960 3272324 3273775 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_26960 3275466 3274477 gene locus_tag LOCUS_26970 3275466 3274477 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_26970 3276457 3275564 gene locus_tag LOCUS_26980 3276457 3275564 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612250.1 protein_id gnl|my_center|LOCUS_26980 3277356 3276961 gene locus_tag LOCUS_26990 3277356 3276961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 3278596 3277511 gene locus_tag LOCUS_27000 3278596 3277511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 3280807 3278606 gene locus_tag LOCUS_27010 3280807 3278606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 3283761 3280798 gene locus_tag LOCUS_27020 3283761 3280798 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080411.1 protein_id gnl|my_center|LOCUS_27020 3285920 3283758 gene locus_tag LOCUS_27030 3285920 3283758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 3286800 3285946 gene locus_tag LOCUS_27040 3286800 3285946 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_27040 3287691 3286801 gene locus_tag LOCUS_27050 3287691 3286801 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037380364.1 protein_id gnl|my_center|LOCUS_27050 3289140 3287776 gene locus_tag LOCUS_27060 3289140 3287776 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582770.1 protein_id gnl|my_center|LOCUS_27060 3290432 3289425 gene locus_tag LOCUS_27070 3290432 3289425 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949137.1 protein_id gnl|my_center|LOCUS_27070 3292925 3290544 gene locus_tag LOCUS_27080 3292925 3290544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 3294206 3293613 gene locus_tag LOCUS_27090 3294206 3293613 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_27090 3296974 3294719 gene locus_tag LOCUS_27100 3296974 3294719 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731969.1 protein_id gnl|my_center|LOCUS_27100 3297433 3297089 gene locus_tag LOCUS_27110 3297433 3297089 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_27110 3298312 3297605 gene locus_tag LOCUS_27120 3298312 3297605 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346313.1 protein_id gnl|my_center|LOCUS_27120 3299521 3298553 gene locus_tag LOCUS_27130 3299521 3298553 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454499.1 protein_id gnl|my_center|LOCUS_27130 3302132 3299661 gene locus_tag LOCUS_27140 3302132 3299661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 3304456 3302396 gene locus_tag LOCUS_27150 3304456 3302396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 3306156 3304543 gene locus_tag LOCUS_27160 3306156 3304543 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_27160 3307192 3306305 gene locus_tag LOCUS_27170 3307192 3306305 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_27170 3308180 3307224 gene locus_tag LOCUS_27180 3308180 3307224 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_27180 3309194 3308205 gene locus_tag LOCUS_27190 3309194 3308205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 3311053 3309623 gene locus_tag LOCUS_27200 3311053 3309623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3312944 3311220 gene locus_tag LOCUS_27210 gene cysI 3312944 3311220 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243849.1 protein_id gnl|my_center|LOCUS_27210 3314812 3312974 gene locus_tag LOCUS_27220 3314812 3312974 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243259.1 protein_id gnl|my_center|LOCUS_27220 3315088 3315546 gene locus_tag LOCUS_27230 3315088 3315546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3315709 3317001 gene locus_tag LOCUS_27240 3315709 3317001 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_27240 3320888 3317112 gene locus_tag LOCUS_27250 3320888 3317112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 3321161 3327874 gene locus_tag LOCUS_27260 3321161 3327874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27260 3327871 3329550 gene locus_tag LOCUS_27270 3327871 3329550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27270 3331053 3329635 gene locus_tag LOCUS_27280 gene gndA 3331053 3329635 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_27280 3331791 3331126 gene locus_tag LOCUS_27290 gene fsa 3331791 3331126 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210267.1 protein_id gnl|my_center|LOCUS_27290 3333833 3331842 gene locus_tag LOCUS_27300 gene tkt 3333833 3331842 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193030.1 protein_id gnl|my_center|LOCUS_27300 3335343 3333811 gene locus_tag LOCUS_27310 gene zwf 3335343 3333811 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445335.1 protein_id gnl|my_center|LOCUS_27310 3335458 3336342 gene locus_tag LOCUS_27320 3335458 3336342 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_27320 3336912 3336523 gene locus_tag LOCUS_27330 3336912 3336523 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028036.1 protein_id gnl|my_center|LOCUS_27330 3337677 3337009 gene locus_tag LOCUS_27340 3337677 3337009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3339103 3338147 gene locus_tag LOCUS_27350 3339103 3338147 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_27350 3339246 3339950 gene locus_tag LOCUS_27360 3339246 3339950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 3341991 3339916 gene locus_tag LOCUS_27370 gene pbpC 3341991 3339916 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227211.1 protein_id gnl|my_center|LOCUS_27370 3343826 3342153 gene locus_tag LOCUS_27380 3343826 3342153 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_27380 3345003 3343816 gene locus_tag LOCUS_27390 3345003 3343816 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531927.1 protein_id gnl|my_center|LOCUS_27390 3346166 3345000 gene locus_tag LOCUS_27400 3346166 3345000 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310749.1 protein_id gnl|my_center|LOCUS_27400 3347983 3346223 gene locus_tag LOCUS_27410 3347983 3346223 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196552.1 protein_id gnl|my_center|LOCUS_27410 3348772 3347996 gene locus_tag LOCUS_27420 3348772 3347996 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_27420 3350595 3348766 gene locus_tag LOCUS_27430 3350595 3348766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 3351466 3350633 gene locus_tag LOCUS_27440 3351466 3350633 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_27440 3352350 3351463 gene locus_tag LOCUS_27450 3352350 3351463 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_27450 3353785 3352457 gene locus_tag LOCUS_27460 3353785 3352457 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_27460 3354447 3354145 gene locus_tag LOCUS_27470 3354447 3354145 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258305.1 protein_id gnl|my_center|LOCUS_27470 3355442 3354450 gene locus_tag LOCUS_27480 3355442 3354450 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124128.1 protein_id gnl|my_center|LOCUS_27480 3355992 3355495 gene locus_tag LOCUS_27490 3355992 3355495 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399152.1 protein_id gnl|my_center|LOCUS_27490 3356613 3356272 gene locus_tag LOCUS_27500 3356613 3356272 CDS product DUF2512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966623.1 protein_id gnl|my_center|LOCUS_27500 3357146 3356628 gene locus_tag LOCUS_27510 3357146 3356628 CDS product DUF3231 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512134.1 protein_id gnl|my_center|LOCUS_27510 3358329 3357292 gene locus_tag LOCUS_27520 3358329 3357292 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_27520 3362153 3358554 gene locus_tag LOCUS_27530 3362153 3358554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3362474 3363175 gene locus_tag LOCUS_27540 3362474 3363175 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401494.1 protein_id gnl|my_center|LOCUS_27540 3364292 3363249 gene locus_tag LOCUS_27550 3364292 3363249 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124219794.1 protein_id gnl|my_center|LOCUS_27550 3364723 3364331 gene locus_tag LOCUS_27560 3364723 3364331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 3365403 3364723 gene locus_tag LOCUS_27570 3365403 3364723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 3366604 3365408 gene locus_tag LOCUS_27580 3366604 3365408 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287856.1 protein_id gnl|my_center|LOCUS_27580 3367353 3366601 gene locus_tag LOCUS_27590 3367353 3366601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 3367600 3367382 gene locus_tag LOCUS_27600 3367600 3367382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 3369215 3367746 gene locus_tag LOCUS_27610 3369215 3367746 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164930.1 protein_id gnl|my_center|LOCUS_27610 3369769 3369257 gene locus_tag LOCUS_27620 3369769 3369257 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027329.1 protein_id gnl|my_center|LOCUS_27620 3371510 3369852 gene locus_tag LOCUS_27630 gene glpD 3371510 3369852 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_27630 3373124 3371631 gene locus_tag LOCUS_27640 gene glpK 3373124 3371631 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233384.1 protein_id gnl|my_center|LOCUS_27640 3373702 3373136 gene locus_tag LOCUS_27650 gene glpP 3373702 3373136 CDS product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394287.1 protein_id gnl|my_center|LOCUS_27650 3375154 3373970 gene locus_tag LOCUS_27660 3375154 3373970 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_27660 3375939 3375151 gene locus_tag LOCUS_27670 3375939 3375151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 3377170 3375932 gene locus_tag LOCUS_27680 3377170 3375932 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421605.1 protein_id gnl|my_center|LOCUS_27680 3377075 3377266 gene locus_tag LOCUS_27690 3377075 3377266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3377765 3377562 gene locus_tag LOCUS_27700 3377765 3377562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3378835 3377846 gene locus_tag LOCUS_27710 3378835 3377846 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775988.1 protein_id gnl|my_center|LOCUS_27710 3379042 3379227 gene locus_tag LOCUS_27720 3379042 3379227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 3379484 3380392 gene locus_tag LOCUS_27730 3379484 3380392 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964753.1 protein_id gnl|my_center|LOCUS_27730 3382102 3380555 gene locus_tag LOCUS_27740 3382102 3380555 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997001.1 protein_id gnl|my_center|LOCUS_27740 3382944 3382150 gene locus_tag LOCUS_27750 3382944 3382150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 3383694 3383083 gene locus_tag LOCUS_27760 3383694 3383083 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438383.1 protein_id gnl|my_center|LOCUS_27760 3383857 3384618 gene locus_tag LOCUS_27770 3383857 3384618 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722299.1 protein_id gnl|my_center|LOCUS_27770 3385769 3384711 gene locus_tag LOCUS_27780 gene mnmH 3385769 3384711 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812887.1 protein_id gnl|my_center|LOCUS_27780 3386836 3385787 gene locus_tag LOCUS_27790 gene selD 3386836 3385787 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_27790 3387784 3386867 gene locus_tag LOCUS_27800 gene rnz 3387784 3386867 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354332.1 protein_id gnl|my_center|LOCUS_27800 3388365 3387904 gene locus_tag LOCUS_27810 3388365 3387904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 3388515 3389033 gene locus_tag LOCUS_27820 3388515 3389033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27820 3389136 3389963 gene locus_tag LOCUS_27830 3389136 3389963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27830 3390288 3389977 gene locus_tag LOCUS_27840 3390288 3389977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 3390547 3391185 gene locus_tag LOCUS_27850 3390547 3391185 CDS product papain-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047147.1 protein_id gnl|my_center|LOCUS_27850 3392402 3391230 gene locus_tag LOCUS_27860 3392402 3391230 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137782.1 protein_id gnl|my_center|LOCUS_27860 3395302 3394583 gene locus_tag LOCUS_27870 3395302 3394583 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532950.1 protein_id gnl|my_center|LOCUS_27870 3397008 3395434 gene locus_tag LOCUS_27880 3397008 3395434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3398423 3397119 gene locus_tag LOCUS_27890 3398423 3397119 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003270289.1 protein_id gnl|my_center|LOCUS_27890 3399354 3398452 gene locus_tag LOCUS_27900 3399354 3398452 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948489.1 protein_id gnl|my_center|LOCUS_27900 3400142 3399375 gene locus_tag LOCUS_27910 3400142 3399375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 3401058 3400135 gene locus_tag LOCUS_27920 3401058 3400135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_27920 3401838 3401137 gene locus_tag LOCUS_27930 3401838 3401137 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948485.1 protein_id gnl|my_center|LOCUS_27930 3401969 3402889 gene locus_tag LOCUS_27940 3401969 3402889 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986973.1 protein_id gnl|my_center|LOCUS_27940 3403239 3402859 gene locus_tag LOCUS_27950 3403239 3402859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3404382 3403303 gene locus_tag LOCUS_27960 3404382 3403303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 3404741 3404406 gene locus_tag LOCUS_27970 3404741 3404406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3404920 3405558 gene locus_tag LOCUS_27980 3404920 3405558 CDS product papain-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047147.1 protein_id gnl|my_center|LOCUS_27980 3405808 3405623 gene locus_tag LOCUS_27990 3405808 3405623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 3407049 3405805 gene locus_tag LOCUS_28000 3407049 3405805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 3407771 3407046 gene locus_tag LOCUS_28010 3407771 3407046 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943077.1 protein_id gnl|my_center|LOCUS_28010 3408762 3407959 gene locus_tag LOCUS_28020 3408762 3407959 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228640.1 protein_id gnl|my_center|LOCUS_28020 3409808 3408816 gene locus_tag LOCUS_28030 gene msrB 3409808 3408816 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000261262.1 protein_id gnl|my_center|LOCUS_28030 3410019 3410438 gene locus_tag LOCUS_28040 3410019 3410438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 3410716 3410522 gene locus_tag LOCUS_28050 3410716 3410522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721789.1 protein_id gnl|my_center|LOCUS_28050 3411781 3410834 gene locus_tag LOCUS_28060 3411781 3410834 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_28060 3413371 3411917 gene locus_tag LOCUS_28070 3413371 3411917 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173227432.1 protein_id gnl|my_center|LOCUS_28070 3414340 3413456 gene locus_tag LOCUS_28080 3414340 3413456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 3415242 3414337 gene locus_tag LOCUS_28090 3415242 3414337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28090 3416187 3415246 gene locus_tag LOCUS_28100 3416187 3415246 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_28100 3416332 3417162 gene locus_tag LOCUS_28110 3416332 3417162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 3417987 3417751 gene locus_tag LOCUS_28120 3417987 3417751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 3419300 3417984 gene locus_tag LOCUS_28130 3419300 3417984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 3420070 3419258 gene locus_tag LOCUS_28140 3420070 3419258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 3420756 3420067 gene locus_tag LOCUS_28150 3420756 3420067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893181.1 protein_id gnl|my_center|LOCUS_28150 3421178 3420753 gene locus_tag LOCUS_28160 3421178 3420753 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436478.1 protein_id gnl|my_center|LOCUS_28160 3422149 3421436 gene locus_tag LOCUS_28170 3422149 3421436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 3422336 3422923 gene locus_tag LOCUS_28180 gene clpP 3422336 3422923 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228214.1 protein_id gnl|my_center|LOCUS_28180 3423476 3422931 gene locus_tag LOCUS_28190 3423476 3422931 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145144.1 protein_id gnl|my_center|LOCUS_28190 3424143 3423802 gene locus_tag LOCUS_28200 3424143 3423802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 3424317 3425048 gene locus_tag LOCUS_28210 3424317 3425048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 3426365 3425115 gene locus_tag LOCUS_28220 3426365 3425115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 3430866 3426400 gene locus_tag LOCUS_28230 3430866 3426400 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602307.1 protein_id gnl|my_center|LOCUS_28230 3433514 3430893 gene locus_tag LOCUS_28240 3433514 3430893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3434796 3433669 gene locus_tag LOCUS_28250 3434796 3433669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 3440888 3435171 gene locus_tag LOCUS_28260 3440888 3435171 CDS product HAMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085385.1 protein_id gnl|my_center|LOCUS_28260 3442578 3440926 gene locus_tag LOCUS_28270 3442578 3440926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3444837 3442867 gene locus_tag LOCUS_28280 3444837 3442867 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493712.1 protein_id gnl|my_center|LOCUS_28280 3445557 3445024 gene locus_tag LOCUS_28290 3445557 3445024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 3446305 3445574 gene locus_tag LOCUS_28300 3446305 3445574 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_28300 3447071 3446526 gene locus_tag LOCUS_28310 3447071 3446526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3448735 3447410 gene locus_tag LOCUS_28320 3448735 3447410 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402274.1 protein_id gnl|my_center|LOCUS_28320 3449069 3450433 gene locus_tag LOCUS_28330 3449069 3450433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 3450577 3452592 gene locus_tag LOCUS_28340 3450577 3452592 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243269.1 protein_id gnl|my_center|LOCUS_28340 3453870 3452647 gene locus_tag LOCUS_28350 3453870 3452647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3454170 3453994 gene locus_tag LOCUS_28360 3454170 3453994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 3454921 3454271 gene locus_tag LOCUS_28370 3454921 3454271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 3455952 3454987 gene locus_tag LOCUS_28380 3455952 3454987 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488048.1 protein_id gnl|my_center|LOCUS_28380 3456875 3455949 gene locus_tag LOCUS_28390 3456875 3455949 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886400.1 protein_id gnl|my_center|LOCUS_28390 3457073 3457987 gene locus_tag LOCUS_28400 3457073 3457987 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808254.1 protein_id gnl|my_center|LOCUS_28400 3458822 3458028 gene locus_tag LOCUS_28410 3458822 3458028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3459841 3458849 gene locus_tag LOCUS_28420 3459841 3458849 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_28420 3460057 3460884 gene locus_tag LOCUS_28430 3460057 3460884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 3462374 3460881 gene locus_tag LOCUS_28440 3462374 3460881 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966741.1 protein_id gnl|my_center|LOCUS_28440 3462717 3463490 gene locus_tag LOCUS_28450 3462717 3463490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812699.1 protein_id gnl|my_center|LOCUS_28450 3463487 3464509 gene locus_tag LOCUS_28460 3463487 3464509 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266746.1 protein_id gnl|my_center|LOCUS_28460 3464604 3465278 gene locus_tag LOCUS_28470 3464604 3465278 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711168.1 protein_id gnl|my_center|LOCUS_28470 3465354 3466046 gene locus_tag LOCUS_28480 3465354 3466046 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_28480 3466584 3466132 gene locus_tag LOCUS_28490 3466584 3466132 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925810.1 protein_id gnl|my_center|LOCUS_28490 3466887 3466693 gene locus_tag LOCUS_28500 3466887 3466693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3468869 3466959 gene locus_tag LOCUS_28510 3468869 3466959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_28510 3470652 3468853 gene locus_tag LOCUS_28520 3470652 3468853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083000.1 protein_id gnl|my_center|LOCUS_28520 3472108 3470675 gene locus_tag LOCUS_28530 3472108 3470675 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716485.1 protein_id gnl|my_center|LOCUS_28530 3472313 3472768 gene locus_tag LOCUS_28540 3472313 3472768 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041894.1 protein_id gnl|my_center|LOCUS_28540 3474931 3472862 gene locus_tag LOCUS_28550 3474931 3472862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 3476229 3475339 gene locus_tag LOCUS_28560 3476229 3475339 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713634.1 protein_id gnl|my_center|LOCUS_28560 3476862 3476260 gene locus_tag LOCUS_28570 3476862 3476260 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435046.1 protein_id gnl|my_center|LOCUS_28570 3477160 3477864 gene locus_tag LOCUS_28580 3477160 3477864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3478218 3477946 gene locus_tag LOCUS_28590 3478218 3477946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 3478344 3478991 gene locus_tag LOCUS_28600 3478344 3478991 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428273.1 protein_id gnl|my_center|LOCUS_28600 3480882 3479014 gene locus_tag LOCUS_28610 gene ltaP 3480882 3479014 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_28610 3482032 3480977 gene locus_tag LOCUS_28620 3482032 3480977 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964009.1 protein_id gnl|my_center|LOCUS_28620 3482571 3482029 gene locus_tag LOCUS_28630 3482571 3482029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 3482791 3483804 gene locus_tag LOCUS_28640 3482791 3483804 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_28640 3484867 3483935 gene locus_tag LOCUS_28650 gene ppaC 3484867 3483935 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416873.1 protein_id gnl|my_center|LOCUS_28650 3485625 3484951 gene locus_tag LOCUS_28660 3485625 3484951 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233805.1 protein_id gnl|my_center|LOCUS_28660 3487365 3485731 gene locus_tag LOCUS_28670 3487365 3485731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3488076 3487522 gene locus_tag LOCUS_28680 3488076 3487522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 3488792 3488073 gene locus_tag LOCUS_28690 3488792 3488073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 3489801 3488887 gene locus_tag LOCUS_28700 gene lolS 3489801 3488887 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747187.1 protein_id gnl|my_center|LOCUS_28700 3491276 3489852 gene locus_tag LOCUS_28710 gene aspA 3491276 3489852 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 protein_id gnl|my_center|LOCUS_28710 3492901 3491486 gene locus_tag LOCUS_28720 gene pyk 3492901 3491486 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_28720 3493112 3493813 gene locus_tag LOCUS_28730 3493112 3493813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 3493961 3494167 gene locus_tag LOCUS_28740 gene sasP 3493961 3494167 CDS product small acid-soluble spore protein, SasP family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013338.1 protein_id gnl|my_center|LOCUS_28740 3494786 3494178 gene locus_tag LOCUS_28750 3494786 3494178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 3495314 3495117 gene locus_tag LOCUS_28760 gene copZ 3495314 3495117 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436973.1 protein_id gnl|my_center|LOCUS_28760 3495894 3495583 gene locus_tag LOCUS_28770 gene trxA 3495894 3495583 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479673.1 protein_id gnl|my_center|LOCUS_28770 3496270 3495872 gene locus_tag LOCUS_28780 3496270 3495872 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219219.1 protein_id gnl|my_center|LOCUS_28780 3497689 3496352 gene locus_tag LOCUS_28790 gene dgt 3497689 3496352 CDS product dNTP triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185138301.1 protein_id gnl|my_center|LOCUS_28790 3497841 3498482 gene locus_tag LOCUS_28800 3497841 3498482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 3499470 3498787 gene locus_tag LOCUS_28810 3499470 3498787 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594450.1 protein_id gnl|my_center|LOCUS_28810 3500308 3499547 gene locus_tag LOCUS_28820 3500308 3499547 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147185.1 protein_id gnl|my_center|LOCUS_28820 3501812 3500295 gene locus_tag LOCUS_28830 3501812 3500295 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460058.1 protein_id gnl|my_center|LOCUS_28830 3502537 3501809 gene locus_tag LOCUS_28840 3502537 3501809 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812756.1 protein_id gnl|my_center|LOCUS_28840 3503824 3503054 gene locus_tag LOCUS_28850 gene rhaR 3503824 3503054 CDS product rhamnose catabolism operon transcriptional regulator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968057.1 protein_id gnl|my_center|LOCUS_28850 3505323 3503854 gene locus_tag LOCUS_28860 gene rhaB 3505323 3503854 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_28860 3506615 3505353 gene locus_tag LOCUS_28870 gene rhaA 3506615 3505353 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387675.1 protein_id gnl|my_center|LOCUS_28870 3507105 3506734 gene locus_tag LOCUS_28880 3507105 3506734 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582807.1 protein_id gnl|my_center|LOCUS_28880 3509219 3507150 gene locus_tag LOCUS_28890 3509219 3507150 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_28890 3509641 3510023 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttagcggcacggcgtgccgttatcgc 3510635 3510111 gene locus_tag LOCUS_28900 3510635 3510111 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_28900 3511005 3510709 gene locus_tag LOCUS_28910 3511005 3510709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3511610 3511059 gene locus_tag LOCUS_28920 3511610 3511059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3512072 3511632 gene locus_tag LOCUS_28930 3512072 3511632 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053186.1 protein_id gnl|my_center|LOCUS_28930 3513073 3512228 gene locus_tag LOCUS_28940 3513073 3512228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 3513219 3514052 gene locus_tag LOCUS_28950 3513219 3514052 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061320.1 protein_id gnl|my_center|LOCUS_28950 3514140 3515888 gene locus_tag LOCUS_28960 3514140 3515888 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_28960 3516050 3517279 gene locus_tag LOCUS_28970 3516050 3517279 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_28970 3518336 3517344 gene locus_tag LOCUS_28980 3518336 3517344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 3519756 3518503 gene locus_tag LOCUS_28990 3519756 3518503 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_28990 3519958 3521205 gene locus_tag LOCUS_29000 3519958 3521205 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244027.1 protein_id gnl|my_center|LOCUS_29000 3523944 3521281 gene locus_tag LOCUS_29010 3523944 3521281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 3524044 3524706 gene locus_tag LOCUS_29020 3524044 3524706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 3525223 3524822 gene locus_tag LOCUS_29030 3525223 3524822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 3525438 3525220 gene locus_tag LOCUS_29040 3525438 3525220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3525382 3526383 gene locus_tag LOCUS_29050 3525382 3526383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3526986 3526474 gene locus_tag LOCUS_29060 3526986 3526474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 3528631 3527027 gene locus_tag LOCUS_29070 gene miaB 3528631 3527027 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005404.1 protein_id gnl|my_center|LOCUS_29070 3528988 3528803 gene locus_tag LOCUS_29080 3528988 3528803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 3529955 3529089 gene locus_tag LOCUS_29090 3529955 3529089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 3530942 3529986 gene locus_tag LOCUS_29100 3530942 3529986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 3531672 3531094 gene locus_tag LOCUS_29110 3531672 3531094 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392695.1 protein_id gnl|my_center|LOCUS_29110 3532416 3531820 gene locus_tag LOCUS_29120 3532416 3531820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 3533105 3532509 gene locus_tag LOCUS_29130 3533105 3532509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 3534852 3533092 gene locus_tag LOCUS_29140 3534852 3533092 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797500.1 protein_id gnl|my_center|LOCUS_29140 3535529 3534849 gene locus_tag LOCUS_29150 3535529 3534849 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_29150 3536549 3535683 gene locus_tag LOCUS_29160 3536549 3535683 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190155.1 protein_id gnl|my_center|LOCUS_29160 3538294 3536549 gene locus_tag LOCUS_29170 3538294 3536549 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625418.1 protein_id gnl|my_center|LOCUS_29170 3539453 3538512 gene locus_tag LOCUS_29180 3539453 3538512 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688057.1 protein_id gnl|my_center|LOCUS_29180 3539857 3539597 gene locus_tag LOCUS_29190 gene spoVS 3539857 3539597 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459952.1 protein_id gnl|my_center|LOCUS_29190 3540911 3540117 gene locus_tag LOCUS_29200 gene ymdB 3540911 3540117 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_29200 3542558 3541017 gene locus_tag LOCUS_29210 gene rny 3542558 3541017 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204912.1 protein_id gnl|my_center|LOCUS_29210 3543758 3542895 gene locus_tag LOCUS_29220 3543758 3542895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 3544917 3543859 gene locus_tag LOCUS_29230 gene recA 3544917 3543859 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283860.1 protein_id gnl|my_center|LOCUS_29230 3547125 3545872 gene locus_tag LOCUS_29240 3547125 3545872 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_29240 3547739 3547122 gene locus_tag LOCUS_29250 gene pgsA 3547739 3547122 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052967.1 protein_id gnl|my_center|LOCUS_29250 3548421 3547930 gene locus_tag LOCUS_29260 3548421 3547930 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233034.1 protein_id gnl|my_center|LOCUS_29260 3548728 3548567 gene locus_tag LOCUS_29270 3548728 3548567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3549684 3548812 gene locus_tag LOCUS_29280 3549684 3548812 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674320.1 protein_id gnl|my_center|LOCUS_29280 3550499 3549729 gene locus_tag LOCUS_29290 3550499 3549729 CDS product DUF3388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000574107.1 protein_id gnl|my_center|LOCUS_29290 3550955 3550704 gene locus_tag LOCUS_29300 3550955 3550704 CDS product DUF3243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393333.1 protein_id gnl|my_center|LOCUS_29300 3551810 3551037 gene locus_tag LOCUS_29310 gene fabG 3551810 3551037 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_29310 3553093 3551807 gene locus_tag LOCUS_29320 3553093 3551807 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 protein_id gnl|my_center|LOCUS_29320 3554378 3553080 gene locus_tag LOCUS_29330 3554378 3553080 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_29330 3555268 3554468 gene locus_tag LOCUS_29340 gene sleB 3555268 3554468 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249053.1 protein_id gnl|my_center|LOCUS_29340 3558100 3555404 gene locus_tag LOCUS_29350 3558100 3555404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3558451 3558179 gene locus_tag LOCUS_29360 3558451 3558179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 3559200 3558448 gene locus_tag LOCUS_29370 gene tepA 3559200 3558448 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139806.1 protein_id gnl|my_center|LOCUS_29370 3561125 3559446 gene locus_tag LOCUS_29380 3561125 3559446 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645621.1 protein_id gnl|my_center|LOCUS_29380 3562236 3561361 gene locus_tag LOCUS_29390 gene dapA 3562236 3561361 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245816.1 protein_id gnl|my_center|LOCUS_29390 3563594 3562293 gene locus_tag LOCUS_29400 gene dapG 3563594 3562293 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692451.1 protein_id gnl|my_center|LOCUS_29400 3564684 3563644 gene locus_tag LOCUS_29410 gene asd 3564684 3563644 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414849.1 protein_id gnl|my_center|LOCUS_29410 3565330 3564734 gene locus_tag LOCUS_29420 3565330 3564734 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_29420 3566223 3565327 gene locus_tag LOCUS_29430 gene dpaA 3566223 3565327 CDS product dipicolinic acid synthetase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954735.1 protein_id gnl|my_center|LOCUS_29430 3567800 3566442 gene locus_tag LOCUS_29440 3567800 3566442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 3568392 3567763 gene locus_tag LOCUS_29450 3568392 3567763 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948534.1 protein_id gnl|my_center|LOCUS_29450 3568943 3568500 gene locus_tag LOCUS_29460 gene dut 3568943 3568500 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552523.1 protein_id gnl|my_center|LOCUS_29460 3570186 3568906 gene locus_tag LOCUS_29470 3570186 3568906 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_29470 3571337 3570279 gene locus_tag LOCUS_29480 3571337 3570279 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868217.1 protein_id gnl|my_center|LOCUS_29480 3573630 3571546 gene locus_tag LOCUS_29490 gene pnp 3573630 3571546 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_29490 3574087 3573818 gene locus_tag LOCUS_29500 gene rpsO 3574087 3573818 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220957.1 protein_id gnl|my_center|LOCUS_29500 3575236 3574262 gene locus_tag LOCUS_29510 3575236 3574262 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_29510 3576224 3575292 gene locus_tag LOCUS_29520 3576224 3575292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 3577206 3576202 gene locus_tag LOCUS_29530 3577206 3576202 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_29530 3577559 3577203 gene locus_tag LOCUS_29540 gene rbfA 3577559 3577203 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_29540 3580694 3577593 gene locus_tag LOCUS_29550 3580694 3577593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 3581019 3580687 gene locus_tag LOCUS_29560 3581019 3580687 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_29560 3581323 3581009 gene locus_tag LOCUS_29570 3581323 3581009 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_29570 3582469 3581372 gene locus_tag LOCUS_29580 gene nusA 3582469 3581372 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_29580 3582957 3582496 gene locus_tag LOCUS_29590 gene rimP 3582957 3582496 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231915.1 protein_id gnl|my_center|LOCUS_29590 3587526 3583186 gene locus_tag LOCUS_29600 3587526 3583186 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245843.1 protein_id gnl|my_center|LOCUS_29600 3588614 3587673 gene locus_tag LOCUS_29610 3588614 3587673 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171047034.1 protein_id gnl|my_center|LOCUS_29610 3589837 3588611 gene locus_tag LOCUS_29620 3589837 3588611 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870172.1 protein_id gnl|my_center|LOCUS_29620 3590721 3589834 gene locus_tag LOCUS_29630 gene sdaAA 3590721 3589834 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_29630 3591401 3590718 gene locus_tag LOCUS_29640 gene sdaAB 3591401 3590718 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294585.1 protein_id gnl|my_center|LOCUS_29640 3592508 3591438 gene locus_tag LOCUS_29650 3592508 3591438 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213126768.1 protein_id gnl|my_center|LOCUS_29650 3593524 3592508 gene locus_tag LOCUS_29660 3593524 3592508 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086980.1 protein_id gnl|my_center|LOCUS_29660 3594972 3593650 gene locus_tag LOCUS_29670 3594972 3593650 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439084.1 protein_id gnl|my_center|LOCUS_29670 3596517 3595069 gene locus_tag LOCUS_29680 gene proS 3596517 3595069 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227720.1 protein_id gnl|my_center|LOCUS_29680 3597811 3596549 gene locus_tag LOCUS_29690 gene rseP 3597811 3596549 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090228.1 protein_id gnl|my_center|LOCUS_29690 3599056 3597908 gene locus_tag LOCUS_29700 3599056 3597908 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_29700 3599917 3599132 gene locus_tag LOCUS_29710 gene cdsA 3599917 3599132 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813592.1 protein_id gnl|my_center|LOCUS_29710 3600725 3599922 gene locus_tag LOCUS_29720 3600725 3599922 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231925.1 protein_id gnl|my_center|LOCUS_29720 3601417 3600863 gene locus_tag LOCUS_29730 gene frr 3601417 3600863 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_29730 3602146 3601418 gene locus_tag LOCUS_29740 gene pyrH 3602146 3601418 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042668.1 protein_id gnl|my_center|LOCUS_29740 3602912 3602262 gene locus_tag LOCUS_29750 gene tsf 3602912 3602262 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_29750 3603751 3603053 gene locus_tag LOCUS_29760 gene rpsB 3603751 3603053 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_29760 3604557 3603964 gene locus_tag LOCUS_29770 3604557 3603964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 3605282 3604554 gene locus_tag LOCUS_29780 3605282 3604554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 3605633 3605304 gene locus_tag LOCUS_29790 3605633 3605304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3607067 3605655 gene locus_tag LOCUS_29800 3607067 3605655 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868974.1 protein_id gnl|my_center|LOCUS_29800 3607874 3607089 gene locus_tag LOCUS_29810 gene sigD 3607874 3607089 CDS product RNA polymerase sigma-28 factor SigD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220911.1 protein_id gnl|my_center|LOCUS_29810 3608310 3607891 gene locus_tag LOCUS_29820 3608310 3607891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 3608806 3608312 gene locus_tag LOCUS_29830 gene cheD 3608806 3608312 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244852.1 protein_id gnl|my_center|LOCUS_29830 3609423 3608806 gene locus_tag LOCUS_29840 gene cheC 3609423 3608806 CDS product CheY-P phosphatase CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231935.1 protein_id gnl|my_center|LOCUS_29840 3609889 3609428 gene locus_tag LOCUS_29850 3609889 3609428 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392262.1 protein_id gnl|my_center|LOCUS_29850 3611983 3609917 gene locus_tag LOCUS_29860 gene cheA 3611983 3609917 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245734.1 protein_id gnl|my_center|LOCUS_29860 3613671 3612016 gene locus_tag LOCUS_29870 3613671 3612016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 3614575 3613709 gene locus_tag LOCUS_29880 3614575 3613709 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965444.1 protein_id gnl|my_center|LOCUS_29880 3616163 3614568 gene locus_tag LOCUS_29890 3616163 3614568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 3618193 3616160 gene locus_tag LOCUS_29900 gene flhA 3618193 3616160 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_29900 3619336 3618242 gene locus_tag LOCUS_29910 gene flhB 3619336 3618242 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_29910 3620164 3619376 gene locus_tag LOCUS_29920 gene fliR 3620164 3619376 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245510.1 protein_id gnl|my_center|LOCUS_29920 3620435 3620166 gene locus_tag LOCUS_29930 gene fliQ 3620435 3620166 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_29930 3621209 3620463 gene locus_tag LOCUS_29940 gene fliP 3621209 3620463 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 protein_id gnl|my_center|LOCUS_29940 3621682 3621206 gene locus_tag LOCUS_29950 3621682 3621206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 3622087 3621725 gene locus_tag LOCUS_29960 gene cheY 3622087 3621725 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244957.1 protein_id gnl|my_center|LOCUS_29960 3623351 3622113 gene locus_tag LOCUS_29970 3623351 3622113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 3624384 3623383 gene locus_tag LOCUS_29980 gene fliM 3624384 3623383 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220879.1 protein_id gnl|my_center|LOCUS_29980 3624902 3624420 gene locus_tag LOCUS_29990 3624902 3624420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 3625132 3624899 gene locus_tag LOCUS_30000 3625132 3624899 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081092.1 protein_id gnl|my_center|LOCUS_30000 3626036 3625212 gene locus_tag LOCUS_30010 gene flgG 3626036 3625212 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_30010 3626538 3626137 gene locus_tag LOCUS_30020 3626538 3626137 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_30020 3626983 3626531 gene locus_tag LOCUS_30030 gene flgD 3626983 3626531 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231970.1 protein_id gnl|my_center|LOCUS_30030 3628418 3627012 gene locus_tag LOCUS_30040 3628418 3627012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 3629382 3628474 gene locus_tag LOCUS_30050 3629382 3628474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 3629863 3629417 gene locus_tag LOCUS_30060 3629863 3629417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 3631186 3629870 gene locus_tag LOCUS_30070 gene fliI 3631186 3629870 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090887161.1 protein_id gnl|my_center|LOCUS_30070 3632009 3631176 gene locus_tag LOCUS_30080 3632009 3631176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 3633018 3632002 gene locus_tag LOCUS_30090 gene fliG 3633018 3632002 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_30090 3634613 3633030 gene locus_tag LOCUS_30100 gene fliF 3634613 3633030 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886506.1 protein_id gnl|my_center|LOCUS_30100 3634972 3634658 gene locus_tag LOCUS_30110 gene fliE 3634972 3634658 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457685.1 protein_id gnl|my_center|LOCUS_30110 3635482 3635033 gene locus_tag LOCUS_30120 gene flgC 3635482 3635033 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245521.1 protein_id gnl|my_center|LOCUS_30120 3635933 3635529 gene locus_tag LOCUS_30130 gene flgB 3635933 3635529 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_30130 3636945 3636169 gene locus_tag LOCUS_30140 gene codY 3636945 3636169 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421290.1 protein_id gnl|my_center|LOCUS_30140 3638375 3636981 gene locus_tag LOCUS_30150 gene hslU 3638375 3636981 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550088.1 protein_id gnl|my_center|LOCUS_30150 3638941 3638399 gene locus_tag LOCUS_30160 gene hslV 3638941 3638399 CDS product ATP-dependent protease proteolytic subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526272.1 protein_id gnl|my_center|LOCUS_30160 3640409 3639081 gene locus_tag LOCUS_30170 gene trmFO 3640409 3639081 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_30170 3642587 3640491 gene locus_tag LOCUS_30180 gene topA 3642587 3640491 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245599.1 protein_id gnl|my_center|LOCUS_30180 3643761 3642667 gene locus_tag LOCUS_30190 gene dprA 3643761 3642667 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_30190 3644795 3643869 gene locus_tag LOCUS_30200 gene sucD 3644795 3643869 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115178.1 protein_id gnl|my_center|LOCUS_30200 3645983 3644823 gene locus_tag LOCUS_30210 gene sucC 3645983 3644823 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_30210 3647835 3646210 gene locus_tag LOCUS_30220 3647835 3646210 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_30220 3648359 3647964 gene locus_tag LOCUS_30230 3648359 3647964 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_30230 3648724 3648356 gene locus_tag LOCUS_30240 3648724 3648356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 3650577 3648760 gene locus_tag LOCUS_30250 3650577 3648760 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164545570.1 protein_id gnl|my_center|LOCUS_30250 3651301 3650660 gene locus_tag LOCUS_30260 3651301 3650660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 3652441 3651575 gene locus_tag LOCUS_30270 gene ylqF 3652441 3651575 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_30270 3653271 3652534 gene locus_tag LOCUS_30280 gene lepB 3653271 3652534 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662493.1 protein_id gnl|my_center|LOCUS_30280 3653747 3653406 gene locus_tag LOCUS_30290 gene rplS 3653747 3653406 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_30290 3654810 3653983 gene locus_tag LOCUS_30300 gene trmD 3654810 3653983 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_30300 3655337 3654813 gene locus_tag LOCUS_30310 gene rimM 3655337 3654813 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170268.1 protein_id gnl|my_center|LOCUS_30310 3655690 3655457 gene locus_tag LOCUS_30320 3655690 3655457 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_30320 3655992 3655720 gene locus_tag LOCUS_30330 gene rpsP 3655992 3655720 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_30330 3657422 3656037 gene locus_tag LOCUS_30340 gene ffh 3657422 3656037 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863461.1 protein_id gnl|my_center|LOCUS_30340 3657855 3657493 gene locus_tag LOCUS_30350 3657855 3657493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3659119 3658016 gene locus_tag LOCUS_30360 3659119 3658016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 3660063 3659230 gene locus_tag LOCUS_30370 3660063 3659230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 3662902 3661655 gene locus_tag LOCUS_30380 gene pucG 3662902 3661655 CDS product (S)-ureidoglycine--glyoxylate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244520.1 protein_id gnl|my_center|LOCUS_30380 3664164 3662908 gene locus_tag LOCUS_30390 gene allC 3664164 3662908 CDS product allantoate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228640.1 protein_id gnl|my_center|LOCUS_30390 3665561 3664161 gene locus_tag LOCUS_30400 3665561 3664161 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887796.1 protein_id gnl|my_center|LOCUS_30400 3665942 3665592 gene locus_tag LOCUS_30410 gene uraH 3665942 3665592 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850504.1 protein_id gnl|my_center|LOCUS_30410 3666480 3665959 gene locus_tag LOCUS_30420 gene uraD 3666480 3665959 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552526.1 protein_id gnl|my_center|LOCUS_30420 3666968 3666477 gene locus_tag LOCUS_30430 3666968 3666477 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173672.1 protein_id gnl|my_center|LOCUS_30430 3667471 3666965 gene locus_tag LOCUS_30440 gene pucE 3667471 3666965 CDS product xanthine dehydrogenase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243276.1 protein_id gnl|my_center|LOCUS_30440 3669789 3667522 gene locus_tag LOCUS_30450 gene pucD 3669789 3667522 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243174.1 protein_id gnl|my_center|LOCUS_30450 3670724 3669780 gene locus_tag LOCUS_30460 3670724 3669780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 3671678 3670749 gene locus_tag LOCUS_30470 3671678 3670749 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_30470 3672808 3671696 gene locus_tag LOCUS_30480 3672808 3671696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_30480 3674331 3672805 gene locus_tag LOCUS_30490 3674331 3672805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_30490 3675688 3674489 gene locus_tag LOCUS_30500 3675688 3674489 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_30500 3676519 3675884 gene locus_tag LOCUS_30510 gene pucB 3676519 3675884 CDS product xanthine dehydrogenase accessory protein PucB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000706287.1 protein_id gnl|my_center|LOCUS_30510 3677468 3676419 gene locus_tag LOCUS_30520 3677468 3676419 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243519.1 protein_id gnl|my_center|LOCUS_30520 3678834 3677491 gene locus_tag LOCUS_30530 3678834 3677491 CDS product 5'-deoxyadenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392738.1 protein_id gnl|my_center|LOCUS_30530 3680552 3678939 gene locus_tag LOCUS_30540 gene pucR 3680552 3678939 CDS product purine catabolism transcriptional regulator PucR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244351.1 protein_id gnl|my_center|LOCUS_30540 3682009 3680786 gene locus_tag LOCUS_30550 3682009 3680786 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819167.1 protein_id gnl|my_center|LOCUS_30550 3682744 3682037 gene locus_tag LOCUS_30560 3682744 3682037 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086078.1 protein_id gnl|my_center|LOCUS_30560 3684207 3682849 gene locus_tag LOCUS_30570 3684207 3682849 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064198.1 protein_id gnl|my_center|LOCUS_30570 3685127 3684297 gene locus_tag LOCUS_30580 3685127 3684297 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064688.1 protein_id gnl|my_center|LOCUS_30580 3686347 3685142 gene locus_tag LOCUS_30590 3686347 3685142 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229312.1 protein_id gnl|my_center|LOCUS_30590 3687739 3686402 gene locus_tag LOCUS_30600 3687739 3686402 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_30600 3688500 3687763 gene locus_tag LOCUS_30610 3688500 3687763 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_30610 3689360 3688497 gene locus_tag LOCUS_30620 3689360 3688497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3690817 3689390 gene locus_tag LOCUS_30630 3690817 3689390 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_30630 3692835 3691195 gene locus_tag LOCUS_30640 3692835 3691195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 3693829 3692828 gene locus_tag LOCUS_30650 3693829 3692828 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379233.1 protein_id gnl|my_center|LOCUS_30650 3694896 3694033 gene locus_tag LOCUS_30660 3694896 3694033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755315.1 protein_id gnl|my_center|LOCUS_30660 3696664 3695141 gene locus_tag LOCUS_30670 3696664 3695141 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233429.1 protein_id gnl|my_center|LOCUS_30670 3697109 3696657 gene locus_tag LOCUS_30680 3697109 3696657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 3698322 3697324 gene locus_tag LOCUS_30690 gene ftsY 3698322 3697324 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007656.1 protein_id gnl|my_center|LOCUS_30690 3702024 3698449 gene locus_tag LOCUS_30700 gene smc 3702024 3698449 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_30700 3702772 3702005 gene locus_tag LOCUS_30710 gene rncS 3702772 3702005 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146873.1 protein_id gnl|my_center|LOCUS_30710 3704145 3702904 gene locus_tag LOCUS_30720 gene fabF 3704145 3702904 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_30720 3704752 3704519 gene locus_tag LOCUS_30730 gene acpP 3704752 3704519 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_30730 3705637 3704885 gene locus_tag LOCUS_30740 gene fabG 3705637 3704885 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232035.1 protein_id gnl|my_center|LOCUS_30740 3706642 3705713 gene locus_tag LOCUS_30750 gene fabD 3706642 3705713 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989819.1 protein_id gnl|my_center|LOCUS_30750 3707669 3706668 gene locus_tag LOCUS_30760 3707669 3706668 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_30760 3708655 3707666 gene locus_tag LOCUS_30770 gene plsX 3708655 3707666 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684110.1 protein_id gnl|my_center|LOCUS_30770 3709245 3708652 gene locus_tag LOCUS_30780 gene fapR 3709245 3708652 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747348.1 protein_id gnl|my_center|LOCUS_30780 3709518 3709345 gene locus_tag LOCUS_30790 gene rpmF 3709518 3709345 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001984764.1 protein_id gnl|my_center|LOCUS_30790 3710106 3709585 gene locus_tag LOCUS_30800 3710106 3709585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 3710264 3711499 gene locus_tag LOCUS_30810 3710264 3711499 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244707.1 protein_id gnl|my_center|LOCUS_30810 3712174 3711719 gene locus_tag LOCUS_30820 3712174 3711719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117689.1 protein_id gnl|my_center|LOCUS_30820 3712366 3713634 gene locus_tag LOCUS_30830 3712366 3713634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3714223 3713705 gene locus_tag LOCUS_30840 gene coaD 3714223 3713705 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200598.1 protein_id gnl|my_center|LOCUS_30840 3714787 3714224 gene locus_tag LOCUS_30850 gene rsmD 3714787 3714224 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266978.1 protein_id gnl|my_center|LOCUS_30850 3715069 3714860 gene locus_tag LOCUS_30860 3715069 3714860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 3715225 3715842 gene locus_tag LOCUS_30870 3715225 3715842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 3716074 3716679 gene locus_tag LOCUS_30880 3716074 3716679 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222730.1 protein_id gnl|my_center|LOCUS_30880 3717379 3717894 gene locus_tag LOCUS_30890 3717379 3717894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 3717945 3718136 gene locus_tag LOCUS_30900 3717945 3718136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 3719305 3718514 gene locus_tag LOCUS_30910 3719305 3718514 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871102.1 protein_id gnl|my_center|LOCUS_30910 3720077 3719295 gene locus_tag LOCUS_30920 3720077 3719295 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256330.1 protein_id gnl|my_center|LOCUS_30920 3720847 3720074 gene locus_tag LOCUS_30930 3720847 3720074 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057157.1 protein_id gnl|my_center|LOCUS_30930 3721142 3720837 gene locus_tag LOCUS_30940 3721142 3720837 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655666.1 protein_id gnl|my_center|LOCUS_30940 3722270 3721188 gene locus_tag LOCUS_30950 3722270 3721188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861411.1 protein_id gnl|my_center|LOCUS_30950 3722652 3722921 gene locus_tag LOCUS_30960 3722652 3722921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3722906 3723997 gene locus_tag LOCUS_30970 3722906 3723997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3723994 3725376 gene locus_tag LOCUS_30980 gene gerKA 3723994 3725376 CDS product spore germination protein GerKA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246515.1 protein_id gnl|my_center|LOCUS_30980 3725373 3726572 gene locus_tag LOCUS_30990 3725373 3726572 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_30990 3726752 3727321 gene locus_tag LOCUS_31000 3726752 3727321 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392473.1 protein_id gnl|my_center|LOCUS_31000 3727278 3728399 gene locus_tag LOCUS_31010 3727278 3728399 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814410.1 protein_id gnl|my_center|LOCUS_31010 3728396 3729376 gene locus_tag LOCUS_31020 3728396 3729376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 3729373 3730218 gene locus_tag LOCUS_31030 3729373 3730218 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814405.1 protein_id gnl|my_center|LOCUS_31030 3731246 3730437 gene locus_tag LOCUS_31040 3731246 3730437 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_31040 3731429 3732244 gene locus_tag LOCUS_31050 gene araC 3731429 3732244 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852388.1 protein_id gnl|my_center|LOCUS_31050 3732638 3733585 gene locus_tag LOCUS_31060 3732638 3733585 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_31060 3737261 3733992 gene locus_tag LOCUS_31070 3737261 3733992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 3740364 3737548 gene locus_tag LOCUS_31080 3740364 3737548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 3741289 3740474 gene locus_tag LOCUS_31090 3741289 3740474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3742857 3741313 gene locus_tag LOCUS_31100 3742857 3741313 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_31100 3742802 3742948 gene locus_tag LOCUS_31110 3742802 3742948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3743825 3742965 gene locus_tag LOCUS_31120 3743825 3742965 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_31120 3744721 3743819 gene locus_tag LOCUS_31130 gene rmgP 3744721 3743819 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_31130 3746596 3744851 gene locus_tag LOCUS_31140 3746596 3744851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3748212 3746623 gene locus_tag LOCUS_31150 3748212 3746623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 3750285 3748399 gene locus_tag LOCUS_31160 3750285 3748399 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_31160 3750505 3751362 gene locus_tag LOCUS_31170 3750505 3751362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 3752183 3751413 gene locus_tag LOCUS_31180 3752183 3751413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 3753119 3752289 gene locus_tag LOCUS_31190 gene uppP 3753119 3752289 CDS product undecaprenyl-diphosphate phosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280036.1 protein_id gnl|my_center|LOCUS_31190 3754388 3753186 gene locus_tag LOCUS_31200 3754388 3753186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 3754888 3754715 gene locus_tag LOCUS_31210 3754888 3754715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3755654 3754959 gene locus_tag LOCUS_31220 3755654 3754959 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195828.1 protein_id gnl|my_center|LOCUS_31220 3757113 3755641 gene locus_tag LOCUS_31230 3757113 3755641 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023851.1 protein_id gnl|my_center|LOCUS_31230 3757482 3758159 gene locus_tag LOCUS_31240 3757482 3758159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 3758585 3758253 gene locus_tag LOCUS_31250 3758585 3758253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 3760624 3759059 gene locus_tag LOCUS_31260 3760624 3759059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 3761595 3760978 gene locus_tag LOCUS_31270 3761595 3760978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 3762517 3761648 gene locus_tag LOCUS_31280 3762517 3761648 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942561.1 protein_id gnl|my_center|LOCUS_31280 3764146 3762533 gene locus_tag LOCUS_31290 3764146 3762533 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_31290 3773138 3764130 gene locus_tag LOCUS_31300 3773138 3764130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 3775421 3773154 gene locus_tag LOCUS_31310 3775421 3773154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31310 3779452 3775499 gene locus_tag LOCUS_31320 3779452 3775499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31320 3780178 3779465 gene locus_tag LOCUS_31330 3780178 3779465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 3783328 3780554 gene locus_tag LOCUS_31340 3783328 3780554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 3785315 3783474 gene locus_tag LOCUS_31350 3785315 3783474 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_31350 3787819 3785543 gene locus_tag LOCUS_31360 3787819 3785543 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 protein_id gnl|my_center|LOCUS_31360 3789415 3787853 gene locus_tag LOCUS_31370 3789415 3787853 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_31370 3790342 3789467 gene locus_tag LOCUS_31380 3790342 3789467 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_31380 3791275 3790364 gene locus_tag LOCUS_31390 gene rmgP 3791275 3790364 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_31390 3791818 3791636 gene locus_tag LOCUS_31400 3791818 3791636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 3792181 3793005 gene locus_tag LOCUS_31410 3792181 3793005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 3793115 3794239 gene locus_tag LOCUS_31420 3793115 3794239 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989908.1 protein_id gnl|my_center|LOCUS_31420 3794229 3796067 gene locus_tag LOCUS_31430 3794229 3796067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 3797059 3796154 gene locus_tag LOCUS_31440 3797059 3796154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 3798706 3797111 gene locus_tag LOCUS_31450 3798706 3797111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 3800443 3798713 gene locus_tag LOCUS_31460 3800443 3798713 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_31460 3801388 3800552 gene locus_tag LOCUS_31470 3801388 3800552 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530307.1 protein_id gnl|my_center|LOCUS_31470 3802283 3801378 gene locus_tag LOCUS_31480 3802283 3801378 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256269.1 protein_id gnl|my_center|LOCUS_31480 3803501 3802371 gene locus_tag LOCUS_31490 3803501 3802371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 3803476 3803724 gene locus_tag LOCUS_31500 3803476 3803724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 3805360 3803855 gene locus_tag LOCUS_31510 3805360 3803855 CDS product DUF5060 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548190.1 protein_id gnl|my_center|LOCUS_31510 3806528 3805377 gene locus_tag LOCUS_31520 3806528 3805377 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_31520 3808951 3806525 gene locus_tag LOCUS_31530 3808951 3806525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 3809208 3812495 gene locus_tag LOCUS_31540 3809208 3812495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 3813791 3812715 gene locus_tag LOCUS_31550 3813791 3812715 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521613.1 protein_id gnl|my_center|LOCUS_31550 3815373 3813817 gene locus_tag LOCUS_31560 3815373 3813817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 3817130 3815370 gene locus_tag LOCUS_31570 3817130 3815370 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_31570 3818516 3817188 gene locus_tag LOCUS_31580 3818516 3817188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243455.1 protein_id gnl|my_center|LOCUS_31580 3820268 3818649 gene locus_tag LOCUS_31590 3820268 3818649 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285974.1 protein_id gnl|my_center|LOCUS_31590 3821261 3820356 gene locus_tag LOCUS_31600 3821261 3820356 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027800.1 protein_id gnl|my_center|LOCUS_31600 3822280 3821285 gene locus_tag LOCUS_31610 3822280 3821285 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_31610 3825094 3822314 gene locus_tag LOCUS_31620 3825094 3822314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3825440 3827359 gene locus_tag LOCUS_31630 3825440 3827359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 3827404 3830106 gene locus_tag LOCUS_31640 3827404 3830106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 3831963 3830137 gene locus_tag LOCUS_31650 3831963 3830137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 3833423 3831984 gene locus_tag LOCUS_31660 3833423 3831984 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641582.1 protein_id gnl|my_center|LOCUS_31660 3835184 3833538 gene locus_tag LOCUS_31670 3835184 3833538 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_31670 3836150 3835254 gene locus_tag LOCUS_31680 3836150 3835254 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_31680 3837088 3836144 gene locus_tag LOCUS_31690 3837088 3836144 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_31690 3838313 3837303 gene locus_tag LOCUS_31700 gene gap 3838313 3837303 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732485.1 protein_id gnl|my_center|LOCUS_31700 3838517 3839116 gene locus_tag LOCUS_31710 3838517 3839116 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258084.1 protein_id gnl|my_center|LOCUS_31710 3839843 3839163 gene locus_tag LOCUS_31720 3839843 3839163 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_31720 3841714 3839987 gene locus_tag LOCUS_31730 gene cydC 3841714 3839987 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485888.1 protein_id gnl|my_center|LOCUS_31730 3843477 3841711 gene locus_tag LOCUS_31740 gene cydD 3843477 3841711 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933481.1 protein_id gnl|my_center|LOCUS_31740 3844533 3843520 gene locus_tag LOCUS_31750 3844533 3843520 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638459.1 protein_id gnl|my_center|LOCUS_31750 3845897 3844533 gene locus_tag LOCUS_31760 3845897 3844533 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485341.1 protein_id gnl|my_center|LOCUS_31760 3847864 3846140 gene locus_tag LOCUS_31770 3847864 3846140 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764450.1 protein_id gnl|my_center|LOCUS_31770 3850596 3847861 gene locus_tag LOCUS_31780 3850596 3847861 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_31780 3851422 3850580 gene locus_tag LOCUS_31790 3851422 3850580 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_31790 3852303 3851422 gene locus_tag LOCUS_31800 3852303 3851422 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_31800 3853739 3852372 gene locus_tag LOCUS_31810 3853739 3852372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3855419 3853872 gene locus_tag LOCUS_31820 3855419 3853872 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 protein_id gnl|my_center|LOCUS_31820 3856972 3855416 gene locus_tag LOCUS_31830 3856972 3855416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 3857171 3857004 gene locus_tag LOCUS_31840 3857171 3857004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 3859785 3857311 gene locus_tag LOCUS_31850 3859785 3857311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 3862929 3859807 gene locus_tag LOCUS_31860 3862929 3859807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3863351 3863557 gene locus_tag LOCUS_31870 3863351 3863557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 3863547 3864806 gene locus_tag LOCUS_31880 3863547 3864806 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886562.1 protein_id gnl|my_center|LOCUS_31880 3864803 3865336 gene locus_tag LOCUS_31890 3864803 3865336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 3865548 3866237 gene locus_tag LOCUS_31900 3865548 3866237 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399422.1 protein_id gnl|my_center|LOCUS_31900 3866329 3866592 gene locus_tag LOCUS_31910 3866329 3866592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 3866859 3866572 gene locus_tag LOCUS_31920 3866859 3866572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 3869020 3866951 gene locus_tag LOCUS_31930 gene recG 3869020 3866951 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000816.1 protein_id gnl|my_center|LOCUS_31930 3869935 3869063 gene locus_tag LOCUS_31940 3869935 3869063 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244125.1 protein_id gnl|my_center|LOCUS_31940 3871777 3869954 gene locus_tag LOCUS_31950 3871777 3869954 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_31950 3872244 3871885 gene locus_tag LOCUS_31960 3872244 3871885 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232054.1 protein_id gnl|my_center|LOCUS_31960 3872428 3872616 gene locus_tag LOCUS_31970 gene rpmB 3872428 3872616 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221548.1 protein_id gnl|my_center|LOCUS_31970 3873780 3873133 gene locus_tag LOCUS_31980 gene rpe 3873780 3873133 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232058.1 protein_id gnl|my_center|LOCUS_31980 3874732 3873785 gene locus_tag LOCUS_31990 gene rsgA 3874732 3873785 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232060.1 protein_id gnl|my_center|LOCUS_31990 3876942 3874729 gene locus_tag LOCUS_32000 gene prkC 3876942 3874729 CDS product serine/threonine protein kinase PrkC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232062.1 protein_id gnl|my_center|LOCUS_32000 3877715 3876939 gene locus_tag LOCUS_32010 3877715 3876939 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_32010 3878797 3877712 gene locus_tag LOCUS_32020 gene rlmN 3878797 3877712 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450540.1 protein_id gnl|my_center|LOCUS_32020 3880275 3878944 gene locus_tag LOCUS_32030 gene rsmB 3880275 3878944 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 protein_id gnl|my_center|LOCUS_32030 3880706 3880227 gene locus_tag LOCUS_32040 3880706 3880227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 3882350 3881391 gene locus_tag LOCUS_32050 gene fmt 3882350 3881391 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_32050 3882845 3882354 gene locus_tag LOCUS_32060 gene def 3882845 3882354 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_32060 3885411 3882901 gene locus_tag LOCUS_32070 gene priA 3885411 3882901 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_32070 3886670 3885408 gene locus_tag LOCUS_32080 gene coaBC 3886670 3885408 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911762.1 protein_id gnl|my_center|LOCUS_32080 3886970 3886734 gene locus_tag LOCUS_32090 3886970 3886734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3887610 3886975 gene locus_tag LOCUS_32100 gene gmk 3887610 3886975 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_32100 3887884 3887624 gene locus_tag LOCUS_32110 3887884 3887624 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_32110 3889965 3888052 gene locus_tag LOCUS_32120 3889965 3888052 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245847.1 protein_id gnl|my_center|LOCUS_32120 3890999 3890169 gene locus_tag LOCUS_32130 gene dapF 3890999 3890169 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_32130 3892766 3891165 gene locus_tag LOCUS_32140 3892766 3891165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 3893885 3892854 gene locus_tag LOCUS_32150 3893885 3892854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3896943 3894118 gene locus_tag LOCUS_32160 3896943 3894118 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 protein_id gnl|my_center|LOCUS_32160 3897896 3899626 gene locus_tag LOCUS_32170 3897896 3899626 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_32170 3900943 3899666 gene locus_tag LOCUS_32180 3900943 3899666 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_32180 3902095 3900998 gene locus_tag LOCUS_32190 3902095 3900998 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973578.1 protein_id gnl|my_center|LOCUS_32190 3902921 3902160 gene locus_tag LOCUS_32200 3902921 3902160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_32200 3903701 3903039 gene locus_tag LOCUS_32210 3903701 3903039 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967141.1 protein_id gnl|my_center|LOCUS_32210 3905571 3903763 gene locus_tag LOCUS_32220 3905571 3903763 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203704.1 protein_id gnl|my_center|LOCUS_32220 3907728 3905686 gene locus_tag LOCUS_32230 3907728 3905686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 3909456 3907753 gene locus_tag LOCUS_32240 3909456 3907753 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_32240 3910423 3909530 gene locus_tag LOCUS_32250 3910423 3909530 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_32250 3911392 3910451 gene locus_tag LOCUS_32260 gene rmgP 3911392 3910451 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_32260 3913369 3911582 gene locus_tag LOCUS_32270 gene yesM 3913369 3911582 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_32270 3914993 3913362 gene locus_tag LOCUS_32280 3914993 3913362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3915370 3915119 gene locus_tag LOCUS_32290 3915370 3915119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 3920085 3915415 gene locus_tag LOCUS_32300 3920085 3915415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 3922500 3920122 gene locus_tag LOCUS_32310 3922500 3920122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 3924345 3922654 gene locus_tag LOCUS_32320 3924345 3922654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_32320 3925348 3924440 gene locus_tag LOCUS_32330 3925348 3924440 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_32330 3926343 3925366 gene locus_tag LOCUS_32340 3926343 3925366 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_32340 3928985 3926691 gene locus_tag LOCUS_32350 3928985 3926691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 3931413 3929095 gene locus_tag LOCUS_32360 3931413 3929095 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108674.1 protein_id gnl|my_center|LOCUS_32360 3931619 3932515 gene locus_tag LOCUS_32370 3931619 3932515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 3933338 3932439 gene locus_tag LOCUS_32380 3933338 3932439 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_32380 3934234 3933335 gene locus_tag LOCUS_32390 3934234 3933335 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_32390 3934796 3934359 gene locus_tag LOCUS_32400 3934796 3934359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 3935278 3935015 gene locus_tag LOCUS_32410 3935278 3935015 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726138.1 protein_id gnl|my_center|LOCUS_32410 3935817 3935323 gene locus_tag LOCUS_32420 3935817 3935323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 3937773 3935887 gene locus_tag LOCUS_32430 3937773 3935887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 3939539 3937770 gene locus_tag LOCUS_32440 3939539 3937770 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_32440 3940938 3939757 gene locus_tag LOCUS_32450 gene sndC 3940938 3939757 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_32450 3941127 3941471 gene locus_tag LOCUS_32460 3941127 3941471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 3941488 3942672 gene locus_tag LOCUS_32470 gene spoVE 3941488 3942672 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_32470 3943112 3942720 gene locus_tag LOCUS_32480 3943112 3942720 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 protein_id gnl|my_center|LOCUS_32480 3943265 3944323 gene locus_tag LOCUS_32490 gene cax 3943265 3944323 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482137.1 protein_id gnl|my_center|LOCUS_32490 3944701 3944402 gene locus_tag LOCUS_32500 3944701 3944402 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135694.1 protein_id gnl|my_center|LOCUS_32500 3945464 3944862 gene locus_tag LOCUS_32510 3945464 3944862 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434857.1 protein_id gnl|my_center|LOCUS_32510 3945849 3945610 gene locus_tag LOCUS_32520 3945849 3945610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 3947048 3945933 gene locus_tag LOCUS_32530 3947048 3945933 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_32530 3949174 3947192 gene locus_tag LOCUS_32540 3949174 3947192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3949551 3950150 gene locus_tag LOCUS_32550 gene rpsD 3949551 3950150 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229304.1 protein_id gnl|my_center|LOCUS_32550 3951926 3950382 gene locus_tag LOCUS_32560 3951926 3950382 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_32560 3952466 3951966 gene locus_tag LOCUS_32570 3952466 3951966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460096.1 protein_id gnl|my_center|LOCUS_32570 3952691 3955846 gene locus_tag LOCUS_32580 3952691 3955846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 3957753 3956029 gene locus_tag LOCUS_32590 gene acsA 3957753 3956029 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399030.1 protein_id gnl|my_center|LOCUS_32590 3958090 3958722 gene locus_tag LOCUS_32600 gene acuA 3958090 3958722 CDS product acetoin utilization protein acetyltransferase AcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229296.1 protein_id gnl|my_center|LOCUS_32600 3958742 3959938 gene locus_tag LOCUS_32610 gene acuC 3958742 3959938 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092826.1 protein_id gnl|my_center|LOCUS_32610 3960740 3960051 gene locus_tag LOCUS_32620 3960740 3960051 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421518.1 protein_id gnl|my_center|LOCUS_32620 3961851 3960844 gene locus_tag LOCUS_32630 gene ccpA 3961851 3960844 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229285.1 protein_id gnl|my_center|LOCUS_32630 3962329 3961985 gene locus_tag LOCUS_32640 gene ytxJ 3962329 3961985 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 protein_id gnl|my_center|LOCUS_32640 3962847 3962437 gene locus_tag LOCUS_32650 3962847 3962437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 3963086 3963613 gene locus_tag LOCUS_32660 3963086 3963613 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723656.1 protein_id gnl|my_center|LOCUS_32660 3965477 3963720 gene locus_tag LOCUS_32670 gene ptsP 3965477 3963720 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431795.1 protein_id gnl|my_center|LOCUS_32670 3967360 3965474 gene locus_tag LOCUS_32680 gene ptsG 3967360 3965474 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832339.1 protein_id gnl|my_center|LOCUS_32680 3967910 3967494 gene locus_tag LOCUS_32690 3967910 3967494 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245606.1 protein_id gnl|my_center|LOCUS_32690 3969250 3967955 gene locus_tag LOCUS_32700 gene aroA 3969250 3967955 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479628.1 protein_id gnl|my_center|LOCUS_32700 3969387 3969689 gene locus_tag LOCUS_32710 3969387 3969689 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 protein_id gnl|my_center|LOCUS_32710 3971325 3969910 gene locus_tag LOCUS_32720 gene gndA 3971325 3969910 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_32720 3972134 3971466 gene locus_tag LOCUS_32730 3972134 3971466 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_32730 3972955 3972353 gene locus_tag LOCUS_32740 3972955 3972353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3973129 3973770 gene locus_tag LOCUS_32750 3973129 3973770 CDS product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155317.1 protein_id gnl|my_center|LOCUS_32750 3976900 3973895 gene locus_tag LOCUS_32760 3976900 3973895 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375594.1 protein_id gnl|my_center|LOCUS_32760 3978298 3977114 gene locus_tag LOCUS_32770 3978298 3977114 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_32770 3978573 3980042 gene locus_tag LOCUS_32780 gene speA 3978573 3980042 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084882.1 protein_id gnl|my_center|LOCUS_32780 3980411 3980121 gene locus_tag LOCUS_32790 3980411 3980121 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810865.1 protein_id gnl|my_center|LOCUS_32790 3981118 3980543 gene locus_tag LOCUS_32800 3981118 3980543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 3981551 3981330 gene locus_tag LOCUS_32810 3981551 3981330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 3981733 3982461 gene locus_tag LOCUS_32820 3981733 3982461 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957681.1 protein_id gnl|my_center|LOCUS_32820 3982768 3982574 gene locus_tag LOCUS_32830 3982768 3982574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 3983092 3983167 gene locus_tag LOCUS_t00240 3983092 3983167 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3983358 3983780 gene locus_tag LOCUS_32840 3983358 3983780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3983911 3983986 gene locus_tag LOCUS_t00250 3983911 3983986 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3984115 3985290 gene locus_tag LOCUS_32850 3984115 3985290 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797323.1 protein_id gnl|my_center|LOCUS_32850 3985444 3986373 gene locus_tag LOCUS_32860 3985444 3986373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3987188 3986436 gene locus_tag LOCUS_32870 3987188 3986436 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242965.1 protein_id gnl|my_center|LOCUS_32870 3987279 3988124 gene locus_tag LOCUS_32880 gene dat 3987279 3988124 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484981.1 protein_id gnl|my_center|LOCUS_32880 3988346 3988176 gene locus_tag LOCUS_32890 3988346 3988176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 3988544 3989077 gene locus_tag LOCUS_32900 3988544 3989077 CDS product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 protein_id gnl|my_center|LOCUS_32900 3989430 3989218 gene locus_tag LOCUS_32910 3989430 3989218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 3990035 3995056 gene locus_tag LOCUS_32920 3990035 3995056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 3995725 3995117 gene locus_tag LOCUS_32930 3995725 3995117 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_32930 3997421 3995820 gene locus_tag LOCUS_32940 3997421 3995820 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_32940 3998309 3997473 gene locus_tag LOCUS_32950 3998309 3997473 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_32950 3999272 3998367 gene locus_tag LOCUS_32960 3999272 3998367 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_32960 4001041 3999269 gene locus_tag LOCUS_32970 4001041 3999269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4004005 4001210 gene locus_tag LOCUS_32980 4004005 4001210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 4005591 4004098 gene locus_tag LOCUS_32990 4005591 4004098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 4007392 4005584 gene locus_tag LOCUS_33000 4007392 4005584 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_33000 4007887 4007799 gene locus_tag LOCUS_t00260 4007887 4007799 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4007998 4007923 gene locus_tag LOCUS_t00270 4007998 4007923 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4008104 4008028 gene locus_tag LOCUS_t00280 4008104 4008028 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4008376 4008185 gene locus_tag LOCUS_33010 4008376 4008185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 4008672 4008508 gene locus_tag LOCUS_33020 4008672 4008508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 4010330 4008768 gene locus_tag LOCUS_33030 4010330 4008768 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_33030 4012040 4010490 gene locus_tag LOCUS_33040 4012040 4010490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 4012924 4012037 gene locus_tag LOCUS_33050 4012924 4012037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_33050 4015822 4012928 gene locus_tag LOCUS_33060 4015822 4012928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 4016929 4015826 gene locus_tag LOCUS_33070 4016929 4015826 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551445.1 protein_id gnl|my_center|LOCUS_33070 4017581 4016889 gene locus_tag LOCUS_33080 4017581 4016889 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_33080 4017817 4019499 gene locus_tag LOCUS_33090 4017817 4019499 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_33090 4019607 4020968 gene locus_tag LOCUS_33100 gene nagZ 4019607 4020968 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_33100 4021036 4021773 gene locus_tag LOCUS_33110 4021036 4021773 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276720.1 protein_id gnl|my_center|LOCUS_33110 4021766 4022881 gene locus_tag LOCUS_33120 gene psdS 4021766 4022881 CDS product two-component sensor histidine kinase PsdS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242699.1 protein_id gnl|my_center|LOCUS_33120 4022991 4023767 gene locus_tag LOCUS_33130 4022991 4023767 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948067.1 protein_id gnl|my_center|LOCUS_33130 4023742 4025697 gene locus_tag LOCUS_33140 4023742 4025697 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011377.1 protein_id gnl|my_center|LOCUS_33140 4026557 4025751 gene locus_tag LOCUS_33150 4026557 4025751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 4027359 4026541 gene locus_tag LOCUS_33160 4027359 4026541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4028399 4027356 gene locus_tag LOCUS_33170 4028399 4027356 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257671.1 protein_id gnl|my_center|LOCUS_33170 4029036 4028791 gene locus_tag LOCUS_33180 4029036 4028791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 4029912 4029259 gene locus_tag LOCUS_33190 gene pyrE 4029912 4029259 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357418.1 protein_id gnl|my_center|LOCUS_33190 4030652 4029909 gene locus_tag LOCUS_33200 gene pyrF 4030652 4029909 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_33200 4033995 4030780 gene locus_tag LOCUS_33210 gene carB 4033995 4030780 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232113.1 protein_id gnl|my_center|LOCUS_33210 4035127 4033982 gene locus_tag LOCUS_33220 4035127 4033982 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_33220 4036452 4035133 gene locus_tag LOCUS_33230 gene pyrC 4036452 4035133 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_33230 4037076 4036507 gene locus_tag LOCUS_33240 gene pyrR 4037076 4036507 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 protein_id gnl|my_center|LOCUS_33240 4038601 4037348 gene locus_tag LOCUS_33250 4038601 4037348 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870908.1 protein_id gnl|my_center|LOCUS_33250 4039765 4038722 gene locus_tag LOCUS_33260 4039765 4038722 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005836.1 protein_id gnl|my_center|LOCUS_33260 4040354 4039725 gene locus_tag LOCUS_33270 4040354 4039725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 4040478 4041218 gene locus_tag LOCUS_33280 4040478 4041218 CDS product yteA family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957385.1 protein_id gnl|my_center|LOCUS_33280 4041649 4041284 gene locus_tag LOCUS_33290 4041649 4041284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 4044964 4041857 gene locus_tag LOCUS_33300 gene ileS 4044964 4041857 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416534.1 protein_id gnl|my_center|LOCUS_33300 4045903 4045391 gene locus_tag LOCUS_33310 gene divIVA 4045903 4045391 CDS product septum site-determining protein DivIVA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131611.1 protein_id gnl|my_center|LOCUS_33310 4046788 4046003 gene locus_tag LOCUS_33320 4046788 4046003 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_33320 4047102 4046809 gene locus_tag LOCUS_33330 4047102 4046809 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 protein_id gnl|my_center|LOCUS_33330 4047569 4047111 gene locus_tag LOCUS_33340 gene sepF 4047569 4047111 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_33340 4048290 4047583 gene locus_tag LOCUS_33350 4048290 4047583 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245324.1 protein_id gnl|my_center|LOCUS_33350 4049132 4048293 gene locus_tag LOCUS_33360 gene pgeF 4049132 4048293 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209009.1 protein_id gnl|my_center|LOCUS_33360 4049463 4049188 gene locus_tag LOCUS_33370 4049463 4049188 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_33370 4050431 4049649 gene locus_tag LOCUS_33380 gene sigG 4050431 4049649 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_33380 4051239 4050517 gene locus_tag LOCUS_33390 gene sigE 4051239 4050517 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_33390 4052226 4051255 gene locus_tag LOCUS_33400 gene spoIIGA 4052226 4051255 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232163.1 protein_id gnl|my_center|LOCUS_33400 4053084 4052704 gene locus_tag LOCUS_33410 4053084 4052704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4053640 4053834 gene locus_tag LOCUS_33420 4053640 4053834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 4055276 4053948 gene locus_tag LOCUS_33430 4055276 4053948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 4056567 4055434 gene locus_tag LOCUS_33440 gene ftsZ 4056567 4055434 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_33440 4057864 4056617 gene locus_tag LOCUS_33450 gene ftsA 4057864 4056617 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087551.1 protein_id gnl|my_center|LOCUS_33450 4058940 4058182 gene locus_tag LOCUS_33460 4058940 4058182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 4060376 4059117 gene locus_tag LOCUS_33470 gene murA 4060376 4059117 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_33470 4061299 4060394 gene locus_tag LOCUS_33480 gene murB 4061299 4060394 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_33480 4062596 4061487 gene locus_tag LOCUS_33490 gene murG 4062596 4061487 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 protein_id gnl|my_center|LOCUS_33490 4063698 4062601 gene locus_tag LOCUS_33500 gene spoVE 4063698 4062601 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_33500 4065184 4063745 gene locus_tag LOCUS_33510 gene murD 4065184 4063745 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860120.1 protein_id gnl|my_center|LOCUS_33510 4066152 4065181 gene locus_tag LOCUS_33520 gene mraY 4066152 4065181 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_33520 4067624 4066152 gene locus_tag LOCUS_33530 4067624 4066152 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_33530 4069108 4067621 gene locus_tag LOCUS_33540 gene murE 4069108 4067621 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_33540 4071332 4069383 gene locus_tag LOCUS_33550 4071332 4069383 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245048.1 protein_id gnl|my_center|LOCUS_33550 4073754 4071448 gene locus_tag LOCUS_33560 4073754 4071448 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600106.1 protein_id gnl|my_center|LOCUS_33560 4074191 4073805 gene locus_tag LOCUS_33570 4074191 4073805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 4075253 4074279 gene locus_tag LOCUS_33580 gene rsmH 4075253 4074279 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 protein_id gnl|my_center|LOCUS_33580 4075797 4075360 gene locus_tag LOCUS_33590 gene mraZ 4075797 4075360 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_33590 4077203 4075938 gene locus_tag LOCUS_33600 4077203 4075938 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_33600 4078879 4077200 gene locus_tag LOCUS_33610 gene bshC 4078879 4077200 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403059.1 protein_id gnl|my_center|LOCUS_33610 4078966 4079736 gene locus_tag LOCUS_33620 4078966 4079736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_33620 4080216 4079821 gene locus_tag LOCUS_33630 4080216 4079821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 4081192 4080227 gene locus_tag LOCUS_33640 4081192 4080227 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103683318.1 protein_id gnl|my_center|LOCUS_33640 4082021 4081371 gene locus_tag LOCUS_33650 gene gerR 4082021 4081371 CDS product sporulation specific transcriptional regulator GerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232210.1 protein_id gnl|my_center|LOCUS_33650 4082328 4082564 gene locus_tag LOCUS_33660 4082328 4082564 CDS product DUF2626 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226300.1 protein_id gnl|my_center|LOCUS_33660 4082751 4083842 gene locus_tag LOCUS_33670 4082751 4083842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 4085120 4083813 gene locus_tag LOCUS_33680 4085120 4083813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 4086659 4085325 gene locus_tag LOCUS_33690 4086659 4085325 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358083.1 protein_id gnl|my_center|LOCUS_33690 4086816 4087421 gene locus_tag LOCUS_33700 4086816 4087421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 4088817 4087741 gene locus_tag LOCUS_33710 4088817 4087741 CDS product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727039.1 protein_id gnl|my_center|LOCUS_33710 4089207 4088902 gene locus_tag LOCUS_33720 4089207 4088902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4091082 4089244 gene locus_tag LOCUS_33730 gene typA 4091082 4089244 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000914762.1 protein_id gnl|my_center|LOCUS_33730 4091775 4091281 gene locus_tag LOCUS_33740 4091775 4091281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 4092579 4091905 gene locus_tag LOCUS_33750 4092579 4091905 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_33750 4092715 4093437 gene locus_tag LOCUS_33760 4092715 4093437 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346925.1 protein_id gnl|my_center|LOCUS_33760 4094723 4093497 gene locus_tag LOCUS_33770 gene thiI 4094723 4093497 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188892867.1 protein_id gnl|my_center|LOCUS_33770 4095884 4094727 gene locus_tag LOCUS_33780 4095884 4094727 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_33780 4096765 4095992 gene locus_tag LOCUS_33790 4096765 4095992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4097131 4096922 gene locus_tag LOCUS_33800 4097131 4096922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 4097704 4097216 gene locus_tag LOCUS_33810 4097704 4097216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 4097920 4099938 gene locus_tag LOCUS_33820 4097920 4099938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 4100195 4100959 gene locus_tag LOCUS_33830 4100195 4100959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 4100975 4101439 gene locus_tag LOCUS_33840 4100975 4101439 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_33840 4101902 4103014 gene locus_tag LOCUS_33850 4101902 4103014 CDS product IS4-like element ISDha2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272302.1 protein_id gnl|my_center|LOCUS_33850 4104639 4103410 gene locus_tag LOCUS_33860 4104639 4103410 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_33860 4105917 4104685 gene locus_tag LOCUS_33870 4105917 4104685 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_33870 4107052 4106096 gene locus_tag LOCUS_33880 4107052 4106096 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_33880 4107981 4107049 gene locus_tag LOCUS_33890 gene znuB 4107981 4107049 CDS product zinc ABC transporter permease ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246340.1 protein_id gnl|my_center|LOCUS_33890 4108634 4107924 gene locus_tag LOCUS_33900 gene znuC 4108634 4107924 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234730.1 protein_id gnl|my_center|LOCUS_33900 4109301 4108804 gene locus_tag LOCUS_33910 4109301 4108804 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831164.1 protein_id gnl|my_center|LOCUS_33910 4109428 4109622 gene locus_tag LOCUS_33920 4109428 4109622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 4109579 4109845 gene locus_tag LOCUS_33930 4109579 4109845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 4110973 4109858 gene locus_tag LOCUS_33940 4110973 4109858 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036241.1 protein_id gnl|my_center|LOCUS_33940 4111761 4110940 gene locus_tag LOCUS_33950 4111761 4110940 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006542.1 protein_id gnl|my_center|LOCUS_33950 4112591 4111758 gene locus_tag LOCUS_33960 4112591 4111758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 4113833 4112697 gene locus_tag LOCUS_33970 gene rpoD 4113833 4112697 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764065.1 protein_id gnl|my_center|LOCUS_33970 4115691 4113865 gene locus_tag LOCUS_33980 gene dnaG 4115691 4113865 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230066.1 protein_id gnl|my_center|LOCUS_33980 4116210 4115740 gene locus_tag LOCUS_33990 4116210 4115740 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708761.1 protein_id gnl|my_center|LOCUS_33990 4117182 4116376 gene locus_tag LOCUS_34000 4117182 4116376 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_34000 4119311 4117224 gene locus_tag LOCUS_34010 gene glyS 4119311 4117224 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230059.1 protein_id gnl|my_center|LOCUS_34010 4120191 4119304 gene locus_tag LOCUS_34020 gene glyQ 4120191 4119304 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226213.1 protein_id gnl|my_center|LOCUS_34020 4121308 4120580 gene locus_tag LOCUS_34030 4121308 4120580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 4122251 4121331 gene locus_tag LOCUS_34040 gene menA 4122251 4121331 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_34040 4123155 4122391 gene locus_tag LOCUS_34050 gene recO 4123155 4122391 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487010.1 protein_id gnl|my_center|LOCUS_34050 4123401 4123249 gene locus_tag LOCUS_34060 4123401 4123249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 4124446 4123541 gene locus_tag LOCUS_34070 gene era 4124446 4123541 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_34070 4124892 4124443 gene locus_tag LOCUS_34080 4124892 4124443 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187960.1 protein_id gnl|my_center|LOCUS_34080 4125305 4124934 gene locus_tag LOCUS_34090 4125305 4124934 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721970.1 protein_id gnl|my_center|LOCUS_34090 4125868 4125302 gene locus_tag LOCUS_34100 gene ybeY 4125868 4125302 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387079.1 protein_id gnl|my_center|LOCUS_34100 4128129 4125865 gene locus_tag LOCUS_34110 gene pgpH 4128129 4125865 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886570.1 protein_id gnl|my_center|LOCUS_34110 4129116 4128145 gene locus_tag LOCUS_34120 4129116 4128145 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230035.1 protein_id gnl|my_center|LOCUS_34120 4130325 4129123 gene locus_tag LOCUS_34130 gene yqfD 4130325 4129123 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_34130 4130749 4130465 gene locus_tag LOCUS_34140 gene yqfC 4130749 4130465 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_34140 4131878 4131105 gene locus_tag LOCUS_34150 4131878 4131105 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_34150 4132762 4132130 gene locus_tag LOCUS_34160 4132762 4132130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 4133757 4132768 gene locus_tag LOCUS_34170 gene floA 4133757 4132768 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230026.1 protein_id gnl|my_center|LOCUS_34170 4135200 4133791 gene locus_tag LOCUS_34180 4135200 4133791 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230024.1 protein_id gnl|my_center|LOCUS_34180 4135847 4135404 gene locus_tag LOCUS_34190 4135847 4135404 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054571.1 protein_id gnl|my_center|LOCUS_34190 4136036 4135863 gene locus_tag LOCUS_34200 4136036 4135863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 4136500 4136144 gene locus_tag LOCUS_34210 gene hinT 4136500 4136144 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 protein_id gnl|my_center|LOCUS_34210 4137013 4136675 gene locus_tag LOCUS_34220 4137013 4136675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 4137758 4137159 gene locus_tag LOCUS_34230 4137758 4137159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 4142172 4137832 gene locus_tag LOCUS_34240 gene addA 4142172 4137832 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233100.1 protein_id gnl|my_center|LOCUS_34240 4145768 4142169 gene locus_tag LOCUS_34250 gene addB 4145768 4142169 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058551.1 protein_id gnl|my_center|LOCUS_34250 4147338 4145923 gene locus_tag LOCUS_34260 4147338 4145923 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_34260 4147460 4148443 gene locus_tag LOCUS_34270 4147460 4148443 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945015.1 protein_id gnl|my_center|LOCUS_34270 4149619 4148477 gene locus_tag LOCUS_34280 4149619 4148477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 4150986 4149637 gene locus_tag LOCUS_34290 gene mtaB 4150986 4149637 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_34290 4151770 4150979 gene locus_tag LOCUS_34300 4151770 4150979 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190167.1 protein_id gnl|my_center|LOCUS_34300 4152698 4152012 gene locus_tag LOCUS_34310 4152698 4152012 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 protein_id gnl|my_center|LOCUS_34310 4153696 4152695 gene locus_tag LOCUS_34320 gene prmA 4153696 4152695 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872105.1 protein_id gnl|my_center|LOCUS_34320 4155055 4153781 gene locus_tag LOCUS_34330 gene tyrS 4155055 4153781 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021122.1 protein_id gnl|my_center|LOCUS_34330 4155742 4155392 gene locus_tag LOCUS_34340 4155742 4155392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 4155900 4155748 gene locus_tag LOCUS_34350 4155900 4155748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 4157306 4156188 gene locus_tag LOCUS_34360 gene dnaJ 4157306 4156188 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230010.1 protein_id gnl|my_center|LOCUS_34360 4159275 4157425 gene locus_tag LOCUS_34370 gene dnaK 4159275 4157425 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398786.1 protein_id gnl|my_center|LOCUS_34370 4159906 4159337 gene locus_tag LOCUS_34380 4159906 4159337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 4160976 4159951 gene locus_tag LOCUS_34390 gene hrcA 4160976 4159951 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954941.1 protein_id gnl|my_center|LOCUS_34390 4161590 4161123 gene locus_tag LOCUS_34400 4161590 4161123 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944375.1 protein_id gnl|my_center|LOCUS_34400 4161808 4162593 gene locus_tag LOCUS_34410 4161808 4162593 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674057.1 protein_id gnl|my_center|LOCUS_34410 4162617 4163828 gene locus_tag LOCUS_34420 4162617 4163828 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_34420 4164097 4165116 gene locus_tag LOCUS_34430 4164097 4165116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 4165433 4165179 gene locus_tag LOCUS_34440 4165433 4165179 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015947.1 protein_id gnl|my_center|LOCUS_34440 4166654 4165476 gene locus_tag LOCUS_34450 gene hemW 4166654 4165476 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398764.1 protein_id gnl|my_center|LOCUS_34450 4166935 4166744 gene locus_tag LOCUS_34460 4166935 4166744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 4168774 4166960 gene locus_tag LOCUS_34470 gene lepA 4168774 4166960 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_34470 4169949 4168852 gene locus_tag LOCUS_34480 4169949 4168852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 4170989 4170090 gene locus_tag LOCUS_34490 4170989 4170090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 4172029 4171013 gene locus_tag LOCUS_34500 gene gutB 4172029 4171013 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_34500 4173166 4172045 gene locus_tag LOCUS_34510 4173166 4172045 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836210.1 protein_id gnl|my_center|LOCUS_34510 4173503 4173189 gene locus_tag LOCUS_34520 4173503 4173189 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529048.1 protein_id gnl|my_center|LOCUS_34520 4174293 4173520 gene locus_tag LOCUS_34530 4174293 4173520 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970020.1 protein_id gnl|my_center|LOCUS_34530 4175041 4174334 gene locus_tag LOCUS_34540 4175041 4174334 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_34540 4175220 4175891 gene locus_tag LOCUS_34550 4175220 4175891 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225250.1 protein_id gnl|my_center|LOCUS_34550 4175904 4176968 gene locus_tag LOCUS_34560 4175904 4176968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 4178633 4176969 gene locus_tag LOCUS_34570 4178633 4176969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 4181237 4178646 gene locus_tag LOCUS_34580 4181237 4178646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 4185243 4181365 gene locus_tag LOCUS_34590 4185243 4181365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 4186115 4185282 gene locus_tag LOCUS_34600 4186115 4185282 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_34600 4187026 4186112 gene locus_tag LOCUS_34610 4187026 4186112 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_34610 4188487 4187129 gene locus_tag LOCUS_34620 4188487 4187129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 4190233 4188599 gene locus_tag LOCUS_34630 4190233 4188599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 4192143 4190281 gene locus_tag LOCUS_34640 4192143 4190281 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_34640 4194362 4192380 gene locus_tag LOCUS_34650 4194362 4192380 CDS product mannonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861470.1 protein_id gnl|my_center|LOCUS_34650 4195367 4194669 gene locus_tag LOCUS_34660 4195367 4194669 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228681.1 protein_id gnl|my_center|LOCUS_34660 4196398 4195412 gene locus_tag LOCUS_34670 4196398 4195412 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461739.1 protein_id gnl|my_center|LOCUS_34670 4197010 4196537 gene locus_tag LOCUS_34680 4197010 4196537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 4198315 4197026 gene locus_tag LOCUS_34690 4198315 4197026 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079278.1 protein_id gnl|my_center|LOCUS_34690 4199239 4199081 gene locus_tag LOCUS_34700 4199239 4199081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 4200714 4199380 gene locus_tag LOCUS_34710 4200714 4199380 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_34710 4202160 4200955 gene locus_tag LOCUS_34720 4202160 4200955 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_34720 4203384 4202164 gene locus_tag LOCUS_34730 4203384 4202164 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_34730 4204406 4203438 gene locus_tag LOCUS_34740 4204406 4203438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 4205783 4204725 gene locus_tag LOCUS_34750 4205783 4204725 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183678.1 protein_id gnl|my_center|LOCUS_34750 4206719 4205892 gene locus_tag LOCUS_34760 4206719 4205892 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_34760 4207601 4206723 gene locus_tag LOCUS_34770 4207601 4206723 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_34770 4209250 4207724 gene locus_tag LOCUS_34780 4209250 4207724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 4211073 4209247 gene locus_tag LOCUS_34790 4211073 4209247 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_34790 4212338 4211334 gene locus_tag LOCUS_34800 gene gpr 4212338 4211334 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_34800 4212526 4212798 gene locus_tag LOCUS_34810 gene rpsT 4212526 4212798 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_34810 4213335 4212910 gene locus_tag LOCUS_34820 4213335 4212910 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941789.1 protein_id gnl|my_center|LOCUS_34820 4215069 4213384 gene locus_tag LOCUS_34830 4215069 4213384 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_34830 4216889 4215105 gene locus_tag LOCUS_34840 gene fadE 4216889 4215105 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244094.1 protein_id gnl|my_center|LOCUS_34840 4218138 4216936 gene locus_tag LOCUS_34850 4218138 4216936 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228574.1 protein_id gnl|my_center|LOCUS_34850 4220558 4218162 gene locus_tag LOCUS_34860 4220558 4218162 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 protein_id gnl|my_center|LOCUS_34860 4222781 4220619 gene locus_tag LOCUS_34870 4222781 4220619 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086758.1 protein_id gnl|my_center|LOCUS_34870 4222916 4223500 gene locus_tag LOCUS_34880 gene fadR 4222916 4223500 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_34880 4223584 4224357 gene locus_tag LOCUS_34890 gene etfB 4223584 4224357 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398765.1 protein_id gnl|my_center|LOCUS_34890 4224397 4225455 gene locus_tag LOCUS_34900 gene etfA 4224397 4225455 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_34900 4227285 4226218 gene locus_tag LOCUS_34910 gene holA 4227285 4226218 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279916.1 protein_id gnl|my_center|LOCUS_34910 4228632 4227460 gene locus_tag LOCUS_34920 4228632 4227460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 4229177 4228629 gene locus_tag LOCUS_34930 4229177 4228629 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256305.1 protein_id gnl|my_center|LOCUS_34930 4232156 4229394 gene locus_tag LOCUS_34940 4232156 4229394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 4232774 4232256 gene locus_tag LOCUS_34950 4232774 4232256 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393866.1 protein_id gnl|my_center|LOCUS_34950 4233524 4232817 gene locus_tag LOCUS_34960 4233524 4232817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 4233672 4234508 gene locus_tag LOCUS_34970 gene comER 4233672 4234508 CDS product late competence protein ComER inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020551.1 protein_id gnl|my_center|LOCUS_34970 4237010 4234572 gene locus_tag LOCUS_34980 gene leuS 4237010 4234572 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_34980 4237990 4237361 gene locus_tag LOCUS_34990 4237990 4237361 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436018.1 protein_id gnl|my_center|LOCUS_34990 4238080 4240296 gene locus_tag LOCUS_35000 4238080 4240296 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716548.1 protein_id gnl|my_center|LOCUS_35000 4241577 4241107 gene locus_tag LOCUS_35010 gene tnpA 4241577 4241107 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_35010 4242549 4241755 gene locus_tag LOCUS_35020 4242549 4241755 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_35020 4243659 4242688 gene locus_tag LOCUS_35030 4243659 4242688 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281269.1 protein_id gnl|my_center|LOCUS_35030 4243997 4243656 gene locus_tag LOCUS_35040 gene rsfS 4243997 4243656 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229971.1 protein_id gnl|my_center|LOCUS_35040 4244598 4244011 gene locus_tag LOCUS_35050 gene yqeK 4244598 4244011 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399059.1 protein_id gnl|my_center|LOCUS_35050 4245193 4244576 gene locus_tag LOCUS_35060 4245193 4244576 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548315.1 protein_id gnl|my_center|LOCUS_35060 4245497 4245207 gene locus_tag LOCUS_35070 gene yhbY 4245497 4245207 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 protein_id gnl|my_center|LOCUS_35070 4246383 4245529 gene locus_tag LOCUS_35080 4246383 4245529 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393067.1 protein_id gnl|my_center|LOCUS_35080 4247531 4246404 gene locus_tag LOCUS_35090 gene yqeH 4247531 4246404 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575406.1 protein_id gnl|my_center|LOCUS_35090 4248058 4247534 gene locus_tag LOCUS_35100 4248058 4247534 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765311.1 protein_id gnl|my_center|LOCUS_35100 4250452 4248203 gene locus_tag LOCUS_35110 4250452 4248203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 4251690 4250449 gene locus_tag LOCUS_35120 4251690 4250449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 4252646 4251693 gene locus_tag LOCUS_35130 4252646 4251693 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553997.1 protein_id gnl|my_center|LOCUS_35130 4253277 4252927 gene locus_tag LOCUS_35140 gene spoVAE 4253277 4252927 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575919.1 protein_id gnl|my_center|LOCUS_35140 4254305 4253301 gene locus_tag LOCUS_35150 gene spoVAD 4254305 4253301 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938965.1 protein_id gnl|my_center|LOCUS_35150 4254799 4254305 gene locus_tag LOCUS_35160 gene spoVAC 4254799 4254305 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095399.1 protein_id gnl|my_center|LOCUS_35160 4255011 4255715 gene locus_tag LOCUS_35170 gene sigK 4255011 4255715 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_35170 4256149 4255799 gene locus_tag LOCUS_35180 4256149 4255799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35180 4259335 4256243 gene locus_tag LOCUS_35190 4259335 4256243 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247443.1 protein_id gnl|my_center|LOCUS_35190 4260497 4259292 gene locus_tag LOCUS_35200 4260497 4259292 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765133.1 protein_id gnl|my_center|LOCUS_35200 4260719 4261213 gene locus_tag LOCUS_35210 4260719 4261213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 4261394 4262059 gene locus_tag LOCUS_35220 gene kapD 4261394 4262059 CDS product 3'-5' exonuclease KapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812131.1 protein_id gnl|my_center|LOCUS_35220 4262254 4263936 gene locus_tag LOCUS_35230 gene ilvD 4262254 4263936 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967560.1 protein_id gnl|my_center|LOCUS_35230 4264185 4264886 gene locus_tag LOCUS_35240 4264185 4264886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 4265491 4264988 gene locus_tag LOCUS_35250 4265491 4264988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 4267236 4265743 gene locus_tag LOCUS_35260 4267236 4265743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 4267461 4268630 gene locus_tag LOCUS_35270 gene ytvI 4267461 4268630 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392554.1 protein_id gnl|my_center|LOCUS_35270 4270407 4268539 gene locus_tag LOCUS_35280 4270407 4268539 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398903.1 protein_id gnl|my_center|LOCUS_35280 4272713 4270581 gene locus_tag LOCUS_35290 4272713 4270581 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_35290 4274249 4272978 gene locus_tag LOCUS_35300 4274249 4272978 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_35300 4275190 4274264 gene locus_tag LOCUS_35310 4275190 4274264 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399094.1 protein_id gnl|my_center|LOCUS_35310 4276642 4275320 gene locus_tag LOCUS_35320 gene mltG 4276642 4275320 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_35320 4277044 4276727 gene locus_tag LOCUS_35330 4277044 4276727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 4277346 4277041 gene locus_tag LOCUS_35340 4277346 4277041 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706616.1 protein_id gnl|my_center|LOCUS_35340 4277773 4277339 gene locus_tag LOCUS_35350 gene ruvX 4277773 4277339 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_35350 4278048 4277773 gene locus_tag LOCUS_35360 4278048 4277773 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_35360 4280872 4278227 gene locus_tag LOCUS_35370 gene alaS 4280872 4278227 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 protein_id gnl|my_center|LOCUS_35370 4282367 4281297 gene locus_tag LOCUS_35380 4282367 4281297 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793108.1 protein_id gnl|my_center|LOCUS_35380 4282756 4282550 gene locus_tag LOCUS_35390 4282756 4282550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225893.1 protein_id gnl|my_center|LOCUS_35390 4283299 4282763 gene locus_tag LOCUS_35400 4283299 4282763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 4284499 4283330 gene locus_tag LOCUS_35410 gene nifS 4284499 4283330 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_35410 4284931 4284512 gene locus_tag LOCUS_35420 gene cymR 4284931 4284512 CDS product cysteine metabolism transcriptional regulator CymR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225879.1 protein_id gnl|my_center|LOCUS_35420 4285232 4286362 gene locus_tag LOCUS_35430 gene mnmA 4285232 4286362 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_35430 4286742 4286545 gene locus_tag LOCUS_35440 gene cspD 4286742 4286545 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176368.1 protein_id gnl|my_center|LOCUS_35440 4287562 4286849 gene locus_tag LOCUS_35450 4287562 4286849 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_35450 4287807 4288040 gene locus_tag LOCUS_35460 4287807 4288040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35460 4288075 4288257 gene locus_tag LOCUS_35470 4288075 4288257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 4288335 4290299 gene locus_tag LOCUS_35480 gene pepF 4288335 4290299 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_35480 4290438 4291568 gene locus_tag LOCUS_35490 4290438 4291568 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545957.1 protein_id gnl|my_center|LOCUS_35490 4292162 4291626 gene locus_tag LOCUS_35500 4292162 4291626 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920347.1 protein_id gnl|my_center|LOCUS_35500 4293087 4292257 gene locus_tag LOCUS_35510 4293087 4292257 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530243.1 protein_id gnl|my_center|LOCUS_35510 4293968 4293087 gene locus_tag LOCUS_35520 4293968 4293087 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180942201.1 protein_id gnl|my_center|LOCUS_35520 4295477 4294059 gene locus_tag LOCUS_35530 4295477 4294059 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256270.1 protein_id gnl|my_center|LOCUS_35530 4296359 4295721 gene locus_tag LOCUS_35540 4296359 4295721 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461121.1 protein_id gnl|my_center|LOCUS_35540 4297118 4296372 gene locus_tag LOCUS_35550 4297118 4296372 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_35550 4298517 4297153 gene locus_tag LOCUS_35560 4298517 4297153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 4300297 4298702 gene locus_tag LOCUS_35570 4300297 4298702 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028566.1 protein_id gnl|my_center|LOCUS_35570 4301951 4300284 gene locus_tag LOCUS_35580 4301951 4300284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 4303806 4301923 gene locus_tag LOCUS_35590 4303806 4301923 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_35590 4304157 4305086 gene locus_tag LOCUS_35600 4304157 4305086 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_35600 4306821 4305343 gene locus_tag LOCUS_35610 gene hemY 4306821 4305343 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245394.1 protein_id gnl|my_center|LOCUS_35610 4307792 4306818 gene locus_tag LOCUS_35620 gene hemH 4307792 4306818 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244736.1 protein_id gnl|my_center|LOCUS_35620 4308838 4307789 gene locus_tag LOCUS_35630 gene hemE 4308838 4307789 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252605.1 protein_id gnl|my_center|LOCUS_35630 4309004 4310218 gene locus_tag LOCUS_35640 4309004 4310218 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179295.1 protein_id gnl|my_center|LOCUS_35640 4310861 4310205 gene locus_tag LOCUS_35650 4310861 4310205 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726755.1 protein_id gnl|my_center|LOCUS_35650 4311099 4313081 gene locus_tag LOCUS_35660 4311099 4313081 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986153.1 protein_id gnl|my_center|LOCUS_35660 4313493 4313188 gene locus_tag LOCUS_35670 4313493 4313188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4313809 4313480 gene locus_tag LOCUS_35680 4313809 4313480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 4315085 4313862 gene locus_tag LOCUS_35690 4315085 4313862 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_35690 4316099 4315284 gene locus_tag LOCUS_35700 gene racE 4316099 4315284 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774002.1 protein_id gnl|my_center|LOCUS_35700 4316563 4316270 gene locus_tag LOCUS_35710 4316563 4316270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 4317034 4316624 gene locus_tag LOCUS_35720 4317034 4316624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 4318009 4317350 gene locus_tag LOCUS_35730 4318009 4317350 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_35730 4318552 4318112 gene locus_tag LOCUS_35740 4318552 4318112 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274006.1 protein_id gnl|my_center|LOCUS_35740 4318700 4318563 gene locus_tag LOCUS_35750 4318700 4318563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 4319001 4318714 gene locus_tag LOCUS_35760 4319001 4318714 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_35760 4319118 4319369 gene locus_tag LOCUS_35770 4319118 4319369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 4319841 4319446 gene locus_tag LOCUS_35780 4319841 4319446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 4320416 4319988 gene locus_tag LOCUS_35790 4320416 4319988 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_35790 4320316 4320564 gene locus_tag LOCUS_35800 4320316 4320564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 4320665 4321525 gene locus_tag LOCUS_35810 4320665 4321525 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245141.1 protein_id gnl|my_center|LOCUS_35810 4322421 4321615 gene locus_tag LOCUS_35820 4322421 4321615 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_35820 4322595 4324094 gene locus_tag LOCUS_35830 4322595 4324094 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802512.1 protein_id gnl|my_center|LOCUS_35830 4325344 4324583 gene locus_tag LOCUS_35840 gene pstB 4325344 4324583 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_35840 4326355 4325402 gene locus_tag LOCUS_35850 gene pstA 4326355 4325402 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994131.1 protein_id gnl|my_center|LOCUS_35850 4327314 4326352 gene locus_tag LOCUS_35860 gene pstC 4327314 4326352 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676681.1 protein_id gnl|my_center|LOCUS_35860 4328274 4327420 gene locus_tag LOCUS_35870 4328274 4327420 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643949.1 protein_id gnl|my_center|LOCUS_35870 4329732 4328308 gene locus_tag LOCUS_35880 4329732 4328308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 4332412 4329968 gene locus_tag LOCUS_35890 4332412 4329968 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_35890 4333325 4332633 gene locus_tag LOCUS_35900 4333325 4332633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 4334656 4333637 gene locus_tag LOCUS_35910 4334656 4333637 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921442.1 protein_id gnl|my_center|LOCUS_35910 4335717 4334683 gene locus_tag LOCUS_35920 4335717 4334683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 4340600 4335912 gene locus_tag LOCUS_35930 4340600 4335912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 4343051 4341468 gene locus_tag LOCUS_35940 4343051 4341468 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_35940 4345832 4343055 gene locus_tag LOCUS_35950 4345832 4343055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 4346756 4345929 gene locus_tag LOCUS_35960 4346756 4345929 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_35960 4347699 4346773 gene locus_tag LOCUS_35970 4347699 4346773 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_35970 4349208 4347727 gene locus_tag LOCUS_35980 4349208 4347727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 4349171 4349308 gene locus_tag LOCUS_35990 4349171 4349308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 4350539 4349769 gene locus_tag LOCUS_36000 4350539 4349769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36000 4351746 4350787 gene locus_tag LOCUS_36010 gene nrdF 4351746 4350787 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203029.1 protein_id gnl|my_center|LOCUS_36010 4353864 4351780 gene locus_tag LOCUS_36020 gene nrdE 4353864 4351780 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_36020 4354210 4353851 gene locus_tag LOCUS_36030 gene nrdI 4354210 4353851 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959447.1 protein_id gnl|my_center|LOCUS_36030 4355583 4354684 gene locus_tag LOCUS_36040 4355583 4354684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 4355740 4356477 gene locus_tag LOCUS_36050 4355740 4356477 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_36050 4356648 4357340 gene locus_tag LOCUS_36060 4356648 4357340 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326870.1 protein_id gnl|my_center|LOCUS_36060 4357340 4358206 gene locus_tag LOCUS_36070 4357340 4358206 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974649.1 protein_id gnl|my_center|LOCUS_36070 4358364 4359182 gene locus_tag LOCUS_36080 4358364 4359182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 4360497 4359292 gene locus_tag LOCUS_36090 gene patB 4360497 4359292 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 protein_id gnl|my_center|LOCUS_36090 4362900 4360519 gene locus_tag LOCUS_36100 4362900 4360519 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055503.1 protein_id gnl|my_center|LOCUS_36100 4363042 4364106 gene locus_tag LOCUS_36110 4363042 4364106 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246351.1 protein_id gnl|my_center|LOCUS_36110 4365086 4364103 gene locus_tag LOCUS_36120 4365086 4364103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 4366360 4365083 gene locus_tag LOCUS_36130 4366360 4365083 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233175.1 protein_id gnl|my_center|LOCUS_36130 4366487 4366669 gene locus_tag LOCUS_36140 4366487 4366669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 4367552 4366950 gene locus_tag LOCUS_36150 4367552 4366950 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619237.1 protein_id gnl|my_center|LOCUS_36150 4368694 4367549 gene locus_tag LOCUS_36160 4368694 4367549 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890391.1 protein_id gnl|my_center|LOCUS_36160 4369448 4368696 gene locus_tag LOCUS_36170 4369448 4368696 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202429.1 protein_id gnl|my_center|LOCUS_36170 4370384 4369494 gene locus_tag LOCUS_36180 4370384 4369494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411157.1 protein_id gnl|my_center|LOCUS_36180 4370609 4371799 gene locus_tag LOCUS_36190 4370609 4371799 CDS product CBU_0270 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957471.1 protein_id gnl|my_center|LOCUS_36190 4372967 4371843 gene locus_tag LOCUS_36200 4372967 4371843 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068619877.1 protein_id gnl|my_center|LOCUS_36200 4373124 4373282 gene locus_tag LOCUS_36210 4373124 4373282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4373661 4373550 gene locus_tag LOCUS_r00080 4373661 4373550 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4376726 4373800 gene locus_tag LOCUS_r00090 4376726 4373800 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4378569 4377019 gene locus_tag LOCUS_r00100 4378569 4377019 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4379028 4379867 gene locus_tag LOCUS_36220 4379028 4379867 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_36220 4380394 4379915 gene locus_tag LOCUS_36230 4380394 4379915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 4381112 4380585 gene locus_tag LOCUS_36240 4381112 4380585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 4382374 4381265 gene locus_tag LOCUS_36250 4382374 4381265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 4383407 4382451 gene locus_tag LOCUS_36260 4383407 4382451 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_36260 4383608 4383826 gene locus_tag LOCUS_36270 4383608 4383826 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082903.1 protein_id gnl|my_center|LOCUS_36270 4385857 4383977 gene locus_tag LOCUS_36280 gene htpG 4385857 4383977 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_36280 4387522 4385975 gene locus_tag LOCUS_36290 gene gntK 4387522 4385975 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255195.1 protein_id gnl|my_center|LOCUS_36290 4388974 4387613 gene locus_tag LOCUS_36300 4388974 4387613 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268371.1 protein_id gnl|my_center|LOCUS_36300 4389859 4389185 gene locus_tag LOCUS_36310 gene gntR 4389859 4389185 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167470.1 protein_id gnl|my_center|LOCUS_36310 4390881 4389976 gene locus_tag LOCUS_36320 4390881 4389976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 4391033 4391878 gene locus_tag LOCUS_36330 4391033 4391878 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_36330 4391883 4392893 gene locus_tag LOCUS_36340 4391883 4392893 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_36340 4394139 4393351 gene locus_tag LOCUS_36350 4394139 4393351 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_36350 4394089 4394304 gene locus_tag LOCUS_36360 4394089 4394304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4394603 4394283 gene locus_tag LOCUS_36370 4394603 4394283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 4395371 4394829 gene locus_tag LOCUS_36380 4395371 4394829 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246473.1 protein_id gnl|my_center|LOCUS_36380 4395542 4396426 gene locus_tag LOCUS_36390 4395542 4396426 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221977.1 protein_id gnl|my_center|LOCUS_36390 4396423 4397211 gene locus_tag LOCUS_36400 gene lieB 4396423 4397211 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_36400 4398080 4397298 gene locus_tag LOCUS_36410 4398080 4397298 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029601.1 protein_id gnl|my_center|LOCUS_36410 4398406 4398756 gene locus_tag LOCUS_36420 4398406 4398756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 4398753 4399823 gene locus_tag LOCUS_36430 4398753 4399823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 4400505 4399918 gene locus_tag LOCUS_36440 4400505 4399918 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101673.1 protein_id gnl|my_center|LOCUS_36440 4401027 4400647 gene locus_tag LOCUS_36450 4401027 4400647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 4401509 4401030 gene locus_tag LOCUS_36460 4401509 4401030 CDS product DUF6530 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943189.1 protein_id gnl|my_center|LOCUS_36460 4402900 4402064 gene locus_tag LOCUS_36470 4402900 4402064 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530858.1 protein_id gnl|my_center|LOCUS_36470 4404172 4402949 gene locus_tag LOCUS_36480 4404172 4402949 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918420.1 protein_id gnl|my_center|LOCUS_36480 4405138 4404371 gene locus_tag LOCUS_36490 gene cobA 4405138 4404371 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521268.1 protein_id gnl|my_center|LOCUS_36490 4405986 4405135 gene locus_tag LOCUS_36500 4405986 4405135 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_36500 4406323 4406015 gene locus_tag LOCUS_36510 gene nirD 4406323 4406015 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246252.1 protein_id gnl|my_center|LOCUS_36510 4408774 4406342 gene locus_tag LOCUS_36520 gene nasD 4408774 4406342 CDS product NADPH-nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234637.1 protein_id gnl|my_center|LOCUS_36520 4409082 4409705 gene locus_tag LOCUS_36530 4409082 4409705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 4409702 4410757 gene locus_tag LOCUS_36540 gene trpD 4409702 4410757 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723937.1 protein_id gnl|my_center|LOCUS_36540 4417435 4411409 gene locus_tag LOCUS_36550 4417435 4411409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 4419121 4417544 gene locus_tag LOCUS_36560 4419121 4417544 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_36560 4420062 4419178 gene locus_tag LOCUS_36570 4420062 4419178 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_36570 4421039 4420110 gene locus_tag LOCUS_36580 4421039 4420110 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_36580 4423421 4421622 gene locus_tag LOCUS_36590 4423421 4421622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 4425048 4423414 gene locus_tag LOCUS_36600 4425048 4423414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 4425253 4425879 gene locus_tag LOCUS_36610 4425253 4425879 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246469.1 protein_id gnl|my_center|LOCUS_36610 4427232 4425775 gene locus_tag LOCUS_36620 4427232 4425775 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246486.1 protein_id gnl|my_center|LOCUS_36620 4427473 4428141 gene locus_tag LOCUS_36630 4427473 4428141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 4428893 4429591 gene locus_tag LOCUS_36640 4428893 4429591 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728678.1 protein_id gnl|my_center|LOCUS_36640 4429588 4430685 gene locus_tag LOCUS_36650 gene uxuA 4429588 4430685 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_36650 4430682 4431542 gene locus_tag LOCUS_36660 4430682 4431542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_36660 4432305 4431661 gene locus_tag LOCUS_36670 4432305 4431661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 4433633 4432770 gene locus_tag LOCUS_36680 4433633 4432770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_36680 4434393 4433614 gene locus_tag LOCUS_36690 4434393 4433614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040538.1 protein_id gnl|my_center|LOCUS_36690 4435495 4434398 gene locus_tag LOCUS_36700 4435495 4434398 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048162.1 protein_id gnl|my_center|LOCUS_36700 4436932 4435838 gene locus_tag LOCUS_36710 4436932 4435838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 4437969 4437043 gene locus_tag LOCUS_36720 4437969 4437043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 4438174 4438608 gene locus_tag LOCUS_36730 4438174 4438608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 4438625 4439377 gene locus_tag LOCUS_36740 gene fabG 4438625 4439377 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_36740 4439619 4439428 gene locus_tag LOCUS_36750 4439619 4439428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 4442416 4440173 gene locus_tag LOCUS_36760 4442416 4440173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 4443271 4442426 gene locus_tag LOCUS_36770 4443271 4442426 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_36770 4444180 4443293 gene locus_tag LOCUS_36780 4444180 4443293 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 protein_id gnl|my_center|LOCUS_36780 4444793 4444416 gene locus_tag LOCUS_36790 4444793 4444416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 4446002 4444803 gene locus_tag LOCUS_36800 4446002 4444803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 4447515 4446019 gene locus_tag LOCUS_36810 4447515 4446019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 4448342 4447545 gene locus_tag LOCUS_36820 4448342 4447545 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867222.1 protein_id gnl|my_center|LOCUS_36820 4449139 4448354 gene locus_tag LOCUS_36830 4449139 4448354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 4450209 4449136 gene locus_tag LOCUS_36840 4450209 4449136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 4453266 4450237 gene locus_tag LOCUS_36850 4453266 4450237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 4454435 4453386 gene locus_tag LOCUS_36860 4454435 4453386 CDS product phosphotriesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972726.1 protein_id gnl|my_center|LOCUS_36860 4456190 4454463 gene locus_tag LOCUS_36870 4456190 4454463 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_36870 4457699 4456326 gene locus_tag LOCUS_36880 4457699 4456326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 4459297 4457696 gene locus_tag LOCUS_36890 4459297 4457696 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_36890 4459196 4459489 gene locus_tag LOCUS_36900 4459196 4459489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 4461571 4459556 gene locus_tag LOCUS_36910 4461571 4459556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 4462481 4461597 gene locus_tag LOCUS_36920 4462481 4461597 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_36920 4463396 4462497 gene locus_tag LOCUS_36930 4463396 4462497 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_36930 4464652 4463579 gene locus_tag LOCUS_36940 4464652 4463579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 4465934 4464900 gene locus_tag LOCUS_36950 4465934 4464900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 4466121 4466831 gene locus_tag LOCUS_36960 4466121 4466831 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_36960 4466893 4467843 gene locus_tag LOCUS_36970 4466893 4467843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 4468045 4469016 gene locus_tag LOCUS_36980 4468045 4469016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 4470109 4469327 gene locus_tag LOCUS_36990 4470109 4469327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 4471166 4470405 gene locus_tag LOCUS_37000 4471166 4470405 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_37000 4475280 4471432 gene locus_tag LOCUS_37010 4475280 4471432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 4476601 4475579 gene locus_tag LOCUS_37020 4476601 4475579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 4478106 4476754 gene locus_tag LOCUS_37030 4478106 4476754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 4479040 4478252 gene locus_tag LOCUS_37040 4479040 4478252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 4480855 4479044 gene locus_tag LOCUS_37050 4480855 4479044 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_37050 4481443 4481063 gene locus_tag LOCUS_37060 4481443 4481063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 4483510 4481879 gene locus_tag LOCUS_37070 4483510 4481879 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329642.1 protein_id gnl|my_center|LOCUS_37070 4484153 4483563 gene locus_tag LOCUS_37080 4484153 4483563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 4484324 4484605 gene locus_tag LOCUS_37090 4484324 4484605 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870842.1 protein_id gnl|my_center|LOCUS_37090 4484692 4485906 gene locus_tag LOCUS_37100 4484692 4485906 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246471.1 protein_id gnl|my_center|LOCUS_37100 4486124 4487098 gene locus_tag LOCUS_37110 4486124 4487098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 4488182 4487175 gene locus_tag LOCUS_37120 4488182 4487175 CDS product YsnF/AvaK domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229586.1 protein_id gnl|my_center|LOCUS_37120 4489102 4488353 gene locus_tag LOCUS_37130 4489102 4488353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 4489550 4489125 gene locus_tag LOCUS_37140 4489550 4489125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 4489950 4489588 gene locus_tag LOCUS_37150 4489950 4489588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255011.1 protein_id gnl|my_center|LOCUS_37150 4490631 4489996 gene locus_tag LOCUS_37160 4490631 4489996 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858827.1 protein_id gnl|my_center|LOCUS_37160 4490828 4490649 gene locus_tag LOCUS_37170 4490828 4490649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 4491378 4490794 gene locus_tag LOCUS_37180 4491378 4490794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 4491982 4491548 gene locus_tag LOCUS_37190 4491982 4491548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 4492716 4492129 gene locus_tag LOCUS_37200 4492716 4492129 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_37200 4493178 4492852 gene locus_tag LOCUS_37210 4493178 4492852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 4493487 4493203 gene locus_tag LOCUS_37220 4493487 4493203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37220 4494028 4493522 gene locus_tag LOCUS_37230 4494028 4493522 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720561.1 protein_id gnl|my_center|LOCUS_37230 4495228 4494059 gene locus_tag LOCUS_37240 4495228 4494059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 4495606 4495337 gene locus_tag LOCUS_37250 4495606 4495337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 4496347 4495778 gene locus_tag LOCUS_37260 4496347 4495778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 4497046 4496513 gene locus_tag LOCUS_37270 4497046 4496513 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691249.1 protein_id gnl|my_center|LOCUS_37270 4497639 4497196 gene locus_tag LOCUS_37280 4497639 4497196 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972158.1 protein_id gnl|my_center|LOCUS_37280 4498445 4497873 gene locus_tag LOCUS_37290 4498445 4497873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 4498677 4498501 gene locus_tag LOCUS_37300 4498677 4498501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 4499075 4498695 gene locus_tag LOCUS_37310 4499075 4498695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 4499314 4499072 gene locus_tag LOCUS_37320 4499314 4499072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 4499988 4499782 gene locus_tag LOCUS_37330 4499988 4499782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 4500672 4500145 gene locus_tag LOCUS_37340 4500672 4500145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 4501387 4500695 gene locus_tag LOCUS_37350 gene cysC 4501387 4500695 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_37350 4503239 4501431 gene locus_tag LOCUS_37360 4503239 4501431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_37360 4504427 4503255 gene locus_tag LOCUS_37370 4504427 4503255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 4504893 4504405 gene locus_tag LOCUS_37380 4504893 4504405 CDS product lasso peptide biosynthesis B2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390771.1 protein_id gnl|my_center|LOCUS_37380 4505198 4504893 gene locus_tag LOCUS_37390 4505198 4504893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 4506157 4505195 gene locus_tag LOCUS_37400 4506157 4505195 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389232.1 protein_id gnl|my_center|LOCUS_37400 4506573 4506445 gene locus_tag LOCUS_37410 4506573 4506445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 4508595 4506652 gene locus_tag LOCUS_37420 4508595 4506652 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388575.1 protein_id gnl|my_center|LOCUS_37420 4510034 4508592 gene locus_tag LOCUS_37430 4510034 4508592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 4512991 4510049 gene locus_tag LOCUS_37440 4512991 4510049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 4514359 4513019 gene locus_tag LOCUS_37450 gene tuaD 4514359 4513019 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_37450 4515786 4514356 gene locus_tag LOCUS_37460 4515786 4514356 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_37460 4516760 4515783 gene locus_tag LOCUS_37470 4516760 4515783 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228270.1 protein_id gnl|my_center|LOCUS_37470 4518862 4517498 gene locus_tag LOCUS_37480 4518862 4517498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 4519743 4518859 gene locus_tag LOCUS_37490 4519743 4518859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 4520795 4519740 gene locus_tag LOCUS_37500 4520795 4519740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 4522019 4520796 gene locus_tag LOCUS_37510 4522019 4520796 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966612.1 protein_id gnl|my_center|LOCUS_37510 4523296 4522016 gene locus_tag LOCUS_37520 4523296 4522016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 4524612 4523353 gene locus_tag LOCUS_37530 4524612 4523353 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966338.1 protein_id gnl|my_center|LOCUS_37530 4525317 4524625 gene locus_tag LOCUS_37540 4525317 4524625 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_37540 4526200 4525301 gene locus_tag LOCUS_37550 gene bpsC 4526200 4525301 CDS product UTP--glucose-1-phosphate uridylyltransferase BpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757832.1 protein_id gnl|my_center|LOCUS_37550 4527270 4526626 gene locus_tag LOCUS_37560 4527270 4526626 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338483.1 protein_id gnl|my_center|LOCUS_37560 4528003 4527251 gene locus_tag LOCUS_37570 4528003 4527251 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_37570 4528886 4528215 gene locus_tag LOCUS_37580 4528886 4528215 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869549.1 protein_id gnl|my_center|LOCUS_37580 4529585 4528911 gene locus_tag LOCUS_37590 4529585 4528911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 4530108 4529914 gene locus_tag LOCUS_37600 4530108 4529914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37600 4530727 4530191 gene locus_tag LOCUS_37610 4530727 4530191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 4530887 4532251 gene locus_tag LOCUS_37620 gene guaD 4530887 4532251 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 protein_id gnl|my_center|LOCUS_37620 4532610 4533497 gene locus_tag LOCUS_37630 4532610 4533497 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890749.1 protein_id gnl|my_center|LOCUS_37630 4534488 4533676 gene locus_tag LOCUS_37640 4534488 4533676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975109.1 protein_id gnl|my_center|LOCUS_37640 4535516 4534485 gene locus_tag LOCUS_37650 4535516 4534485 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029252.1 protein_id gnl|my_center|LOCUS_37650 4535671 4535808 gene locus_tag LOCUS_37660 4535671 4535808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 4536233 4535841 gene locus_tag LOCUS_37670 4536233 4535841 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877650.1 protein_id gnl|my_center|LOCUS_37670 4536711 4536286 gene locus_tag LOCUS_37680 4536711 4536286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 4537027 4536806 gene locus_tag LOCUS_37690 4537027 4536806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 4537491 4537123 gene locus_tag LOCUS_37700 4537491 4537123 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_37700 4538088 4537753 gene locus_tag LOCUS_37710 gene isdG 4538088 4537753 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587818.1 protein_id gnl|my_center|LOCUS_37710 4539315 4538206 gene locus_tag LOCUS_37720 4539315 4538206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 4540310 4539312 gene locus_tag LOCUS_37730 4540310 4539312 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445949.1 protein_id gnl|my_center|LOCUS_37730 4541356 4540307 gene locus_tag LOCUS_37740 4541356 4540307 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748469.1 protein_id gnl|my_center|LOCUS_37740 4542471 4541326 gene locus_tag LOCUS_37750 4542471 4541326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 4543289 4542468 gene locus_tag LOCUS_37760 4543289 4542468 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403746.1 protein_id gnl|my_center|LOCUS_37760 4544262 4543279 gene locus_tag LOCUS_37770 4544262 4543279 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036855.1 protein_id gnl|my_center|LOCUS_37770 4545255 4544296 gene locus_tag LOCUS_37780 gene isdE 4545255 4544296 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163510.1 protein_id gnl|my_center|LOCUS_37780 4548804 4545376 gene locus_tag LOCUS_37790 4548804 4545376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 4549499 4549098 gene locus_tag LOCUS_37800 4549499 4549098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 4551200 4549818 gene locus_tag LOCUS_37810 4551200 4549818 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990020.1 protein_id gnl|my_center|LOCUS_37810 4551874 4551197 gene locus_tag LOCUS_37820 4551874 4551197 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781961.1 protein_id gnl|my_center|LOCUS_37820 4553036 4552149 gene locus_tag LOCUS_37830 gene gltC 4553036 4552149 CDS product glutamate biosynthesis transcriptional regulator GltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399246.1 protein_id gnl|my_center|LOCUS_37830 4553203 4554582 gene locus_tag LOCUS_37840 gene gdhA 4553203 4554582 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721354.1 protein_id gnl|my_center|LOCUS_37840 4554742 4555089 gene locus_tag LOCUS_37850 4554742 4555089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 4555623 4555252 gene locus_tag LOCUS_37860 gene fra 4555623 4555252 CDS product iron chaperone frataxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244145.1 protein_id gnl|my_center|LOCUS_37860 4557914 4555647 gene locus_tag LOCUS_37870 4557914 4555647 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_37870 4559550 4557931 gene locus_tag LOCUS_37880 4559550 4557931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 4561294 4559525 gene locus_tag LOCUS_37890 4561294 4559525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 4563064 4561310 gene locus_tag LOCUS_37900 4563064 4561310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37900 4564575 4563160 gene locus_tag LOCUS_37910 4564575 4563160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 4566138 4564588 gene locus_tag LOCUS_37920 4566138 4564588 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_37920 4568025 4566235 gene locus_tag LOCUS_37930 4568025 4566235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 4569037 4568072 gene locus_tag LOCUS_37940 4569037 4568072 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_37940 4569948 4569034 gene locus_tag LOCUS_37950 4569948 4569034 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_37950 4571209 4570211 gene locus_tag LOCUS_37960 4571209 4570211 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_37960 4572754 4571228 gene locus_tag LOCUS_37970 4572754 4571228 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_37970 4574660 4572777 gene locus_tag LOCUS_37980 4574660 4572777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 4580077 4574933 gene locus_tag LOCUS_37990 4580077 4574933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 4581631 4580408 gene locus_tag LOCUS_38000 4581631 4580408 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_38000 4581761 4582675 gene locus_tag LOCUS_38010 4581761 4582675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 4585167 4583179 gene locus_tag LOCUS_38020 4585167 4583179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 4586008 4585187 gene locus_tag LOCUS_38030 4586008 4585187 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 protein_id gnl|my_center|LOCUS_38030 4586909 4586019 gene locus_tag LOCUS_38040 4586909 4586019 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_38040 4588498 4587011 gene locus_tag LOCUS_38050 4588498 4587011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4590912 4588699 gene locus_tag LOCUS_38060 4590912 4588699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 4596656 4590924 gene locus_tag LOCUS_38070 4596656 4590924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 4599696 4596679 gene locus_tag LOCUS_38080 4599696 4596679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 4601054 4599693 gene locus_tag LOCUS_38090 4601054 4599693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 4602659 4601067 gene locus_tag LOCUS_38100 4602659 4601067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 4604091 4602835 gene locus_tag LOCUS_38110 4604091 4602835 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786453.1 protein_id gnl|my_center|LOCUS_38110 4605458 4604088 gene locus_tag LOCUS_38120 4605458 4604088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029515.1 protein_id gnl|my_center|LOCUS_38120 4606222 4605470 gene locus_tag LOCUS_38130 4606222 4605470 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027946.1 protein_id gnl|my_center|LOCUS_38130 4606926 4606219 gene locus_tag LOCUS_38140 gene tcyM 4606926 4606219 CDS product sulfur-containing amino acid ABC transporter permease TcyM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398678.1 protein_id gnl|my_center|LOCUS_38140 4607636 4606923 gene locus_tag LOCUS_38150 4607636 4606923 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255026.1 protein_id gnl|my_center|LOCUS_38150 4608503 4607649 gene locus_tag LOCUS_38160 4608503 4607649 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880638.1 protein_id gnl|my_center|LOCUS_38160 4608739 4609314 gene locus_tag LOCUS_38170 4608739 4609314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4609402 4610316 gene locus_tag LOCUS_38180 4609402 4610316 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_38180 4610303 4610464 gene locus_tag LOCUS_38190 4610303 4610464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 4611174 4610413 gene locus_tag LOCUS_38200 4611174 4610413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 4611718 4611155 gene locus_tag LOCUS_38210 4611718 4611155 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 protein_id gnl|my_center|LOCUS_38210 4611846 4612238 gene locus_tag LOCUS_38220 4611846 4612238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 4614317 4612224 gene locus_tag LOCUS_38230 4614317 4612224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 4615220 4614330 gene locus_tag LOCUS_38240 4615220 4614330 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_38240 4617161 4615239 gene locus_tag LOCUS_38250 4617161 4615239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 4618920 4617259 gene locus_tag LOCUS_38260 4618920 4617259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 4620382 4619264 gene locus_tag LOCUS_38270 4620382 4619264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 4621812 4620523 gene locus_tag LOCUS_38280 4621812 4620523 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_38280 4623591 4621822 gene locus_tag LOCUS_38290 4623591 4621822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 4624510 4623605 gene locus_tag LOCUS_38300 4624510 4623605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 4625417 4624536 gene locus_tag LOCUS_38310 4625417 4624536 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_38310 4626341 4625427 gene locus_tag LOCUS_38320 4626341 4625427 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_38320 4628099 4626408 gene locus_tag LOCUS_38330 4628099 4626408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 4634017 4628225 gene locus_tag LOCUS_38340 4634017 4628225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 4636864 4634201 gene locus_tag LOCUS_38350 4636864 4634201 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_38350 4637001 4637870 gene locus_tag LOCUS_38360 4637001 4637870 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266784.1 protein_id gnl|my_center|LOCUS_38360 4641062 4638171 gene locus_tag LOCUS_38370 4641062 4638171 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_38370 4642977 4641040 gene locus_tag LOCUS_38380 4642977 4641040 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068161.1 protein_id gnl|my_center|LOCUS_38380 4643885 4643040 gene locus_tag LOCUS_38390 4643885 4643040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 4645965 4643968 gene locus_tag LOCUS_38400 4645965 4643968 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194904324.1 protein_id gnl|my_center|LOCUS_38400 4647071 4646181 gene locus_tag LOCUS_38410 4647071 4646181 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_38410 4647985 4647083 gene locus_tag LOCUS_38420 4647985 4647083 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_38420 4649777 4648056 gene locus_tag LOCUS_38430 4649777 4648056 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_38430 4651513 4649876 gene locus_tag LOCUS_38440 4651513 4649876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 4653288 4651510 gene locus_tag LOCUS_38450 4653288 4651510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 4653469 4654896 gene locus_tag LOCUS_38460 4653469 4654896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 4655893 4655015 gene locus_tag LOCUS_38470 gene rarD 4655893 4655015 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814542.1 protein_id gnl|my_center|LOCUS_38470 4657026 4656004 gene locus_tag LOCUS_38480 4657026 4656004 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_38480 4661714 4657275 gene locus_tag LOCUS_38490 4661714 4657275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 4664546 4661895 gene locus_tag LOCUS_38500 4664546 4661895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 4666196 4664565 gene locus_tag LOCUS_38510 4666196 4664565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 4667078 4666257 gene locus_tag LOCUS_38520 4667078 4666257 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_38520 4667988 4667080 gene locus_tag LOCUS_38530 4667988 4667080 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289645.1 protein_id gnl|my_center|LOCUS_38530 4669387 4667981 gene locus_tag LOCUS_38540 4669387 4667981 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776896.1 protein_id gnl|my_center|LOCUS_38540 4669648 4670553 gene locus_tag LOCUS_38550 4669648 4670553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 4673249 4670958 gene locus_tag LOCUS_38560 4673249 4670958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 4673328 4674236 gene locus_tag LOCUS_38570 4673328 4674236 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767195.1 protein_id gnl|my_center|LOCUS_38570 4676866 4674314 gene locus_tag LOCUS_38580 4676866 4674314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 4677072 4676863 gene locus_tag LOCUS_38590 4677072 4676863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 4678902 4677193 gene locus_tag LOCUS_38600 4678902 4677193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 4679866 4678985 gene locus_tag LOCUS_38610 4679866 4678985 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_38610 4680788 4679883 gene locus_tag LOCUS_38620 4680788 4679883 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_38620 4682612 4680990 gene locus_tag LOCUS_38630 4682612 4680990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 4684330 4682624 gene locus_tag LOCUS_38640 4684330 4682624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 4687105 4684472 gene locus_tag LOCUS_38650 4687105 4684472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 4687641 4688144 gene locus_tag LOCUS_38660 4687641 4688144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 4689350 4688202 gene locus_tag LOCUS_38670 gene dgoD 4689350 4688202 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199088.1 protein_id gnl|my_center|LOCUS_38670 4690027 4689347 gene locus_tag LOCUS_38680 4690027 4689347 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 protein_id gnl|my_center|LOCUS_38680 4690230 4691213 gene locus_tag LOCUS_38690 4690230 4691213 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_38690 4691318 4692064 gene locus_tag LOCUS_38700 4691318 4692064 CDS product YqcI/YcgG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154291.1 protein_id gnl|my_center|LOCUS_38700 4693641 4692148 gene locus_tag LOCUS_38710 4693641 4692148 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767035.1 protein_id gnl|my_center|LOCUS_38710 4693704 4693871 gene locus_tag LOCUS_38720 4693704 4693871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 4693825 4694637 gene locus_tag LOCUS_38730 4693825 4694637 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_38730 4695834 4694665 gene locus_tag LOCUS_38740 4695834 4694665 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173729.1 protein_id gnl|my_center|LOCUS_38740 4696856 4695969 gene locus_tag LOCUS_38750 4696856 4695969 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227377.1 protein_id gnl|my_center|LOCUS_38750 4696995 4697912 gene locus_tag LOCUS_38760 4696995 4697912 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929692.1 protein_id gnl|my_center|LOCUS_38760 4697899 4699086 gene locus_tag LOCUS_38770 4697899 4699086 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_38770 4699112 4699798 gene locus_tag LOCUS_38780 4699112 4699798 CDS product succinyl-CoA--3-ketoacid CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244373.1 protein_id gnl|my_center|LOCUS_38780 4699823 4700488 gene locus_tag LOCUS_38790 4699823 4700488 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889326.1 protein_id gnl|my_center|LOCUS_38790 4700510 4701304 gene locus_tag LOCUS_38800 4700510 4701304 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258445.1 protein_id gnl|my_center|LOCUS_38800 4702185 4701415 gene locus_tag LOCUS_38810 gene fabG 4702185 4701415 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989818.1 protein_id gnl|my_center|LOCUS_38810 4703442 4702282 gene locus_tag LOCUS_38820 4703442 4702282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 4707712 4703456 gene locus_tag LOCUS_38830 4707712 4703456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 4708717 4707854 gene locus_tag LOCUS_38840 4708717 4707854 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_38840 4709668 4708718 gene locus_tag LOCUS_38850 4709668 4708718 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_38850 4711124 4709766 gene locus_tag LOCUS_38860 4711124 4709766 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_38860 4711162 4711398 gene locus_tag LOCUS_38870 4711162 4711398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 4713796 4711565 gene locus_tag LOCUS_38880 4713796 4711565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 4714052 4715050 gene locus_tag LOCUS_38890 4714052 4715050 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227186.1 protein_id gnl|my_center|LOCUS_38890 4715162 4715959 gene locus_tag LOCUS_38900 4715162 4715959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 4715987 4716886 gene locus_tag LOCUS_38910 4715987 4716886 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146242.1 protein_id gnl|my_center|LOCUS_38910 4718926 4716944 gene locus_tag LOCUS_38920 4718926 4716944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 4721241 4718956 gene locus_tag LOCUS_38930 4721241 4718956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 4723091 4721379 gene locus_tag LOCUS_38940 4723091 4721379 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_38940 4724070 4723165 gene locus_tag LOCUS_38950 4724070 4723165 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_38950 4724972 4724088 gene locus_tag LOCUS_38960 4724972 4724088 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_38960 4725284 4725069 gene locus_tag LOCUS_38970 4725284 4725069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 4726906 4725503 gene locus_tag LOCUS_38980 4726906 4725503 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234986.1 protein_id gnl|my_center|LOCUS_38980 4727036 4727380 gene locus_tag LOCUS_38990 4727036 4727380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 4730166 4727767 gene locus_tag LOCUS_39000 4730166 4727767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 4732568 4730163 gene locus_tag LOCUS_39010 4732568 4730163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 4733416 4732595 gene locus_tag LOCUS_39020 4733416 4732595 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_39020 4734334 4733417 gene locus_tag LOCUS_39030 4734334 4733417 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_39030 4735691 4734402 gene locus_tag LOCUS_39040 4735691 4734402 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 protein_id gnl|my_center|LOCUS_39040 4737493 4735874 gene locus_tag LOCUS_39050 4737493 4735874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 4739189 4737465 gene locus_tag LOCUS_39060 4739189 4737465 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_39060 4742696 4739385 gene locus_tag LOCUS_39070 4742696 4739385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 4743710 4742715 gene locus_tag LOCUS_39080 4743710 4742715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 4746549 4743727 gene locus_tag LOCUS_39090 4746549 4743727 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548204.1 protein_id gnl|my_center|LOCUS_39090 4747418 4746678 gene locus_tag LOCUS_39100 4747418 4746678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 4748793 4747432 gene locus_tag LOCUS_39110 4748793 4747432 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459600.1 protein_id gnl|my_center|LOCUS_39110 4749325 4749083 gene locus_tag LOCUS_39120 4749325 4749083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 4751247 4749631 gene locus_tag LOCUS_39130 4751247 4749631 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_39130 4753164 4751437 gene locus_tag LOCUS_39140 4753164 4751437 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_39140 4754076 4753201 gene locus_tag LOCUS_39150 4754076 4753201 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_39150 4755021 4754092 gene locus_tag LOCUS_39160 4755021 4754092 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_39160 4755200 4756867 gene locus_tag LOCUS_39170 gene yesM 4755200 4756867 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_39170 4756871 4758469 gene locus_tag LOCUS_39180 4756871 4758469 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_39180 4759813 4758551 gene locus_tag LOCUS_39190 4759813 4758551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 4761670 4759925 gene locus_tag LOCUS_39200 4761670 4759925 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_39200 4762838 4762188 gene locus_tag LOCUS_39210 gene ydfI 4762838 4762188 CDS product two-component system response regulator YdfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244318.1 protein_id gnl|my_center|LOCUS_39210 4764062 4762842 gene locus_tag LOCUS_39220 4764062 4762842 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966700.1 protein_id gnl|my_center|LOCUS_39220 4766474 4764270 gene locus_tag LOCUS_39230 4766474 4764270 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243548.1 protein_id gnl|my_center|LOCUS_39230 4766860 4767120 gene locus_tag LOCUS_39240 4766860 4767120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 4767977 4767189 gene locus_tag LOCUS_39250 4767977 4767189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 4768612 4768301 gene locus_tag LOCUS_39260 4768612 4768301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39260 4769470 4768628 gene locus_tag LOCUS_39270 4769470 4768628 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 protein_id gnl|my_center|LOCUS_39270 4769924 4769556 gene locus_tag LOCUS_39280 4769924 4769556 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890862.1 protein_id gnl|my_center|LOCUS_39280 4771033 4770626 gene locus_tag LOCUS_39290 4771033 4770626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39290 4771540 4771400 gene locus_tag LOCUS_39300 4771540 4771400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 4771747 4771580 gene locus_tag LOCUS_39310 4771747 4771580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 4772672 4772597 gene locus_tag LOCUS_t00290 4772672 4772597 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4773299 4772838 gene locus_tag LOCUS_39320 gene nrdR 4773299 4772838 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223586.1 protein_id gnl|my_center|LOCUS_39320 4773416 4773637 gene locus_tag LOCUS_39330 4773416 4773637 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069660.1 protein_id gnl|my_center|LOCUS_39330 4774260 4773721 gene locus_tag LOCUS_39340 4774260 4773721 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_39340 4774907 4774299 gene locus_tag LOCUS_39350 gene coaE 4774907 4774299 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398928.1 protein_id gnl|my_center|LOCUS_39350 4775994 4775221 gene locus_tag LOCUS_39360 gene ytaF 4775994 4775221 CDS product sporulation membrane protein YtaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281740.1 protein_id gnl|my_center|LOCUS_39360 4777050 4776109 gene locus_tag LOCUS_39370 gene mutM 4777050 4776109 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246122.1 protein_id gnl|my_center|LOCUS_39370 4779837 4777117 gene locus_tag LOCUS_39380 gene polA 4779837 4777117 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_39380 4779990 4781132 gene locus_tag LOCUS_39390 4779990 4781132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 4781321 4783282 gene locus_tag LOCUS_39400 4781321 4783282 CDS product stalk domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392742.1 protein_id gnl|my_center|LOCUS_39400 4784445 4783786 gene locus_tag LOCUS_39410 gene phoU 4784445 4783786 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_39410 4785220 4784471 gene locus_tag LOCUS_39420 gene pstB 4785220 4784471 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_39420 4786298 4785312 gene locus_tag LOCUS_39430 4786298 4785312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 4787232 4786345 gene locus_tag LOCUS_39440 gene pstA 4787232 4786345 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564208.1 protein_id gnl|my_center|LOCUS_39440 4788167 4787229 gene locus_tag LOCUS_39450 gene pstC 4788167 4787229 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398935.1 protein_id gnl|my_center|LOCUS_39450 4789176 4788247 gene locus_tag LOCUS_39460 4789176 4788247 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106652674.1 protein_id gnl|my_center|LOCUS_39460 4790567 4789299 gene locus_tag LOCUS_39470 4790567 4789299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 4790566 4790916 gene locus_tag LOCUS_39480 4790566 4790916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 4791058 4791735 gene locus_tag LOCUS_39490 4791058 4791735 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643910.1 protein_id gnl|my_center|LOCUS_39490 4791797 4793041 gene locus_tag LOCUS_39500 4791797 4793041 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739122.1 protein_id gnl|my_center|LOCUS_39500 4793625 4793128 gene locus_tag LOCUS_39510 gene queF 4793625 4793128 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218613.1 protein_id gnl|my_center|LOCUS_39510 4794397 4793639 gene locus_tag LOCUS_39520 gene queE 4794397 4793639 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090918384.1 protein_id gnl|my_center|LOCUS_39520 4794854 4794390 gene locus_tag LOCUS_39530 gene queD 4794854 4794390 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245665.1 protein_id gnl|my_center|LOCUS_39530 4795519 4794854 gene locus_tag LOCUS_39540 gene queC 4795519 4794854 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711596.1 protein_id gnl|my_center|LOCUS_39540 4796628 4796014 gene locus_tag LOCUS_39550 4796628 4796014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 4801692 4796755 gene locus_tag LOCUS_39560 4801692 4796755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 4803386 4801836 gene locus_tag LOCUS_39570 4803386 4801836 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_39570 4804346 4803465 gene locus_tag LOCUS_39580 4804346 4803465 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_39580 4805324 4804359 gene locus_tag LOCUS_39590 gene rmgP 4805324 4804359 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_39590 4807251 4805419 gene locus_tag LOCUS_39600 4807251 4805419 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831078.1 protein_id gnl|my_center|LOCUS_39600 4808884 4807268 gene locus_tag LOCUS_39610 4808884 4807268 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_39610 4810279 4809020 gene locus_tag LOCUS_39620 4810279 4809020 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082946.1 protein_id gnl|my_center|LOCUS_39620 4811968 4810799 gene locus_tag LOCUS_39630 4811968 4810799 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_39630 4811615 4811690 gene locus_tag LOCUS_t00300 4811615 4811690 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4812894 4811956 gene locus_tag LOCUS_39640 4812894 4811956 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_39640 4814191 4813121 gene locus_tag LOCUS_39650 4814191 4813121 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_39650 4814317 4815186 gene locus_tag LOCUS_39660 4814317 4815186 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613409.1 protein_id gnl|my_center|LOCUS_39660 4816346 4815222 gene locus_tag LOCUS_39670 gene rsgA 4816346 4815222 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_39670 4817266 4816769 gene locus_tag LOCUS_39680 4817266 4816769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 4817390 4817199 gene locus_tag LOCUS_39690 4817390 4817199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39690 4817596 4817387 gene locus_tag LOCUS_39700 4817596 4817387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39700 4817847 4817593 gene locus_tag LOCUS_39710 4817847 4817593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_39710 4819559 4821079 gene locus_tag LOCUS_39720 4819559 4821079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4822733 4821426 gene locus_tag LOCUS_39730 4822733 4821426 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_39730 4824234 4822855 gene locus_tag LOCUS_39740 4824234 4822855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 4824870 4824445 gene locus_tag LOCUS_39750 4824870 4824445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 4825590 4825042 gene locus_tag LOCUS_39760 gene ahpA 4825590 4825042 CDS product biofilm-specific peroxidase AhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245371.1 protein_id gnl|my_center|LOCUS_39760 4826862 4825783 gene locus_tag LOCUS_39770 gene leuB 4826862 4825783 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_39770 4827546 4827022 gene locus_tag LOCUS_39780 gene mobB 4827546 4827022 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503325.1 protein_id gnl|my_center|LOCUS_39780 4828085 4827543 gene locus_tag LOCUS_39790 gene mobA 4828085 4827543 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453897.1 protein_id gnl|my_center|LOCUS_39790 4829425 4828166 gene locus_tag LOCUS_39800 gene moeA 4829425 4828166 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442216.1 protein_id gnl|my_center|LOCUS_39800 4831085 4829886 gene locus_tag LOCUS_39810 4831085 4829886 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_39810 4832721 4831165 gene locus_tag LOCUS_39820 4832721 4831165 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967929.1 protein_id gnl|my_center|LOCUS_39820 4833819 4832827 gene locus_tag LOCUS_39830 gene ilvC 4833819 4832827 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861143.1 protein_id gnl|my_center|LOCUS_39830 4834517 4834029 gene locus_tag LOCUS_39840 gene ilvN 4834517 4834029 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_39840 4836259 4834514 gene locus_tag LOCUS_39850 gene ilvB 4836259 4834514 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398643.1 protein_id gnl|my_center|LOCUS_39850 4836908 4837342 gene locus_tag LOCUS_39860 4836908 4837342 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876692.1 protein_id gnl|my_center|LOCUS_39860 4838028 4837348 gene locus_tag LOCUS_39870 4838028 4837348 CDS product DUF4166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227829.1 protein_id gnl|my_center|LOCUS_39870 4839005 4838025 gene locus_tag LOCUS_39880 4839005 4838025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 4839724 4839002 gene locus_tag LOCUS_39890 4839724 4839002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 4840323 4839868 gene locus_tag LOCUS_39900 4840323 4839868 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399128.1 protein_id gnl|my_center|LOCUS_39900 4841005 4840361 gene locus_tag LOCUS_39910 gene narL 4841005 4840361 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092968.1 protein_id gnl|my_center|LOCUS_39910 4842335 4841019 gene locus_tag LOCUS_39920 4842335 4841019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 4844085 4842538 gene locus_tag LOCUS_39930 gene pruA 4844085 4842538 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_39930 4844175 4845098 gene locus_tag LOCUS_39940 4844175 4845098 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228782.1 protein_id gnl|my_center|LOCUS_39940 4846720 4845317 gene locus_tag LOCUS_39950 4846720 4845317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 4848446 4846830 gene locus_tag LOCUS_39960 4848446 4846830 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_39960 4849467 4848556 gene locus_tag LOCUS_39970 4849467 4848556 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_39970 4850411 4849494 gene locus_tag LOCUS_39980 4850411 4849494 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_39980 4851045 4851530 gene locus_tag LOCUS_39990 4851045 4851530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 4853426 4851789 gene locus_tag LOCUS_40000 4853426 4851789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 4855168 4853522 gene locus_tag LOCUS_40010 4855168 4853522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 4855401 4859621 gene locus_tag LOCUS_40020 4855401 4859621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 4860161 4859880 gene locus_tag LOCUS_40030 4860161 4859880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 4860704 4860345 gene locus_tag LOCUS_40040 gene rplT 4860704 4860345 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_40040 4860968 4860768 gene locus_tag LOCUS_40050 gene rpmI 4860968 4860768 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222418.1 protein_id gnl|my_center|LOCUS_40050 4861400 4860987 gene locus_tag LOCUS_40060 gene infC 4861400 4860987 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958948.1 protein_id gnl|my_center|LOCUS_40060 4863109 4861871 gene locus_tag LOCUS_40070 4863109 4861871 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_40070 4863778 4865529 gene locus_tag LOCUS_40080 4863778 4865529 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942560.1 protein_id gnl|my_center|LOCUS_40080 4866841 4866056 gene locus_tag LOCUS_40090 gene trmB 4866841 4866056 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723580.1 protein_id gnl|my_center|LOCUS_40090 4867756 4866926 gene locus_tag LOCUS_40100 4867756 4866926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 4868102 4867914 gene locus_tag LOCUS_40110 4868102 4867914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 4868426 4869394 gene locus_tag LOCUS_40120 4868426 4869394 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868031.1 protein_id gnl|my_center|LOCUS_40120 4869399 4870019 gene locus_tag LOCUS_40130 4869399 4870019 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404273.1 protein_id gnl|my_center|LOCUS_40130 4870021 4870440 gene locus_tag LOCUS_40140 gene glxA 4870021 4870440 CDS product glyoxalase GlxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243380.1 protein_id gnl|my_center|LOCUS_40140 4870437 4871414 gene locus_tag LOCUS_40150 gene manA 4870437 4871414 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379715.1 protein_id gnl|my_center|LOCUS_40150 4871515 4871997 gene locus_tag LOCUS_40160 4871515 4871997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 4872204 4872674 gene locus_tag LOCUS_40170 4872204 4872674 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398479.1 protein_id gnl|my_center|LOCUS_40170 4873397 4873233 gene locus_tag LOCUS_40180 4873397 4873233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 4875200 4873728 gene locus_tag LOCUS_40190 4875200 4873728 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993830.1 protein_id gnl|my_center|LOCUS_40190 4875347 4875925 gene locus_tag LOCUS_40200 4875347 4875925 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999314.1 protein_id gnl|my_center|LOCUS_40200 4877744 4876002 gene locus_tag LOCUS_40210 4877744 4876002 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_40210 4877983 4878402 gene locus_tag LOCUS_40220 4877983 4878402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40220 4878454 4878897 gene locus_tag LOCUS_40230 4878454 4878897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40230 4880290 4878944 gene locus_tag LOCUS_40240 4880290 4878944 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_40240 4881513 4880410 gene locus_tag LOCUS_40250 4881513 4880410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 4881704 4882507 gene locus_tag LOCUS_40260 4881704 4882507 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_40260 4882960 4882601 gene locus_tag LOCUS_40270 4882960 4882601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 4883098 4883247 gene locus_tag LOCUS_40280 4883098 4883247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 4885268 4884174 gene locus_tag LOCUS_40290 4885268 4884174 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_40290 4886433 4885366 gene locus_tag LOCUS_40300 4886433 4885366 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_40300 4887239 4886436 gene locus_tag LOCUS_40310 gene cysW 4887239 4886436 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951362.1 protein_id gnl|my_center|LOCUS_40310 4888048 4887236 gene locus_tag LOCUS_40320 gene cysT 4888048 4887236 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_40320 4888219 4888620 gene locus_tag LOCUS_40330 4888219 4888620 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 protein_id gnl|my_center|LOCUS_40330 4889326 4888691 gene locus_tag LOCUS_40340 4889326 4888691 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926684.1 protein_id gnl|my_center|LOCUS_40340 4890820 4889468 gene locus_tag LOCUS_40350 4890820 4889468 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_40350 4891457 4890963 gene locus_tag LOCUS_40360 4891457 4890963 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532723.1 protein_id gnl|my_center|LOCUS_40360 4893626 4891542 gene locus_tag LOCUS_40370 4893626 4891542 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698132.1 protein_id gnl|my_center|LOCUS_40370 4895359 4893692 gene locus_tag LOCUS_40380 4895359 4893692 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_40380 4896366 4895473 gene locus_tag LOCUS_40390 4896366 4895473 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_40390 4897367 4896393 gene locus_tag LOCUS_40400 4897367 4896393 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_40400 4902304 4897718 gene locus_tag LOCUS_40410 4902304 4897718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 4902514 4904070 gene locus_tag LOCUS_40420 4902514 4904070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922520.1 protein_id gnl|my_center|LOCUS_40420 4904083 4905852 gene locus_tag LOCUS_40430 4904083 4905852 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_40430 4907037 4905883 gene locus_tag LOCUS_40440 4907037 4905883 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393536.1 protein_id gnl|my_center|LOCUS_40440 4908539 4907034 gene locus_tag LOCUS_40450 4908539 4907034 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_40450 4909713 4908604 gene locus_tag LOCUS_40460 4909713 4908604 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966574.1 protein_id gnl|my_center|LOCUS_40460 4909958 4909710 gene locus_tag LOCUS_40470 4909958 4909710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 4912297 4910108 gene locus_tag LOCUS_40480 4912297 4910108 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_40480 4912508 4913788 gene locus_tag LOCUS_40490 4912508 4913788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 4914381 4914184 gene locus_tag LOCUS_40500 4914381 4914184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 4914741 4914424 gene locus_tag LOCUS_40510 4914741 4914424 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000077234.1 protein_id gnl|my_center|LOCUS_40510 4916981 4914969 gene locus_tag LOCUS_40520 gene tkt 4916981 4914969 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 protein_id gnl|my_center|LOCUS_40520 4918144 4917242 gene locus_tag LOCUS_40530 gene purU 4918144 4917242 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245802.1 protein_id gnl|my_center|LOCUS_40530 4919349 4918219 gene locus_tag LOCUS_40540 4919349 4918219 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_40540 4919621 4920097 gene locus_tag LOCUS_40550 gene yneK 4919621 4920097 CDS product DynA interaction protein YneK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231580.1 protein_id gnl|my_center|LOCUS_40550 4920152 4920622 gene locus_tag LOCUS_40560 4920152 4920622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 4920650 4921564 gene locus_tag LOCUS_40570 4920650 4921564 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019638483.1 protein_id gnl|my_center|LOCUS_40570 4923238 4921571 gene locus_tag LOCUS_40580 4923238 4921571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 4923775 4923287 gene locus_tag LOCUS_40590 4923775 4923287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 4924737 4923790 gene locus_tag LOCUS_40600 4924737 4923790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 4927078 4924700 gene locus_tag LOCUS_40610 4927078 4924700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 4927682 4927062 gene locus_tag LOCUS_40620 4927682 4927062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 4928017 4927802 gene locus_tag LOCUS_40630 4928017 4927802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 4928908 4928042 gene locus_tag LOCUS_40640 4928908 4928042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 4929651 4928905 gene locus_tag LOCUS_40650 4929651 4928905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 4930883 4929648 gene locus_tag LOCUS_40660 4930883 4929648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 4932097 4930865 gene locus_tag LOCUS_40670 4932097 4930865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 4936152 4932295 gene locus_tag LOCUS_40680 4936152 4932295 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989993.1 protein_id gnl|my_center|LOCUS_40680 4939455 4936189 gene locus_tag LOCUS_40690 4939455 4936189 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989995.1 protein_id gnl|my_center|LOCUS_40690 4940577 4939582 gene locus_tag LOCUS_40700 4940577 4939582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 4941663 4940659 gene locus_tag LOCUS_40710 4941663 4940659 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030865419.1 protein_id gnl|my_center|LOCUS_40710 4942484 4941669 gene locus_tag LOCUS_40720 4942484 4941669 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760712.1 protein_id gnl|my_center|LOCUS_40720 4943278 4942487 gene locus_tag LOCUS_40730 4943278 4942487 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975914.1 protein_id gnl|my_center|LOCUS_40730 4945035 4943275 gene locus_tag LOCUS_40740 gene malL 4945035 4943275 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415176.1 protein_id gnl|my_center|LOCUS_40740 4945920 4945051 gene locus_tag LOCUS_40750 4945920 4945051 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210024.1 protein_id gnl|my_center|LOCUS_40750 4946972 4945914 gene locus_tag LOCUS_40760 4946972 4945914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 4948283 4947003 gene locus_tag LOCUS_40770 4948283 4947003 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392273.1 protein_id gnl|my_center|LOCUS_40770 4951816 4948280 gene locus_tag LOCUS_40780 4951816 4948280 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989369.1 protein_id gnl|my_center|LOCUS_40780 4952930 4951821 gene locus_tag LOCUS_40790 gene aroB 4952930 4951821 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_40790 4953314 4952955 gene locus_tag LOCUS_40800 4953314 4952955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 4954193 4953456 gene locus_tag LOCUS_40810 4954193 4953456 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_40810 4955275 4954190 gene locus_tag LOCUS_40820 4955275 4954190 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_40820 4956134 4955307 gene locus_tag LOCUS_40830 4956134 4955307 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_40830 4957017 4956124 gene locus_tag LOCUS_40840 4957017 4956124 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_40840 4958450 4957098 gene locus_tag LOCUS_40850 4958450 4957098 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_40850 4959674 4958640 gene locus_tag LOCUS_40860 4959674 4958640 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_40860 4961248 4960454 gene locus_tag LOCUS_40870 4961248 4960454 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355660.1 protein_id gnl|my_center|LOCUS_40870 4962365 4961334 gene locus_tag LOCUS_40880 4962365 4961334 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 protein_id gnl|my_center|LOCUS_40880 4963303 4962383 gene locus_tag LOCUS_40890 4963303 4962383 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973777.1 protein_id gnl|my_center|LOCUS_40890 4963437 4964327 gene locus_tag LOCUS_40900 4963437 4964327 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_40900 4964876 4964340 gene locus_tag LOCUS_40910 4964876 4964340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 4965101 4965790 gene locus_tag LOCUS_40920 4965101 4965790 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_40920 4965771 4967195 gene locus_tag LOCUS_40930 4965771 4967195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 4967713 4967243 gene locus_tag LOCUS_40940 4967713 4967243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 4968278 4967760 gene locus_tag LOCUS_40950 gene paiA 4968278 4967760 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244000.1 protein_id gnl|my_center|LOCUS_40950 4968752 4968300 gene locus_tag LOCUS_40960 4968752 4968300 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226875.1 protein_id gnl|my_center|LOCUS_40960 4970470 4968965 gene locus_tag LOCUS_40970 4970470 4968965 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_40970 4971505 4970600 gene locus_tag LOCUS_40980 4971505 4970600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40980 4971623 4972534 gene locus_tag LOCUS_40990 4971623 4972534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 4972915 4973124 gene locus_tag LOCUS_41000 4972915 4973124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 4973250 4973933 gene locus_tag LOCUS_41010 4973250 4973933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41010 4974646 4973957 gene locus_tag LOCUS_41020 4974646 4973957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 4975153 4974650 gene locus_tag LOCUS_41030 4975153 4974650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 4976800 4975235 gene locus_tag LOCUS_41040 4976800 4975235 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_41040 4976932 4977537 gene locus_tag LOCUS_41050 4976932 4977537 CDS product biliverdin-producing heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177622.1 protein_id gnl|my_center|LOCUS_41050 4977561 4980122 gene locus_tag LOCUS_41060 4977561 4980122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 4980974 4980150 gene locus_tag LOCUS_41070 4980974 4980150 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082697.1 protein_id gnl|my_center|LOCUS_41070 4981685 4982584 gene locus_tag LOCUS_41080 gene alkA 4981685 4982584 CDS product DNA-3-methyladenine glycosidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123533.1 protein_id gnl|my_center|LOCUS_41080 4983192 4982665 gene locus_tag LOCUS_41090 gene adaB 4983192 4982665 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246311.1 protein_id gnl|my_center|LOCUS_41090 4983797 4983189 gene locus_tag LOCUS_41100 gene adaA 4983797 4983189 CDS product bifunctional transcriptional activator/DNA repair enzyme AdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234924.1 protein_id gnl|my_center|LOCUS_41100 4984028 4985107 gene locus_tag LOCUS_41110 4984028 4985107 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_41110 4985139 4985864 gene locus_tag LOCUS_41120 4985139 4985864 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_41120 4985898 4987004 gene locus_tag LOCUS_41130 4985898 4987004 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_41130 4989711 4987054 gene locus_tag LOCUS_41140 4989711 4987054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 4991188 4989842 gene locus_tag LOCUS_41150 gene msmE 4991188 4989842 CDS product sugar-binding protein MsmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262872.1 protein_id gnl|my_center|LOCUS_41150 4992945 4991320 gene locus_tag LOCUS_41160 4992945 4991320 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_41160 4994678 4992942 gene locus_tag LOCUS_41170 4994678 4992942 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_41170 4995521 4994703 gene locus_tag LOCUS_41180 4995521 4994703 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_41180 4996432 4995518 gene locus_tag LOCUS_41190 4996432 4995518 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_41190 4997349 4996633 gene locus_tag LOCUS_41200 4997349 4996633 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_41200 4998633 4997449 gene locus_tag LOCUS_41210 4998633 4997449 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002374726.1 protein_id gnl|my_center|LOCUS_41210 4998783 5001533 gene locus_tag LOCUS_41220 4998783 5001533 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_41220 5001728 5002093 gene locus_tag LOCUS_41230 5001728 5002093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 5002090 5002419 gene locus_tag LOCUS_41240 5002090 5002419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 5003388 5002576 gene locus_tag LOCUS_41250 5003388 5002576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 5003567 5005543 gene locus_tag LOCUS_41260 5003567 5005543 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_41260 5005835 5006947 gene locus_tag LOCUS_41270 5005835 5006947 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393190.1 protein_id gnl|my_center|LOCUS_41270 5006960 5008534 gene locus_tag LOCUS_41280 5006960 5008534 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966133.1 protein_id gnl|my_center|LOCUS_41280 5009338 5008547 gene locus_tag LOCUS_41290 gene fdhD 5009338 5008547 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_41290 5011711 5009357 gene locus_tag LOCUS_41300 5011711 5009357 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256094.1 protein_id gnl|my_center|LOCUS_41300 5012489 5011896 gene locus_tag LOCUS_41310 5012489 5011896 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227303.1 protein_id gnl|my_center|LOCUS_41310 5013170 5012931 gene locus_tag LOCUS_41320 5013170 5012931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 5014538 5013483 gene locus_tag LOCUS_41330 5014538 5013483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 5015024 5014626 gene locus_tag LOCUS_41340 5015024 5014626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 5015152 5016426 gene locus_tag LOCUS_41350 5015152 5016426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 5018076 5016709 gene locus_tag LOCUS_41360 5018076 5016709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 5021296 5018093 gene locus_tag LOCUS_41370 5021296 5018093 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_41370 5024325 5021425 gene locus_tag LOCUS_41380 5024325 5021425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 5025194 5024433 gene locus_tag LOCUS_41390 5025194 5024433 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_41390 5026942 5025185 gene locus_tag LOCUS_41400 5026942 5025185 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 protein_id gnl|my_center|LOCUS_41400 5028500 5027010 gene locus_tag LOCUS_41410 5028500 5027010 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_41410 5030527 5028548 gene locus_tag LOCUS_41420 5030527 5028548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 5031356 5030529 gene locus_tag LOCUS_41430 5031356 5030529 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 protein_id gnl|my_center|LOCUS_41430 5032240 5031356 gene locus_tag LOCUS_41440 5032240 5031356 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_41440 5033665 5032325 gene locus_tag LOCUS_41450 5033665 5032325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 5033840 5035606 gene locus_tag LOCUS_41460 5033840 5035606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 5035618 5037168 gene locus_tag LOCUS_41470 5035618 5037168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 5037972 5037304 gene locus_tag LOCUS_41480 5037972 5037304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 5039160 5038006 gene locus_tag LOCUS_41490 5039160 5038006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 5041176 5039386 gene locus_tag LOCUS_41500 5041176 5039386 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861596.1 protein_id gnl|my_center|LOCUS_41500 5041315 5042175 gene locus_tag LOCUS_41510 5041315 5042175 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286852.1 protein_id gnl|my_center|LOCUS_41510 5042165 5043004 gene locus_tag LOCUS_41520 5042165 5043004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 5043104 5044102 gene locus_tag LOCUS_41530 5043104 5044102 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256322.1 protein_id gnl|my_center|LOCUS_41530 5045008 5044142 gene locus_tag LOCUS_41540 5045008 5044142 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_41540 5045933 5045025 gene locus_tag LOCUS_41550 gene rmgP 5045933 5045025 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_41550 5047583 5046024 gene locus_tag LOCUS_41560 5047583 5046024 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803820.1 protein_id gnl|my_center|LOCUS_41560 5050150 5047934 gene locus_tag LOCUS_41570 5050150 5047934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 5050509 5050240 gene locus_tag LOCUS_41580 5050509 5050240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 5050729 5051382 gene locus_tag LOCUS_41590 5050729 5051382 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_41590 5051588 5052361 gene locus_tag LOCUS_41600 5051588 5052361 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083078.1 protein_id gnl|my_center|LOCUS_41600 5052394 5053287 gene locus_tag LOCUS_41610 5052394 5053287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 5054579 5053617 gene locus_tag LOCUS_41620 5054579 5053617 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208809.1 protein_id gnl|my_center|LOCUS_41620 5055774 5054629 gene locus_tag LOCUS_41630 5055774 5054629 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242837.1 protein_id gnl|my_center|LOCUS_41630 5056720 5055842 gene locus_tag LOCUS_41640 5056720 5055842 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492432.1 protein_id gnl|my_center|LOCUS_41640 5057815 5056757 gene locus_tag LOCUS_41650 5057815 5056757 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_41650 5058735 5057836 gene locus_tag LOCUS_41660 5058735 5057836 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242776.1 protein_id gnl|my_center|LOCUS_41660 5059896 5058736 gene locus_tag LOCUS_41670 5059896 5058736 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704492.1 protein_id gnl|my_center|LOCUS_41670 5060940 5059921 gene locus_tag LOCUS_41680 5060940 5059921 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393751.1 protein_id gnl|my_center|LOCUS_41680 5062550 5060943 gene locus_tag LOCUS_41690 5062550 5060943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 5063274 5062570 gene locus_tag LOCUS_41700 5063274 5062570 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_41700 5064174 5063341 gene locus_tag LOCUS_41710 5064174 5063341 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 protein_id gnl|my_center|LOCUS_41710 5065058 5064174 gene locus_tag LOCUS_41720 5065058 5064174 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_41720 5066310 5065126 gene locus_tag LOCUS_41730 5066310 5065126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 5066300 5066515 gene locus_tag LOCUS_41740 5066300 5066515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 5069982 5066695 gene locus_tag LOCUS_41750 5069982 5066695 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225518.1 protein_id gnl|my_center|LOCUS_41750 5072002 5070005 gene locus_tag LOCUS_41760 5072002 5070005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 5073052 5072219 gene locus_tag LOCUS_41770 5073052 5072219 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_41770 5073191 5074075 gene locus_tag LOCUS_41780 5073191 5074075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 5075635 5074082 gene locus_tag LOCUS_41790 5075635 5074082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 5077493 5075676 gene locus_tag LOCUS_41800 5077493 5075676 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831067.1 protein_id gnl|my_center|LOCUS_41800 5078632 5077631 gene locus_tag LOCUS_41810 5078632 5077631 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228883.1 protein_id gnl|my_center|LOCUS_41810 5079423 5078659 gene locus_tag LOCUS_41820 5079423 5078659 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172461.1 protein_id gnl|my_center|LOCUS_41820 5082264 5079448 gene locus_tag LOCUS_41830 5082264 5079448 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_41830 5083049 5082333 gene locus_tag LOCUS_41840 5083049 5082333 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460218.1 protein_id gnl|my_center|LOCUS_41840 5083692 5083198 gene locus_tag LOCUS_41850 5083692 5083198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 5083844 5084155 gene locus_tag LOCUS_41860 5083844 5084155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 5084383 5084207 gene locus_tag LOCUS_41870 5084383 5084207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 5084519 5084878 gene locus_tag LOCUS_41880 5084519 5084878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 5085895 5084990 gene locus_tag LOCUS_41890 5085895 5084990 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_41890 5087232 5085892 gene locus_tag LOCUS_41900 gene hemL 5087232 5085892 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875867.1 protein_id gnl|my_center|LOCUS_41900 5088138 5087347 gene locus_tag LOCUS_41910 5088138 5087347 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976366.1 protein_id gnl|my_center|LOCUS_41910 5088440 5090542 gene locus_tag LOCUS_41920 5088440 5090542 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389647.1 protein_id gnl|my_center|LOCUS_41920 5090539 5091219 gene locus_tag LOCUS_41930 5090539 5091219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 5091661 5091227 gene locus_tag LOCUS_41940 5091661 5091227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 5091940 5093304 gene locus_tag LOCUS_41950 5091940 5093304 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113112.1 protein_id gnl|my_center|LOCUS_41950 5093301 5093885 gene locus_tag LOCUS_41960 5093301 5093885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 5093899 5094720 gene locus_tag LOCUS_41970 5093899 5094720 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113110.1 protein_id gnl|my_center|LOCUS_41970 5094713 5095459 gene locus_tag LOCUS_41980 5094713 5095459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 5095462 5095857 gene locus_tag LOCUS_41990 5095462 5095857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 5095879 5096526 gene locus_tag LOCUS_42000 5095879 5096526 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_42000 5097233 5096649 gene locus_tag LOCUS_42010 5097233 5096649 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921332.1 protein_id gnl|my_center|LOCUS_42010 5097232 5097387 gene locus_tag LOCUS_42020 5097232 5097387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 5098507 5097569 gene locus_tag LOCUS_42030 5098507 5097569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 5099620 5098664 gene locus_tag LOCUS_42040 5099620 5098664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 5100745 5099783 gene locus_tag LOCUS_42050 5100745 5099783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 5101736 5100783 gene locus_tag LOCUS_42060 5101736 5100783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 5102033 5102203 gene locus_tag LOCUS_42070 5102033 5102203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 5102311 5102445 gene locus_tag LOCUS_42080 5102311 5102445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 5102537 5102722 gene locus_tag LOCUS_42090 5102537 5102722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090 5103389 5103304 gene locus_tag LOCUS_t00310 5103389 5103304 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5103555 5103480 gene locus_tag LOCUS_t00320 5103555 5103480 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5103640 5103566 gene locus_tag LOCUS_t00330 5103640 5103566 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5103791 5104732 gene locus_tag LOCUS_42100 gene corA 5103791 5104732 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391811.1 protein_id gnl|my_center|LOCUS_42100 5104818 5106080 gene locus_tag LOCUS_42110 5104818 5106080 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 protein_id gnl|my_center|LOCUS_42110 5106597 5106507 gene locus_tag LOCUS_t00340 5106597 5106507 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5106677 5106602 gene locus_tag LOCUS_t00350 5106677 5106602 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5107258 5106758 gene locus_tag LOCUS_42120 5107258 5106758 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344247.1 protein_id gnl|my_center|LOCUS_42120 5107362 5107718 gene locus_tag LOCUS_42130 5107362 5107718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 5107839 5107976 gene locus_tag LOCUS_42140 5107839 5107976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 5110280 5108091 gene locus_tag LOCUS_42150 5110280 5108091 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246556.1 protein_id gnl|my_center|LOCUS_42150 5110976 5110362 gene locus_tag LOCUS_42160 gene hlyIIR 5110976 5110362 CDS product hemolysin II regulator HlyIIR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000520495.1 protein_id gnl|my_center|LOCUS_42160 5111478 5111128 gene locus_tag LOCUS_42170 gene ndoA 5111478 5111128 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635963.1 protein_id gnl|my_center|LOCUS_42170 5111763 5111482 gene locus_tag LOCUS_42180 gene endB 5111763 5111482 CDS product type II toxin-antitoxin system antitoxin EndoAI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225183.1 protein_id gnl|my_center|LOCUS_42180 5113098 5111914 gene locus_tag LOCUS_42190 gene alr 5113098 5111914 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_42190 5114428 5113280 gene locus_tag LOCUS_42200 5114428 5113280 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234282.1 protein_id gnl|my_center|LOCUS_42200 5114851 5114519 gene locus_tag LOCUS_42210 5114851 5114519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 5115204 5114848 gene locus_tag LOCUS_42220 5115204 5114848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 5115387 5115208 gene locus_tag LOCUS_42230 5115387 5115208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 5115667 5115392 gene locus_tag LOCUS_42240 5115667 5115392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 5118994 5115746 gene locus_tag LOCUS_42250 5118994 5115746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 5121198 5119033 gene locus_tag LOCUS_42260 5121198 5119033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42260 5121423 5122781 gene locus_tag LOCUS_42270 5121423 5122781 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_42270 5124312 5122792 gene locus_tag LOCUS_42280 5124312 5122792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 5124708 5124406 gene locus_tag LOCUS_42290 5124708 5124406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42290 5124901 5124689 gene locus_tag LOCUS_42300 5124901 5124689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 5126863 5125046 gene locus_tag LOCUS_42310 5126863 5125046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 5127625 5127185 gene locus_tag LOCUS_42320 5127625 5127185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 5127740 5127618 gene locus_tag LOCUS_42330 5127740 5127618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 5128087 5128668 gene locus_tag LOCUS_42340 5128087 5128668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 5131393 5128655 gene locus_tag LOCUS_42350 5131393 5128655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 5132184 5131408 gene locus_tag LOCUS_42360 5132184 5131408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 5136352 5132231 gene locus_tag LOCUS_42370 5136352 5132231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 5136877 5136389 gene locus_tag LOCUS_42380 5136877 5136389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 5137857 5137063 gene locus_tag LOCUS_42390 5137857 5137063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 5138586 5137873 gene locus_tag LOCUS_42400 5138586 5137873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 5141461 5138888 gene locus_tag LOCUS_42410 gene yonO 5141461 5138888 CDS product DNA-directed RNA polymerase YonO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399271.1 protein_id gnl|my_center|LOCUS_42410 5141593 5141468 gene locus_tag LOCUS_42420 5141593 5141468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 5143826 5141907 gene locus_tag LOCUS_42430 gene thrS 5143826 5141907 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243399.1 protein_id gnl|my_center|LOCUS_42430 5144239 5144045 gene locus_tag LOCUS_42440 5144239 5144045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 5144321 5145022 gene locus_tag LOCUS_42450 5144321 5145022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929879.1 protein_id gnl|my_center|LOCUS_42450 5145085 5146320 gene locus_tag LOCUS_42460 5145085 5146320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 5146429 5147697 gene locus_tag LOCUS_42470 5146429 5147697 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015312606.1 protein_id gnl|my_center|LOCUS_42470 5147684 5148409 gene locus_tag LOCUS_42480 5147684 5148409 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_42480 5148399 5148851 gene locus_tag LOCUS_42490 5148399 5148851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 5148848 5149192 gene locus_tag LOCUS_42500 5148848 5149192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393711.1 protein_id gnl|my_center|LOCUS_42500 5149213 5150982 gene locus_tag LOCUS_42510 5149213 5150982 CDS product copper amine oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177726.1 protein_id gnl|my_center|LOCUS_42510 5152251 5151553 gene locus_tag LOCUS_42520 5152251 5151553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 5152496 5152421 gene locus_tag LOCUS_t00360 5152496 5152421 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5152950 5152783 gene locus_tag LOCUS_42530 5152950 5152783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 5153144 5153069 gene locus_tag LOCUS_t00370 5153144 5153069 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5153375 5155330 gene locus_tag LOCUS_42540 5153375 5155330 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_42540 5156430 5155417 gene locus_tag LOCUS_42550 5156430 5155417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 5156691 5157218 gene locus_tag LOCUS_42560 gene def 5156691 5157218 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_42560 5157289 5160981 gene locus_tag LOCUS_42570 5157289 5160981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 5162494 5161409 gene locus_tag LOCUS_42580 5162494 5161409 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153481.1 protein_id gnl|my_center|LOCUS_42580 5163512 5162475 gene locus_tag LOCUS_42590 5163512 5162475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 5164511 5163519 gene locus_tag LOCUS_42600 5164511 5163519 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_42600 5164705 5165925 gene locus_tag LOCUS_42610 5164705 5165925 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066054433.1 protein_id gnl|my_center|LOCUS_42610 5167190 5166096 gene locus_tag LOCUS_42620 5167190 5166096 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068619877.1 protein_id gnl|my_center|LOCUS_42620 5169173 5167308 gene locus_tag LOCUS_42630 5169173 5167308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 5173714 5169179 gene locus_tag LOCUS_42640 5173714 5169179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 5174953 5173754 gene locus_tag LOCUS_42650 5174953 5173754 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_42650 5175783 5175022 gene locus_tag LOCUS_42660 5175783 5175022 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228906.1 protein_id gnl|my_center|LOCUS_42660 5176281 5175787 gene locus_tag LOCUS_42670 5176281 5175787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 5177267 5176296 gene locus_tag LOCUS_42680 5177267 5176296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 5179947 5177296 gene locus_tag LOCUS_42690 5179947 5177296 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_42690 5181771 5180041 gene locus_tag LOCUS_42700 5181771 5180041 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966867.1 protein_id gnl|my_center|LOCUS_42700 5182688 5181804 gene locus_tag LOCUS_42710 5182688 5181804 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_42710 5183614 5182706 gene locus_tag LOCUS_42720 5183614 5182706 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_42720 5185390 5183678 gene locus_tag LOCUS_42730 5185390 5183678 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_42730 5187167 5185536 gene locus_tag LOCUS_42740 5187167 5185536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42740 5188834 5187164 gene locus_tag LOCUS_42750 5188834 5187164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 5188769 5188936 gene locus_tag LOCUS_42760 5188769 5188936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 5190405 5189056 gene locus_tag LOCUS_42770 5190405 5189056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 5191198 5190419 gene locus_tag LOCUS_42780 5191198 5190419 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728415.1 protein_id gnl|my_center|LOCUS_42780 5192679 5191174 gene locus_tag LOCUS_42790 5192679 5191174 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836208.1 protein_id gnl|my_center|LOCUS_42790 5193013 5192777 gene locus_tag LOCUS_42800 5193013 5192777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 5193955 5193305 gene locus_tag LOCUS_42810 gene eda 5193955 5193305 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_42810 5194701 5193952 gene locus_tag LOCUS_42820 gene kduD 5194701 5193952 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097013.1 protein_id gnl|my_center|LOCUS_42820 5195475 5194708 gene locus_tag LOCUS_42830 5195475 5194708 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392220.1 protein_id gnl|my_center|LOCUS_42830 5196339 5195506 gene locus_tag LOCUS_42840 gene kduI 5196339 5195506 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 protein_id gnl|my_center|LOCUS_42840 5196752 5196504 gene locus_tag LOCUS_42850 5196752 5196504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 5197341 5196745 gene locus_tag LOCUS_42860 5197341 5196745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 5198174 5197338 gene locus_tag LOCUS_42870 5198174 5197338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 5199072 5198212 gene locus_tag LOCUS_42880 5199072 5198212 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214342.1 protein_id gnl|my_center|LOCUS_42880 5200243 5199149 gene locus_tag LOCUS_42890 5200243 5199149 CDS product GerAB/ArcD/ProY family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918574.1 protein_id gnl|my_center|LOCUS_42890 5201373 5200267 gene locus_tag LOCUS_42900 5201373 5200267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 5202865 5201381 gene locus_tag LOCUS_42910 5202865 5201381 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467497.1 protein_id gnl|my_center|LOCUS_42910 5205334 5203004 gene locus_tag LOCUS_42920 5205334 5203004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 5207235 5205331 gene locus_tag LOCUS_42930 5207235 5205331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 5210384 5207253 gene locus_tag LOCUS_42940 5210384 5207253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 5211242 5210400 gene locus_tag LOCUS_42950 5211242 5210400 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113800.1 protein_id gnl|my_center|LOCUS_42950 5213151 5211250 gene locus_tag LOCUS_42960 5213151 5211250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 5214908 5213235 gene locus_tag LOCUS_42970 5214908 5213235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 5216739 5215177 gene locus_tag LOCUS_42980 5216739 5215177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 5216714 5216935 gene locus_tag LOCUS_42990 5216714 5216935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 5217109 5218959 gene locus_tag LOCUS_43000 5217109 5218959 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356857.1 protein_id gnl|my_center|LOCUS_43000 5218931 5220523 gene locus_tag LOCUS_43010 5218931 5220523 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723174.1 protein_id gnl|my_center|LOCUS_43010 5221546 5220539 gene locus_tag LOCUS_43020 5221546 5220539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 5228270 5221623 gene locus_tag LOCUS_43030 5228270 5221623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 5229177 5228662 gene locus_tag LOCUS_43040 5229177 5228662 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503553.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43040 5229972 5229589 gene locus_tag LOCUS_43050 5229972 5229589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 5230651 5230076 gene locus_tag LOCUS_43060 5230651 5230076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230911.1 protein_id gnl|my_center|LOCUS_43060 5231382 5230786 gene locus_tag LOCUS_43070 5231382 5230786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 5232372 5231578 gene locus_tag LOCUS_43080 5232372 5231578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 5233589 5232675 gene locus_tag LOCUS_43090 5233589 5232675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 5234650 5233883 gene locus_tag LOCUS_43100 5234650 5233883 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262191.1 protein_id gnl|my_center|LOCUS_43100 5235667 5234915 gene locus_tag LOCUS_43110 5235667 5234915 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978344.1 protein_id gnl|my_center|LOCUS_43110 5235825 5236709 gene locus_tag LOCUS_43120 gene cmrA 5235825 5236709 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_43120 5237062 5236835 gene locus_tag LOCUS_43130 5237062 5236835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 5238502 5237330 gene locus_tag LOCUS_43140 5238502 5237330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 5238569 5238739 gene locus_tag LOCUS_43150 5238569 5238739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 5238723 5239079 gene locus_tag LOCUS_43160 5238723 5239079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 5240015 5239128 gene locus_tag LOCUS_43170 5240015 5239128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941367.1 protein_id gnl|my_center|LOCUS_43170 5241336 5240074 gene locus_tag LOCUS_43180 5241336 5240074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 5244920 5241564 gene locus_tag LOCUS_43190 5244920 5241564 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202205.1 protein_id gnl|my_center|LOCUS_43190 5245049 5245936 gene locus_tag LOCUS_43200 5245049 5245936 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801276.1 protein_id gnl|my_center|LOCUS_43200 5246189 5246809 gene locus_tag LOCUS_43210 5246189 5246809 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861619.1 protein_id gnl|my_center|LOCUS_43210 5247876 5246986 gene locus_tag LOCUS_43220 5247876 5246986 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_43220 5248537 5247863 gene locus_tag LOCUS_43230 5248537 5247863 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_43230 5248705 5248944 gene locus_tag LOCUS_43240 gene sspI 5248705 5248944 CDS product small acid-soluble spore protein SspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229525.1 protein_id gnl|my_center|LOCUS_43240 5250120 5248951 gene locus_tag LOCUS_43250 5250120 5248951 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435857.1 protein_id gnl|my_center|LOCUS_43250 5251988 5250255 gene locus_tag LOCUS_43260 5251988 5250255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 5253298 5252207 gene locus_tag LOCUS_43270 5253298 5252207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_43270 5253484 5254416 gene locus_tag LOCUS_43280 5253484 5254416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 5258359 5254556 gene locus_tag LOCUS_43290 5258359 5254556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43290 5263089 5258488 gene locus_tag LOCUS_43300 5263089 5258488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 5264695 5263286 gene locus_tag LOCUS_43310 5264695 5263286 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929854.1 protein_id gnl|my_center|LOCUS_43310 5265591 5264767 gene locus_tag LOCUS_43320 5265591 5264767 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_43320 5266487 5265594 gene locus_tag LOCUS_43330 5266487 5265594 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_43330 5267612 5266512 gene locus_tag LOCUS_43340 5267612 5266512 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_43340 5269017 5267983 gene locus_tag LOCUS_43350 5269017 5267983 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704143.1 protein_id gnl|my_center|LOCUS_43350 5270784 5269198 gene locus_tag LOCUS_43360 5270784 5269198 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_43360 5272634 5271102 gene locus_tag LOCUS_43370 5272634 5271102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 5274329 5272788 gene locus_tag LOCUS_43380 5274329 5272788 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229620.1 protein_id gnl|my_center|LOCUS_43380 5275034 5274363 gene locus_tag LOCUS_43390 5275034 5274363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400906.1 protein_id gnl|my_center|LOCUS_43390 5275713 5275027 gene locus_tag LOCUS_43400 5275713 5275027 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258384.1 protein_id gnl|my_center|LOCUS_43400 5276360 5275731 gene locus_tag LOCUS_43410 5276360 5275731 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102258.1 protein_id gnl|my_center|LOCUS_43410 5276598 5276440 gene locus_tag LOCUS_43420 5276598 5276440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 5277236 5276613 gene locus_tag LOCUS_43430 5277236 5276613 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393784.1 protein_id gnl|my_center|LOCUS_43430 5278846 5277293 gene locus_tag LOCUS_43440 gene zwf 5278846 5277293 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393785.1 protein_id gnl|my_center|LOCUS_43440 5279172 5279705 gene locus_tag LOCUS_43450 5279172 5279705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43450 5281161 5279977 gene locus_tag LOCUS_43460 5281161 5279977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 5282656 5281184 gene locus_tag LOCUS_43470 5282656 5281184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 5283510 5282857 gene locus_tag LOCUS_43480 gene liaR 5283510 5282857 CDS product two-component system response regulator LiaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243201.1 protein_id gnl|my_center|LOCUS_43480 5284537 5283470 gene locus_tag LOCUS_43490 gene liaS 5284537 5283470 CDS product two-component system sensor histidine kinase LiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244464.1 protein_id gnl|my_center|LOCUS_43490 5285198 5284551 gene locus_tag LOCUS_43500 5285198 5284551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43500 5286057 5285362 gene locus_tag LOCUS_43510 5286057 5285362 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811261.1 protein_id gnl|my_center|LOCUS_43510 5286571 5286062 gene locus_tag LOCUS_43520 5286571 5286062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 5287240 5286575 gene locus_tag LOCUS_43530 5287240 5286575 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110280.1 protein_id gnl|my_center|LOCUS_43530 5287565 5287263 gene locus_tag LOCUS_43540 5287565 5287263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 5287777 5288400 gene locus_tag LOCUS_43550 5287777 5288400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 5288907 5288449 gene locus_tag LOCUS_43560 5288907 5288449 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 protein_id gnl|my_center|LOCUS_43560 5289085 5289426 gene locus_tag LOCUS_43570 5289085 5289426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 5289507 5290463 gene locus_tag LOCUS_43580 5289507 5290463 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226536.1 protein_id gnl|my_center|LOCUS_43580 5291486 5290683 gene locus_tag LOCUS_43590 5291486 5290683 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730486.1 protein_id gnl|my_center|LOCUS_43590 5292000 5291656 gene locus_tag LOCUS_43600 5292000 5291656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43600 5292893 5292054 gene locus_tag LOCUS_43610 gene rsbQ 5292893 5292054 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_43610 5293184 5293099 gene locus_tag LOCUS_t00380 5293184 5293099 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5293290 5293214 gene locus_tag LOCUS_t00390 5293290 5293214 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5293375 5293302 gene locus_tag LOCUS_t00400 5293375 5293302 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 5293461 5293387 gene locus_tag LOCUS_t00410 5293461 5293387 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5293540 5293466 gene locus_tag LOCUS_t00420 5293540 5293466 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5293628 5293553 gene locus_tag LOCUS_t00430 5293628 5293553 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5293720 5293647 gene locus_tag LOCUS_t00440 5293720 5293647 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5293822 5293739 gene locus_tag LOCUS_t00450 5293822 5293739 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5293914 5293839 gene locus_tag LOCUS_t00460 5293914 5293839 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5294013 5293938 gene locus_tag LOCUS_t00470 5294013 5293938 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5294117 5294041 gene locus_tag LOCUS_t00480 5294117 5294041 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5294227 5294151 gene locus_tag LOCUS_t00490 5294227 5294151 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5294412 5294338 gene locus_tag LOCUS_t00500 5294412 5294338 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5294524 5294432 gene locus_tag LOCUS_t00510 5294524 5294432 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5294604 5294529 gene locus_tag LOCUS_t00520 5294604 5294529 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5294741 5294630 gene locus_tag LOCUS_r00110 5294741 5294630 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5297806 5294880 gene locus_tag LOCUS_r00120 5297806 5294880 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5299649 5298099 gene locus_tag LOCUS_r00130 5299649 5298099 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 5300776 5299970 gene locus_tag LOCUS_43620 5300776 5299970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 5301825 5300926 gene locus_tag LOCUS_43630 5301825 5300926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 5301990 5302364 gene locus_tag LOCUS_43640 5301990 5302364 CDS product YgzB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243536.1 protein_id gnl|my_center|LOCUS_43640 5304171 5302426 gene locus_tag LOCUS_43650 5304171 5302426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 5304692 5304315 gene locus_tag LOCUS_43660 gene perR 5304692 5304315 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002002038.1 protein_id gnl|my_center|LOCUS_43660 5305515 5304850 gene locus_tag LOCUS_43670 5305515 5304850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 5306242 5305544 gene locus_tag LOCUS_43680 5306242 5305544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 5306797 5306327 gene locus_tag LOCUS_43690 5306797 5306327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 5308319 5306874 gene locus_tag LOCUS_43700 gene gatB 5308319 5306874 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219444.1 protein_id gnl|my_center|LOCUS_43700 5309790 5308339 gene locus_tag LOCUS_43710 gene gatA 5309790 5308339 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051433.1 protein_id gnl|my_center|LOCUS_43710 5310102 5309815 gene locus_tag LOCUS_43720 gene gatC 5310102 5309815 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086999.1 protein_id gnl|my_center|LOCUS_43720 5310290 5311366 gene locus_tag LOCUS_43730 5310290 5311366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 5311445 5311864 gene locus_tag LOCUS_43740 5311445 5311864 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_43740 5312327 5311950 gene locus_tag LOCUS_43750 5312327 5311950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 5313554 5312427 gene locus_tag LOCUS_43760 5313554 5312427 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_43760 5314195 5313710 gene locus_tag LOCUS_43770 5314195 5313710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 5314642 5314217 gene locus_tag LOCUS_43780 5314642 5314217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 5314785 5314639 gene locus_tag LOCUS_43790 5314785 5314639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 5314968 5314819 gene locus_tag LOCUS_43800 5314968 5314819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 5315910 5315017 gene locus_tag LOCUS_43810 5315910 5315017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 5316907 5315978 gene locus_tag LOCUS_43820 5316907 5315978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 5318358 5316901 gene locus_tag LOCUS_43830 5318358 5316901 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394924.1 protein_id gnl|my_center|LOCUS_43830 5319200 5318355 gene locus_tag LOCUS_43840 5319200 5318355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43840 5319913 5319197 gene locus_tag LOCUS_43850 5319913 5319197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 5320748 5320119 gene locus_tag LOCUS_43860 5320748 5320119 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967732.1 protein_id gnl|my_center|LOCUS_43860 5321328 5320762 gene locus_tag LOCUS_43870 5321328 5320762 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009878789.1 protein_id gnl|my_center|LOCUS_43870 5322035 5321427 gene locus_tag LOCUS_43880 5322035 5321427 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900214.1 protein_id gnl|my_center|LOCUS_43880 5322233 5322682 gene locus_tag LOCUS_43890 5322233 5322682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 5322772 5323083 gene locus_tag LOCUS_43900 5322772 5323083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 5325337 5323157 gene locus_tag LOCUS_43910 5325337 5323157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 5326308 5325622 gene locus_tag LOCUS_43920 5326308 5325622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43920 5328025 5326343 gene locus_tag LOCUS_43930 5328025 5326343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 5329351 5328146 gene locus_tag LOCUS_43940 5329351 5328146 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_43940 5330010 5329348 gene locus_tag LOCUS_43950 5330010 5329348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 5330818 5330003 gene locus_tag LOCUS_43960 5330818 5330003 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_43960 5331459 5330848 gene locus_tag LOCUS_43970 5331459 5330848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 5331590 5331811 gene locus_tag LOCUS_43980 5331590 5331811 CDS product DUF1128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366196.1 protein_id gnl|my_center|LOCUS_43980 5332302 5332111 gene locus_tag LOCUS_43990 5332302 5332111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 5334015 5332393 gene locus_tag LOCUS_44000 gene galT 5334015 5332393 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227402.1 protein_id gnl|my_center|LOCUS_44000 5335177 5334191 gene locus_tag LOCUS_44010 gene galE 5335177 5334191 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987061.1 protein_id gnl|my_center|LOCUS_44010 5336360 5335179 gene locus_tag LOCUS_44020 5336360 5335179 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_44020 5336525 5337382 gene locus_tag LOCUS_44030 5336525 5337382 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754235.1 protein_id gnl|my_center|LOCUS_44030 5337762 5337355 gene locus_tag LOCUS_44040 5337762 5337355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 5337839 5338006 gene locus_tag LOCUS_44050 5337839 5338006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 5338034 5338945 gene locus_tag LOCUS_44060 5338034 5338945 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_44060 5340007 5339012 gene locus_tag LOCUS_44070 5340007 5339012 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_44070 5341846 5340053 gene locus_tag LOCUS_44080 5341846 5340053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 5342010 5342321 gene locus_tag LOCUS_44090 5342010 5342321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 5342401 5342682 gene locus_tag LOCUS_44100 5342401 5342682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 5344536 5343085 gene locus_tag LOCUS_44110 5344536 5343085 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_44110 5344785 5345105 gene locus_tag LOCUS_44120 5344785 5345105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 5345299 5345084 gene locus_tag LOCUS_44130 5345299 5345084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 5345249 5346037 gene locus_tag LOCUS_44140 5345249 5346037 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_44140 5346698 5346351 gene locus_tag LOCUS_44150 5346698 5346351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 5347571 5346789 gene locus_tag LOCUS_44160 gene sigB 5347571 5346789 CDS product RNA polymerase sigma factor SigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246715.1 protein_id gnl|my_center|LOCUS_44160 5348011 5347568 gene locus_tag LOCUS_44170 gene rsbW 5348011 5347568 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234299.1 protein_id gnl|my_center|LOCUS_44170 5348384 5348058 gene locus_tag LOCUS_44180 gene rsbV 5348384 5348058 CDS product anti sigma b factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195245.1 protein_id gnl|my_center|LOCUS_44180 5348545 5348697 gene locus_tag LOCUS_44190 5348545 5348697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 5348752 5349984 gene locus_tag LOCUS_44200 5348752 5349984 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 protein_id gnl|my_center|LOCUS_44200 5350574 5350017 gene locus_tag LOCUS_44210 5350574 5350017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 5351527 5350679 gene locus_tag LOCUS_44220 5351527 5350679 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_44220 5352862 5351714 gene locus_tag LOCUS_44230 5352862 5351714 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025547.1 protein_id gnl|my_center|LOCUS_44230 5353357 5353031 gene locus_tag LOCUS_44240 5353357 5353031 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233729.1 protein_id gnl|my_center|LOCUS_44240 5353993 5353418 gene locus_tag LOCUS_44250 5353993 5353418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 5354377 5354541 gene locus_tag LOCUS_44260 5354377 5354541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44260 5354843 5355829 gene locus_tag LOCUS_44270 5354843 5355829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 5355871 5357052 gene locus_tag LOCUS_44280 5355871 5357052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_44280 5357042 5358385 gene locus_tag LOCUS_44290 5357042 5358385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 5359528 5358863 gene locus_tag LOCUS_44300 5359528 5358863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 5361029 5359665 gene locus_tag LOCUS_44310 5361029 5359665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 5361326 5361652 gene locus_tag LOCUS_44320 5361326 5361652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 5362400 5361732 gene locus_tag LOCUS_44330 5362400 5361732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 5365122 5362492 gene locus_tag LOCUS_44340 5365122 5362492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 5365711 5365427 gene locus_tag LOCUS_44350 5365711 5365427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 5365710 5365889 gene locus_tag LOCUS_44360 5365710 5365889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 5366004 5366957 gene locus_tag LOCUS_44370 5366004 5366957 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_44370 5367464 5367246 gene locus_tag LOCUS_44380 5367464 5367246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 5368406 5367591 gene locus_tag LOCUS_44390 5368406 5367591 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777022.1 protein_id gnl|my_center|LOCUS_44390 5368603 5369466 gene locus_tag LOCUS_44400 5368603 5369466 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_44400 5369463 5370191 gene locus_tag LOCUS_44410 gene nagB 5369463 5370191 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_44410 5370188 5371390 gene locus_tag LOCUS_44420 gene nagA 5370188 5371390 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029554.1 protein_id gnl|my_center|LOCUS_44420 5371687 5371439 gene locus_tag LOCUS_44430 5371687 5371439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 5372823 5372188 gene locus_tag LOCUS_44440 5372823 5372188 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 protein_id gnl|my_center|LOCUS_44440 5372895 5373080 gene locus_tag LOCUS_44450 5372895 5373080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 5373855 5373094 gene locus_tag LOCUS_44460 gene fabG 5373855 5373094 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_44460 5374192 5373845 gene locus_tag LOCUS_44470 5374192 5373845 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527935.1 protein_id gnl|my_center|LOCUS_44470 5374418 5375506 gene locus_tag LOCUS_44480 5374418 5375506 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093643.1 protein_id gnl|my_center|LOCUS_44480 5375787 5375527 gene locus_tag LOCUS_44490 5375787 5375527 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_44490 5376278 5375808 gene locus_tag LOCUS_44500 5376278 5375808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 5376449 5376700 gene locus_tag LOCUS_44510 5376449 5376700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44510 5377568 5376633 gene locus_tag LOCUS_44520 5377568 5376633 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764146.1 protein_id gnl|my_center|LOCUS_44520 5378984 5377695 gene locus_tag LOCUS_44530 5378984 5377695 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_44530 5380389 5379085 gene locus_tag LOCUS_44540 gene yjoB 5380389 5379085 CDS product ATPase YjoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245490.1 protein_id gnl|my_center|LOCUS_44540 5381439 5380573 gene locus_tag LOCUS_44550 5381439 5380573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 5383099 5381510 gene locus_tag LOCUS_44560 5383099 5381510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 5383809 5383162 gene locus_tag LOCUS_44570 5383809 5383162 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398522.1 protein_id gnl|my_center|LOCUS_44570 5384083 5384985 gene locus_tag LOCUS_44580 5384083 5384985 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266475.1 protein_id gnl|my_center|LOCUS_44580 5385129 5385797 gene locus_tag LOCUS_44590 5385129 5385797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44590 5387370 5386414 gene locus_tag LOCUS_44600 5387370 5386414 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_44600 5388394 5387363 gene locus_tag LOCUS_44610 gene oppD 5388394 5387363 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 protein_id gnl|my_center|LOCUS_44610 5389322 5388408 gene locus_tag LOCUS_44620 gene dppC 5389322 5388408 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245702.1 protein_id gnl|my_center|LOCUS_44620 5390255 5389326 gene locus_tag LOCUS_44630 5390255 5389326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534167.1 protein_id gnl|my_center|LOCUS_44630 5392082 5390385 gene locus_tag LOCUS_44640 5392082 5390385 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727217.1 protein_id gnl|my_center|LOCUS_44640 5393862 5392408 gene locus_tag LOCUS_44650 5393862 5392408 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150184.1 protein_id gnl|my_center|LOCUS_44650 5394980 5394381 gene locus_tag LOCUS_44660 5394980 5394381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 5396020 5394977 gene locus_tag LOCUS_44670 5396020 5394977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 5396854 5396048 gene locus_tag LOCUS_44680 gene speD 5396854 5396048 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_44680 5397338 5397042 gene locus_tag LOCUS_44690 5397338 5397042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44690 5397500 5397712 gene locus_tag LOCUS_44700 5397500 5397712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 5398063 5399433 gene locus_tag LOCUS_44710 5398063 5399433 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361833.1 protein_id gnl|my_center|LOCUS_44710 5400945 5399443 gene locus_tag LOCUS_44720 5400945 5399443 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_44720 5401065 5401943 gene locus_tag LOCUS_44730 5401065 5401943 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_44730 5403565 5402384 gene locus_tag LOCUS_44740 5403565 5402384 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272237.1 protein_id gnl|my_center|LOCUS_44740 5403860 5403642 gene locus_tag LOCUS_44750 5403860 5403642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44750 5404483 5403995 gene locus_tag LOCUS_44760 5404483 5403995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 5404629 5405777 gene locus_tag LOCUS_44770 5404629 5405777 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649088.1 protein_id gnl|my_center|LOCUS_44770 5405995 5407437 gene locus_tag LOCUS_44780 5405995 5407437 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_44780 5408818 5407466 gene locus_tag LOCUS_44790 5408818 5407466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 5409541 5408858 gene locus_tag LOCUS_44800 5409541 5408858 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_44800 5415460 5409695 gene locus_tag LOCUS_44810 5415460 5409695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 5417154 5415487 gene locus_tag LOCUS_44820 5417154 5415487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 5420228 5417172 gene locus_tag LOCUS_44830 5420228 5417172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 5420523 5420828 gene locus_tag LOCUS_44840 5420523 5420828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 5422464 5420950 gene locus_tag LOCUS_44850 5422464 5420950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 5422580 5422888 gene locus_tag LOCUS_44860 5422580 5422888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 5422918 5424198 gene locus_tag LOCUS_44870 5422918 5424198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 5424182 5424754 gene locus_tag LOCUS_44880 5424182 5424754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 5426353 5425193 gene locus_tag LOCUS_44890 5426353 5425193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 5431067 5426493 gene locus_tag LOCUS_44900 5431067 5426493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 5431956 5431123 gene locus_tag LOCUS_44910 5431956 5431123 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_44910 5432882 5431941 gene locus_tag LOCUS_44920 5432882 5431941 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_44920 5434200 5432899 gene locus_tag LOCUS_44930 5434200 5432899 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_44930 5435967 5434456 gene locus_tag LOCUS_44940 5435967 5434456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44940 5437823 5436012 gene locus_tag LOCUS_44950 5437823 5436012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44950 5439683 5438124 gene locus_tag LOCUS_44960 5439683 5438124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44960 5439887 5440270 gene locus_tag LOCUS_44970 5439887 5440270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44970 5440267 5440908 gene locus_tag LOCUS_44980 5440267 5440908 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256153.1 protein_id gnl|my_center|LOCUS_44980 5440989 5441453 gene locus_tag LOCUS_44990 5440989 5441453 CDS product DUF4385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141893.1 protein_id gnl|my_center|LOCUS_44990 5442320 5441466 gene locus_tag LOCUS_45000 5442320 5441466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 5443178 5442366 gene locus_tag LOCUS_45010 5443178 5442366 CDS product AAC(3) family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783346.1 protein_id gnl|my_center|LOCUS_45010 5443299 5443700 gene locus_tag LOCUS_45020 5443299 5443700 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_45020 5445181 5443895 gene locus_tag LOCUS_45030 gene hflX 5445181 5443895 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393283.1 protein_id gnl|my_center|LOCUS_45030 5445989 5445585 gene locus_tag LOCUS_45040 5445989 5445585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45040 5446300 5447163 gene locus_tag LOCUS_45050 5446300 5447163 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_45050 5447160 5447795 gene locus_tag LOCUS_45060 5447160 5447795 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810935.1 protein_id gnl|my_center|LOCUS_45060 5449392 5447830 gene locus_tag LOCUS_45070 5449392 5447830 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_45070 5451629 5449422 gene locus_tag LOCUS_45080 5451629 5449422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45080 5458758 5451796 gene locus_tag LOCUS_45090 5458758 5451796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45090 5459286 5459131 gene locus_tag LOCUS_45100 5459286 5459131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 5464433 5459445 gene locus_tag LOCUS_45110 5464433 5459445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 5466061 5464520 gene locus_tag LOCUS_45120 5466061 5464520 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800385.1 protein_id gnl|my_center|LOCUS_45120 5466985 5466101 gene locus_tag LOCUS_45130 5466985 5466101 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_45130 5468021 5466999 gene locus_tag LOCUS_45140 5468021 5466999 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_45140 5468576 5468307 gene locus_tag LOCUS_45150 5468576 5468307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45150 5470982 5468670 gene locus_tag LOCUS_45160 5470982 5468670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45160 5472382 5471108 gene locus_tag LOCUS_45170 5472382 5471108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 5473398 5472742 gene locus_tag LOCUS_45180 gene bshB2 5473398 5472742 CDS product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456851.1 protein_id gnl|my_center|LOCUS_45180 5473770 5473426 gene locus_tag LOCUS_45190 5473770 5473426 CDS product YojF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000407043.1 protein_id gnl|my_center|LOCUS_45190 5474011 5474199 gene locus_tag LOCUS_45200 5474011 5474199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 5474212 5474523 gene locus_tag LOCUS_45210 5474212 5474523 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963933.1 protein_id gnl|my_center|LOCUS_45210 5474629 5475624 gene locus_tag LOCUS_45220 5474629 5475624 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356071.1 protein_id gnl|my_center|LOCUS_45220 5476110 5475898 gene locus_tag LOCUS_45230 5476110 5475898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45230 5476132 5476377 gene locus_tag LOCUS_45240 5476132 5476377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45240 5477527 5476352 gene locus_tag LOCUS_45250 gene gguB 5477527 5476352 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257795.1 protein_id gnl|my_center|LOCUS_45250 5479060 5477540 gene locus_tag LOCUS_45260 gene gguA 5479060 5477540 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257794.1 protein_id gnl|my_center|LOCUS_45260 5480265 5479159 gene locus_tag LOCUS_45270 gene chvE 5480265 5479159 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257793.1 protein_id gnl|my_center|LOCUS_45270 5481807 5480455 gene locus_tag LOCUS_45280 gene mepA 5481807 5480455 CDS product multidrug efflux MATE transporter MepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651051.1 protein_id gnl|my_center|LOCUS_45280 5481944 5482624 gene locus_tag LOCUS_45290 5481944 5482624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 5484156 5483011 gene locus_tag LOCUS_45300 gene xylF 5484156 5483011 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_45300 5485742 5484159 gene locus_tag LOCUS_45310 5485742 5484159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 5487180 5485735 gene locus_tag LOCUS_45320 5487180 5485735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45320 5488154 5487177 gene locus_tag LOCUS_45330 5488154 5487177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 5489455 5488316 gene locus_tag LOCUS_45340 5489455 5488316 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022426.1 protein_id gnl|my_center|LOCUS_45340 5491173 5489485 gene locus_tag LOCUS_45350 5491173 5489485 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022425.1 protein_id gnl|my_center|LOCUS_45350 5491928 5491188 gene locus_tag LOCUS_45360 5491928 5491188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022424.1 protein_id gnl|my_center|LOCUS_45360 5494036 5492225 gene locus_tag LOCUS_45370 5494036 5492225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45370 5494716 5494072 gene locus_tag LOCUS_45380 gene bsp22 5494716 5494072 CDS product type III secretion system needle tip complex Bsp22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809882.1 protein_id gnl|my_center|LOCUS_45380 5495342 5494821 gene locus_tag LOCUS_45390 5495342 5494821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45390 5496102 5495713 gene locus_tag LOCUS_45400 5496102 5495713 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_45400 5496906 5496238 gene locus_tag LOCUS_45410 5496906 5496238 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705602.1 protein_id gnl|my_center|LOCUS_45410 5497041 5497955 gene locus_tag LOCUS_45420 5497041 5497955 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_45420 5498987 5498091 gene locus_tag LOCUS_45430 5498987 5498091 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036279.1 protein_id gnl|my_center|LOCUS_45430 5500393 5499071 gene locus_tag LOCUS_45440 5500393 5499071 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_45440 5502113 5500452 gene locus_tag LOCUS_45450 5502113 5500452 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_45450 5506270 5502179 gene locus_tag LOCUS_45460 5506270 5502179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45460 5508816 5506468 gene locus_tag LOCUS_45470 5508816 5506468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 5510234 5508942 gene locus_tag LOCUS_45480 5510234 5508942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 5511163 5510231 gene locus_tag LOCUS_45490 5511163 5510231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45490 5512160 5511210 gene locus_tag LOCUS_45500 5512160 5511210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45500 5513169 5512183 gene locus_tag LOCUS_45510 5513169 5512183 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_45510 5514817 5513264 gene locus_tag LOCUS_45520 5514817 5513264 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_45520 5515015 5514836 gene locus_tag LOCUS_45530 5515015 5514836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45530 5516578 5515016 gene locus_tag LOCUS_45540 5516578 5515016 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028506.1 protein_id gnl|my_center|LOCUS_45540 5517661 5516705 gene locus_tag LOCUS_45550 5517661 5516705 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_45550 5518592 5517675 gene locus_tag LOCUS_45560 5518592 5517675 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_45560 5520415 5518922 gene locus_tag LOCUS_45570 5520415 5518922 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_45570 5520620 5522506 gene locus_tag LOCUS_45580 5520620 5522506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45580 5524297 5522540 gene locus_tag LOCUS_45590 5524297 5522540 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861596.1 protein_id gnl|my_center|LOCUS_45590 5531023 5524394 gene locus_tag LOCUS_45600 5531023 5524394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 5532411 5531143 gene locus_tag LOCUS_45610 5532411 5531143 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_45610 5533311 5532439 gene locus_tag LOCUS_45620 5533311 5532439 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_45620 5534213 5533305 gene locus_tag LOCUS_45630 5534213 5533305 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_45630 5535847 5534291 gene locus_tag LOCUS_45640 5535847 5534291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45640 5538352 5536142 gene locus_tag LOCUS_45650 5538352 5536142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 5539081 5538770 gene locus_tag LOCUS_45660 5539081 5538770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 5540328 5539471 gene locus_tag LOCUS_45670 5540328 5539471 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089438.1 protein_id gnl|my_center|LOCUS_45670 5541159 5540419 gene locus_tag LOCUS_45680 5541159 5540419 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331388.1 protein_id gnl|my_center|LOCUS_45680 5542177 5541281 gene locus_tag LOCUS_45690 5542177 5541281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45690 5542350 5543837 gene locus_tag LOCUS_45700 5542350 5543837 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966741.1 protein_id gnl|my_center|LOCUS_45700 5544975 5543929 gene locus_tag LOCUS_45710 5544975 5543929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45710 5545890 5545117 gene locus_tag LOCUS_45720 5545890 5545117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45720 5546803 5545883 gene locus_tag LOCUS_45730 5546803 5545883 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986750.1 protein_id gnl|my_center|LOCUS_45730 5548311 5546800 gene locus_tag LOCUS_45740 5548311 5546800 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_45740 5549273 5548419 gene locus_tag LOCUS_45750 gene ycbM 5549273 5548419 CDS product two-component system sensor histidine kinase YcbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246497.1 protein_id gnl|my_center|LOCUS_45750 5550043 5549342 gene locus_tag LOCUS_45760 5550043 5549342 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651982.1 protein_id gnl|my_center|LOCUS_45760 5550597 5550226 gene locus_tag LOCUS_45770 5550597 5550226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 5551912 5551373 gene locus_tag LOCUS_45780 5551912 5551373 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_45780 5552895 5552041 gene locus_tag LOCUS_45790 5552895 5552041 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267123.1 protein_id gnl|my_center|LOCUS_45790 5553734 5552949 gene locus_tag LOCUS_45800 5553734 5552949 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117668.1 protein_id gnl|my_center|LOCUS_45800 5554777 5553740 gene locus_tag LOCUS_45810 5554777 5553740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114797.1 protein_id gnl|my_center|LOCUS_45810 5555583 5554774 gene locus_tag LOCUS_45820 5555583 5554774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770465.1 protein_id gnl|my_center|LOCUS_45820 5556521 5555583 gene locus_tag LOCUS_45830 5556521 5555583 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091588.1 protein_id gnl|my_center|LOCUS_45830 5557698 5556592 gene locus_tag LOCUS_45840 5557698 5556592 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870212.1 protein_id gnl|my_center|LOCUS_45840 5557909 5562747 gene locus_tag LOCUS_45850 5557909 5562747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 5563855 5563271 gene locus_tag LOCUS_45860 5563855 5563271 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190900.1 protein_id gnl|my_center|LOCUS_45860 5564079 5565278 gene locus_tag LOCUS_45870 5564079 5565278 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244454.1 protein_id gnl|my_center|LOCUS_45870 5565591 5565271 gene locus_tag LOCUS_45880 5565591 5565271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 5566473 5565835 gene locus_tag LOCUS_45890 5566473 5565835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45890 5566710 5566474 gene locus_tag LOCUS_45900 5566710 5566474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 5566811 5567587 gene locus_tag LOCUS_45910 5566811 5567587 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_45910 5567659 5567835 gene locus_tag LOCUS_45920 5567659 5567835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 5568243 5567944 gene locus_tag LOCUS_45930 5568243 5567944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45930 5568747 5568364 gene locus_tag LOCUS_45940 gene hypR 5568747 5568364 CDS product transcriptional regulator HypR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242487.1 protein_id gnl|my_center|LOCUS_45940 5569862 5568810 gene locus_tag LOCUS_45950 5569862 5568810 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_45950 5570909 5569992 gene locus_tag LOCUS_45960 5570909 5569992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 5571067 5573553 gene locus_tag LOCUS_45970 5571067 5573553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 5575721 5573652 gene locus_tag LOCUS_45980 5575721 5573652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 5576206 5575769 gene locus_tag LOCUS_45990 5576206 5575769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 5576717 5577646 gene locus_tag LOCUS_46000 5576717 5577646 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966735.1 protein_id gnl|my_center|LOCUS_46000 5579182 5577782 gene locus_tag LOCUS_46010 5579182 5577782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 5580237 5579179 gene locus_tag LOCUS_46020 5580237 5579179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46020 5581721 5580252 gene locus_tag LOCUS_46030 5581721 5580252 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392013.1 protein_id gnl|my_center|LOCUS_46030 5582817 5581705 gene locus_tag LOCUS_46040 gene ald 5582817 5581705 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219410.1 protein_id gnl|my_center|LOCUS_46040 5583613 5582840 gene locus_tag LOCUS_46050 5583613 5582840 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_46050 5585308 5583638 gene locus_tag LOCUS_46060 5585308 5583638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 5587278 5585875 gene locus_tag LOCUS_46070 5587278 5585875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 5601627 5587591 gene locus_tag LOCUS_46080 5601627 5587591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46080 5603018 5601864 gene locus_tag LOCUS_46090 5603018 5601864 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809602.1 protein_id gnl|my_center|LOCUS_46090 5604828 5602999 gene locus_tag LOCUS_46100 5604828 5602999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46100 5606007 5604934 gene locus_tag LOCUS_46110 5606007 5604934 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_46110 5606780 5606004 gene locus_tag LOCUS_46120 5606780 5606004 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_46120 5607706 5606822 gene locus_tag LOCUS_46130 5607706 5606822 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_46130 5608653 5607724 gene locus_tag LOCUS_46140 5608653 5607724 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_46140 5611061 5608773 gene locus_tag LOCUS_46150 5611061 5608773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46150 5612752 5611205 gene locus_tag LOCUS_46160 5612752 5611205 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002995654.1 protein_id gnl|my_center|LOCUS_46160 5614173 5613076 gene locus_tag LOCUS_46170 5614173 5613076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 5618268 5614186 gene locus_tag LOCUS_46180 5618268 5614186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 5619168 5618449 gene locus_tag LOCUS_46190 5619168 5618449 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530083.1 protein_id gnl|my_center|LOCUS_46190 5620228 5619194 gene locus_tag LOCUS_46200 5620228 5619194 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075125.1 protein_id gnl|my_center|LOCUS_46200 5620992 5620285 gene locus_tag LOCUS_46210 5620992 5620285 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104434.1 protein_id gnl|my_center|LOCUS_46210 5621081 5621890 gene locus_tag LOCUS_46220 5621081 5621890 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_46220 5622699 5621908 gene locus_tag LOCUS_46230 5622699 5621908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 5623723 5622668 gene locus_tag LOCUS_46240 5623723 5622668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 5624000 5625241 gene locus_tag LOCUS_46250 5624000 5625241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 5625274 5625858 gene locus_tag LOCUS_46260 5625274 5625858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46260 5626254 5628005 gene locus_tag LOCUS_46270 5626254 5628005 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761079.1 protein_id gnl|my_center|LOCUS_46270 5628118 5631849 gene locus_tag LOCUS_46280 5628118 5631849 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477902.1 protein_id gnl|my_center|LOCUS_46280 5631997 5632332 gene locus_tag LOCUS_46290 5631997 5632332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46290 5633495 5632737 gene locus_tag LOCUS_46300 5633495 5632737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 5633874 5633692 gene locus_tag LOCUS_46310 5633874 5633692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 5634711 5633938 gene locus_tag LOCUS_46320 5634711 5633938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46320 5640576 5634901 gene locus_tag LOCUS_46330 5640576 5634901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 5643010 5640824 gene locus_tag LOCUS_46340 gene aguA 5643010 5640824 CDS product xylan alpha-(1->2)-glucuronosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082543.1 protein_id gnl|my_center|LOCUS_46340 5644294 5643104 gene locus_tag LOCUS_46350 5644294 5643104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46350 5645313 5644378 gene locus_tag LOCUS_46360 5645313 5644378 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_46360 5646304 5645330 gene locus_tag LOCUS_46370 5646304 5645330 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_46370 5647931 5646408 gene locus_tag LOCUS_46380 5647931 5646408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_46380 5647957 5648163 gene locus_tag LOCUS_46390 5647957 5648163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46390 5648437 5649495 gene locus_tag LOCUS_46400 gene fni 5648437 5649495 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_46400 5649568 5650449 gene locus_tag LOCUS_46410 5649568 5650449 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642485.1 protein_id gnl|my_center|LOCUS_46410 5650453 5651946 gene locus_tag LOCUS_46420 5650453 5651946 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 protein_id gnl|my_center|LOCUS_46420 5652002 5653336 gene locus_tag LOCUS_46430 5652002 5653336 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_46430 5653365 5653871 gene locus_tag LOCUS_46440 gene crtO 5653365 5653871 CDS product glycosyl-4,4'-diaponeurosporenoate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001805835.1 protein_id gnl|my_center|LOCUS_46440 5653868 5655394 gene locus_tag LOCUS_46450 gene crtI 5653868 5655394 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102097.1 protein_id gnl|my_center|LOCUS_46450 5655411 5656526 gene locus_tag LOCUS_46460 gene crtQ 5655411 5656526 CDS product 4,4'-diaponeurosporenoate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871744.1 protein_id gnl|my_center|LOCUS_46460 5656589 5657470 gene locus_tag LOCUS_46470 5656589 5657470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 5658409 5657516 gene locus_tag LOCUS_46480 gene mneS 5658409 5657516 CDS product manganese transporter MneS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233995.1 protein_id gnl|my_center|LOCUS_46480 5659282 5658629 gene locus_tag LOCUS_46490 5659282 5658629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 5661179 5659398 gene locus_tag LOCUS_46500 5661179 5659398 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_46500 5662787 5661198 gene locus_tag LOCUS_46510 5662787 5661198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46510 5663179 5663976 gene locus_tag LOCUS_46520 5663179 5663976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46520 5664957 5664055 gene locus_tag LOCUS_46530 5664957 5664055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46530 5665701 5665066 gene locus_tag LOCUS_46540 gene xynA 5665701 5665066 CDS product endo-1,4-beta-xylanase XynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231377.1 protein_id gnl|my_center|LOCUS_46540 5666180 5667226 gene locus_tag LOCUS_46550 5666180 5667226 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_46550 5668184 5667939 gene locus_tag LOCUS_46560 5668184 5667939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 5668916 5668293 gene locus_tag LOCUS_46570 5668916 5668293 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_46570 5669064 5670299 gene locus_tag LOCUS_46580 5669064 5670299 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817233.1 protein_id gnl|my_center|LOCUS_46580 5670350 5670727 gene locus_tag LOCUS_46590 5670350 5670727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46590 5670914 5672368 gene locus_tag LOCUS_46600 5670914 5672368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 5672567 5674669 gene locus_tag LOCUS_46610 5672567 5674669 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137396889.1 protein_id gnl|my_center|LOCUS_46610 5675304 5674948 gene locus_tag LOCUS_46620 5675304 5674948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 5675626 5675414 gene locus_tag LOCUS_46630 5675626 5675414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46630 5676555 5676025 gene locus_tag LOCUS_46640 5676555 5676025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 5677002 5677433 gene locus_tag LOCUS_46650 5677002 5677433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46650 5681645 5677536 gene locus_tag LOCUS_46660 5681645 5677536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46660 5684927 5681796 gene locus_tag LOCUS_46670 5684927 5681796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 5685542 5684991 gene locus_tag LOCUS_46680 5685542 5684991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 5686567 5685710 gene locus_tag LOCUS_46690 5686567 5685710 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_46690 5687675 5686605 gene locus_tag LOCUS_46700 5687675 5686605 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_46700 5688874 5687672 gene locus_tag LOCUS_46710 5688874 5687672 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038499.1 protein_id gnl|my_center|LOCUS_46710 5689989 5688892 gene locus_tag LOCUS_46720 5689989 5688892 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086741.1 protein_id gnl|my_center|LOCUS_46720 5690453 5689986 gene locus_tag LOCUS_46730 5690453 5689986 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033059696.1 protein_id gnl|my_center|LOCUS_46730 5690560 5690787 gene locus_tag LOCUS_46740 5690560 5690787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 5691155 5690964 gene locus_tag LOCUS_46750 5691155 5690964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 5692574 5691195 gene locus_tag LOCUS_46760 5692574 5691195 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929927.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46760 5694379 5692694 gene locus_tag LOCUS_46770 5694379 5692694 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804913.1 protein_id gnl|my_center|LOCUS_46770 5695296 5694397 gene locus_tag LOCUS_46780 5695296 5694397 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_46780 5696274 5695309 gene locus_tag LOCUS_46790 5696274 5695309 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_46790 5699283 5696923 gene locus_tag LOCUS_46800 5699283 5696923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 5699773 5699507 gene locus_tag LOCUS_46810 5699773 5699507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46810 5702494 5699891 gene locus_tag LOCUS_46820 5702494 5699891 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_46820 5704201 5702549 gene locus_tag LOCUS_46830 5704201 5702549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46830 5705927 5704209 gene locus_tag LOCUS_46840 gene yesM 5705927 5704209 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_46840 5707765 5706026 gene locus_tag LOCUS_46850 5707765 5706026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 5708042 5708953 gene locus_tag LOCUS_46860 5708042 5708953 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_46860 5708975 5709853 gene locus_tag LOCUS_46870 5708975 5709853 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_46870 5710665 5710456 gene locus_tag LOCUS_46880 5710665 5710456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46880 5713340 5710749 gene locus_tag LOCUS_46890 5713340 5710749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46890 5718435 5713408 gene locus_tag LOCUS_46900 5718435 5713408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 5719619 5718645 gene locus_tag LOCUS_46910 gene namA 5719619 5718645 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966504.1 protein_id gnl|my_center|LOCUS_46910 5719767 5720210 gene locus_tag LOCUS_46920 5719767 5720210 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178565.1 protein_id gnl|my_center|LOCUS_46920 5721541 5720201 gene locus_tag LOCUS_46930 5721541 5720201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46930 5723623 5721740 gene locus_tag LOCUS_46940 5723623 5721740 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_46940 5723880 5725337 gene locus_tag LOCUS_46950 5723880 5725337 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_46950 5726168 5725611 gene locus_tag LOCUS_46960 5726168 5725611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46960 5726620 5726201 gene locus_tag LOCUS_46970 5726620 5726201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46970 5726757 5727494 gene locus_tag LOCUS_46980 5726757 5727494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46980 5727589 5728572 gene locus_tag LOCUS_46990 5727589 5728572 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252564.1 protein_id gnl|my_center|LOCUS_46990 5728769 5728644 gene locus_tag LOCUS_47000 5728769 5728644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 5729938 5728925 gene locus_tag LOCUS_47010 5729938 5728925 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898152.1 protein_id gnl|my_center|LOCUS_47010 5730053 5730943 gene locus_tag LOCUS_47020 5730053 5730943 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403856.1 protein_id gnl|my_center|LOCUS_47020 5733024 5731078 gene locus_tag LOCUS_47030 5733024 5731078 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903359.1 protein_id gnl|my_center|LOCUS_47030 5733424 5733849 gene locus_tag LOCUS_47040 5733424 5733849 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_47040 5734602 5735018 gene locus_tag LOCUS_47050 5734602 5735018 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809248.1 protein_id gnl|my_center|LOCUS_47050 5735678 5735244 gene locus_tag LOCUS_47060 5735678 5735244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 5736544 5735678 gene locus_tag LOCUS_47070 5736544 5735678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 5737424 5736576 gene locus_tag LOCUS_47080 5737424 5736576 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963984.1 protein_id gnl|my_center|LOCUS_47080 5739693 5737417 gene locus_tag LOCUS_47090 5739693 5737417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 5741119 5740010 gene locus_tag LOCUS_47100 5741119 5740010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 5742967 5741195 gene locus_tag LOCUS_47110 5742967 5741195 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088947.1 protein_id gnl|my_center|LOCUS_47110 5743365 5743790 gene locus_tag LOCUS_47120 5743365 5743790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 5744279 5743860 gene locus_tag LOCUS_47130 5744279 5743860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 5744854 5744429 gene locus_tag LOCUS_47140 5744854 5744429 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_47140 5745886 5744930 gene locus_tag LOCUS_47150 5745886 5744930 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974078.1 protein_id gnl|my_center|LOCUS_47150 5746565 5746242 gene locus_tag LOCUS_47160 5746565 5746242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 5747196 5746759 gene locus_tag LOCUS_47170 5747196 5746759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47170 5747413 5747222 gene locus_tag LOCUS_47180 5747413 5747222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 5748817 5747558 gene locus_tag LOCUS_47190 5748817 5747558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47190 5753057 5748882 gene locus_tag LOCUS_47200 5753057 5748882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47200 5753726 5753205 gene locus_tag LOCUS_47210 5753726 5753205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 5754250 5753723 gene locus_tag LOCUS_47220 5754250 5753723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185130035.1 protein_id gnl|my_center|LOCUS_47220 5754621 5754322 gene locus_tag LOCUS_47230 5754621 5754322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47230 5754834 5754646 gene locus_tag LOCUS_47240 5754834 5754646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 5755000 5755251 gene locus_tag LOCUS_47250 5755000 5755251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47250 5757354 5755336 gene locus_tag LOCUS_47260 5757354 5755336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074238.1 protein_id gnl|my_center|LOCUS_47260 5758488 5757754 gene locus_tag LOCUS_47270 5758488 5757754 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_47270 5759303 5758590 gene locus_tag LOCUS_47280 5759303 5758590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47280 5761931 5759487 gene locus_tag LOCUS_47290 5761931 5759487 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966109.1 protein_id gnl|my_center|LOCUS_47290 5762241 5761915 gene locus_tag LOCUS_47300 5762241 5761915 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143661.1 protein_id gnl|my_center|LOCUS_47300 5763866 5762508 gene locus_tag LOCUS_47310 5763866 5762508 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_47310 5764130 5765386 gene locus_tag LOCUS_47320 5764130 5765386 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_47320 5765415 5767451 gene locus_tag LOCUS_47330 5765415 5767451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 5767455 5768132 gene locus_tag LOCUS_47340 5767455 5768132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47340 5768138 5769091 gene locus_tag LOCUS_47350 5768138 5769091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47350 5771145 5769265 gene locus_tag LOCUS_47360 5771145 5769265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47360 5771489 5771157 gene locus_tag LOCUS_47370 5771489 5771157 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_47370 5773363 5772869 gene locus_tag LOCUS_47380 5773363 5772869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47380 5774174 5773626 gene locus_tag LOCUS_47390 5774174 5773626 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438330.1 protein_id gnl|my_center|LOCUS_47390 5775326 5774298 gene locus_tag LOCUS_47400 5775326 5774298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47400 5775982 5775350 gene locus_tag LOCUS_47410 5775982 5775350 CDS product DUF2185 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089860.1 protein_id gnl|my_center|LOCUS_47410 5776240 5777424 gene locus_tag LOCUS_47420 5776240 5777424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47420 5777475 5777609 gene locus_tag LOCUS_47430 5777475 5777609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47430 5777615 5777881 gene locus_tag LOCUS_47440 5777615 5777881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47440 5778038 5778637 gene locus_tag LOCUS_47450 5778038 5778637 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226530.1 protein_id gnl|my_center|LOCUS_47450 5778669 5779502 gene locus_tag LOCUS_47460 5778669 5779502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 5779524 5780180 gene locus_tag LOCUS_47470 5779524 5780180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776712.1 protein_id gnl|my_center|LOCUS_47470 5780509 5781072 gene locus_tag LOCUS_47480 5780509 5781072 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975987.1 protein_id gnl|my_center|LOCUS_47480 5781878 5781153 gene locus_tag LOCUS_47490 5781878 5781153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 5782040 5782810 gene locus_tag LOCUS_47500 5782040 5782810 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966636.1 protein_id gnl|my_center|LOCUS_47500 5782822 5783553 gene locus_tag LOCUS_47510 5782822 5783553 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655263.1 protein_id gnl|my_center|LOCUS_47510 5783576 5784040 gene locus_tag LOCUS_47520 5783576 5784040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47520 5784141 5784944 gene locus_tag LOCUS_47530 5784141 5784944 CDS product chromosome condensation regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000385090.1 protein_id gnl|my_center|LOCUS_47530 5784904 5785095 gene locus_tag LOCUS_47540 5784904 5785095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47540 5785206 5785664 gene locus_tag LOCUS_47550 5785206 5785664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130055558.1 protein_id gnl|my_center|LOCUS_47550 5785774 5786370 gene locus_tag LOCUS_47560 5785774 5786370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 5786447 5786812 gene locus_tag LOCUS_47570 5786447 5786812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432674.1 protein_id gnl|my_center|LOCUS_47570 5787361 5789037 gene locus_tag LOCUS_47580 5787361 5789037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47580 5789162 5789344 gene locus_tag LOCUS_47590 5789162 5789344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47590 5789472 5789996 gene locus_tag LOCUS_47600 5789472 5789996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126295251.1 protein_id gnl|my_center|LOCUS_47600 5792251 5790260 gene locus_tag LOCUS_47610 5792251 5790260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 5793859 5792267 gene locus_tag LOCUS_47620 5793859 5792267 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_47620 5795032 5793902 gene locus_tag LOCUS_47630 5795032 5793902 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107571.1 protein_id gnl|my_center|LOCUS_47630 5796094 5795039 gene locus_tag LOCUS_47640 5796094 5795039 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_47640 5797061 5796171 gene locus_tag LOCUS_47650 5797061 5796171 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_47650 5797142 5798011 gene locus_tag LOCUS_47660 5797142 5798011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 5799477 5798008 gene locus_tag LOCUS_47670 5799477 5798008 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_47670 5801275 5799494 gene locus_tag LOCUS_47680 5801275 5799494 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640593.1 protein_id gnl|my_center|LOCUS_47680 5801464 5803746 gene locus_tag LOCUS_47690 5801464 5803746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 5804144 5805100 gene locus_tag LOCUS_47700 5804144 5805100 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_47700 5805113 5805997 gene locus_tag LOCUS_47710 5805113 5805997 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027800.1 protein_id gnl|my_center|LOCUS_47710 5806167 5807741 gene locus_tag LOCUS_47720 5806167 5807741 CDS product DUF3502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161603547.1 protein_id gnl|my_center|LOCUS_47720 5810349 5808130 gene locus_tag LOCUS_47730 5810349 5808130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 5810527 5811423 gene locus_tag LOCUS_47740 5810527 5811423 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966961.1 protein_id gnl|my_center|LOCUS_47740 5813848 5811482 gene locus_tag LOCUS_47750 5813848 5811482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 5816041 5813864 gene locus_tag LOCUS_47760 5816041 5813864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 5816923 5816087 gene locus_tag LOCUS_47770 5816923 5816087 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_47770 5817830 5816940 gene locus_tag LOCUS_47780 5817830 5816940 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_47780 5819263 5817890 gene locus_tag LOCUS_47790 5819263 5817890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47790 5822118 5819806 gene locus_tag LOCUS_47800 5822118 5819806 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_47800 5822908 5822342 gene locus_tag LOCUS_47810 5822908 5822342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47810 5823359 5823153 gene locus_tag LOCUS_47820 5823359 5823153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 5824447 5823497 gene locus_tag LOCUS_47830 5824447 5823497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47830 5824854 5824603 gene locus_tag LOCUS_47840 5824854 5824603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47840 5825217 5824981 gene locus_tag LOCUS_47850 5825217 5824981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47850 5827271 5825367 gene locus_tag LOCUS_47860 5827271 5825367 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094944.1 protein_id gnl|my_center|LOCUS_47860 5828201 5827332 gene locus_tag LOCUS_47870 5828201 5827332 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_47870 5829124 5828198 gene locus_tag LOCUS_47880 5829124 5828198 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434865.1 protein_id gnl|my_center|LOCUS_47880 5830615 5829197 gene locus_tag LOCUS_47890 5830615 5829197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 5830939 5831829 gene locus_tag LOCUS_47900 5830939 5831829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 5831870 5832044 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggccatgtaacgctgtacagcg 5832457 5832188 gene locus_tag LOCUS_47910 5832457 5832188 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699599.1 protein_id gnl|my_center|LOCUS_47910 5832866 5832540 gene locus_tag LOCUS_47920 5832866 5832540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 5833184 5832906 gene locus_tag LOCUS_47930 gene rpsN 5833184 5832906 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233455.1 protein_id gnl|my_center|LOCUS_47930 5834125 5833232 gene locus_tag LOCUS_47940 5834125 5833232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 5834295 5834146 gene locus_tag LOCUS_47950 gene rpmG 5834295 5834146 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265708.1 protein_id gnl|my_center|LOCUS_47950 5835617 5834409 gene locus_tag LOCUS_47960 5835617 5834409 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742949.1 protein_id gnl|my_center|LOCUS_47960 5836175 5835696 gene locus_tag LOCUS_47970 5836175 5835696 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254439.1 protein_id gnl|my_center|LOCUS_47970 5836706 5836440 gene locus_tag LOCUS_47980 5836706 5836440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47980 5838701 5837772 gene locus_tag LOCUS_47990 5838701 5837772 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_47990 5838795 5839277 gene locus_tag LOCUS_48000 5838795 5839277 CDS product effector binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836639.1 protein_id gnl|my_center|LOCUS_48000 5840746 5839343 gene locus_tag LOCUS_48010 5840746 5839343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 5841130 5840756 gene locus_tag LOCUS_48020 5841130 5840756 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723032.1 protein_id gnl|my_center|LOCUS_48020 5841793 5841317 gene locus_tag LOCUS_48030 5841793 5841317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48030 5842064 5842327 gene locus_tag LOCUS_48040 5842064 5842327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 5842344 5843147 gene locus_tag LOCUS_48050 5842344 5843147 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063245668.1 protein_id gnl|my_center|LOCUS_48050 5843202 5843855 gene locus_tag LOCUS_48060 5843202 5843855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48060 5844349 5843918 gene locus_tag LOCUS_48070 5844349 5843918 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528798.1 protein_id gnl|my_center|LOCUS_48070 5844797 5844402 gene locus_tag LOCUS_48080 5844797 5844402 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_48080 5845754 5844960 gene locus_tag LOCUS_48090 5845754 5844960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229423.1 protein_id gnl|my_center|LOCUS_48090 5847115 5846738 gene locus_tag LOCUS_48100 5847115 5846738 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_48100 5848031 5847198 gene locus_tag LOCUS_48110 5848031 5847198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48110 5848150 5849283 gene locus_tag LOCUS_48120 5848150 5849283 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_48120 5853656 5849382 gene locus_tag LOCUS_48130 5853656 5849382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48130 5856989 5853921 gene locus_tag LOCUS_48140 5856989 5853921 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_48140 5858140 5856986 gene locus_tag LOCUS_48150 5858140 5856986 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459132.1 protein_id gnl|my_center|LOCUS_48150 5858810 5858331 gene locus_tag LOCUS_48160 5858810 5858331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 5859487 5858807 gene locus_tag LOCUS_48170 5859487 5858807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 5859912 5859502 gene locus_tag LOCUS_48180 5859912 5859502 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384928.1 protein_id gnl|my_center|LOCUS_48180 5859997 5860698 gene locus_tag LOCUS_48190 gene yjjG 5859997 5860698 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263181.1 protein_id gnl|my_center|LOCUS_48190 5860673 5860939 gene locus_tag LOCUS_48200 5860673 5860939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48200 5861769 5860975 gene locus_tag LOCUS_48210 5861769 5860975 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_48210 5866939 5862155 gene locus_tag LOCUS_48220 5866939 5862155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48220 5869080 5866972 gene locus_tag LOCUS_48230 5869080 5866972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48230 5870184 5869099 gene locus_tag LOCUS_48240 5870184 5869099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 5871098 5870274 gene locus_tag LOCUS_48250 5871098 5870274 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_48250 5871976 5871098 gene locus_tag LOCUS_48260 5871976 5871098 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_48260 5873472 5872075 gene locus_tag LOCUS_48270 5873472 5872075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48270 5875127 5873574 gene locus_tag LOCUS_48280 5875127 5873574 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_48280 5876857 5875124 gene locus_tag LOCUS_48290 5876857 5875124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48290 5877974 5877042 gene locus_tag LOCUS_48300 5877974 5877042 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_48300 5878558 5878052 gene locus_tag LOCUS_48310 gene pchR 5878558 5878052 CDS product pulcherriminic acid biosynthesis transcriptional regulator PchR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228073.1 protein_id gnl|my_center|LOCUS_48310 5878714 5879814 gene locus_tag LOCUS_48320 5878714 5879814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 5880961 5879888 gene locus_tag LOCUS_48330 5880961 5879888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48330 5881090 5881938 gene locus_tag LOCUS_48340 5881090 5881938 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_48340 5882155 5881949 gene locus_tag LOCUS_48350 5882155 5881949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48350 5882512 5882321 gene locus_tag LOCUS_48360 5882512 5882321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 5883903 5882662 gene locus_tag LOCUS_48370 5883903 5882662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48370 5884414 5884094 gene locus_tag LOCUS_48380 5884414 5884094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48380 5885824 5884940 gene locus_tag LOCUS_48390 5885824 5884940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48390 5886913 5885858 gene locus_tag LOCUS_48400 5886913 5885858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48400 5887653 5886910 gene locus_tag LOCUS_48410 5887653 5886910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 5888811 5887744 gene locus_tag LOCUS_48420 5888811 5887744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48420 5889488 5888808 gene locus_tag LOCUS_48430 5889488 5888808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48430 5890333 5889485 gene locus_tag LOCUS_48440 5890333 5889485 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039135.1 protein_id gnl|my_center|LOCUS_48440 5891279 5890320 gene locus_tag LOCUS_48450 5891279 5890320 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803726.1 protein_id gnl|my_center|LOCUS_48450 5893434 5891443 gene locus_tag LOCUS_48460 5893434 5891443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031474.1 protein_id gnl|my_center|LOCUS_48460 5894379 5893507 gene locus_tag LOCUS_48470 5894379 5893507 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_48470 5895301 5894393 gene locus_tag LOCUS_48480 5895301 5894393 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_48480 5901322 5895308 gene locus_tag LOCUS_48490 5901322 5895308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 5903002 5901404 gene locus_tag LOCUS_48500 5903002 5901404 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_48500 5905468 5903183 gene locus_tag LOCUS_48510 5905468 5903183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48510 5906321 5905743 gene locus_tag LOCUS_48520 5906321 5905743 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568299.1 protein_id gnl|my_center|LOCUS_48520 5906815 5906348 gene locus_tag LOCUS_48530 5906815 5906348 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966950.1 protein_id gnl|my_center|LOCUS_48530 5906905 5907816 gene locus_tag LOCUS_48540 5906905 5907816 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989441.1 protein_id gnl|my_center|LOCUS_48540 5908895 5907861 gene locus_tag LOCUS_48550 5908895 5907861 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 protein_id gnl|my_center|LOCUS_48550 5908954 5909157 gene locus_tag LOCUS_48560 5908954 5909157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 5909928 5909338 gene locus_tag LOCUS_48570 5909928 5909338 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073543581.1 protein_id gnl|my_center|LOCUS_48570 5910352 5909960 gene locus_tag LOCUS_48580 gene hxlR 5910352 5909960 CDS product transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246265.1 protein_id gnl|my_center|LOCUS_48580 5911046 5910489 gene locus_tag LOCUS_48590 gene hxlB 5911046 5910489 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_48590 5911683 5911051 gene locus_tag LOCUS_48600 gene hxlA 5911683 5911051 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246452.1 protein_id gnl|my_center|LOCUS_48600 5915601 5912518 gene locus_tag LOCUS_48610 5915601 5912518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 5918195 5915613 gene locus_tag LOCUS_48620 5918195 5915613 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_48620 5920973 5918199 gene locus_tag LOCUS_48630 5920973 5918199 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256996.1 protein_id gnl|my_center|LOCUS_48630 5922550 5920997 gene locus_tag LOCUS_48640 5922550 5920997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48640 5923604 5922660 gene locus_tag LOCUS_48650 5923604 5922660 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_48650 5924488 5923598 gene locus_tag LOCUS_48660 gene rmgP 5924488 5923598 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_48660 5924734 5925786 gene locus_tag LOCUS_48670 5924734 5925786 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_48670 5931117 5925856 gene locus_tag LOCUS_48680 5931117 5925856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48680 5932063 5931719 gene locus_tag LOCUS_48690 5932063 5931719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48690 5932662 5932252 gene locus_tag LOCUS_48700 5932662 5932252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48700 5933979 5932843 gene locus_tag LOCUS_48710 5933979 5932843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48710 5934736 5933996 gene locus_tag LOCUS_48720 5934736 5933996 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_48720 5935493 5934738 gene locus_tag LOCUS_48730 5935493 5934738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 5935698 5936462 gene locus_tag LOCUS_48740 5935698 5936462 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083899.1 protein_id gnl|my_center|LOCUS_48740 5936481 5937455 gene locus_tag LOCUS_48750 5936481 5937455 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876792.1 protein_id gnl|my_center|LOCUS_48750 5937610 5937452 gene locus_tag LOCUS_48760 5937610 5937452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 5938524 5937604 gene locus_tag LOCUS_48770 5938524 5937604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48770 5938654 5939769 gene locus_tag LOCUS_48780 5938654 5939769 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972774.1 protein_id gnl|my_center|LOCUS_48780 5940240 5940091 gene locus_tag LOCUS_48790 5940240 5940091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48790 5940504 5940262 gene locus_tag LOCUS_48800 5940504 5940262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 5940677 5941171 gene locus_tag LOCUS_48810 5940677 5941171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803992.1 protein_id gnl|my_center|LOCUS_48810 5941210 5942001 gene locus_tag LOCUS_48820 5941210 5942001 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548923.1 protein_id gnl|my_center|LOCUS_48820 5942776 5942132 gene locus_tag LOCUS_48830 5942776 5942132 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_48830 5943499 5942807 gene locus_tag LOCUS_48840 5943499 5942807 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405201.1 protein_id gnl|my_center|LOCUS_48840 5943782 5943516 gene locus_tag LOCUS_48850 5943782 5943516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 5943966 5944679 gene locus_tag LOCUS_48860 5943966 5944679 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_48860 5944676 5945710 gene locus_tag LOCUS_48870 5944676 5945710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48870 5946700 5945921 gene locus_tag LOCUS_48880 5946700 5945921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48880 5946930 5947547 gene locus_tag LOCUS_48890 5946930 5947547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48890 5947670 5948713 gene locus_tag LOCUS_48900 5947670 5948713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48900 5949094 5948897 gene locus_tag LOCUS_48910 5949094 5948897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48910 5949477 5949136 gene locus_tag LOCUS_48920 gene mazF 5949477 5949136 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_48920 5949701 5949471 gene locus_tag LOCUS_48930 5949701 5949471 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392534.1 protein_id gnl|my_center|LOCUS_48930 5949837 5950016 gene locus_tag LOCUS_48940 5949837 5950016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48940 5950420 5950127 gene locus_tag LOCUS_48950 5950420 5950127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 5951634 5950951 gene locus_tag LOCUS_48960 5951634 5950951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 5952359 5951871 gene locus_tag LOCUS_48970 5952359 5951871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839539.1 protein_id gnl|my_center|LOCUS_48970 5953627 5952362 gene locus_tag LOCUS_48980 5953627 5952362 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404780.1 protein_id gnl|my_center|LOCUS_48980 5953919 5955697 gene locus_tag LOCUS_48990 5953919 5955697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 5956165 5955764 gene locus_tag LOCUS_49000 5956165 5955764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49000 5956460 5958538 gene locus_tag LOCUS_49010 5956460 5958538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49010 5958543 5959250 gene locus_tag LOCUS_49020 5958543 5959250 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459873.1 protein_id gnl|my_center|LOCUS_49020 5959716 5959300 gene locus_tag LOCUS_49030 5959716 5959300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49030 5959922 5959713 gene locus_tag LOCUS_49040 5959922 5959713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49040 5960242 5960502 gene locus_tag LOCUS_49050 5960242 5960502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 5960502 5963570 gene locus_tag LOCUS_49060 5960502 5963570 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_49060 5964778 5963633 gene locus_tag LOCUS_49070 5964778 5963633 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 protein_id gnl|my_center|LOCUS_49070 5965013 5968423 gene locus_tag LOCUS_49080 5965013 5968423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 5969391 5968504 gene locus_tag LOCUS_49090 5969391 5968504 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268504.1 protein_id gnl|my_center|LOCUS_49090 5969609 5970364 gene locus_tag LOCUS_49100 5969609 5970364 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_49100 5971201 5970437 gene locus_tag LOCUS_49110 5971201 5970437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49110 5971962 5971198 gene locus_tag LOCUS_49120 5971962 5971198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49120 5972666 5971959 gene locus_tag LOCUS_49130 5972666 5971959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 5973711 5972746 gene locus_tag LOCUS_49140 5973711 5972746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 5974421 5973741 gene locus_tag LOCUS_49150 gene ykoG 5974421 5973741 CDS product two-component system response regulator YkoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232551.1 protein_id gnl|my_center|LOCUS_49150 5975064 5974831 gene locus_tag LOCUS_49160 5975064 5974831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49160 5975658 5975089 gene locus_tag LOCUS_49170 5975658 5975089 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094667284.1 protein_id gnl|my_center|LOCUS_49170 5975808 5976737 gene locus_tag LOCUS_49180 5975808 5976737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 5977459 5976872 gene locus_tag LOCUS_49190 5977459 5976872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 5978458 5977469 gene locus_tag LOCUS_49200 5978458 5977469 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 protein_id gnl|my_center|LOCUS_49200 5978651 5979166 gene locus_tag LOCUS_49210 5978651 5979166 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287818.1 protein_id gnl|my_center|LOCUS_49210 5980359 5979607 gene locus_tag LOCUS_49220 5980359 5979607 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051633.1 protein_id gnl|my_center|LOCUS_49220 5981183 5981806 gene locus_tag LOCUS_49230 5981183 5981806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 5985876 5981974 gene locus_tag LOCUS_49240 5985876 5981974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 5986009 5985815 gene locus_tag LOCUS_49250 5986009 5985815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49250 5986545 5986246 gene locus_tag LOCUS_49260 5986545 5986246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 5987216 5986584 gene locus_tag LOCUS_49270 5987216 5986584 CDS product DUF3885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181592.1 protein_id gnl|my_center|LOCUS_49270 5987499 5987203 gene locus_tag LOCUS_49280 5987499 5987203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 5987711 5987523 gene locus_tag LOCUS_49290 5987711 5987523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 5987878 5988222 gene locus_tag LOCUS_49300 5987878 5988222 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279278.1 protein_id gnl|my_center|LOCUS_49300 5989305 5988550 gene locus_tag LOCUS_49310 5989305 5988550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49310 5989596 5989823 gene locus_tag LOCUS_49320 5989596 5989823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 5989985 5990590 gene locus_tag LOCUS_49330 5989985 5990590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 5990610 5991053 gene locus_tag LOCUS_49340 5990610 5991053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 5991041 5991601 gene locus_tag LOCUS_49350 5991041 5991601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 5991594 5991884 gene locus_tag LOCUS_49360 5991594 5991884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 5992015 5993373 gene locus_tag LOCUS_49370 5992015 5993373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 5993400 5995100 gene locus_tag LOCUS_49380 5993400 5995100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49380 5996134 5995544 gene locus_tag LOCUS_49390 5996134 5995544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49390 5996303 5996127 gene locus_tag LOCUS_49400 5996303 5996127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 5998037 5996418 gene locus_tag LOCUS_49410 gene rlmD 5998037 5996418 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_49410 5999058 5998144 gene locus_tag LOCUS_49420 5999058 5998144 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_49420 6000800 5999709 gene locus_tag LOCUS_49430 6000800 5999709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 6002293 6000917 gene locus_tag LOCUS_49440 6002293 6000917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 6005835 6002491 gene locus_tag LOCUS_49450 6005835 6002491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49450 6005970 6008300 gene locus_tag LOCUS_49460 6005970 6008300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49460 6010304 6008703 gene locus_tag LOCUS_49470 6010304 6008703 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_49470 6011346 6010426 gene locus_tag LOCUS_49480 6011346 6010426 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_49480 6012337 6011363 gene locus_tag LOCUS_49490 6012337 6011363 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_49490 6012686 6013981 gene locus_tag LOCUS_49500 6012686 6013981 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_49500 6016808 6014370 gene locus_tag LOCUS_49510 6016808 6014370 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_49510 6017673 6016852 gene locus_tag LOCUS_49520 6017673 6016852 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_49520 6018544 6017675 gene locus_tag LOCUS_49530 6018544 6017675 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_49530 6020004 6018637 gene locus_tag LOCUS_49540 6020004 6018637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49540 6020220 6022067 gene locus_tag LOCUS_49550 6020220 6022067 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_49550 6022082 6022840 gene locus_tag LOCUS_49560 6022082 6022840 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222616.1 protein_id gnl|my_center|LOCUS_49560 6023973 6022966 gene locus_tag LOCUS_49570 6023973 6022966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 6029854 6024041 gene locus_tag LOCUS_49580 6029854 6024041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49580 6031142 6030321 gene locus_tag LOCUS_49590 6031142 6030321 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256268.1 protein_id gnl|my_center|LOCUS_49590 6032035 6031151 gene locus_tag LOCUS_49600 6032035 6031151 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722208.1 protein_id gnl|my_center|LOCUS_49600 6033491 6032109 gene locus_tag LOCUS_49610 6033491 6032109 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972116.1 protein_id gnl|my_center|LOCUS_49610 6035494 6033890 gene locus_tag LOCUS_49620 6035494 6033890 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_49620 6037350 6035563 gene locus_tag LOCUS_49630 6037350 6035563 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_49630 6039150 6037537 gene locus_tag LOCUS_49640 6039150 6037537 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_49640 6040200 6039271 gene locus_tag LOCUS_49650 6040200 6039271 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_49650 6041243 6040239 gene locus_tag LOCUS_49660 6041243 6040239 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_49660 6042965 6041340 gene locus_tag LOCUS_49670 6042965 6041340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49670 6044857 6043037 gene locus_tag LOCUS_49680 6044857 6043037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 6044793 6044999 gene locus_tag LOCUS_49690 6044793 6044999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49690 6045456 6045115 gene locus_tag LOCUS_49700 6045456 6045115 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_49700 6045745 6046332 gene locus_tag LOCUS_49710 6045745 6046332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49710 6051001 6046898 gene locus_tag LOCUS_49720 6051001 6046898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49720 6052302 6051355 gene locus_tag LOCUS_49730 6052302 6051355 CDS product DUF1861 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213840.1 protein_id gnl|my_center|LOCUS_49730 6053400 6052405 gene locus_tag LOCUS_49740 6053400 6052405 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723381.1 protein_id gnl|my_center|LOCUS_49740 6054044 6053430 gene locus_tag LOCUS_49750 6054044 6053430 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231442.1 protein_id gnl|my_center|LOCUS_49750 6055486 6054413 gene locus_tag LOCUS_49760 6055486 6054413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 6056701 6055499 gene locus_tag LOCUS_49770 6056701 6055499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49770 6057231 6056854 gene locus_tag LOCUS_49780 6057231 6056854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 6057405 6058649 gene locus_tag LOCUS_49790 6057405 6058649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49790 6059164 6058730 gene locus_tag LOCUS_49800 6059164 6058730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49800 6060353 6059292 gene locus_tag LOCUS_49810 6060353 6059292 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005089629.1 protein_id gnl|my_center|LOCUS_49810 6060717 6061565 gene locus_tag LOCUS_49820 6060717 6061565 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039292.1 protein_id gnl|my_center|LOCUS_49820 6065865 6061690 gene locus_tag LOCUS_49830 6065865 6061690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49830 6066322 6066131 gene locus_tag LOCUS_49840 6066322 6066131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49840 6066603 6066364 gene locus_tag LOCUS_49850 6066603 6066364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49850 6068026 6066704 gene locus_tag LOCUS_49860 6068026 6066704 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819149.1 protein_id gnl|my_center|LOCUS_49860 6069133 6068156 gene locus_tag LOCUS_49870 6069133 6068156 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_49870 6069284 6069919 gene locus_tag LOCUS_49880 6069284 6069919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 6070871 6069945 gene locus_tag LOCUS_49890 6070871 6069945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 6071762 6070938 gene locus_tag LOCUS_49900 6071762 6070938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49900 6071882 6075034 gene locus_tag LOCUS_49910 6071882 6075034 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_49910 6075251 6075021 gene locus_tag LOCUS_49920 6075251 6075021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49920 6075670 6075530 gene locus_tag LOCUS_49930 6075670 6075530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 6076859 6075738 gene locus_tag LOCUS_49940 6076859 6075738 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027505.1 protein_id gnl|my_center|LOCUS_49940 6077027 6078133 gene locus_tag LOCUS_49950 6077027 6078133 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948092.1 protein_id gnl|my_center|LOCUS_49950 6078136 6078900 gene locus_tag LOCUS_49960 6078136 6078900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948093.1 protein_id gnl|my_center|LOCUS_49960 6080618 6079425 gene locus_tag LOCUS_49970 6080618 6079425 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974865.1 protein_id gnl|my_center|LOCUS_49970 6081614 6080655 gene locus_tag LOCUS_49980 6081614 6080655 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929960.1 protein_id gnl|my_center|LOCUS_49980 6082020 6081673 gene locus_tag LOCUS_49990 6082020 6081673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49990 6083729 6082020 gene locus_tag LOCUS_50000 6083729 6082020 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_50000 6084530 6083769 gene locus_tag LOCUS_50010 gene pxpA 6084530 6083769 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_50010 6086175 6084751 gene locus_tag LOCUS_50020 6086175 6084751 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_50020 6087255 6086194 gene locus_tag LOCUS_50030 6087255 6086194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50030 6088176 6087379 gene locus_tag LOCUS_50040 6088176 6087379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222208.1 protein_id gnl|my_center|LOCUS_50040 6088967 6088176 gene locus_tag LOCUS_50050 6088967 6088176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199877.1 protein_id gnl|my_center|LOCUS_50050 6090000 6088972 gene locus_tag LOCUS_50060 gene pxpC 6090000 6088972 CDS product 5-oxoprolinase subunit PxpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234419.1 protein_id gnl|my_center|LOCUS_50060 6090818 6089997 gene locus_tag LOCUS_50070 gene pxpB 6090818 6089997 CDS product 5-oxoprolinase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234420.1 protein_id gnl|my_center|LOCUS_50070 6090954 6091841 gene locus_tag LOCUS_50080 6090954 6091841 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246517.1 protein_id gnl|my_center|LOCUS_50080 6093438 6092212 gene locus_tag LOCUS_50090 6093438 6092212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50090 6096888 6093457 gene locus_tag LOCUS_50100 6096888 6093457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50100 6099095 6096885 gene locus_tag LOCUS_50110 6099095 6096885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50110 6099948 6099133 gene locus_tag LOCUS_50120 6099948 6099133 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_50120 6100838 6099960 gene locus_tag LOCUS_50130 6100838 6099960 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260027.1 protein_id gnl|my_center|LOCUS_50130 6102554 6100926 gene locus_tag LOCUS_50140 6102554 6100926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50140 6102926 6104002 gene locus_tag LOCUS_50150 6102926 6104002 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_50150 6106640 6104160 gene locus_tag LOCUS_50160 6106640 6104160 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003185.1 protein_id gnl|my_center|LOCUS_50160 6107098 6106739 gene locus_tag LOCUS_50170 6107098 6106739 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_50170 6108634 6107600 gene locus_tag LOCUS_50180 6108634 6107600 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119158.1 protein_id gnl|my_center|LOCUS_50180 6108815 6111376 gene locus_tag LOCUS_50190 6108815 6111376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50190 6112748 6111450 gene locus_tag LOCUS_50200 gene melA 6112748 6111450 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_50200 6112886 6113740 gene locus_tag LOCUS_50210 6112886 6113740 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729459.1 protein_id gnl|my_center|LOCUS_50210 6115853 6114285 gene locus_tag LOCUS_50220 6115853 6114285 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583551.1 protein_id gnl|my_center|LOCUS_50220 6116664 6116984 gene locus_tag LOCUS_50230 6116664 6116984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50230 6117178 6116963 gene locus_tag LOCUS_50240 6117178 6116963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50240 6117128 6117916 gene locus_tag LOCUS_50250 6117128 6117916 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_50250 6119753 6118209 gene locus_tag LOCUS_50260 6119753 6118209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 6120942 6119935 gene locus_tag LOCUS_50270 gene galM 6120942 6119935 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_50270 6121963 6120947 gene locus_tag LOCUS_50280 6121963 6120947 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033831.1 protein_id gnl|my_center|LOCUS_50280 6122851 6122015 gene locus_tag LOCUS_50290 6122851 6122015 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533026.1 protein_id gnl|my_center|LOCUS_50290 6123825 6122848 gene locus_tag LOCUS_50300 6123825 6122848 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974398.1 protein_id gnl|my_center|LOCUS_50300 6125268 6123886 gene locus_tag LOCUS_50310 6125268 6123886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50310 6125365 6125222 gene locus_tag LOCUS_50320 6125365 6125222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 6127875 6125611 gene locus_tag LOCUS_50330 6127875 6125611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 6129011 6127920 gene locus_tag LOCUS_50340 6129011 6127920 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_50340 6129243 6130325 gene locus_tag LOCUS_50350 6129243 6130325 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_50350 6130572 6130387 gene locus_tag LOCUS_50360 6130572 6130387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50360 6134157 6130762 gene locus_tag LOCUS_50370 6134157 6130762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 6135284 6134526 gene locus_tag LOCUS_50380 6135284 6134526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50380 6136687 6135302 gene locus_tag LOCUS_50390 6136687 6135302 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_50390 6138092 6136704 gene locus_tag LOCUS_50400 6138092 6136704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 6139389 6138076 gene locus_tag LOCUS_50410 6139389 6138076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 6141016 6139742 gene locus_tag LOCUS_50420 6141016 6139742 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242507.1 protein_id gnl|my_center|LOCUS_50420 6141197 6142123 gene locus_tag LOCUS_50430 6141197 6142123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50430 6142385 6144544 gene locus_tag LOCUS_50440 gene amyA 6142385 6144544 CDS product alpha-amylase AmyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922388.1 protein_id gnl|my_center|LOCUS_50440 6146640 6144622 gene locus_tag LOCUS_50450 6146640 6144622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50450 6147172 6146645 gene locus_tag LOCUS_50460 6147172 6146645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 6147694 6147188 gene locus_tag LOCUS_50470 6147694 6147188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50470 6147961 6147791 gene locus_tag LOCUS_50480 6147961 6147791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50480 6150056 6148029 gene locus_tag LOCUS_50490 6150056 6148029 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812357.1 protein_id gnl|my_center|LOCUS_50490 6151851 6150130 gene locus_tag LOCUS_50500 6151851 6150130 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584022.1 protein_id gnl|my_center|LOCUS_50500 6152684 6151848 gene locus_tag LOCUS_50510 6152684 6151848 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_50510 6153991 6152681 gene locus_tag LOCUS_50520 gene malC 6153991 6152681 CDS product maltosaccharide ABC transporter permease MalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194993.1 protein_id gnl|my_center|LOCUS_50520 6155507 6154080 gene locus_tag LOCUS_50530 6155507 6154080 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_50530 6155871 6156899 gene locus_tag LOCUS_50540 gene malR 6155871 6156899 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_50540 6156905 6158872 gene locus_tag LOCUS_50550 6156905 6158872 CDS product glucan 1,4-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065886.1 protein_id gnl|my_center|LOCUS_50550 6160054 6159038 gene locus_tag LOCUS_50560 6160054 6159038 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289537.1 protein_id gnl|my_center|LOCUS_50560 6161102 6160281 gene locus_tag LOCUS_50570 6161102 6160281 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_50570 6161263 6161382 gene locus_tag LOCUS_50580 6161263 6161382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 6162701 6161442 gene locus_tag LOCUS_50590 gene purD 6162701 6161442 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101962.1 protein_id gnl|my_center|LOCUS_50590 6164283 6162724 gene locus_tag LOCUS_50600 gene purH 6164283 6162724 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745444.1 protein_id gnl|my_center|LOCUS_50600 6165168 6164548 gene locus_tag LOCUS_50610 gene purN 6165168 6164548 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_50610 6166211 6165165 gene locus_tag LOCUS_50620 gene purM 6166211 6165165 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_50620 6166358 6166555 gene locus_tag LOCUS_50630 6166358 6166555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 6168577 6166940 gene locus_tag LOCUS_50640 gene purF 6168577 6166940 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879029.1 protein_id gnl|my_center|LOCUS_50640 6170805 6168562 gene locus_tag LOCUS_50650 gene purL 6170805 6168562 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055546.1 protein_id gnl|my_center|LOCUS_50650 6171475 6170783 gene locus_tag LOCUS_50660 gene purQ 6171475 6170783 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243954.1 protein_id gnl|my_center|LOCUS_50660 6171724 6171482 gene locus_tag LOCUS_50670 gene purS 6171724 6171482 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219409.1 protein_id gnl|my_center|LOCUS_50670 6173030 6172107 gene locus_tag LOCUS_50680 6173030 6172107 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_50680 6174358 6173063 gene locus_tag LOCUS_50690 gene purB 6174358 6173063 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733238.1 protein_id gnl|my_center|LOCUS_50690 6175684 6174365 gene locus_tag LOCUS_50700 gene purK 6175684 6174365 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196812.1 protein_id gnl|my_center|LOCUS_50700 6176166 6175681 gene locus_tag LOCUS_50710 gene purE 6176166 6175681 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244134.1 protein_id gnl|my_center|LOCUS_50710 6177346 6176777 gene locus_tag LOCUS_50720 6177346 6176777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50720 6178087 6177572 gene locus_tag LOCUS_50730 6178087 6177572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50730 6180245 6178116 gene locus_tag LOCUS_50740 6180245 6178116 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088156.1 protein_id gnl|my_center|LOCUS_50740 6181614 6180337 gene locus_tag LOCUS_50750 6181614 6180337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 6183158 6181767 gene locus_tag LOCUS_50760 6183158 6181767 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392746.1 protein_id gnl|my_center|LOCUS_50760 6184348 6183569 gene locus_tag LOCUS_50770 6184348 6183569 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881298.1 protein_id gnl|my_center|LOCUS_50770 6185916 6184396 gene locus_tag LOCUS_50780 gene guaA 6185916 6184396 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162837124.1 protein_id gnl|my_center|LOCUS_50780 6190607 6186225 gene locus_tag LOCUS_50790 6190607 6186225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50790 6191221 6190757 gene locus_tag LOCUS_50800 gene bcp 6191221 6190757 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 protein_id gnl|my_center|LOCUS_50800 6193566 6191401 gene locus_tag LOCUS_50810 6193566 6191401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50810 6194665 6193619 gene locus_tag LOCUS_50820 6194665 6193619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50820 6195291 6194662 gene locus_tag LOCUS_50830 gene gmhA 6195291 6194662 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_50830 6195535 6195308 gene locus_tag LOCUS_50840 6195535 6195308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 6195792 6195631 gene locus_tag LOCUS_50850 6195792 6195631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50850 6198368 6195933 gene locus_tag LOCUS_50860 6198368 6195933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50860 6199940 6198369 gene locus_tag LOCUS_50870 6199940 6198369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 6201328 6200069 gene locus_tag LOCUS_50880 6201328 6200069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 6202858 6201497 gene locus_tag LOCUS_50890 6202858 6201497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50890 6203843 6203016 gene locus_tag LOCUS_50900 6203843 6203016 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_50900 6204733 6203858 gene locus_tag LOCUS_50910 6204733 6203858 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083605764.1 protein_id gnl|my_center|LOCUS_50910 6205770 6204754 gene locus_tag LOCUS_50920 6205770 6204754 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_50920 6206652 6208454 gene locus_tag LOCUS_50930 6206652 6208454 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_50930 6210816 6208783 gene locus_tag LOCUS_50940 6210816 6208783 CDS product DUF1923 family maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865200.1 protein_id gnl|my_center|LOCUS_50940 6216193 6210806 gene locus_tag LOCUS_50950 6216193 6210806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 6217565 6216207 gene locus_tag LOCUS_50960 6217565 6216207 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_50960 6218247 6217558 gene locus_tag LOCUS_50970 6218247 6217558 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880245.1 protein_id gnl|my_center|LOCUS_50970 6219422 6218244 gene locus_tag LOCUS_50980 gene malE 6219422 6218244 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583082.1 protein_id gnl|my_center|LOCUS_50980 6221178 6220114 gene locus_tag LOCUS_50990 6221178 6220114 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769283.1 protein_id gnl|my_center|LOCUS_50990 6222974 6221175 gene locus_tag LOCUS_51000 6222974 6221175 CDS product alpha-glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471779.1 protein_id gnl|my_center|LOCUS_51000 6224544 6223486 gene locus_tag LOCUS_51010 6224544 6223486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 6225914 6224541 gene locus_tag LOCUS_51020 6225914 6224541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 6226785 6225952 gene locus_tag LOCUS_51030 gene malD 6226785 6225952 CDS product maltosaccharide ABC transporter permease MalD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022608.1 protein_id gnl|my_center|LOCUS_51030 6228198 6226792 gene locus_tag LOCUS_51040 6228198 6226792 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804062.1 protein_id gnl|my_center|LOCUS_51040 6229505 6228195 gene locus_tag LOCUS_51050 6229505 6228195 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709916.1 protein_id gnl|my_center|LOCUS_51050 6229877 6230542 gene locus_tag LOCUS_51060 6229877 6230542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 6231895 6231092 gene locus_tag LOCUS_51070 6231895 6231092 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965773.1 protein_id gnl|my_center|LOCUS_51070 6232696 6231902 gene locus_tag LOCUS_51080 6232696 6231902 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521524.1 protein_id gnl|my_center|LOCUS_51080 6234006 6232693 gene locus_tag LOCUS_51090 6234006 6232693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51090 6234121 6235134 gene locus_tag LOCUS_51100 6234121 6235134 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582789.1 protein_id gnl|my_center|LOCUS_51100 6235248 6236582 gene locus_tag LOCUS_51110 6235248 6236582 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233535.1 protein_id gnl|my_center|LOCUS_51110 6237108 6236740 gene locus_tag LOCUS_51120 6237108 6236740 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971320.1 protein_id gnl|my_center|LOCUS_51120 6237247 6238143 gene locus_tag LOCUS_51130 6237247 6238143 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_51130 6238140 6238652 gene locus_tag LOCUS_51140 6238140 6238652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51140 6239065 6238739 gene locus_tag LOCUS_51150 6239065 6238739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 6240010 6239174 gene locus_tag LOCUS_51160 6240010 6239174 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_51160 6240966 6240148 gene locus_tag LOCUS_51170 6240966 6240148 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 protein_id gnl|my_center|LOCUS_51170 6242236 6241196 gene locus_tag LOCUS_51180 gene uvsE 6242236 6241196 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961166.1 protein_id gnl|my_center|LOCUS_51180 6243604 6242396 gene locus_tag LOCUS_51190 gene nagA 6243604 6242396 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243413.1 protein_id gnl|my_center|LOCUS_51190 6244748 6243594 gene locus_tag LOCUS_51200 gene glcK 6244748 6243594 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_51200 6245013 6246215 gene locus_tag LOCUS_51210 6245013 6246215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51210 6248453 6246648 gene locus_tag LOCUS_51220 6248453 6246648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51220 6250077 6248446 gene locus_tag LOCUS_51230 6250077 6248446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 6250861 6250379 gene locus_tag LOCUS_51240 6250861 6250379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51240 6252665 6250878 gene locus_tag LOCUS_51250 6252665 6250878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51250 6255223 6252662 gene locus_tag LOCUS_51260 6255223 6252662 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_51260 6256404 6255328 gene locus_tag LOCUS_51270 6256404 6255328 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096071.1 protein_id gnl|my_center|LOCUS_51270 6258652 6256439 gene locus_tag LOCUS_51280 6258652 6256439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 6260251 6258737 gene locus_tag LOCUS_51290 6260251 6258737 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582717.1 protein_id gnl|my_center|LOCUS_51290 6260160 6260546 gene locus_tag LOCUS_51300 6260160 6260546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51300 6261430 6260549 gene locus_tag LOCUS_51310 6261430 6260549 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_51310 6262317 6261472 gene locus_tag LOCUS_51320 6262317 6261472 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_51320 6262628 6262825 gene locus_tag LOCUS_51330 6262628 6262825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 6270609 6262939 gene locus_tag LOCUS_51340 6270609 6262939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 6270850 6270719 gene locus_tag LOCUS_51350 6270850 6270719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51350 6271764 6270967 gene locus_tag LOCUS_51360 6271764 6270967 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_51360 6273020 6271761 gene locus_tag LOCUS_51370 6273020 6271761 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028031.1 protein_id gnl|my_center|LOCUS_51370 6274141 6273131 gene locus_tag LOCUS_51380 6274141 6273131 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067528.1 protein_id gnl|my_center|LOCUS_51380 6274959 6274168 gene locus_tag LOCUS_51390 6274959 6274168 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027539.1 protein_id gnl|my_center|LOCUS_51390 6275991 6275062 gene locus_tag LOCUS_51400 gene pfkB 6275991 6275062 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_51400 6276854 6275988 gene locus_tag LOCUS_51410 gene fba 6276854 6275988 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_51410 6277025 6278074 gene locus_tag LOCUS_51420 6277025 6278074 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003148055.1 protein_id gnl|my_center|LOCUS_51420 6279513 6278434 gene locus_tag LOCUS_51430 6279513 6278434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51430 6280430 6279510 gene locus_tag LOCUS_51440 6280430 6279510 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897167.1 protein_id gnl|my_center|LOCUS_51440 6281298 6280447 gene locus_tag LOCUS_51450 gene iolO 6281298 6280447 CDS product 5-keto-L-gluconate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083268.1 protein_id gnl|my_center|LOCUS_51450 6282504 6281329 gene locus_tag LOCUS_51460 gene nagA 6282504 6281329 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386286.1 protein_id gnl|my_center|LOCUS_51460 6283280 6282501 gene locus_tag LOCUS_51470 6283280 6282501 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_51470 6284323 6283277 gene locus_tag LOCUS_51480 6284323 6283277 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_51480 6285180 6284326 gene locus_tag LOCUS_51490 6285180 6284326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51490 6285556 6285359 gene locus_tag LOCUS_51500 6285556 6285359 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943836.1 protein_id gnl|my_center|LOCUS_51500 6285901 6285581 gene locus_tag LOCUS_51510 6285901 6285581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51510 6286218 6287117 gene locus_tag LOCUS_51520 gene rpoD 6286218 6287117 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_51520 6288521 6287394 gene locus_tag LOCUS_51530 6288521 6287394 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161413.1 protein_id gnl|my_center|LOCUS_51530 6289655 6288573 gene locus_tag LOCUS_51540 6289655 6288573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51540 6290040 6292748 gene locus_tag LOCUS_51550 gene acnA 6290040 6292748 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245728.1 protein_id gnl|my_center|LOCUS_51550 6292875 6294041 gene locus_tag LOCUS_51560 6292875 6294041 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989884.1 protein_id gnl|my_center|LOCUS_51560 6294935 6294192 gene locus_tag LOCUS_51570 6294935 6294192 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392692.1 protein_id gnl|my_center|LOCUS_51570 6295148 6296188 gene locus_tag LOCUS_51580 6295148 6296188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 6296271 6297413 gene locus_tag LOCUS_51590 6296271 6297413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51590 6305218 6297530 gene locus_tag LOCUS_51600 6305218 6297530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51600 6310535 6305349 gene locus_tag LOCUS_51610 6310535 6305349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51610 6310948 6310706 gene locus_tag LOCUS_51620 6310948 6310706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51620 6312908 6311304 gene locus_tag LOCUS_51630 6312908 6311304 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813543.1 protein_id gnl|my_center|LOCUS_51630 6314183 6313107 gene locus_tag LOCUS_51640 6314183 6313107 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_51640 6314388 6315140 gene locus_tag LOCUS_51650 6314388 6315140 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532200.1 protein_id gnl|my_center|LOCUS_51650 6315809 6315216 gene locus_tag LOCUS_51660 gene folE 6315809 6315216 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225516.1 protein_id gnl|my_center|LOCUS_51660 6316103 6315867 gene locus_tag LOCUS_51670 6316103 6315867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51670 6317347 6316328 gene locus_tag LOCUS_51680 6317347 6316328 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461739.1 protein_id gnl|my_center|LOCUS_51680 6319625 6317535 gene locus_tag LOCUS_51690 6319625 6317535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51690 6320254 6319640 gene locus_tag LOCUS_51700 6320254 6319640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51700 6320432 6322522 gene locus_tag LOCUS_51710 6320432 6322522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51710 6323920 6322715 gene locus_tag LOCUS_51720 gene queG 6323920 6322715 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345218.1 protein_id gnl|my_center|LOCUS_51720 6324526 6323942 gene locus_tag LOCUS_51730 gene lepB 6324526 6323942 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_51730 6325119 6324523 gene locus_tag LOCUS_51740 6325119 6324523 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643214.1 protein_id gnl|my_center|LOCUS_51740 6325690 6325268 gene locus_tag LOCUS_51750 6325690 6325268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51750 6326166 6326777 gene locus_tag LOCUS_51760 6326166 6326777 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387688.1 protein_id gnl|my_center|LOCUS_51760 6328511 6327126 gene locus_tag LOCUS_51770 6328511 6327126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 6329407 6328508 gene locus_tag LOCUS_51780 6329407 6328508 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_51780 6329487 6329852 gene locus_tag LOCUS_51790 6329487 6329852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51790 6330468 6330073 gene locus_tag LOCUS_51800 gene acpS 6330468 6330073 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583416.1 protein_id gnl|my_center|LOCUS_51800 6331285 6330476 gene locus_tag LOCUS_51810 gene nadE 6331285 6330476 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660553.1 protein_id gnl|my_center|LOCUS_51810 6331844 6331416 gene locus_tag LOCUS_51820 6331844 6331416 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063706.1 protein_id gnl|my_center|LOCUS_51820 6332110 6331982 gene locus_tag LOCUS_51830 6332110 6331982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 6333841 6332174 gene locus_tag LOCUS_51840 6333841 6332174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 6334066 6335304 gene locus_tag LOCUS_51850 6334066 6335304 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229222.1 protein_id gnl|my_center|LOCUS_51850 6335450 6335629 gene locus_tag LOCUS_51860 6335450 6335629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 6336775 6336371 gene locus_tag LOCUS_51870 6336775 6336371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51870 6338170 6336839 gene locus_tag LOCUS_51880 6338170 6336839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51880 6338934 6338167 gene locus_tag LOCUS_51890 6338934 6338167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816701.1 protein_id gnl|my_center|LOCUS_51890 6340654 6339158 gene locus_tag LOCUS_51900 gene xylB 6340654 6339158 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245233.1 protein_id gnl|my_center|LOCUS_51900 6342016 6340697 gene locus_tag LOCUS_51910 gene xylA 6342016 6340697 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245235.1 protein_id gnl|my_center|LOCUS_51910 6342207 6343373 gene locus_tag LOCUS_51920 6342207 6343373 CDS product xylose repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244935.1 protein_id gnl|my_center|LOCUS_51920 6343984 6343550 gene locus_tag LOCUS_51930 6343984 6343550 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_51930 6344153 6343941 gene locus_tag LOCUS_51940 6344153 6343941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 6344511 6344227 gene locus_tag LOCUS_51950 6344511 6344227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 6345028 6344570 gene locus_tag LOCUS_51960 6345028 6344570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 6349435 6345167 gene locus_tag LOCUS_51970 6349435 6345167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 6349623 6352739 gene locus_tag LOCUS_51980 6349623 6352739 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942800.1 protein_id gnl|my_center|LOCUS_51980 6352736 6353857 gene locus_tag LOCUS_51990 6352736 6353857 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810004.1 protein_id gnl|my_center|LOCUS_51990 6355744 6353918 gene locus_tag LOCUS_52000 6355744 6353918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 6357165 6355741 gene locus_tag LOCUS_52010 6357165 6355741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52010 6358897 6357143 gene locus_tag LOCUS_52020 6358897 6357143 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_52020 6360896 6359097 gene locus_tag LOCUS_52030 6360896 6359097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52030 6361964 6361068 gene locus_tag LOCUS_52040 6361964 6361068 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776882.1 protein_id gnl|my_center|LOCUS_52040 6362951 6361983 gene locus_tag LOCUS_52050 6362951 6361983 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_52050 6364824 6363580 gene locus_tag LOCUS_52060 6364824 6363580 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543417.1 protein_id gnl|my_center|LOCUS_52060 6365097 6365720 gene locus_tag LOCUS_52070 6365097 6365720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 6365857 6366852 gene locus_tag LOCUS_52080 6365857 6366852 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_52080 6367619 6366936 gene locus_tag LOCUS_52090 6367619 6366936 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230767.1 protein_id gnl|my_center|LOCUS_52090 6370812 6368164 gene locus_tag LOCUS_52100 6370812 6368164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 6371085 6373631 gene locus_tag LOCUS_52110 6371085 6373631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52110 6373900 6373694 gene locus_tag LOCUS_52120 6373900 6373694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52120 6374427 6374059 gene locus_tag LOCUS_52130 6374427 6374059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52130 6374399 6375403 gene locus_tag LOCUS_52140 6374399 6375403 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031134.1 protein_id gnl|my_center|LOCUS_52140 6375997 6375476 gene locus_tag LOCUS_52150 gene lspA 6375997 6375476 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724127.1 protein_id gnl|my_center|LOCUS_52150 6376963 6376127 gene locus_tag LOCUS_52160 6376963 6376127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52160 6377382 6376966 gene locus_tag LOCUS_52170 6377382 6376966 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495063.1 protein_id gnl|my_center|LOCUS_52170 6377543 6378667 gene locus_tag LOCUS_52180 6377543 6378667 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120110396.1 protein_id gnl|my_center|LOCUS_52180 6378705 6379616 gene locus_tag LOCUS_52190 6378705 6379616 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707170.1 protein_id gnl|my_center|LOCUS_52190 6379989 6380309 gene locus_tag LOCUS_52200 6379989 6380309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52200 6380503 6380288 gene locus_tag LOCUS_52210 6380503 6380288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52210 6380453 6381241 gene locus_tag LOCUS_52220 6380453 6381241 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_52220 6382615 6381578 gene locus_tag LOCUS_52230 6382615 6381578 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370395.1 protein_id gnl|my_center|LOCUS_52230 6383558 6382752 gene locus_tag LOCUS_52240 6383558 6382752 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_52240 6385522 6383561 gene locus_tag LOCUS_52250 6385522 6383561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52250 6391768 6385610 gene locus_tag LOCUS_52260 6391768 6385610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 6393534 6391855 gene locus_tag LOCUS_52270 6393534 6391855 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_52270 6394497 6393622 gene locus_tag LOCUS_52280 6394497 6393622 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_52280 6395505 6394516 gene locus_tag LOCUS_52290 6395505 6394516 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_52290 6397443 6395665 gene locus_tag LOCUS_52300 6397443 6395665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52300 6401803 6397607 gene locus_tag LOCUS_52310 6401803 6397607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 6403027 6402023 gene locus_tag LOCUS_52320 6403027 6402023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 6404715 6403129 gene locus_tag LOCUS_52330 6404715 6403129 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028506.1 protein_id gnl|my_center|LOCUS_52330 6405721 6404774 gene locus_tag LOCUS_52340 6405721 6404774 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988998.1 protein_id gnl|my_center|LOCUS_52340 6406670 6405759 gene locus_tag LOCUS_52350 6406670 6405759 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_52350 6406934 6406725 gene locus_tag LOCUS_52360 6406934 6406725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52360 6409782 6407497 gene locus_tag LOCUS_52370 6409782 6407497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52370 6410404 6409955 gene locus_tag LOCUS_52380 6410404 6409955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52380 6410889 6410431 gene locus_tag LOCUS_52390 6410889 6410431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52390 6411677 6410889 gene locus_tag LOCUS_52400 6411677 6410889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52400 6412869 6411874 gene locus_tag LOCUS_52410 6412869 6411874 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_52410 6414177 6413056 gene locus_tag LOCUS_52420 6414177 6413056 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_52420 6414331 6415239 gene locus_tag LOCUS_52430 6414331 6415239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52430 6415635 6415471 gene locus_tag LOCUS_52440 6415635 6415471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52440 6417022 6415793 gene locus_tag LOCUS_52450 6417022 6415793 CDS product SfnB family sulfur acquisition oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107493.1 protein_id gnl|my_center|LOCUS_52450 6418430 6417060 gene locus_tag LOCUS_52460 6418430 6417060 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130606586.1 protein_id gnl|my_center|LOCUS_52460 6419488 6418451 gene locus_tag LOCUS_52470 6419488 6418451 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084175.1 protein_id gnl|my_center|LOCUS_52470 6420488 6419469 gene locus_tag LOCUS_52480 6420488 6419469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_52480 6421473 6420565 gene locus_tag LOCUS_52490 6421473 6420565 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724711.1 protein_id gnl|my_center|LOCUS_52490 6422440 6421496 gene locus_tag LOCUS_52500 6422440 6421496 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086126.1 protein_id gnl|my_center|LOCUS_52500 6424150 6422522 gene locus_tag LOCUS_52510 6424150 6422522 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966683.1 protein_id gnl|my_center|LOCUS_52510 6425497 6424307 gene locus_tag LOCUS_52520 6425497 6424307 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382099.1 protein_id gnl|my_center|LOCUS_52520 6426220 6425516 gene locus_tag LOCUS_52530 6426220 6425516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52530 6426382 6427347 gene locus_tag LOCUS_52540 6426382 6427347 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989968.1 protein_id gnl|my_center|LOCUS_52540 6427477 6428832 gene locus_tag LOCUS_52550 6427477 6428832 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130606586.1 protein_id gnl|my_center|LOCUS_52550 6435143 6428955 gene locus_tag LOCUS_52560 6435143 6428955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52560 6437837 6435282 gene locus_tag LOCUS_52570 6437837 6435282 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_52570 6438812 6437937 gene locus_tag LOCUS_52580 6438812 6437937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52580 6438960 6440930 gene locus_tag LOCUS_52590 6438960 6440930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52590 6444984 6441097 gene locus_tag LOCUS_52600 6444984 6441097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52600 6445848 6445285 gene locus_tag LOCUS_52610 6445848 6445285 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201269.1 protein_id gnl|my_center|LOCUS_52610 6447061 6446063 gene locus_tag LOCUS_52620 gene gap 6447061 6446063 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_52620 6448083 6447109 gene locus_tag LOCUS_52630 6448083 6447109 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 protein_id gnl|my_center|LOCUS_52630 6448536 6448135 gene locus_tag LOCUS_52640 6448536 6448135 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968618.1 protein_id gnl|my_center|LOCUS_52640 6448951 6449235 gene locus_tag LOCUS_52650 6448951 6449235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 6450762 6449554 gene locus_tag LOCUS_52660 6450762 6449554 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967206.1 protein_id gnl|my_center|LOCUS_52660 6452211 6450856 gene locus_tag LOCUS_52670 6452211 6450856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 6453278 6452397 gene locus_tag LOCUS_52680 6453278 6452397 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469098.1 protein_id gnl|my_center|LOCUS_52680 6453941 6453381 gene locus_tag LOCUS_52690 6453941 6453381 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880755.1 protein_id gnl|my_center|LOCUS_52690 6455492 6454080 gene locus_tag LOCUS_52700 6455492 6454080 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110815093.1 protein_id gnl|my_center|LOCUS_52700 6456566 6455517 gene locus_tag LOCUS_52710 6456566 6455517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 6457663 6456572 gene locus_tag LOCUS_52720 6457663 6456572 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199169830.1 protein_id gnl|my_center|LOCUS_52720 6457812 6458639 gene locus_tag LOCUS_52730 6457812 6458639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 6460286 6459387 gene locus_tag LOCUS_52740 6460286 6459387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 6461358 6460432 gene locus_tag LOCUS_52750 6461358 6460432 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854514.1 protein_id gnl|my_center|LOCUS_52750 6461318 6461668 gene locus_tag LOCUS_52760 6461318 6461668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 6462790 6462023 gene locus_tag LOCUS_52770 6462790 6462023 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_52770 6463648 6462809 gene locus_tag LOCUS_52780 6463648 6462809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 6464661 6463663 gene locus_tag LOCUS_52790 6464661 6463663 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324237.1 protein_id gnl|my_center|LOCUS_52790 6465826 6464675 gene locus_tag LOCUS_52800 6465826 6464675 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_52800 6466583 6465948 gene locus_tag LOCUS_52810 6466583 6465948 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807782.1 protein_id gnl|my_center|LOCUS_52810 6466671 6467300 gene locus_tag LOCUS_52820 6466671 6467300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52820 6467435 6468328 gene locus_tag LOCUS_52830 6467435 6468328 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164690802.1 protein_id gnl|my_center|LOCUS_52830 6469832 6468588 gene locus_tag LOCUS_52840 6469832 6468588 CDS product IS4-like element ISDha3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458871.1 protein_id gnl|my_center|LOCUS_52840 6473845 6470576 gene locus_tag LOCUS_52850 6473845 6470576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52850 6475380 6473881 gene locus_tag LOCUS_52860 6475380 6473881 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_52860 6476262 6475381 gene locus_tag LOCUS_52870 6476262 6475381 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_52870 6477147 6476281 gene locus_tag LOCUS_52880 6477147 6476281 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_52880 6479039 6477315 gene locus_tag LOCUS_52890 6479039 6477315 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_52890 6480867 6479182 gene locus_tag LOCUS_52900 6480867 6479182 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_52900 6482677 6480971 gene locus_tag LOCUS_52910 6482677 6480971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 6484431 6482674 gene locus_tag LOCUS_52920 6484431 6482674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52920 6485519 6484560 gene locus_tag LOCUS_52930 6485519 6484560 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290171.1 protein_id gnl|my_center|LOCUS_52930 6485640 6486512 gene locus_tag LOCUS_52940 6485640 6486512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 6486650 6488041 gene locus_tag LOCUS_52950 6486650 6488041 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969766.1 protein_id gnl|my_center|LOCUS_52950 6488474 6488277 gene locus_tag LOCUS_52960 6488474 6488277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 6488633 6489112 gene locus_tag LOCUS_52970 6488633 6489112 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393264.1 protein_id gnl|my_center|LOCUS_52970 6489423 6489974 gene locus_tag LOCUS_52980 6489423 6489974 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023665.1 protein_id gnl|my_center|LOCUS_52980 6490150 6490890 gene locus_tag LOCUS_52990 6490150 6490890 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_52990 6491801 6490887 gene locus_tag LOCUS_53000 6491801 6490887 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447162.1 protein_id gnl|my_center|LOCUS_53000 6492026 6492661 gene locus_tag LOCUS_53010 gene azoRB 6492026 6492661 CDS product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 protein_id gnl|my_center|LOCUS_53010 6495190 6493631 gene locus_tag LOCUS_53020 6495190 6493631 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_53020 6496158 6495271 gene locus_tag LOCUS_53030 6496158 6495271 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_53030 6497111 6496161 gene locus_tag LOCUS_53040 6497111 6496161 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_53040 6498901 6497294 gene locus_tag LOCUS_53050 6498901 6497294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53050 6500703 6498898 gene locus_tag LOCUS_53060 6500703 6498898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53060 6501578 6500700 gene locus_tag LOCUS_53070 6501578 6500700 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989345.1 protein_id gnl|my_center|LOCUS_53070 6502176 6501727 gene locus_tag LOCUS_53080 6502176 6501727 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090630.1 protein_id gnl|my_center|LOCUS_53080 6503303 6502173 gene locus_tag LOCUS_53090 6503303 6502173 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967916.1 protein_id gnl|my_center|LOCUS_53090 6506591 6503475 gene locus_tag LOCUS_53100 6506591 6503475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53100 6508112 6506838 gene locus_tag LOCUS_53110 6508112 6506838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53110 6509894 6508137 gene locus_tag LOCUS_53120 6509894 6508137 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_53120 6511417 6509891 gene locus_tag LOCUS_53130 gene glpK 6511417 6509891 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035612.1 protein_id gnl|my_center|LOCUS_53130 6512368 6511430 gene locus_tag LOCUS_53140 6512368 6511430 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732677.1 protein_id gnl|my_center|LOCUS_53140 6513215 6512370 gene locus_tag LOCUS_53150 6513215 6512370 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_53150 6514669 6513236 gene locus_tag LOCUS_53160 6514669 6513236 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989642.1 protein_id gnl|my_center|LOCUS_53160 6514900 6515973 gene locus_tag LOCUS_53170 6514900 6515973 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989641.1 protein_id gnl|my_center|LOCUS_53170 6518404 6516128 gene locus_tag LOCUS_53180 6518404 6516128 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_53180 6520062 6518515 gene locus_tag LOCUS_53190 6520062 6518515 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906003.1 protein_id gnl|my_center|LOCUS_53190 6521028 6520153 gene locus_tag LOCUS_53200 6521028 6520153 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_53200 6521982 6521050 gene locus_tag LOCUS_53210 6521982 6521050 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_53210 6523761 6522154 gene locus_tag LOCUS_53220 6523761 6522154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 6525513 6523768 gene locus_tag LOCUS_53230 gene yesM 6525513 6523768 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_53230 6527905 6525635 gene locus_tag LOCUS_53240 6527905 6525635 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_53240 6530870 6527955 gene locus_tag LOCUS_53250 6530870 6527955 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_53250 6531189 6530974 gene locus_tag LOCUS_53260 6531189 6530974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 6533382 6531472 gene locus_tag LOCUS_53270 6533382 6531472 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_53270 6535031 6533400 gene locus_tag LOCUS_53280 6535031 6533400 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_53280 6535286 6536674 gene locus_tag LOCUS_53290 6535286 6536674 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836857.1 protein_id gnl|my_center|LOCUS_53290 6536753 6537640 gene locus_tag LOCUS_53300 6536753 6537640 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_53300 6537650 6538462 gene locus_tag LOCUS_53310 6537650 6538462 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 protein_id gnl|my_center|LOCUS_53310 6538505 6540292 gene locus_tag LOCUS_53320 6538505 6540292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 6544337 6540687 gene locus_tag LOCUS_53330 6544337 6540687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 6546103 6544445 gene locus_tag LOCUS_53340 6546103 6544445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53340 6547095 6546205 gene locus_tag LOCUS_53350 6547095 6546205 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_53350 6548123 6547119 gene locus_tag LOCUS_53360 6548123 6547119 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_53360 6548344 6550086 gene locus_tag LOCUS_53370 gene yesM 6548344 6550086 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_53370 6550079 6551656 gene locus_tag LOCUS_53380 6550079 6551656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53380 6552169 6552339 gene locus_tag LOCUS_53390 6552169 6552339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53390 6554744 6552357 gene locus_tag LOCUS_53400 6554744 6552357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53400 6555553 6554942 gene locus_tag LOCUS_53410 6555553 6554942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 6555744 6556193 gene locus_tag LOCUS_53420 6555744 6556193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 6558331 6556646 gene locus_tag LOCUS_53430 6558331 6556646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 6562248 6558352 gene locus_tag LOCUS_53440 6562248 6558352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 6564099 6562297 gene locus_tag LOCUS_53450 6564099 6562297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53450 6565051 6564167 gene locus_tag LOCUS_53460 6565051 6564167 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_53460 6566023 6565079 gene locus_tag LOCUS_53470 6566023 6565079 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_53470 6568450 6566039 gene locus_tag LOCUS_53480 6568450 6566039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 6569100 6568447 gene locus_tag LOCUS_53490 gene pgmB 6569100 6568447 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_53490 6571513 6569093 gene locus_tag LOCUS_53500 6571513 6569093 CDS product glycosyl hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886611.1 protein_id gnl|my_center|LOCUS_53500 6573445 6571613 gene locus_tag LOCUS_53510 6573445 6571613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53510 6575067 6573448 gene locus_tag LOCUS_53520 6575067 6573448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 6575840 6575472 gene locus_tag LOCUS_53530 6575840 6575472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 6581153 6575868 gene locus_tag LOCUS_53540 6581153 6575868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 6581817 6581221 gene locus_tag LOCUS_53550 gene slrC 6581817 6581221 CDS product transcriptional regulator SlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227396.1 protein_id gnl|my_center|LOCUS_53550 6582058 6582210 gene locus_tag LOCUS_53560 6582058 6582210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 6590052 6582433 gene locus_tag LOCUS_53570 6590052 6582433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53570 6590275 6590108 gene locus_tag LOCUS_53580 6590275 6590108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53580 6590784 6590458 gene locus_tag LOCUS_53590 6590784 6590458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53590 6592269 6590992 gene locus_tag LOCUS_53600 6592269 6590992 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_53600 6593164 6592262 gene locus_tag LOCUS_53610 6593164 6592262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_53610 6594114 6593161 gene locus_tag LOCUS_53620 6594114 6593161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53620 6594527 6594111 gene locus_tag LOCUS_53630 6594527 6594111 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392679.1 protein_id gnl|my_center|LOCUS_53630 6595285 6594560 gene locus_tag LOCUS_53640 6595285 6594560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 6595495 6596796 gene locus_tag LOCUS_53650 6595495 6596796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 6597745 6600159 gene locus_tag LOCUS_53660 6597745 6600159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 6601078 6600227 gene locus_tag LOCUS_53670 6601078 6600227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53670 6602713 6601133 gene locus_tag LOCUS_53680 gene ggt 6602713 6601133 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227847.1 protein_id gnl|my_center|LOCUS_53680 6604004 6602790 gene locus_tag LOCUS_53690 6604004 6602790 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529753.1 protein_id gnl|my_center|LOCUS_53690 6604980 6604291 gene locus_tag LOCUS_53700 6604980 6604291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 6605165 6605854 gene locus_tag LOCUS_53710 gene yycF 6605165 6605854 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 protein_id gnl|my_center|LOCUS_53710 6605851 6607221 gene locus_tag LOCUS_53720 6605851 6607221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 6607776 6607315 gene locus_tag LOCUS_53730 6607776 6607315 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538766.1 protein_id gnl|my_center|LOCUS_53730 6608773 6607862 gene locus_tag LOCUS_53740 gene ctaG 6608773 6607862 CDS product cytochrome c oxidase assembly factor CtaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069023.1 protein_id gnl|my_center|LOCUS_53740 6609441 6609121 gene locus_tag LOCUS_53750 6609441 6609121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53750 6610066 6609446 gene locus_tag LOCUS_53760 gene ctaE 6610066 6609446 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557860.1 protein_id gnl|my_center|LOCUS_53760 6611910 6610063 gene locus_tag LOCUS_53770 gene ctaD 6611910 6610063 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011371630.1 protein_id gnl|my_center|LOCUS_53770 6613022 6611949 gene locus_tag LOCUS_53780 gene coxB 6613022 6611949 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232248.1 protein_id gnl|my_center|LOCUS_53780 6613448 6614200 gene locus_tag LOCUS_53790 6613448 6614200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 6614907 6614719 gene locus_tag LOCUS_53800 6614907 6614719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 6615768 6615040 gene locus_tag LOCUS_53810 6615768 6615040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 6616496 6615924 gene locus_tag LOCUS_53820 6616496 6615924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53820 6616704 6617984 gene locus_tag LOCUS_53830 gene ilvA 6616704 6617984 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250353.1 protein_id gnl|my_center|LOCUS_53830 6618091 6619284 gene locus_tag LOCUS_53840 6618091 6619284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494345.1 protein_id gnl|my_center|LOCUS_53840 6619293 6619940 gene locus_tag LOCUS_53850 6619293 6619940 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886465.1 protein_id gnl|my_center|LOCUS_53850 6620111 6620254 gene locus_tag LOCUS_53860 6620111 6620254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53860 6620278 6620559 gene locus_tag LOCUS_53870 6620278 6620559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 6622482 6621427 gene locus_tag LOCUS_53880 6622482 6621427 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233537.1 protein_id gnl|my_center|LOCUS_53880 6623594 6622479 gene locus_tag LOCUS_53890 6623594 6622479 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245738.1 protein_id gnl|my_center|LOCUS_53890 6624404 6623622 gene locus_tag LOCUS_53900 6624404 6623622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53900 6625419 6624454 gene locus_tag LOCUS_53910 6625419 6624454 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112591.1 protein_id gnl|my_center|LOCUS_53910 6627273 6625507 gene locus_tag LOCUS_53920 6627273 6625507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53920 6627393 6627884 gene locus_tag LOCUS_53930 gene mscL 6627393 6627884 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_53930 6627881 6628558 gene locus_tag LOCUS_53940 6627881 6628558 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963768.1 protein_id gnl|my_center|LOCUS_53940 6629721 6628822 gene locus_tag LOCUS_53950 6629721 6628822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53950 6630935 6629853 gene locus_tag LOCUS_53960 6630935 6629853 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411472.1 protein_id gnl|my_center|LOCUS_53960 6631765 6631004 gene locus_tag LOCUS_53970 6631765 6631004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 6632287 6631937 gene locus_tag LOCUS_53980 6632287 6631937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53980 6632682 6632284 gene locus_tag LOCUS_53990 6632682 6632284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53990 6635760 6632740 gene locus_tag LOCUS_54000 6635760 6632740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 6636354 6635782 gene locus_tag LOCUS_54010 6636354 6635782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 6637465 6636347 gene locus_tag LOCUS_54020 6637465 6636347 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229940.1 protein_id gnl|my_center|LOCUS_54020 6637917 6637462 gene locus_tag LOCUS_54030 6637917 6637462 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047787.1 protein_id gnl|my_center|LOCUS_54030 6638173 6637910 gene locus_tag LOCUS_54040 6638173 6637910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54040 6639137 6638166 gene locus_tag LOCUS_54050 6639137 6638166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047789.1 protein_id gnl|my_center|LOCUS_54050 6639724 6639134 gene locus_tag LOCUS_54060 6639724 6639134 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047790.1 protein_id gnl|my_center|LOCUS_54060 6641944 6639758 gene locus_tag LOCUS_54070 6641944 6639758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 6642095 6641952 gene locus_tag LOCUS_54080 6642095 6641952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 6642529 6642119 gene locus_tag LOCUS_54090 6642529 6642119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 6642950 6642543 gene locus_tag LOCUS_54100 6642950 6642543 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047795.1 protein_id gnl|my_center|LOCUS_54100 6644417 6642969 gene locus_tag LOCUS_54110 6644417 6642969 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047796.1 protein_id gnl|my_center|LOCUS_54110 6644617 6644420 gene locus_tag LOCUS_54120 6644617 6644420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54120 6645080 6644631 gene locus_tag LOCUS_54130 6645080 6644631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54130 6645765 6645190 gene locus_tag LOCUS_54140 6645765 6645190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54140 6646044 6646442 gene locus_tag LOCUS_54150 6646044 6646442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54150 6646513 6647094 gene locus_tag LOCUS_54160 6646513 6647094 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232721.1 protein_id gnl|my_center|LOCUS_54160 6647705 6647163 gene locus_tag LOCUS_54170 gene yhbO 6647705 6647163 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037599.1 protein_id gnl|my_center|LOCUS_54170 6648297 6648082 gene locus_tag LOCUS_54180 6648297 6648082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 6648540 6648920 gene locus_tag LOCUS_54190 6648540 6648920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 6649104 6649029 gene locus_tag LOCUS_t00530 6649104 6649029 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6649236 6649895 gene locus_tag LOCUS_54200 6649236 6649895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_54200 6649945 6651075 gene locus_tag LOCUS_54210 6649945 6651075 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_54210 6651224 6651072 gene locus_tag LOCUS_54220 6651224 6651072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54220 6651616 6652629 gene locus_tag LOCUS_54230 6651616 6652629 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972497.1 protein_id gnl|my_center|LOCUS_54230 6652811 6652611 gene locus_tag LOCUS_54240 6652811 6652611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 6652732 6653340 gene locus_tag LOCUS_54250 6652732 6653340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 6654504 6653476 gene locus_tag LOCUS_54260 6654504 6653476 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_54260 6654919 6655806 gene locus_tag LOCUS_54270 6654919 6655806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_54270 6656794 6655919 gene locus_tag LOCUS_54280 6656794 6655919 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659627.1 protein_id gnl|my_center|LOCUS_54280 6660007 6656825 gene locus_tag LOCUS_54290 gene srfP 6660007 6656825 CDS product surfactin resistance protein SrfP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242663.1 protein_id gnl|my_center|LOCUS_54290 6661082 6660375 gene locus_tag LOCUS_54300 6661082 6660375 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583993.1 protein_id gnl|my_center|LOCUS_54300 6661555 6661079 gene locus_tag LOCUS_54310 6661555 6661079 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_54310 6662630 6661584 gene locus_tag LOCUS_54320 6662630 6661584 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257043.1 protein_id gnl|my_center|LOCUS_54320 6664582 6663092 gene locus_tag LOCUS_54330 6664582 6663092 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966741.1 protein_id gnl|my_center|LOCUS_54330 6664811 6665560 gene locus_tag LOCUS_54340 6664811 6665560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54340 6666400 6665714 gene locus_tag LOCUS_54350 6666400 6665714 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271956.1 protein_id gnl|my_center|LOCUS_54350 6668285 6666423 gene locus_tag LOCUS_54360 gene ltaP 6668285 6666423 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_54360 6668518 6668820 gene locus_tag LOCUS_54370 6668518 6668820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54370 6669342 6672629 gene locus_tag LOCUS_54380 6669342 6672629 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011074.1 protein_id gnl|my_center|LOCUS_54380 6672747 6673226 gene locus_tag LOCUS_54390 6672747 6673226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 6673413 6673862 gene locus_tag LOCUS_54400 6673413 6673862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 6675343 6673916 gene locus_tag LOCUS_54410 6675343 6673916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54410 6676431 6675406 gene locus_tag LOCUS_54420 6676431 6675406 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_54420 6676856 6677932 gene locus_tag LOCUS_54430 6676856 6677932 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004266412.1 protein_id gnl|my_center|LOCUS_54430 6679123 6678632 gene locus_tag LOCUS_54440 gene infC 6679123 6678632 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583670.1 protein_id gnl|my_center|LOCUS_54440 6680410 6679148 gene locus_tag LOCUS_54450 6680410 6679148 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112840.1 protein_id gnl|my_center|LOCUS_54450 6680570 6680361 gene locus_tag LOCUS_54460 6680570 6680361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 6682593 6680617 gene locus_tag LOCUS_54470 6682593 6680617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54470 6684034 6682793 gene locus_tag LOCUS_54480 6684034 6682793 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058301.1 protein_id gnl|my_center|LOCUS_54480 6686040 6684148 gene locus_tag LOCUS_54490 gene ltaP 6686040 6684148 CDS product lipoteichoic acid primase LtaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931059.1 protein_id gnl|my_center|LOCUS_54490 6687829 6686510 gene locus_tag LOCUS_54500 6687829 6686510 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_54500 6688787 6687948 gene locus_tag LOCUS_54510 6688787 6687948 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_54510 6689677 6688787 gene locus_tag LOCUS_54520 6689677 6688787 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582924.1 protein_id gnl|my_center|LOCUS_54520 6689785 6691773 gene locus_tag LOCUS_54530 6689785 6691773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54530 6691770 6693428 gene locus_tag LOCUS_54540 6691770 6693428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54540 6699888 6693862 gene locus_tag LOCUS_54550 6699888 6693862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54550 6701121 6700237 gene locus_tag LOCUS_54560 6701121 6700237 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_54560 6702084 6701134 gene locus_tag LOCUS_54570 gene rmgP 6702084 6701134 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_54570 6703816 6702164 gene locus_tag LOCUS_54580 6703816 6702164 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_54580 6704106 6704975 gene locus_tag LOCUS_54590 6704106 6704975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54590 6706505 6705105 gene locus_tag LOCUS_54600 6706505 6705105 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000537911.1 protein_id gnl|my_center|LOCUS_54600 6711037 6707066 gene locus_tag LOCUS_54610 6711037 6707066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 6712049 6711039 gene locus_tag LOCUS_54620 gene cydB 6712049 6711039 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_54620 6713510 6712116 gene locus_tag LOCUS_54630 6713510 6712116 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722078.1 protein_id gnl|my_center|LOCUS_54630 6713940 6714158 gene locus_tag LOCUS_54640 6713940 6714158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54640 6714226 6714741 gene locus_tag LOCUS_54650 6714226 6714741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54650 6714929 6715741 gene locus_tag LOCUS_54660 6714929 6715741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 6716061 6715858 gene locus_tag LOCUS_54670 gene cspB 6716061 6715858 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_54670 6716693 6716478 gene locus_tag LOCUS_54680 6716693 6716478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54680 6717393 6716926 gene locus_tag LOCUS_54690 6717393 6716926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954998.1 protein_id gnl|my_center|LOCUS_54690 6717702 6717466 gene locus_tag LOCUS_54700 6717702 6717466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 6724185 6717859 gene locus_tag LOCUS_54710 6724185 6717859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 6728259 6724381 gene locus_tag LOCUS_54720 6728259 6724381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54720 6730713 6728896 gene locus_tag LOCUS_54730 6730713 6728896 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062822707.1 protein_id gnl|my_center|LOCUS_54730 6736508 6731232 gene locus_tag LOCUS_54740 6736508 6731232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 6737468 6736674 gene locus_tag LOCUS_54750 6737468 6736674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_54750 6738409 6737468 gene locus_tag LOCUS_54760 6738409 6737468 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092881.1 protein_id gnl|my_center|LOCUS_54760 6739502 6738426 gene locus_tag LOCUS_54770 6739502 6738426 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_54770 6740627 6739653 gene locus_tag LOCUS_54780 6740627 6739653 CDS product catalase family peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004549880.1 protein_id gnl|my_center|LOCUS_54780 6740842 6741630 gene locus_tag LOCUS_54790 6740842 6741630 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_54790 6741761 6742540 gene locus_tag LOCUS_54800 6741761 6742540 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_54800 6742632 6744479 gene locus_tag LOCUS_54810 6742632 6744479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 6744472 6744951 gene locus_tag LOCUS_54820 6744472 6744951 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393956.1 protein_id gnl|my_center|LOCUS_54820 6745284 6745096 gene locus_tag LOCUS_54830 6745284 6745096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 6745515 6746459 gene locus_tag LOCUS_54840 6745515 6746459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54840 6748378 6746777 gene locus_tag LOCUS_54850 6748378 6746777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54850 6750322 6748466 gene locus_tag LOCUS_54860 6750322 6748466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 6751831 6750461 gene locus_tag LOCUS_54870 6751831 6750461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 6752837 6751986 gene locus_tag LOCUS_54880 6752837 6751986 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_54880 6753772 6752834 gene locus_tag LOCUS_54890 6753772 6752834 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_54890 6754026 6754550 gene locus_tag LOCUS_54900 6754026 6754550 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100102.1 protein_id gnl|my_center|LOCUS_54900 6755478 6755101 gene locus_tag LOCUS_54910 6755478 6755101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 6756319 6755600 gene locus_tag LOCUS_54920 6756319 6755600 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861683.1 protein_id gnl|my_center|LOCUS_54920 6757443 6756400 gene locus_tag LOCUS_54930 gene lytR 6757443 6756400 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_54930 6758789 6757416 gene locus_tag LOCUS_54940 6758789 6757416 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_54940 6759825 6758920 gene locus_tag LOCUS_54950 gene galU 6759825 6758920 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_54950 6761415 6759943 gene locus_tag LOCUS_54960 gene wzxC 6761415 6759943 CDS product colanic acid undecaprenyl disphosphate flippase WzxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097869.1 protein_id gnl|my_center|LOCUS_54960 6762584 6761412 gene locus_tag LOCUS_54970 6762584 6761412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 6763717 6762581 gene locus_tag LOCUS_54980 6763717 6762581 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526112.1 protein_id gnl|my_center|LOCUS_54980 6765012 6763714 gene locus_tag LOCUS_54990 6765012 6763714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 6766405 6765056 gene locus_tag LOCUS_55000 gene tuaD 6766405 6765056 CDS product UDP-glucose 6-dehydrogenase TuaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242596.1 protein_id gnl|my_center|LOCUS_55000 6767578 6766421 gene locus_tag LOCUS_55010 6767578 6766421 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268294.1 protein_id gnl|my_center|LOCUS_55010 6768340 6767624 gene locus_tag LOCUS_55020 6768340 6767624 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060578.1 protein_id gnl|my_center|LOCUS_55020 6769036 6768344 gene locus_tag LOCUS_55030 gene ptkA 6769036 6768344 CDS product tyrosine-protein kinase PtkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244182.1 protein_id gnl|my_center|LOCUS_55030 6770280 6769090 gene locus_tag LOCUS_55040 6770280 6769090 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929363.1 protein_id gnl|my_center|LOCUS_55040 6771095 6770319 gene locus_tag LOCUS_55050 6771095 6770319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55050 6772592 6771390 gene locus_tag LOCUS_55060 6772592 6771390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 6774514 6772805 gene locus_tag LOCUS_55070 6774514 6772805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55070 6776348 6775260 gene locus_tag LOCUS_55080 6776348 6775260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55080 6776725 6776534 gene locus_tag LOCUS_55090 6776725 6776534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 6776728 6778341 gene locus_tag LOCUS_55100 6776728 6778341 CDS product SWIM zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227806.1 protein_id gnl|my_center|LOCUS_55100 6778338 6781400 gene locus_tag LOCUS_55110 6778338 6781400 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610086.1 protein_id gnl|my_center|LOCUS_55110 6781684 6781511 gene locus_tag LOCUS_55120 6781684 6781511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 6781905 6782324 gene locus_tag LOCUS_55130 6781905 6782324 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101108.1 protein_id gnl|my_center|LOCUS_55130 6782476 6783459 gene locus_tag LOCUS_55140 6782476 6783459 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387131.1 protein_id gnl|my_center|LOCUS_55140 6783846 6783484 gene locus_tag LOCUS_55150 6783846 6783484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55150 6787142 6784479 gene locus_tag LOCUS_55160 gene clpB 6787142 6784479 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_55160 6788285 6787224 gene locus_tag LOCUS_55170 6788285 6787224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55170 6788644 6788435 gene locus_tag LOCUS_55180 6788644 6788435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55180 6789616 6788684 gene locus_tag LOCUS_55190 6789616 6788684 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_55190 6789772 6790539 gene locus_tag LOCUS_55200 6789772 6790539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55200 6791031 6790588 gene locus_tag LOCUS_55210 6791031 6790588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55210 6791417 6791235 gene locus_tag LOCUS_55220 6791417 6791235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 6791416 6791580 gene locus_tag LOCUS_55230 6791416 6791580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 6791610 6792425 gene locus_tag LOCUS_55240 6791610 6792425 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723624.1 protein_id gnl|my_center|LOCUS_55240 6792781 6792479 gene locus_tag LOCUS_55250 6792781 6792479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 6793813 6792950 gene locus_tag LOCUS_55260 6793813 6792950 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243895.1 protein_id gnl|my_center|LOCUS_55260 6794713 6794204 gene locus_tag LOCUS_55270 6794713 6794204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55270 6795909 6794815 gene locus_tag LOCUS_55280 gene gerBC 6795909 6794815 CDS product spore germination protein GerBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242990.1 protein_id gnl|my_center|LOCUS_55280 6797021 6795921 gene locus_tag LOCUS_55290 6797021 6795921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55290 6798439 6797018 gene locus_tag LOCUS_55300 6798439 6797018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 6800451 6798559 gene locus_tag LOCUS_55310 6800451 6798559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 6800683 6800934 gene locus_tag LOCUS_55320 6800683 6800934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55320 6800928 6801557 gene locus_tag LOCUS_55330 gene udk 6800928 6801557 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289751.1 protein_id gnl|my_center|LOCUS_55330 6803798 6801708 gene locus_tag LOCUS_55340 6803798 6801708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55340 6806176 6803795 gene locus_tag LOCUS_55350 6806176 6803795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55350 6807076 6806255 gene locus_tag LOCUS_55360 6807076 6806255 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_55360 6807942 6807073 gene locus_tag LOCUS_55370 6807942 6807073 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_55370 6809356 6807995 gene locus_tag LOCUS_55380 6809356 6807995 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965989.1 protein_id gnl|my_center|LOCUS_55380 6809527 6811320 gene locus_tag LOCUS_55390 6809527 6811320 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_55390 6811320 6812840 gene locus_tag LOCUS_55400 6811320 6812840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55400 6813027 6815594 gene locus_tag LOCUS_55410 6813027 6815594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 6815809 6815513 gene locus_tag LOCUS_55420 6815809 6815513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55420 6817043 6815715 gene locus_tag LOCUS_55430 gene ltrA 6817043 6815715 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 protein_id gnl|my_center|LOCUS_55430 6818510 6817755 gene locus_tag LOCUS_55440 6818510 6817755 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813595.1 protein_id gnl|my_center|LOCUS_55440 6819742 6818585 gene locus_tag LOCUS_55450 6819742 6818585 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261645.1 protein_id gnl|my_center|LOCUS_55450 6819939 6820466 gene locus_tag LOCUS_55460 6819939 6820466 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868576.1 protein_id gnl|my_center|LOCUS_55460 6821546 6820692 gene locus_tag LOCUS_55470 6821546 6820692 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_55470 6822406 6821588 gene locus_tag LOCUS_55480 6822406 6821588 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940422.1 protein_id gnl|my_center|LOCUS_55480 6823326 6822436 gene locus_tag LOCUS_55490 6823326 6822436 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815927.1 protein_id gnl|my_center|LOCUS_55490 6824804 6823437 gene locus_tag LOCUS_55500 6824804 6823437 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940420.1 protein_id gnl|my_center|LOCUS_55500 6825725 6824922 gene locus_tag LOCUS_55510 6825725 6824922 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_55510 6831390 6825952 gene locus_tag LOCUS_55520 6831390 6825952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55520 6832204 6831641 gene locus_tag LOCUS_55530 gene glpP 6832204 6831641 CDS product glycerol uptake operon antiterminator GlpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394287.1 protein_id gnl|my_center|LOCUS_55530 6832340 6832543 gene locus_tag LOCUS_55540 6832340 6832543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 6833352 6832438 gene locus_tag LOCUS_55550 6833352 6832438 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_55550 6835155 6833569 gene locus_tag LOCUS_55560 gene nagZ 6835155 6833569 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_55560 6836381 6835236 gene locus_tag LOCUS_55570 6836381 6835236 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963509.1 protein_id gnl|my_center|LOCUS_55570 6837089 6836385 gene locus_tag LOCUS_55580 6837089 6836385 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_55580 6838072 6837086 gene locus_tag LOCUS_55590 6838072 6837086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 6838647 6838438 gene locus_tag LOCUS_55600 6838647 6838438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 6838736 6839032 gene locus_tag LOCUS_55610 6838736 6839032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55610 6840321 6838948 gene locus_tag LOCUS_55620 gene anmK 6840321 6838948 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_55620 6841219 6840359 gene locus_tag LOCUS_55630 6841219 6840359 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989564.1 protein_id gnl|my_center|LOCUS_55630 6842141 6841239 gene locus_tag LOCUS_55640 6842141 6841239 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003052879.1 protein_id gnl|my_center|LOCUS_55640 6843707 6842244 gene locus_tag LOCUS_55650 6843707 6842244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 6844685 6843771 gene locus_tag LOCUS_55660 gene murQ 6844685 6843771 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963499.1 protein_id gnl|my_center|LOCUS_55660 6845758 6844895 gene locus_tag LOCUS_55670 6845758 6844895 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_55670 6846007 6847287 gene locus_tag LOCUS_55680 6846007 6847287 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861728.1 protein_id gnl|my_center|LOCUS_55680 6847314 6847649 gene locus_tag LOCUS_55690 6847314 6847649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55690 6848597 6849619 gene locus_tag LOCUS_55700 6848597 6849619 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223063.1 protein_id gnl|my_center|LOCUS_55700 6850202 6849828 gene locus_tag LOCUS_55710 6850202 6849828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 6850360 6851097 gene locus_tag LOCUS_55720 gene tatC 6850360 6851097 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_55720 6851171 6851371 gene locus_tag LOCUS_55730 gene tatAD 6851171 6851371 CDS product sec-independent protein translocase protein TatAD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223835.1 protein_id gnl|my_center|LOCUS_55730 6852168 6851461 gene locus_tag LOCUS_55740 6852168 6851461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 6852995 6852291 gene locus_tag LOCUS_55750 6852995 6852291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55750 6854133 6853009 gene locus_tag LOCUS_55760 6854133 6853009 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287753.1 protein_id gnl|my_center|LOCUS_55760 6856028 6854313 gene locus_tag LOCUS_55770 6856028 6854313 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851097.1 protein_id gnl|my_center|LOCUS_55770 6856827 6856051 gene locus_tag LOCUS_55780 6856827 6856051 CDS product gluconate 2-dehydrogenase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857555.1 protein_id gnl|my_center|LOCUS_55780 6856953 6857699 gene locus_tag LOCUS_55790 6856953 6857699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55790 6858589 6858197 gene locus_tag LOCUS_55800 gene gcvH 6858589 6858197 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_55800 6860543 6859296 gene locus_tag LOCUS_55810 6860543 6859296 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161410139.1 protein_id gnl|my_center|LOCUS_55810 6862351 6860543 gene locus_tag LOCUS_55820 gene yesM 6862351 6860543 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_55820 6863242 6862361 gene locus_tag LOCUS_55830 6863242 6862361 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_55830 6864177 6863284 gene locus_tag LOCUS_55840 6864177 6863284 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_55840 6865663 6864266 gene locus_tag LOCUS_55850 6865663 6864266 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026992.1 protein_id gnl|my_center|LOCUS_55850 6865787 6866110 gene locus_tag LOCUS_55860 6865787 6866110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 6866946 6866068 gene locus_tag LOCUS_55870 6866946 6866068 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377714.1 protein_id gnl|my_center|LOCUS_55870 6867979 6867164 gene locus_tag LOCUS_55880 6867979 6867164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 6868144 6869292 gene locus_tag LOCUS_55890 6868144 6869292 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404080.1 protein_id gnl|my_center|LOCUS_55890 6870104 6869280 gene locus_tag LOCUS_55900 6870104 6869280 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233767.1 protein_id gnl|my_center|LOCUS_55900 6870340 6871602 gene locus_tag LOCUS_55910 6870340 6871602 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106376.1 protein_id gnl|my_center|LOCUS_55910 6872263 6871964 gene locus_tag LOCUS_55920 6872263 6871964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_55920 6872856 6872263 gene locus_tag LOCUS_55930 6872856 6872263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 6873018 6873857 gene locus_tag LOCUS_55940 6873018 6873857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530928.1 protein_id gnl|my_center|LOCUS_55940 6874540 6873920 gene locus_tag LOCUS_55950 6874540 6873920 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011993730.1 protein_id gnl|my_center|LOCUS_55950 6875631 6874537 gene locus_tag LOCUS_55960 6875631 6874537 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582734.1 protein_id gnl|my_center|LOCUS_55960 6876269 6875730 gene locus_tag LOCUS_55970 6876269 6875730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245720.1 protein_id gnl|my_center|LOCUS_55970 6876361 6876957 gene locus_tag LOCUS_55980 6876361 6876957 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_55980 6878968 6877241 gene locus_tag LOCUS_55990 6878968 6877241 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_55990 6881053 6879599 gene locus_tag LOCUS_56000 gene serS 6881053 6879599 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887919.1 protein_id gnl|my_center|LOCUS_56000 6882184 6881072 gene locus_tag LOCUS_56010 gene serC 6882184 6881072 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_56010 6883492 6882488 gene locus_tag LOCUS_56020 6883492 6882488 CDS product DUF4917 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119745.1 protein_id gnl|my_center|LOCUS_56020 6883594 6884196 gene locus_tag LOCUS_56030 6883594 6884196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56030 6884732 6884121 gene locus_tag LOCUS_56040 6884732 6884121 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949065.1 protein_id gnl|my_center|LOCUS_56040 6885753 6884800 gene locus_tag LOCUS_56050 6885753 6884800 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234172.1 protein_id gnl|my_center|LOCUS_56050 6886592 6885885 gene locus_tag LOCUS_56060 6886592 6885885 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573662.1 protein_id gnl|my_center|LOCUS_56060 6888629 6886620 gene locus_tag LOCUS_56070 6888629 6886620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56070 6890068 6888992 gene locus_tag LOCUS_56080 6890068 6888992 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083251.1 protein_id gnl|my_center|LOCUS_56080 6890896 6890105 gene locus_tag LOCUS_56090 gene cheR 6890896 6890105 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230589.1 protein_id gnl|my_center|LOCUS_56090 6892512 6890914 gene locus_tag LOCUS_56100 6892512 6890914 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943215.1 protein_id gnl|my_center|LOCUS_56100 6894721 6892541 gene locus_tag LOCUS_56110 6894721 6892541 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392263.1 protein_id gnl|my_center|LOCUS_56110 6895157 6894735 gene locus_tag LOCUS_56120 6895157 6894735 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_56120 6897045 6895207 gene locus_tag LOCUS_56130 gene tlpB 6897045 6895207 CDS product methyl-accepting chemotaxis protein TlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243983.1 protein_id gnl|my_center|LOCUS_56130 6897422 6897042 gene locus_tag LOCUS_56140 6897422 6897042 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_56140 6897924 6897427 gene locus_tag LOCUS_56150 6897924 6897427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56150 6899119 6898148 gene locus_tag LOCUS_56160 gene sbnB 6899119 6898148 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115662.1 protein_id gnl|my_center|LOCUS_56160 6900153 6899116 gene locus_tag LOCUS_56170 gene sbnA 6900153 6899116 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921742.1 protein_id gnl|my_center|LOCUS_56170 6901381 6900167 gene locus_tag LOCUS_56180 6901381 6900167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 6901563 6902351 gene locus_tag LOCUS_56190 6901563 6902351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 6902936 6902412 gene locus_tag LOCUS_56200 6902936 6902412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56200 6903187 6902915 gene locus_tag LOCUS_56210 6903187 6902915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56210 6904295 6903396 gene locus_tag LOCUS_56220 6904295 6903396 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105258.1 protein_id gnl|my_center|LOCUS_56220 6905399 6904401 gene locus_tag LOCUS_56230 6905399 6904401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 6906086 6905622 gene locus_tag LOCUS_56240 6906086 6905622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 6908027 6906255 gene locus_tag LOCUS_56250 6908027 6906255 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_56250 6908179 6909093 gene locus_tag LOCUS_56260 6908179 6909093 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058303659.1 protein_id gnl|my_center|LOCUS_56260 6909985 6909101 gene locus_tag LOCUS_56270 6909985 6909101 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986415.1 protein_id gnl|my_center|LOCUS_56270 6910852 6910085 gene locus_tag LOCUS_56280 6910852 6910085 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989490.1 protein_id gnl|my_center|LOCUS_56280 6912374 6910872 gene locus_tag LOCUS_56290 6912374 6910872 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072073.1 protein_id gnl|my_center|LOCUS_56290 6913195 6912371 gene locus_tag LOCUS_56300 6913195 6912371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 6913605 6913201 gene locus_tag LOCUS_56310 6913605 6913201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56310 6914232 6913720 gene locus_tag LOCUS_56320 6914232 6913720 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244690.1 protein_id gnl|my_center|LOCUS_56320 6914465 6915295 gene locus_tag LOCUS_56330 6914465 6915295 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210024.1 protein_id gnl|my_center|LOCUS_56330 6917294 6915906 gene locus_tag LOCUS_56340 6917294 6915906 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816666.1 protein_id gnl|my_center|LOCUS_56340 6917687 6917448 gene locus_tag LOCUS_56350 6917687 6917448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56350 6917989 6917789 gene locus_tag LOCUS_56360 gene cspB 6917989 6917789 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_56360 6918154 6918339 gene locus_tag LOCUS_56370 6918154 6918339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 6919164 6918265 gene locus_tag LOCUS_56380 6919164 6918265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56380 6920160 6919225 gene locus_tag LOCUS_56390 6920160 6919225 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055032204.1 protein_id gnl|my_center|LOCUS_56390 6921558 6920635 gene locus_tag LOCUS_56400 6921558 6920635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 6924275 6921687 gene locus_tag LOCUS_56410 6924275 6921687 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229822.1 protein_id gnl|my_center|LOCUS_56410 6925544 6924279 gene locus_tag LOCUS_56420 6925544 6924279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56420 6926815 6925589 gene locus_tag LOCUS_56430 6926815 6925589 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256441.1 protein_id gnl|my_center|LOCUS_56430 6927644 6926859 gene locus_tag LOCUS_56440 6927644 6926859 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816142.1 protein_id gnl|my_center|LOCUS_56440 6928395 6927934 gene locus_tag LOCUS_56450 6928395 6927934 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_56450 6929913 6928414 gene locus_tag LOCUS_56460 6929913 6928414 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222854.1 protein_id gnl|my_center|LOCUS_56460 6930892 6930317 gene locus_tag LOCUS_56470 6930892 6930317 CDS product ribonuclease H-like YkuK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232389.1 protein_id gnl|my_center|LOCUS_56470 6931039 6930964 gene locus_tag LOCUS_t00540 6931039 6930964 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6931124 6931047 gene locus_tag LOCUS_t00550 6931124 6931047 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6931221 6931148 gene locus_tag LOCUS_t00560 6931221 6931148 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6931301 6931227 gene locus_tag LOCUS_t00570 6931301 6931227 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6931724 6931545 gene locus_tag LOCUS_56480 6931724 6931545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 6932099 6933412 gene locus_tag LOCUS_56490 6932099 6933412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 6933387 6934232 gene locus_tag LOCUS_56500 6933387 6934232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56500 6935097 6934252 gene locus_tag LOCUS_56510 6935097 6934252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56510 6935472 6935200 gene locus_tag LOCUS_56520 6935472 6935200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56520 6935840 6935583 gene locus_tag LOCUS_56530 6935840 6935583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56530 6937509 6936061 gene locus_tag LOCUS_56540 gene dbpA 6937509 6936061 CDS product ATP-dependent RNA helicase DbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037430.1 protein_id gnl|my_center|LOCUS_56540 6938235 6937606 gene locus_tag LOCUS_56550 6938235 6937606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56550 6938329 6938496 gene locus_tag LOCUS_56560 6938329 6938496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 6938997 6938581 gene locus_tag LOCUS_56570 6938997 6938581 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359781.1 protein_id gnl|my_center|LOCUS_56570 6939432 6939223 gene locus_tag LOCUS_56580 6939432 6939223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56580 6939743 6939564 gene locus_tag LOCUS_56590 6939743 6939564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56590 6943096 6939803 gene locus_tag LOCUS_56600 6943096 6939803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 6943312 6947718 gene locus_tag LOCUS_56610 6943312 6947718 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_56610 6947736 6948119 gene locus_tag LOCUS_56620 6947736 6948119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56620 6948800 6948261 gene locus_tag LOCUS_56630 6948800 6948261 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986716.1 protein_id gnl|my_center|LOCUS_56630 6949357 6948824 gene locus_tag LOCUS_56640 6949357 6948824 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267035.1 protein_id gnl|my_center|LOCUS_56640 6949812 6950075 gene locus_tag LOCUS_56650 6949812 6950075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56650 6950077 6950469 gene locus_tag LOCUS_56660 6950077 6950469 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289716.1 protein_id gnl|my_center|LOCUS_56660 6952293 6950575 gene locus_tag LOCUS_56670 6952293 6950575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 6953337 6952297 gene locus_tag LOCUS_56680 6953337 6952297 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096071.1 protein_id gnl|my_center|LOCUS_56680 6953549 6953298 gene locus_tag LOCUS_56690 6953549 6953298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 6953775 6954299 gene locus_tag LOCUS_56700 6953775 6954299 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_56700 6954268 6955005 gene locus_tag LOCUS_56710 6954268 6955005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 6955346 6955113 gene locus_tag LOCUS_56720 6955346 6955113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56720 6955728 6955483 gene locus_tag LOCUS_56730 6955728 6955483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 6955777 6956004 gene locus_tag LOCUS_56740 6955777 6956004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56740 6956154 6956005 gene locus_tag LOCUS_56750 6956154 6956005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56750 6959454 6956317 gene locus_tag LOCUS_56760 6959454 6956317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56760 6961191 6959482 gene locus_tag LOCUS_56770 6961191 6959482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56770 6962106 6961195 gene locus_tag LOCUS_56780 6962106 6961195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56780 6964778 6962121 gene locus_tag LOCUS_56790 6964778 6962121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56790 6965631 6964798 gene locus_tag LOCUS_56800 6965631 6964798 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_56800 6966557 6965628 gene locus_tag LOCUS_56810 6966557 6965628 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582825.1 protein_id gnl|my_center|LOCUS_56810 6967980 6966634 gene locus_tag LOCUS_56820 6967980 6966634 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258532.1 protein_id gnl|my_center|LOCUS_56820 6968399 6969451 gene locus_tag LOCUS_56830 6968399 6969451 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_56830 6969644 6969453 gene locus_tag LOCUS_56840 6969644 6969453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56840 6970546 6970058 gene locus_tag LOCUS_56850 6970546 6970058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 6971956 6970754 gene locus_tag LOCUS_56860 6971956 6970754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 6975411 6971971 gene locus_tag LOCUS_56870 6975411 6971971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 6976279 6975404 gene locus_tag LOCUS_56880 6976279 6975404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56880 6977046 6976309 gene locus_tag LOCUS_56890 6977046 6976309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56890 6977697 6977089 gene locus_tag LOCUS_56900 6977697 6977089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 6978370 6977927 gene locus_tag LOCUS_56910 6978370 6977927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56910 6979393 6979030 gene locus_tag LOCUS_tm00010 6979393 6979030 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6980159 6979674 gene locus_tag LOCUS_56920 gene smpB 6980159 6979674 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_56920 6980260 6980394 gene locus_tag LOCUS_56930 6980260 6980394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56930 6981371 6980436 gene locus_tag LOCUS_56940 gene pyrB 6981371 6980436 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_56940 6984768 6981628 gene locus_tag LOCUS_56950 6984768 6981628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 6985203 6984967 gene locus_tag LOCUS_56960 gene secG 6985203 6984967 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_56960 6985676 6985311 gene locus_tag LOCUS_56970 6985676 6985311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56970 6986098 6985712 gene locus_tag LOCUS_56980 6986098 6985712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 6986714 6986226 gene locus_tag LOCUS_56990 6986714 6986226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56990 6988541 6986937 gene locus_tag LOCUS_57000 gene katX 6988541 6986937 CDS product catalase KatX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243042.1 protein_id gnl|my_center|LOCUS_57000 6989488 6988718 gene locus_tag LOCUS_57010 6989488 6988718 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_57010 6989957 6989778 gene locus_tag LOCUS_57020 6989957 6989778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 6992830 6990035 gene locus_tag LOCUS_57030 6992830 6990035 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_57030 6996014 6992856 gene locus_tag LOCUS_57040 6996014 6992856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57040 6997341 6996007 gene locus_tag LOCUS_57050 6997341 6996007 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989563.1 protein_id gnl|my_center|LOCUS_57050 6998173 6998607 gene locus_tag LOCUS_57060 6998173 6998607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57060 7001725 6998588 gene locus_tag LOCUS_57070 7001725 6998588 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204437144.1 protein_id gnl|my_center|LOCUS_57070 7004022 7001722 gene locus_tag LOCUS_57080 7004022 7001722 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796108.1 protein_id gnl|my_center|LOCUS_57080 7005048 7004131 gene locus_tag LOCUS_57090 7005048 7004131 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727964.1 protein_id gnl|my_center|LOCUS_57090 7006010 7005078 gene locus_tag LOCUS_57100 7006010 7005078 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_57100 7007583 7006111 gene locus_tag LOCUS_57110 7007583 7006111 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_57110 7009280 7007745 gene locus_tag LOCUS_57120 7009280 7007745 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304851.1 protein_id gnl|my_center|LOCUS_57120 7011132 7009330 gene locus_tag LOCUS_57130 7011132 7009330 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356857.1 protein_id gnl|my_center|LOCUS_57130 7012570 7011278 gene locus_tag LOCUS_57140 gene eno 7012570 7011278 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_57140 7014704 7013157 gene locus_tag LOCUS_57150 gene gpmI 7014704 7013157 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_57150 7015461 7014706 gene locus_tag LOCUS_57160 gene tpiA 7015461 7014706 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_57160 7016653 7015472 gene locus_tag LOCUS_57170 7016653 7015472 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_57170 7017762 7016755 gene locus_tag LOCUS_57180 gene gap 7017762 7016755 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219957.1 protein_id gnl|my_center|LOCUS_57180 7018912 7017884 gene locus_tag LOCUS_57190 gene cggR 7018912 7017884 CDS product gapA transcriptional regulator CggR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968188.1 protein_id gnl|my_center|LOCUS_57190 7019211 7019285 gene locus_tag LOCUS_t00580 7019211 7019285 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7019498 7020079 gene locus_tag LOCUS_57200 gene clpP 7019498 7020079 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_57200 7021818 7020259 gene locus_tag LOCUS_57210 7021818 7020259 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_57210 7022766 7021885 gene locus_tag LOCUS_57220 7022766 7021885 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_57220 7023784 7022798 gene locus_tag LOCUS_57230 gene rmgP 7023784 7022798 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_57230 7026253 7023971 gene locus_tag LOCUS_57240 7026253 7023971 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 protein_id gnl|my_center|LOCUS_57240 7026649 7026915 gene locus_tag LOCUS_57250 7026649 7026915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57250 7027733 7026972 gene locus_tag LOCUS_57260 7027733 7026972 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461134.1 protein_id gnl|my_center|LOCUS_57260 7028738 7027968 gene locus_tag LOCUS_57270 7028738 7027968 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679259.1 protein_id gnl|my_center|LOCUS_57270 7029134 7028865 gene locus_tag LOCUS_57280 7029134 7028865 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_57280 7030172 7029237 gene locus_tag LOCUS_57290 gene whiA 7030172 7029237 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 protein_id gnl|my_center|LOCUS_57290 7031166 7030180 gene locus_tag LOCUS_57300 gene mgfK 7031166 7030180 CDS product gluconeogenesis morphogenetic factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244450.1 protein_id gnl|my_center|LOCUS_57300 7032079 7031159 gene locus_tag LOCUS_57310 gene rapZ 7032079 7031159 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_57310 7033081 7032131 gene locus_tag LOCUS_57320 gene glcK 7033081 7032131 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_57320 7034122 7033166 gene locus_tag LOCUS_57330 gene trxB 7034122 7033166 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_57330 7035904 7034165 gene locus_tag LOCUS_57340 7035904 7034165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 7036131 7035907 gene locus_tag LOCUS_57350 7036131 7035907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 7037161 7036211 gene locus_tag LOCUS_57360 7037161 7036211 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_57360 7038055 7037396 gene locus_tag LOCUS_57370 gene hisIE 7038055 7037396 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243045.1 protein_id gnl|my_center|LOCUS_57370 7038810 7038052 gene locus_tag LOCUS_57380 gene hisF 7038810 7038052 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244585.1 protein_id gnl|my_center|LOCUS_57380 7039722 7038991 gene locus_tag LOCUS_57390 gene hisA 7039722 7038991 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242559.1 protein_id gnl|my_center|LOCUS_57390 7040566 7039949 gene locus_tag LOCUS_57400 gene hisH 7040566 7039949 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560360.1 protein_id gnl|my_center|LOCUS_57400 7041182 7040568 gene locus_tag LOCUS_57410 gene hisB 7041182 7040568 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_57410 7042472 7041183 gene locus_tag LOCUS_57420 gene hisD 7042472 7041183 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_57420 7043190 7042549 gene locus_tag LOCUS_57430 gene hisG 7043190 7042549 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 protein_id gnl|my_center|LOCUS_57430 7044437 7043187 gene locus_tag LOCUS_57440 7044437 7043187 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244441.1 protein_id gnl|my_center|LOCUS_57440 7045245 7044736 gene locus_tag LOCUS_57450 7045245 7044736 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255064.1 protein_id gnl|my_center|LOCUS_57450 7045929 7045249 gene locus_tag LOCUS_57460 gene ppaX 7045929 7045249 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700956.1 protein_id gnl|my_center|LOCUS_57460 7047007 7045886 gene locus_tag LOCUS_57470 7047007 7045886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57470 7047989 7047057 gene locus_tag LOCUS_57480 gene hprK 7047989 7047057 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127244.1 protein_id gnl|my_center|LOCUS_57480 7048555 7048205 gene locus_tag LOCUS_57490 7048555 7048205 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530816.1 protein_id gnl|my_center|LOCUS_57490 7050186 7048552 gene locus_tag LOCUS_57500 7050186 7048552 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970047.1 protein_id gnl|my_center|LOCUS_57500 7051029 7050235 gene locus_tag LOCUS_57510 7051029 7050235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57510 7052172 7051051 gene locus_tag LOCUS_57520 7052172 7051051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57520 7052521 7052189 gene locus_tag LOCUS_57530 7052521 7052189 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730602.1 protein_id gnl|my_center|LOCUS_57530 7054122 7052518 gene locus_tag LOCUS_57540 7054122 7052518 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970047.1 protein_id gnl|my_center|LOCUS_57540 7055060 7054215 gene locus_tag LOCUS_57550 7055060 7054215 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432128.1 protein_id gnl|my_center|LOCUS_57550 7055878 7055075 gene locus_tag LOCUS_57560 7055878 7055075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_57560 7056080 7056856 gene locus_tag LOCUS_57570 7056080 7056856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886450.1 protein_id gnl|my_center|LOCUS_57570 7058063 7056942 gene locus_tag LOCUS_57580 gene ugpC 7058063 7056942 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_57580 7059250 7058153 gene locus_tag LOCUS_57590 7059250 7058153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57590 7060279 7059326 gene locus_tag LOCUS_57600 7060279 7059326 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272199.1 protein_id gnl|my_center|LOCUS_57600 7060487 7060412 gene locus_tag LOCUS_t00590 7060487 7060412 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7060580 7060496 gene locus_tag LOCUS_t00600 7060580 7060496 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7060718 7060643 gene locus_tag LOCUS_t00610 7060718 7060643 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7060815 7060739 gene locus_tag LOCUS_t00620 7060815 7060739 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 7060906 7060831 gene locus_tag LOCUS_t00630 7060906 7060831 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7060998 7060922 gene locus_tag LOCUS_t00640 7060998 7060922 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7064063 7061137 gene locus_tag LOCUS_r00140 7064063 7061137 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7064271 7064196 gene locus_tag LOCUS_t00650 7064271 7064196 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7064374 7064298 gene locus_tag LOCUS_t00660 7064374 7064298 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 7064547 7064436 gene locus_tag LOCUS_r00150 7064547 7064436 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7066185 7064635 gene locus_tag LOCUS_r00160 7066185 7064635 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7066769 7066503 gene locus_tag LOCUS_57610 7066769 7066503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 7067056 7066766 gene locus_tag LOCUS_57620 7067056 7066766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 7067821 7067222 gene locus_tag LOCUS_57630 gene recR 7067821 7067222 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_57630 7068148 7067837 gene locus_tag LOCUS_57640 7068148 7067837 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_57640 7069967 7068162 gene locus_tag LOCUS_57650 gene dnaX 7069967 7068162 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121588.1 protein_id gnl|my_center|LOCUS_57650 7071186 7070005 gene locus_tag LOCUS_57660 gene gnfL 7071186 7070005 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_57660 7072162 7071743 gene locus_tag LOCUS_57670 7072162 7071743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57670 7072433 7072236 gene locus_tag LOCUS_57680 gene rpmE 7072433 7072236 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_57680 7074788 7072566 gene locus_tag LOCUS_57690 7074788 7072566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57690 7076048 7075116 gene locus_tag LOCUS_57700 7076048 7075116 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_57700 7076813 7076109 gene locus_tag LOCUS_57710 7076813 7076109 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859648.1 protein_id gnl|my_center|LOCUS_57710 7077687 7076857 gene locus_tag LOCUS_57720 7077687 7076857 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_57720 7078585 7077689 gene locus_tag LOCUS_57730 7078585 7077689 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_57730 7080072 7078690 gene locus_tag LOCUS_57740 7080072 7078690 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989565.1 protein_id gnl|my_center|LOCUS_57740 7081885 7080266 gene locus_tag LOCUS_57750 7081885 7080266 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_57750 7082843 7081974 gene locus_tag LOCUS_57760 7082843 7081974 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584123.1 protein_id gnl|my_center|LOCUS_57760 7084264 7082996 gene locus_tag LOCUS_57770 7084264 7082996 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_57770 7087078 7084337 gene locus_tag LOCUS_57780 7087078 7084337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57780 7088398 7087148 gene locus_tag LOCUS_57790 gene murA 7088398 7087148 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413260.1 protein_id gnl|my_center|LOCUS_57790 7089442 7088588 gene locus_tag LOCUS_57800 7089442 7088588 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829938.1 protein_id gnl|my_center|LOCUS_57800 7090032 7089634 gene locus_tag LOCUS_57810 gene spo0F 7090032 7089634 CDS product sporulation initiation phosphotransferase Spo0F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398594.1 protein_id gnl|my_center|LOCUS_57810 7091774 7090167 gene locus_tag LOCUS_57820 gene pyrG 7091774 7090167 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170460.1 protein_id gnl|my_center|LOCUS_57820 7092663 7092073 gene locus_tag LOCUS_57830 7092663 7092073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57830 7093130 7094329 gene locus_tag LOCUS_57840 7093130 7094329 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393523.1 protein_id gnl|my_center|LOCUS_57840 7094697 7094506 gene locus_tag LOCUS_57850 7094697 7094506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57850 7096443 7094770 gene locus_tag LOCUS_57860 gene argS 7096443 7094770 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_57860 7096843 7096448 gene locus_tag LOCUS_57870 7096843 7096448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57870 7097384 7099099 gene locus_tag LOCUS_57880 gene argS 7097384 7099099 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101383.1 protein_id gnl|my_center|LOCUS_57880 7099116 7099346 gene locus_tag LOCUS_57890 7099116 7099346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 7099679 7099530 gene locus_tag LOCUS_57900 7099679 7099530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57900 7102175 7099950 gene locus_tag LOCUS_57910 7102175 7099950 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060825866.1 protein_id gnl|my_center|LOCUS_57910 7103203 7102367 gene locus_tag LOCUS_57920 gene speE 7103203 7102367 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424696.1 protein_id gnl|my_center|LOCUS_57920 7103448 7105553 gene locus_tag LOCUS_57930 7103448 7105553 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227540.1 protein_id gnl|my_center|LOCUS_57930 7106258 7105743 gene locus_tag LOCUS_57940 7106258 7105743 CDS product YwhD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244446.1 protein_id gnl|my_center|LOCUS_57940 7107301 7106465 gene locus_tag LOCUS_57950 7107301 7106465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 7107494 7109644 gene locus_tag LOCUS_57960 7107494 7109644 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123042767.1 protein_id gnl|my_center|LOCUS_57960 7109661 7110479 gene locus_tag LOCUS_57970 7109661 7110479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57970 7110965 7111432 gene locus_tag LOCUS_57980 7110965 7111432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57980 7112918 7111617 gene locus_tag LOCUS_57990 7112918 7111617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 7114036 7112915 gene locus_tag LOCUS_58000 7114036 7112915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 7115002 7114040 gene locus_tag LOCUS_58010 7115002 7114040 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_58010 7115644 7115201 gene locus_tag LOCUS_58020 7115644 7115201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 7116553 7115693 gene locus_tag LOCUS_58030 7116553 7115693 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243882.1 protein_id gnl|my_center|LOCUS_58030 7117465 7116659 gene locus_tag LOCUS_58040 gene pdaB 7117465 7116659 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 protein_id gnl|my_center|LOCUS_58040 7117745 7117539 gene locus_tag LOCUS_58050 7117745 7117539 CDS product DUF1657 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216166.1 protein_id gnl|my_center|LOCUS_58050 7117942 7118415 gene locus_tag LOCUS_58060 gene spoVAC 7117942 7118415 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223947.1 protein_id gnl|my_center|LOCUS_58060 7118420 7119457 gene locus_tag LOCUS_58070 gene spoVAD 7118420 7119457 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938970.1 protein_id gnl|my_center|LOCUS_58070 7119462 7120322 gene locus_tag LOCUS_58080 7119462 7120322 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018922.1 protein_id gnl|my_center|LOCUS_58080 7122209 7120344 gene locus_tag LOCUS_58090 7122209 7120344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58090 7122982 7122206 gene locus_tag LOCUS_58100 7122982 7122206 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888221.1 protein_id gnl|my_center|LOCUS_58100 7123486 7124076 gene locus_tag LOCUS_58110 7123486 7124076 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 protein_id gnl|my_center|LOCUS_58110 7124111 7124998 gene locus_tag LOCUS_58120 7124111 7124998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58120 7125339 7125076 gene locus_tag LOCUS_58130 7125339 7125076 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658909.1 protein_id gnl|my_center|LOCUS_58130 7127060 7125339 gene locus_tag LOCUS_58140 gene ptsP 7127060 7125339 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218638.1 protein_id gnl|my_center|LOCUS_58140 7128256 7127099 gene locus_tag LOCUS_58150 7128256 7127099 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246548.1 protein_id gnl|my_center|LOCUS_58150 7128690 7128253 gene locus_tag LOCUS_58160 7128690 7128253 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246714.1 protein_id gnl|my_center|LOCUS_58160 7130798 7128696 gene locus_tag LOCUS_58170 gene mtlR 7130798 7128696 CDS product mannitol operon transcriptional activator MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246695.1 protein_id gnl|my_center|LOCUS_58170 7132448 7130925 gene locus_tag LOCUS_58180 7132448 7130925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 7132941 7133171 gene locus_tag LOCUS_58190 7132941 7133171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 7134526 7133102 gene locus_tag LOCUS_58200 7134526 7133102 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029787.1 protein_id gnl|my_center|LOCUS_58200 7135180 7134650 gene locus_tag LOCUS_58210 7135180 7134650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58210 7135354 7136220 gene locus_tag LOCUS_58220 7135354 7136220 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426507.1 protein_id gnl|my_center|LOCUS_58220 7136798 7136373 gene locus_tag LOCUS_58230 7136798 7136373 CDS product DUF6157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_58230 7138997 7136910 gene locus_tag LOCUS_58240 7138997 7136910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 7139324 7139034 gene locus_tag LOCUS_58250 7139324 7139034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58250 7139526 7140305 gene locus_tag LOCUS_58260 7139526 7140305 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989811.1 protein_id gnl|my_center|LOCUS_58260 7140976 7140317 gene locus_tag LOCUS_58270 7140976 7140317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 7141247 7140966 gene locus_tag LOCUS_58280 7141247 7140966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58280 7141464 7141874 gene locus_tag LOCUS_58290 7141464 7141874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58290 7143032 7142076 gene locus_tag LOCUS_58300 7143032 7142076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58300 7143971 7143099 gene locus_tag LOCUS_58310 7143971 7143099 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082369.1 protein_id gnl|my_center|LOCUS_58310 7145017 7143968 gene locus_tag LOCUS_58320 gene hflK 7145017 7143968 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_58320 7146342 7145404 gene locus_tag LOCUS_58330 7146342 7145404 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_58330 7147359 7146361 gene locus_tag LOCUS_58340 7147359 7146361 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_58340 7147487 7148326 gene locus_tag LOCUS_58350 gene araC 7147487 7148326 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045790020.1 protein_id gnl|my_center|LOCUS_58350 7148813 7148436 gene locus_tag LOCUS_58360 7148813 7148436 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228135.1 protein_id gnl|my_center|LOCUS_58360 7148930 7149943 gene locus_tag LOCUS_58370 7148930 7149943 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_58370 7150962 7150060 gene locus_tag LOCUS_58380 7150962 7150060 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747210.1 protein_id gnl|my_center|LOCUS_58380 7152507 7151038 gene locus_tag LOCUS_58390 gene pnbA 7152507 7151038 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_58390 7152676 7153488 gene locus_tag LOCUS_58400 7152676 7153488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58400 7153636 7154292 gene locus_tag LOCUS_58410 7153636 7154292 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_58410 7154454 7155011 gene locus_tag LOCUS_58420 7154454 7155011 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030768.1 protein_id gnl|my_center|LOCUS_58420 7156303 7155092 gene locus_tag LOCUS_58430 7156303 7155092 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014654825.1 protein_id gnl|my_center|LOCUS_58430 7156463 7156828 gene locus_tag LOCUS_58440 7156463 7156828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58440 7156759 7156920 gene locus_tag LOCUS_58450 7156759 7156920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58450 7157924 7157010 gene locus_tag LOCUS_58460 7157924 7157010 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497497.1 protein_id gnl|my_center|LOCUS_58460 7158290 7158090 gene locus_tag LOCUS_58470 7158290 7158090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58470 7159297 7158845 gene locus_tag LOCUS_58480 7159297 7158845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 7159432 7160256 gene locus_tag LOCUS_58490 7159432 7160256 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204082927.1 protein_id gnl|my_center|LOCUS_58490 7160374 7160946 gene locus_tag LOCUS_58500 7160374 7160946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58500 7160971 7161123 gene locus_tag LOCUS_58510 7160971 7161123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58510 7161188 7162042 gene locus_tag LOCUS_58520 7161188 7162042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 7162957 7162154 gene locus_tag LOCUS_58530 7162957 7162154 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328871.1 protein_id gnl|my_center|LOCUS_58530 7163496 7163053 gene locus_tag LOCUS_58540 7163496 7163053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58540 7165078 7163615 gene locus_tag LOCUS_58550 7165078 7163615 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836876.1 protein_id gnl|my_center|LOCUS_58550 7165333 7165133 gene locus_tag LOCUS_58560 7165333 7165133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58560 7165310 7166311 gene locus_tag LOCUS_58570 7165310 7166311 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356689.1 protein_id gnl|my_center|LOCUS_58570 7166677 7167552 gene locus_tag LOCUS_58580 gene aguB 7166677 7167552 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_58580 7169275 7168160 gene locus_tag LOCUS_58590 gene citA 7169275 7168160 CDS product citrate synthase CitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244745.1 protein_id gnl|my_center|LOCUS_58590 7169740 7171164 gene locus_tag LOCUS_58600 7169740 7171164 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_58600 7171173 7172507 gene locus_tag LOCUS_58610 gene yjoB 7171173 7172507 CDS product ATPase YjoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245490.1 protein_id gnl|my_center|LOCUS_58610 7173320 7172868 gene locus_tag LOCUS_58620 7173320 7172868 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142675.1 protein_id gnl|my_center|LOCUS_58620 7173491 7174138 gene locus_tag LOCUS_58630 7173491 7174138 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704899.1 protein_id gnl|my_center|LOCUS_58630 7174849 7174280 gene locus_tag LOCUS_58640 7174849 7174280 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964644.1 protein_id gnl|my_center|LOCUS_58640 7175038 7175706 gene locus_tag LOCUS_58650 7175038 7175706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 7177760 7175781 gene locus_tag LOCUS_58660 7177760 7175781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58660 7180039 7177757 gene locus_tag LOCUS_58670 7180039 7177757 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_58670 7182703 7180079 gene locus_tag LOCUS_58680 gene bglX 7182703 7180079 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108888.1 protein_id gnl|my_center|LOCUS_58680 7183740 7182856 gene locus_tag LOCUS_58690 7183740 7182856 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_58690 7184685 7183753 gene locus_tag LOCUS_58700 7184685 7183753 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_58700 7186460 7184901 gene locus_tag LOCUS_58710 7186460 7184901 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010729380.1 protein_id gnl|my_center|LOCUS_58710 7188178 7186535 gene locus_tag LOCUS_58720 7188178 7186535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 7189934 7188153 gene locus_tag LOCUS_58730 7189934 7188153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 7190529 7190134 gene locus_tag LOCUS_58740 7190529 7190134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58740 7192078 7190618 gene locus_tag LOCUS_58750 7192078 7190618 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_58750 7193588 7192140 gene locus_tag LOCUS_58760 7193588 7192140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58760 7195795 7194011 gene locus_tag LOCUS_58770 7195795 7194011 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038020.1 protein_id gnl|my_center|LOCUS_58770 7196739 7195843 gene locus_tag LOCUS_58780 7196739 7195843 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_58780 7197624 7196740 gene locus_tag LOCUS_58790 7197624 7196740 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530308.1 protein_id gnl|my_center|LOCUS_58790 7199192 7197726 gene locus_tag LOCUS_58800 7199192 7197726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 7201190 7199946 gene locus_tag LOCUS_58810 7201190 7199946 CDS product IS4-like element ISDha3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458871.1 protein_id gnl|my_center|LOCUS_58810 7203381 7201705 gene locus_tag LOCUS_58820 7203381 7201705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 7205185 7203356 gene locus_tag LOCUS_58830 7205185 7203356 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015253363.1 protein_id gnl|my_center|LOCUS_58830 7205525 7205815 gene locus_tag LOCUS_58840 7205525 7205815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 7206719 7205877 gene locus_tag LOCUS_58850 7206719 7205877 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214567418.1 protein_id gnl|my_center|LOCUS_58850 7207182 7206733 gene locus_tag LOCUS_58860 7207182 7206733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58860 7207792 7207262 gene locus_tag LOCUS_58870 7207792 7207262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58870 7208163 7207828 gene locus_tag LOCUS_58880 7208163 7207828 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078066.1 protein_id gnl|my_center|LOCUS_58880 7208677 7208531 gene locus_tag LOCUS_58890 7208677 7208531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58890 7209280 7208789 gene locus_tag LOCUS_58900 7209280 7208789 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970650.1 protein_id gnl|my_center|LOCUS_58900 7211465 7209354 gene locus_tag LOCUS_58910 7211465 7209354 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346347.1 protein_id gnl|my_center|LOCUS_58910 7212223 7211462 gene locus_tag LOCUS_58920 7212223 7211462 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029038.1 protein_id gnl|my_center|LOCUS_58920 7212414 7212220 gene locus_tag LOCUS_58930 7212414 7212220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58930 7213499 7212447 gene locus_tag LOCUS_58940 7213499 7212447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 7216853 7213554 gene locus_tag LOCUS_58950 7216853 7213554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 7219519 7217651 gene locus_tag LOCUS_58960 7219519 7217651 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831078.1 protein_id gnl|my_center|LOCUS_58960 7220532 7219516 gene locus_tag LOCUS_58970 7220532 7219516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 7222245 7220626 gene locus_tag LOCUS_58980 7222245 7220626 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_58980 7223277 7222360 gene locus_tag LOCUS_58990 7223277 7222360 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_58990 7224243 7223281 gene locus_tag LOCUS_59000 7224243 7223281 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_59000 7225147 7224515 gene locus_tag LOCUS_59010 gene azoRB 7225147 7224515 CDS product FMN-dependent NADH-azoreductase AzoRB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243587.1 protein_id gnl|my_center|LOCUS_59010 7225285 7225644 gene locus_tag LOCUS_59020 7225285 7225644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 7226600 7225923 gene locus_tag LOCUS_59030 7226600 7225923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 7227392 7226697 gene locus_tag LOCUS_59040 7227392 7226697 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103807.1 protein_id gnl|my_center|LOCUS_59040 7227477 7227950 gene locus_tag LOCUS_59050 7227477 7227950 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991273.1 protein_id gnl|my_center|LOCUS_59050 7228476 7227970 gene locus_tag LOCUS_59060 7228476 7227970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 7228649 7229413 gene locus_tag LOCUS_59070 7228649 7229413 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911797.1 protein_id gnl|my_center|LOCUS_59070 7229388 7229930 gene locus_tag LOCUS_59080 7229388 7229930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 7230664 7230083 gene locus_tag LOCUS_59090 7230664 7230083 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287055.1 protein_id gnl|my_center|LOCUS_59090 7230756 7231487 gene locus_tag LOCUS_59100 7230756 7231487 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038927.1 protein_id gnl|my_center|LOCUS_59100 7231589 7232239 gene locus_tag LOCUS_59110 7231589 7232239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59110 7232436 7233257 gene locus_tag LOCUS_59120 7232436 7233257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59120 7233360 7234148 gene locus_tag LOCUS_59130 7233360 7234148 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815367.1 protein_id gnl|my_center|LOCUS_59130 7234207 7235556 gene locus_tag LOCUS_59140 7234207 7235556 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392994.1 protein_id gnl|my_center|LOCUS_59140 7235576 7236547 gene locus_tag LOCUS_59150 7235576 7236547 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_59150 7236565 7237383 gene locus_tag LOCUS_59160 7236565 7237383 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_59160 7240876 7237457 gene locus_tag LOCUS_59170 7240876 7237457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59170 7242594 7241278 gene locus_tag LOCUS_59180 7242594 7241278 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776739.1 protein_id gnl|my_center|LOCUS_59180 7243522 7242668 gene locus_tag LOCUS_59190 gene araQ 7243522 7242668 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_59190 7244494 7243526 gene locus_tag LOCUS_59200 7244494 7243526 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289132.1 protein_id gnl|my_center|LOCUS_59200 7245971 7244565 gene locus_tag LOCUS_59210 7245971 7244565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 7246867 7246079 gene locus_tag LOCUS_59220 7246867 7246079 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922507.1 protein_id gnl|my_center|LOCUS_59220 7248651 7246864 gene locus_tag LOCUS_59230 gene yesM 7248651 7246864 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_59230 7248857 7249843 gene locus_tag LOCUS_59240 7248857 7249843 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_59240 7250055 7250267 gene locus_tag LOCUS_59250 7250055 7250267 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289418.1 protein_id gnl|my_center|LOCUS_59250 7250798 7250346 gene locus_tag LOCUS_59260 7250798 7250346 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226527.1 protein_id gnl|my_center|LOCUS_59260 7251390 7250848 gene locus_tag LOCUS_59270 7251390 7250848 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030568.1 protein_id gnl|my_center|LOCUS_59270 7252920 7252069 gene locus_tag LOCUS_59280 7252920 7252069 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689435.1 protein_id gnl|my_center|LOCUS_59280 7254081 7253032 gene locus_tag LOCUS_59290 7254081 7253032 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246664.1 protein_id gnl|my_center|LOCUS_59290 7254218 7255561 gene locus_tag LOCUS_59300 7254218 7255561 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280110.1 protein_id gnl|my_center|LOCUS_59300 7257217 7255565 gene locus_tag LOCUS_59310 7257217 7255565 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724033.1 protein_id gnl|my_center|LOCUS_59310 7257452 7257670 gene locus_tag LOCUS_59320 7257452 7257670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59320 7257877 7258683 gene locus_tag LOCUS_59330 gene rsbQ 7257877 7258683 CDS product sigma factor SigB/phosphatase RsbP regulator RsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228292.1 protein_id gnl|my_center|LOCUS_59330 7258702 7259697 gene locus_tag LOCUS_59340 7258702 7259697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 7261170 7259740 gene locus_tag LOCUS_59350 7261170 7259740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 7262455 7261346 gene locus_tag LOCUS_59360 7262455 7261346 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_59360 7262773 7264161 gene locus_tag LOCUS_59370 7262773 7264161 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257891.1 protein_id gnl|my_center|LOCUS_59370 7264246 7265361 gene locus_tag LOCUS_59380 gene ugpC 7264246 7265361 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_59380 7265355 7268285 gene locus_tag LOCUS_59390 7265355 7268285 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_59390 7268294 7269271 gene locus_tag LOCUS_59400 7268294 7269271 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259689.1 protein_id gnl|my_center|LOCUS_59400 7269274 7270146 gene locus_tag LOCUS_59410 7269274 7270146 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_59410 7270164 7272266 gene locus_tag LOCUS_59420 7270164 7272266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259691.1 protein_id gnl|my_center|LOCUS_59420 7272259 7274586 gene locus_tag LOCUS_59430 7272259 7274586 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_59430 7274583 7275503 gene locus_tag LOCUS_59440 7274583 7275503 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259693.1 protein_id gnl|my_center|LOCUS_59440 7275500 7276477 gene locus_tag LOCUS_59450 7275500 7276477 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_59450 7276522 7279665 gene locus_tag LOCUS_59460 7276522 7279665 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_59460 7279723 7282347 gene locus_tag LOCUS_59470 7279723 7282347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59470 7282507 7287939 gene locus_tag LOCUS_59480 7282507 7287939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 7288097 7289260 gene locus_tag LOCUS_59490 gene trpB 7288097 7289260 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937396.1 protein_id gnl|my_center|LOCUS_59490 7290650 7289826 gene locus_tag LOCUS_59500 7290650 7289826 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_59500 7290833 7291714 gene locus_tag LOCUS_59510 7290833 7291714 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243004.1 protein_id gnl|my_center|LOCUS_59510 7293484 7291730 gene locus_tag LOCUS_59520 7293484 7291730 CDS product HAMP domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392261.1 protein_id gnl|my_center|LOCUS_59520 7293890 7293582 gene locus_tag LOCUS_59530 7293890 7293582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 7294024 7294242 gene locus_tag LOCUS_59540 7294024 7294242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 7296246 7295020 gene locus_tag LOCUS_59550 7296246 7295020 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017008.1 protein_id gnl|my_center|LOCUS_59550 7296417 7297310 gene locus_tag LOCUS_59560 gene rmgP 7296417 7297310 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_59560 7297315 7298211 gene locus_tag LOCUS_59570 7297315 7298211 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830948.1 protein_id gnl|my_center|LOCUS_59570 7298281 7300008 gene locus_tag LOCUS_59580 7298281 7300008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 7300089 7301879 gene locus_tag LOCUS_59590 7300089 7301879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59590 7301891 7303486 gene locus_tag LOCUS_59600 7301891 7303486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 7303506 7306439 gene locus_tag LOCUS_59610 7303506 7306439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59610 7307408 7306503 gene locus_tag LOCUS_59620 7307408 7306503 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447162.1 protein_id gnl|my_center|LOCUS_59620 7308717 7307398 gene locus_tag LOCUS_59630 7308717 7307398 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713010.1 protein_id gnl|my_center|LOCUS_59630 7308878 7309678 gene locus_tag LOCUS_59640 7308878 7309678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59640 7310175 7309675 gene locus_tag LOCUS_59650 7310175 7309675 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223567.1 protein_id gnl|my_center|LOCUS_59650 7311196 7310195 gene locus_tag LOCUS_59660 7311196 7310195 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079769.1 protein_id gnl|my_center|LOCUS_59660 7313621 7311390 gene locus_tag LOCUS_59670 7313621 7311390 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542359.1 protein_id gnl|my_center|LOCUS_59670 7315794 7313965 gene locus_tag LOCUS_59680 7315794 7313965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528118.1 protein_id gnl|my_center|LOCUS_59680 7316708 7315791 gene locus_tag LOCUS_59690 7316708 7315791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528117.1 protein_id gnl|my_center|LOCUS_59690 7316972 7316835 gene locus_tag LOCUS_59700 7316972 7316835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 7318924 7317002 gene locus_tag LOCUS_59710 7318924 7317002 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388575.1 protein_id gnl|my_center|LOCUS_59710 7319362 7320249 gene locus_tag LOCUS_59720 gene dapA 7319362 7320249 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966863.1 protein_id gnl|my_center|LOCUS_59720 7321070 7320363 gene locus_tag LOCUS_59730 7321070 7320363 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549867.1 protein_id gnl|my_center|LOCUS_59730 7321802 7321143 gene locus_tag LOCUS_59740 gene catA 7321802 7321143 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986550.1 protein_id gnl|my_center|LOCUS_59740 7322771 7321995 gene locus_tag LOCUS_59750 7322771 7321995 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003873.1 protein_id gnl|my_center|LOCUS_59750 7323297 7322830 gene locus_tag LOCUS_59760 7323297 7322830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 7323482 7324336 gene locus_tag LOCUS_59770 7323482 7324336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 7325459 7324386 gene locus_tag LOCUS_59780 7325459 7324386 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681714.1 protein_id gnl|my_center|LOCUS_59780 7328872 7325657 gene locus_tag LOCUS_59790 7328872 7325657 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_59790 7329988 7328909 gene locus_tag LOCUS_59800 7329988 7328909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59800 7332152 7330074 gene locus_tag LOCUS_59810 gene tynA 7332152 7330074 CDS product primary-amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206905.1 protein_id gnl|my_center|LOCUS_59810 7332435 7333154 gene locus_tag LOCUS_59820 7332435 7333154 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808110.1 protein_id gnl|my_center|LOCUS_59820 7333135 7335255 gene locus_tag LOCUS_59830 7333135 7335255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 7336352 7335258 gene locus_tag LOCUS_59840 7336352 7335258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59840 7336600 7336355 gene locus_tag LOCUS_59850 7336600 7336355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 7337793 7336600 gene locus_tag LOCUS_59860 gene gerSC 7337793 7336600 CDS product spore germination protein GerSC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252213.1 protein_id gnl|my_center|LOCUS_59860 7339270 7337816 gene locus_tag LOCUS_59870 7339270 7337816 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393538.1 protein_id gnl|my_center|LOCUS_59870 7339437 7340186 gene locus_tag LOCUS_59880 7339437 7340186 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_59880 7340204 7341052 gene locus_tag LOCUS_59890 7340204 7341052 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775269.1 protein_id gnl|my_center|LOCUS_59890 7341180 7342169 gene locus_tag LOCUS_59900 7341180 7342169 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_59900 7342479 7342261 gene locus_tag LOCUS_59910 7342479 7342261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59910 7343660 7342581 gene locus_tag LOCUS_59920 7343660 7342581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 7351859 7343772 gene locus_tag LOCUS_59930 7351859 7343772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 7353575 7351992 gene locus_tag LOCUS_59940 7353575 7351992 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_59940 7354581 7353673 gene locus_tag LOCUS_59950 7354581 7353673 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_59950 7355497 7354598 gene locus_tag LOCUS_59960 7355497 7354598 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924790.1 protein_id gnl|my_center|LOCUS_59960 7358199 7355734 gene locus_tag LOCUS_59970 7358199 7355734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 7360813 7358225 gene locus_tag LOCUS_59980 7360813 7358225 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_59980 7361917 7360826 gene locus_tag LOCUS_59990 7361917 7360826 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068619877.1 protein_id gnl|my_center|LOCUS_59990 7362206 7361940 gene locus_tag LOCUS_60000 7362206 7361940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 7362184 7364562 gene locus_tag LOCUS_60010 7362184 7364562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 7364581 7366320 gene locus_tag LOCUS_60020 7364581 7366320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 7367413 7366424 gene locus_tag LOCUS_60030 gene trpS 7367413 7366424 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_60030 7368309 7367875 gene locus_tag LOCUS_60040 7368309 7367875 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224535.1 protein_id gnl|my_center|LOCUS_60040 7368833 7370338 gene locus_tag LOCUS_60050 7368833 7370338 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994007.1 protein_id gnl|my_center|LOCUS_60050 7371310 7370486 gene locus_tag LOCUS_60060 7371310 7370486 CDS product TIGR02452 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010884064.1 protein_id gnl|my_center|LOCUS_60060 7371873 7371313 gene locus_tag LOCUS_60070 7371873 7371313 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166680960.1 protein_id gnl|my_center|LOCUS_60070 7372743 7372333 gene locus_tag LOCUS_60080 7372743 7372333 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258306.1 protein_id gnl|my_center|LOCUS_60080 7373208 7372762 gene locus_tag LOCUS_60090 7373208 7372762 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616176.1 protein_id gnl|my_center|LOCUS_60090 7374216 7373365 gene locus_tag LOCUS_60100 7374216 7373365 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637560.1 protein_id gnl|my_center|LOCUS_60100 7375058 7374219 gene locus_tag LOCUS_60110 7375058 7374219 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402124.1 protein_id gnl|my_center|LOCUS_60110 7375882 7375121 gene locus_tag LOCUS_60120 7375882 7375121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964710.1 protein_id gnl|my_center|LOCUS_60120 7376640 7375882 gene locus_tag LOCUS_60130 7376640 7375882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964708.1 protein_id gnl|my_center|LOCUS_60130 7377943 7376711 gene locus_tag LOCUS_60140 7377943 7376711 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035915.1 protein_id gnl|my_center|LOCUS_60140 7378863 7377940 gene locus_tag LOCUS_60150 7378863 7377940 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993809.1 protein_id gnl|my_center|LOCUS_60150 7380011 7379001 gene locus_tag LOCUS_60160 7380011 7379001 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964709.1 protein_id gnl|my_center|LOCUS_60160 7380269 7380105 gene locus_tag LOCUS_60170 7380269 7380105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 7380623 7381303 gene locus_tag LOCUS_60180 7380623 7381303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 7381567 7381782 gene locus_tag LOCUS_60190 7381567 7381782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60190 7382257 7382045 gene locus_tag LOCUS_60200 7382257 7382045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 7382647 7382378 gene locus_tag LOCUS_60210 7382647 7382378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 7382558 7383379 gene locus_tag LOCUS_60220 7382558 7383379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60220 7387769 7383753 gene locus_tag LOCUS_60230 7387769 7383753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60230 7387908 7388399 gene locus_tag LOCUS_60240 7387908 7388399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60240 7388424 7388753 gene locus_tag LOCUS_60250 7388424 7388753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 7389790 7388828 gene locus_tag LOCUS_60260 7389790 7388828 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036625881.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60260 7389932 7389717 gene locus_tag LOCUS_60270 7389932 7389717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60270 7390574 7390044 gene locus_tag LOCUS_60280 7390574 7390044 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223840.1 protein_id gnl|my_center|LOCUS_60280 7390916 7390731 gene locus_tag LOCUS_60290 7390916 7390731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 7391716 7390913 gene locus_tag LOCUS_60300 7391716 7390913 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228234.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60300 7393053 7391923 gene locus_tag LOCUS_60310 7393053 7391923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60310 7393374 7394063 gene locus_tag LOCUS_60320 7393374 7394063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60320 7394207 7394473 gene locus_tag LOCUS_60330 7394207 7394473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60330 7395596 7394721 gene locus_tag LOCUS_60340 7395596 7394721 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_60340 7396577 7395612 gene locus_tag LOCUS_60350 7396577 7395612 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_60350 7398329 7396683 gene locus_tag LOCUS_60360 7398329 7396683 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_60360 7400762 7398474 gene locus_tag LOCUS_60370 7400762 7398474 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968004.1 protein_id gnl|my_center|LOCUS_60370 7401730 7400948 gene locus_tag LOCUS_60380 7401730 7400948 CDS product PaaX family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230091.1 protein_id gnl|my_center|LOCUS_60380 7401869 7402558 gene locus_tag LOCUS_60390 7401869 7402558 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_60390 7402589 7403509 gene locus_tag LOCUS_60400 7402589 7403509 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 protein_id gnl|my_center|LOCUS_60400 7404037 7403543 gene locus_tag LOCUS_60410 7404037 7403543 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606669.1 protein_id gnl|my_center|LOCUS_60410 7405055 7404099 gene locus_tag LOCUS_60420 7405055 7404099 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231290.1 protein_id gnl|my_center|LOCUS_60420 7405517 7406401 gene locus_tag LOCUS_60430 7405517 7406401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60430 7406558 7406379 gene locus_tag LOCUS_60440 7406558 7406379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60440 7407651 7406527 gene locus_tag LOCUS_60450 7407651 7406527 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036625881.1 protein_id gnl|my_center|LOCUS_60450 7408336 7407758 gene locus_tag LOCUS_60460 7408336 7407758 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_60460 7409509 7408565 gene locus_tag LOCUS_60470 7409509 7408565 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813471.1 protein_id gnl|my_center|LOCUS_60470 7410923 7410054 gene locus_tag LOCUS_60480 7410923 7410054 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637560.1 protein_id gnl|my_center|LOCUS_60480 7412380 7410953 gene locus_tag LOCUS_60490 7412380 7410953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 7413197 7412517 gene locus_tag LOCUS_60500 7413197 7412517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60500 7413384 7414313 gene locus_tag LOCUS_60510 gene ytlI 7413384 7414313 CDS product LysR family transcriptional regulator YtlI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398915.1 protein_id gnl|my_center|LOCUS_60510 7415865 7414354 gene locus_tag LOCUS_60520 7415865 7414354 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726682.1 protein_id gnl|my_center|LOCUS_60520 7416435 7415869 gene locus_tag LOCUS_60530 7416435 7415869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 7417590 7416532 gene locus_tag LOCUS_60540 7417590 7416532 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930003.1 protein_id gnl|my_center|LOCUS_60540 7417764 7418540 gene locus_tag LOCUS_60550 7417764 7418540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 7420841 7418502 gene locus_tag LOCUS_60560 7420841 7418502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 7423074 7420870 gene locus_tag LOCUS_60570 7423074 7420870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 7423387 7424346 gene locus_tag LOCUS_60580 7423387 7424346 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_60580 7424361 7425227 gene locus_tag LOCUS_60590 7424361 7425227 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803822.1 protein_id gnl|my_center|LOCUS_60590 7425340 7426896 gene locus_tag LOCUS_60600 7425340 7426896 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972693.1 protein_id gnl|my_center|LOCUS_60600 7426939 7427949 gene locus_tag LOCUS_60610 7426939 7427949 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192249737.1 protein_id gnl|my_center|LOCUS_60610 7428155 7427973 gene locus_tag LOCUS_60620 7428155 7427973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 7430500 7428161 gene locus_tag LOCUS_60630 7430500 7428161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 7431572 7430637 gene locus_tag LOCUS_60640 7431572 7430637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 7432716 7431715 gene locus_tag LOCUS_60650 7432716 7431715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 7435059 7432798 gene locus_tag LOCUS_60660 7435059 7432798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 7435971 7435108 gene locus_tag LOCUS_60670 7435971 7435108 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804067.1 protein_id gnl|my_center|LOCUS_60670 7436870 7435965 gene locus_tag LOCUS_60680 7436870 7435965 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_60680 7438601 7436964 gene locus_tag LOCUS_60690 7438601 7436964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 7438948 7439685 gene locus_tag LOCUS_60700 7438948 7439685 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965648.1 protein_id gnl|my_center|LOCUS_60700 7439685 7440461 gene locus_tag LOCUS_60710 7439685 7440461 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965648.1 protein_id gnl|my_center|LOCUS_60710 7440597 7441892 gene locus_tag LOCUS_60720 7440597 7441892 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884513.1 protein_id gnl|my_center|LOCUS_60720 7442092 7443006 gene locus_tag LOCUS_60730 gene hprK 7442092 7443006 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_60730 7444201 7443092 gene locus_tag LOCUS_60740 7444201 7443092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 7444416 7445012 gene locus_tag LOCUS_60750 7444416 7445012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60750 7445351 7446472 gene locus_tag LOCUS_60760 gene ssuD 7445351 7446472 CDS product FMNH2-dependent alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192866.1 protein_id gnl|my_center|LOCUS_60760 7448114 7447287 gene locus_tag LOCUS_60770 7448114 7447287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975298.1 protein_id gnl|my_center|LOCUS_60770 7449135 7448128 gene locus_tag LOCUS_60780 7449135 7448128 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726676.1 protein_id gnl|my_center|LOCUS_60780 7449941 7449171 gene locus_tag LOCUS_60790 7449941 7449171 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975811.1 protein_id gnl|my_center|LOCUS_60790 7450298 7451629 gene locus_tag LOCUS_60800 7450298 7451629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60800 7451660 7453354 gene locus_tag LOCUS_60810 7451660 7453354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384278.1 protein_id gnl|my_center|LOCUS_60810 7453379 7454305 gene locus_tag LOCUS_60820 7453379 7454305 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928488.1 protein_id gnl|my_center|LOCUS_60820 7454477 7454887 gene locus_tag LOCUS_60830 7454477 7454887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60830 7456369 7454912 gene locus_tag LOCUS_60840 7456369 7454912 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_60840 7456668 7457564 gene locus_tag LOCUS_60850 7456668 7457564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_60850 7457631 7459880 gene locus_tag LOCUS_60860 7457631 7459880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60860 7460073 7461305 gene locus_tag LOCUS_60870 gene sndC 7460073 7461305 CDS product N-acetyl amino acid acetylase SndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245681.1 protein_id gnl|my_center|LOCUS_60870 7463322 7461421 gene locus_tag LOCUS_60880 7463322 7461421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60880 7464584 7463412 gene locus_tag LOCUS_60890 7464584 7463412 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234334.1 protein_id gnl|my_center|LOCUS_60890 7466782 7464725 gene locus_tag LOCUS_60900 7466782 7464725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 7467056 7467754 gene locus_tag LOCUS_60910 gene phoP 7467056 7467754 CDS product two-component system response regulator PhoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065226.1 protein_id gnl|my_center|LOCUS_60910 7467763 7469250 gene locus_tag LOCUS_60920 7467763 7469250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 7469420 7470625 gene locus_tag LOCUS_60930 7469420 7470625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60930 7470639 7471748 gene locus_tag LOCUS_60940 7470639 7471748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60940 7471776 7472474 gene locus_tag LOCUS_60950 7471776 7472474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 7473288 7472632 gene locus_tag LOCUS_60960 7473288 7472632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60960 7473599 7473285 gene locus_tag LOCUS_60970 7473599 7473285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60970 7476449 7473750 gene locus_tag LOCUS_60980 7476449 7473750 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_60980 7476827 7477270 gene locus_tag LOCUS_60990 7476827 7477270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60990 7478035 7477436 gene locus_tag LOCUS_61000 7478035 7477436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61000 7478439 7478032 gene locus_tag LOCUS_61010 7478439 7478032 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886646.1 protein_id gnl|my_center|LOCUS_61010 7479728 7478514 gene locus_tag LOCUS_61020 7479728 7478514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477904.1 protein_id gnl|my_center|LOCUS_61020 7480482 7479880 gene locus_tag LOCUS_61030 7480482 7479880 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254429.1 protein_id gnl|my_center|LOCUS_61030 7482303 7480738 gene locus_tag LOCUS_61040 7482303 7480738 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545536.1 protein_id gnl|my_center|LOCUS_61040 7482566 7483129 gene locus_tag LOCUS_61050 7482566 7483129 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028964.1 protein_id gnl|my_center|LOCUS_61050 7483153 7484013 gene locus_tag LOCUS_61060 7483153 7484013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61060 7484044 7484946 gene locus_tag LOCUS_61070 7484044 7484946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 7485884 7484994 gene locus_tag LOCUS_61080 7485884 7484994 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242958.1 protein_id gnl|my_center|LOCUS_61080 7485997 7486992 gene locus_tag LOCUS_61090 7485997 7486992 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_61090 7487027 7487431 gene locus_tag LOCUS_61100 7487027 7487431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 7488194 7487487 gene locus_tag LOCUS_61110 7488194 7487487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61110 7488817 7488230 gene locus_tag LOCUS_61120 7488817 7488230 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001789900.1 protein_id gnl|my_center|LOCUS_61120 7488984 7489343 gene locus_tag LOCUS_61130 7488984 7489343 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156908.1 protein_id gnl|my_center|LOCUS_61130 7489794 7489405 gene locus_tag LOCUS_61140 7489794 7489405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61140 7491265 7489862 gene locus_tag LOCUS_61150 7491265 7489862 CDS product allantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243112.1 protein_id gnl|my_center|LOCUS_61150 7492381 7491335 gene locus_tag LOCUS_61160 7492381 7491335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 7493300 7492431 gene locus_tag LOCUS_61170 7493300 7492431 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_61170 7494199 7493300 gene locus_tag LOCUS_61180 7494199 7493300 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_61180 7495580 7494240 gene locus_tag LOCUS_61190 7495580 7494240 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530310.1 protein_id gnl|my_center|LOCUS_61190 7496329 7495667 gene locus_tag LOCUS_61200 7496329 7495667 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083340.1 protein_id gnl|my_center|LOCUS_61200 7496706 7497704 gene locus_tag LOCUS_61210 7496706 7497704 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 protein_id gnl|my_center|LOCUS_61210 7497694 7498932 gene locus_tag LOCUS_61220 7497694 7498932 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_61220 7498929 7499927 gene locus_tag LOCUS_61230 7498929 7499927 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 protein_id gnl|my_center|LOCUS_61230 7499924 7500913 gene locus_tag LOCUS_61240 7499924 7500913 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947356.1 protein_id gnl|my_center|LOCUS_61240 7500910 7502238 gene locus_tag LOCUS_61250 7500910 7502238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 protein_id gnl|my_center|LOCUS_61250 7502235 7503395 gene locus_tag LOCUS_61260 7502235 7503395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615347.1 protein_id gnl|my_center|LOCUS_61260 7503417 7504280 gene locus_tag LOCUS_61270 7503417 7504280 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228540.1 protein_id gnl|my_center|LOCUS_61270 7505526 7504312 gene locus_tag LOCUS_61280 7505526 7504312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61280 7505659 7506840 gene locus_tag LOCUS_61290 7505659 7506840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61290 7508603 7507119 gene locus_tag LOCUS_61300 7508603 7507119 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890812.1 protein_id gnl|my_center|LOCUS_61300 7508722 7509273 gene locus_tag LOCUS_61310 7508722 7509273 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286354.1 protein_id gnl|my_center|LOCUS_61310 7509789 7509301 gene locus_tag LOCUS_61320 7509789 7509301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61320 7511590 7509818 gene locus_tag LOCUS_61330 7511590 7509818 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_61330 7511759 7512073 gene locus_tag LOCUS_61340 7511759 7512073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 7512115 7512408 gene locus_tag LOCUS_61350 7512115 7512408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61350 7513732 7512464 gene locus_tag LOCUS_61360 7513732 7512464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 7514267 7513719 gene locus_tag LOCUS_61370 7514267 7513719 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_61370 7515475 7514654 gene locus_tag LOCUS_61380 7515475 7514654 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383326.1 protein_id gnl|my_center|LOCUS_61380 7517717 7515762 gene locus_tag LOCUS_61390 7517717 7515762 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986616.1 protein_id gnl|my_center|LOCUS_61390 7519237 7518194 gene locus_tag LOCUS_61400 7519237 7518194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 7519712 7521190 gene locus_tag LOCUS_61410 7519712 7521190 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_61410 7521300 7524671 gene locus_tag LOCUS_61420 7521300 7524671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 7524912 7526729 gene locus_tag LOCUS_61430 7524912 7526729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61430 7528196 7527285 gene locus_tag LOCUS_61440 gene ligD 7528196 7527285 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393573.1 protein_id gnl|my_center|LOCUS_61440 7528910 7528407 gene locus_tag LOCUS_61450 gene mgsA 7528910 7528407 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_61450 7529137 7529463 gene locus_tag LOCUS_61460 7529137 7529463 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461621.1 protein_id gnl|my_center|LOCUS_61460 7529476 7530768 gene locus_tag LOCUS_61470 7529476 7530768 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243030.1 protein_id gnl|my_center|LOCUS_61470 7530806 7531231 gene locus_tag LOCUS_61480 7530806 7531231 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_61480 7531474 7532424 gene locus_tag LOCUS_61490 gene ligD 7531474 7532424 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879221.1 protein_id gnl|my_center|LOCUS_61490 7533245 7532643 gene locus_tag LOCUS_61500 7533245 7532643 CDS product DUF2812 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589231.1 protein_id gnl|my_center|LOCUS_61500 7533552 7533247 gene locus_tag LOCUS_61510 7533552 7533247 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194196.1 protein_id gnl|my_center|LOCUS_61510 7534400 7533723 gene locus_tag LOCUS_61520 7534400 7533723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 7534819 7534466 gene locus_tag LOCUS_61530 7534819 7534466 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_61530 7534961 7535305 gene locus_tag LOCUS_61540 7534961 7535305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61540 7535561 7535316 gene locus_tag LOCUS_61550 7535561 7535316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61550 7535677 7535814 gene locus_tag LOCUS_61560 7535677 7535814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61560 7536764 7535922 gene locus_tag LOCUS_61570 7536764 7535922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61570 7536882 7537718 gene locus_tag LOCUS_61580 7536882 7537718 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_61580 7538304 7537786 gene locus_tag LOCUS_61590 7538304 7537786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61590 7539151 7538330 gene locus_tag LOCUS_61600 7539151 7538330 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803678.1 protein_id gnl|my_center|LOCUS_61600 7539280 7540086 gene locus_tag LOCUS_61610 7539280 7540086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61610 7540277 7540558 gene locus_tag LOCUS_61620 7540277 7540558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 7540718 7541236 gene locus_tag LOCUS_61630 7540718 7541236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 7542890 7542492 gene locus_tag LOCUS_61640 7542890 7542492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 7544292 7543582 gene locus_tag LOCUS_61650 7544292 7543582 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759544.1 protein_id gnl|my_center|LOCUS_61650 7544396 7544755 gene locus_tag LOCUS_61660 7544396 7544755 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_61660 7544889 7545326 gene locus_tag LOCUS_61670 7544889 7545326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61670 7545753 7551401 gene locus_tag LOCUS_61680 7545753 7551401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 7552458 7551616 gene locus_tag LOCUS_61690 7552458 7551616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 7552675 7553661 gene locus_tag LOCUS_61700 gene tdh 7552675 7553661 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172666275.1 protein_id gnl|my_center|LOCUS_61700 7553658 7554665 gene locus_tag LOCUS_61710 gene bchC 7553658 7554665 CDS product chlorophyll synthesis pathway protein BchC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390729.1 protein_id gnl|my_center|LOCUS_61710 7554650 7555354 gene locus_tag LOCUS_61720 7554650 7555354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 7559700 7555498 gene locus_tag LOCUS_61730 7559700 7555498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61730 7562126 7559745 gene locus_tag LOCUS_61740 7562126 7559745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61740 7563045 7562167 gene locus_tag LOCUS_61750 7563045 7562167 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582589.1 protein_id gnl|my_center|LOCUS_61750 7563947 7563072 gene locus_tag LOCUS_61760 7563947 7563072 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582590.1 protein_id gnl|my_center|LOCUS_61760 7565398 7563962 gene locus_tag LOCUS_61770 7565398 7563962 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582591.1 protein_id gnl|my_center|LOCUS_61770 7565528 7566475 gene locus_tag LOCUS_61780 7565528 7566475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61780 7568204 7566447 gene locus_tag LOCUS_61790 gene yesM 7568204 7566447 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_61790 7569010 7568201 gene locus_tag LOCUS_61800 7569010 7568201 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477526.1 protein_id gnl|my_center|LOCUS_61800 7569967 7569224 gene locus_tag LOCUS_61810 7569967 7569224 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_61810 7570161 7570715 gene locus_tag LOCUS_61820 7570161 7570715 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038534996.1 protein_id gnl|my_center|LOCUS_61820 7571618 7570812 gene locus_tag LOCUS_61830 7571618 7570812 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660564.1 protein_id gnl|my_center|LOCUS_61830 7572980 7571841 gene locus_tag LOCUS_61840 7572980 7571841 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710628.1 protein_id gnl|my_center|LOCUS_61840 7573756 7573091 gene locus_tag LOCUS_61850 7573756 7573091 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461502.1 protein_id gnl|my_center|LOCUS_61850 7574625 7573855 gene locus_tag LOCUS_61860 gene lieB 7574625 7573855 CDS product multidrug efflux ABC transporter permease LieB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931920.1 protein_id gnl|my_center|LOCUS_61860 7575384 7574626 gene locus_tag LOCUS_61870 7575384 7574626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017474.1 protein_id gnl|my_center|LOCUS_61870 7575749 7575399 gene locus_tag LOCUS_61880 7575749 7575399 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889650.1 protein_id gnl|my_center|LOCUS_61880 7576109 7575762 gene locus_tag LOCUS_61890 7576109 7575762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61890 7576432 7576106 gene locus_tag LOCUS_61900 7576432 7576106 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429487.1 protein_id gnl|my_center|LOCUS_61900 7576665 7576474 gene locus_tag LOCUS_61910 7576665 7576474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61910 7577945 7576659 gene locus_tag LOCUS_61920 7577945 7576659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 7579413 7578682 gene locus_tag LOCUS_61930 gene udp 7579413 7578682 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_61930 7580093 7579416 gene locus_tag LOCUS_61940 7580093 7579416 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_61940 7581051 7580128 gene locus_tag LOCUS_61950 7581051 7580128 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969293.1 protein_id gnl|my_center|LOCUS_61950 7582102 7581035 gene locus_tag LOCUS_61960 7582102 7581035 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969292.1 protein_id gnl|my_center|LOCUS_61960 7583594 7582095 gene locus_tag LOCUS_61970 7583594 7582095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964022.1 protein_id gnl|my_center|LOCUS_61970 7584763 7583684 gene locus_tag LOCUS_61980 7584763 7583684 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869312.1 protein_id gnl|my_center|LOCUS_61980 7585071 7586306 gene locus_tag LOCUS_61990 7585071 7586306 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365630.1 protein_id gnl|my_center|LOCUS_61990 7586589 7586975 gene locus_tag LOCUS_62000 7586589 7586975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 7587172 7587954 gene locus_tag LOCUS_62010 7587172 7587954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 7589055 7588189 gene locus_tag LOCUS_62020 7589055 7588189 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637552.1 protein_id gnl|my_center|LOCUS_62020 7590499 7589285 gene locus_tag LOCUS_62030 7590499 7589285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256286.1 protein_id gnl|my_center|LOCUS_62030 7590733 7591212 gene locus_tag LOCUS_62040 7590733 7591212 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386773.1 protein_id gnl|my_center|LOCUS_62040 7591603 7591271 gene locus_tag LOCUS_62050 7591603 7591271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 7591816 7592625 gene locus_tag LOCUS_62060 gene motA 7591816 7592625 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458996.1 protein_id gnl|my_center|LOCUS_62060 7592603 7593463 gene locus_tag LOCUS_62070 7592603 7593463 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809827.1 protein_id gnl|my_center|LOCUS_62070 7594442 7593606 gene locus_tag LOCUS_62080 7594442 7593606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62080 7594681 7595139 gene locus_tag LOCUS_62090 gene tadA 7594681 7595139 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_62090 7595346 7595128 gene locus_tag LOCUS_62100 7595346 7595128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62100 7595550 7596254 gene locus_tag LOCUS_62110 7595550 7596254 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948494.1 protein_id gnl|my_center|LOCUS_62110 7596350 7597606 gene locus_tag LOCUS_62120 7596350 7597606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62120 7597716 7598408 gene locus_tag LOCUS_62130 7597716 7598408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399472.1 protein_id gnl|my_center|LOCUS_62130 7598405 7600981 gene locus_tag LOCUS_62140 7598405 7600981 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948492.1 protein_id gnl|my_center|LOCUS_62140 7602505 7601579 gene locus_tag LOCUS_62150 7602505 7601579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62150 7603560 7602550 gene locus_tag LOCUS_62160 7603560 7602550 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967753.1 protein_id gnl|my_center|LOCUS_62160 7608529 7603712 gene locus_tag LOCUS_62170 7608529 7603712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62170 7610431 7608863 gene locus_tag LOCUS_62180 7610431 7608863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62180 7611337 7610465 gene locus_tag LOCUS_62190 7611337 7610465 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_62190 7612268 7611357 gene locus_tag LOCUS_62200 7612268 7611357 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_62200 7614174 7612357 gene locus_tag LOCUS_62210 7614174 7612357 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_62210 7615067 7614180 gene locus_tag LOCUS_62220 7615067 7614180 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815859.1 protein_id gnl|my_center|LOCUS_62220 7615961 7615191 gene locus_tag LOCUS_62230 7615961 7615191 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_62230 7616105 7617067 gene locus_tag LOCUS_62240 7616105 7617067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62240 7618375 7617362 gene locus_tag LOCUS_62250 7618375 7617362 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091307767.1 protein_id gnl|my_center|LOCUS_62250 7618546 7618621 gene locus_tag LOCUS_t00670 7618546 7618621 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7619943 7618675 gene locus_tag LOCUS_62260 7619943 7618675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 7620960 7620082 gene locus_tag LOCUS_62270 7620960 7620082 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_62270 7621867 7620986 gene locus_tag LOCUS_62280 7621867 7620986 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_62280 7623347 7621860 gene locus_tag LOCUS_62290 7623347 7621860 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814254.1 protein_id gnl|my_center|LOCUS_62290 7624730 7623534 gene locus_tag LOCUS_62300 7624730 7623534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 7626196 7624727 gene locus_tag LOCUS_62310 7626196 7624727 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948337.1 protein_id gnl|my_center|LOCUS_62310 7626897 7626199 gene locus_tag LOCUS_62320 7626897 7626199 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974745.1 protein_id gnl|my_center|LOCUS_62320 7627152 7634705 gene locus_tag LOCUS_62330 7627152 7634705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 7635147 7635956 gene locus_tag LOCUS_62340 7635147 7635956 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965862.1 protein_id gnl|my_center|LOCUS_62340 7635953 7636186 gene locus_tag LOCUS_62350 7635953 7636186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62350 7636233 7636655 gene locus_tag LOCUS_62360 7636233 7636655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62360 7637061 7636660 gene locus_tag LOCUS_62370 7637061 7636660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62370 7638360 7637080 gene locus_tag LOCUS_62380 7638360 7637080 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_62380 7638438 7639112 gene locus_tag LOCUS_62390 7638438 7639112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62390 7639393 7639109 gene locus_tag LOCUS_62400 7639393 7639109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 7640692 7639412 gene locus_tag LOCUS_62410 7640692 7639412 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_62410 7643568 7640896 gene locus_tag LOCUS_62420 7643568 7640896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62420 7643832 7644515 gene locus_tag LOCUS_62430 7643832 7644515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 7644536 7644997 gene locus_tag LOCUS_62440 gene lepB 7644536 7644997 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_62440 7645014 7645340 gene locus_tag LOCUS_62450 7645014 7645340 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_62450 7645838 7645356 gene locus_tag LOCUS_62460 7645838 7645356 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288269.1 protein_id gnl|my_center|LOCUS_62460 7645921 7646754 gene locus_tag LOCUS_62470 7645921 7646754 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_62470 7646883 7647629 gene locus_tag LOCUS_62480 7646883 7647629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62480 7648244 7648975 gene locus_tag LOCUS_62490 7648244 7648975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 7650116 7649010 gene locus_tag LOCUS_62500 7650116 7649010 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732398.1 protein_id gnl|my_center|LOCUS_62500 7650511 7650113 gene locus_tag LOCUS_62510 7650511 7650113 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721477.1 protein_id gnl|my_center|LOCUS_62510 7650674 7650750 gene locus_tag LOCUS_t00680 7650674 7650750 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7650898 7651581 gene locus_tag LOCUS_62520 gene hitR 7650898 7651581 CDS product envelope stress response regulator transcription factor HitR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612413.1 protein_id gnl|my_center|LOCUS_62520 7651574 7652938 gene locus_tag LOCUS_62530 7651574 7652938 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839485.1 protein_id gnl|my_center|LOCUS_62530 7653009 7656116 gene locus_tag LOCUS_62540 7653009 7656116 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033514.1 protein_id gnl|my_center|LOCUS_62540 7656317 7658101 gene locus_tag LOCUS_62550 7656317 7658101 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018463.1 protein_id gnl|my_center|LOCUS_62550 7658098 7659156 gene locus_tag LOCUS_62560 7658098 7659156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989621.1 protein_id gnl|my_center|LOCUS_62560 7660025 7659207 gene locus_tag LOCUS_62570 7660025 7659207 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461645.1 protein_id gnl|my_center|LOCUS_62570 7661344 7660631 gene locus_tag LOCUS_62580 7661344 7660631 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000539282.1 protein_id gnl|my_center|LOCUS_62580 7662372 7661356 gene locus_tag LOCUS_62590 7662372 7661356 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227484.1 protein_id gnl|my_center|LOCUS_62590 7663123 7662365 gene locus_tag LOCUS_62600 7663123 7662365 CDS product KDGP aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181910.1 protein_id gnl|my_center|LOCUS_62600 7664228 7663125 gene locus_tag LOCUS_62610 7664228 7663125 CDS product DgaE family pyridoxal phosphate-dependent ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510089.1 protein_id gnl|my_center|LOCUS_62610 7665342 7664194 gene locus_tag LOCUS_62620 7665342 7664194 CDS product amidohydrolase/deacetylase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139971.1 protein_id gnl|my_center|LOCUS_62620 7665505 7667280 gene locus_tag LOCUS_62630 7665505 7667280 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_62630 7667277 7668836 gene locus_tag LOCUS_62640 7667277 7668836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62640 7668991 7670367 gene locus_tag LOCUS_62650 7668991 7670367 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969647.1 protein_id gnl|my_center|LOCUS_62650 7670502 7671374 gene locus_tag LOCUS_62660 7670502 7671374 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_62660 7671413 7672315 gene locus_tag LOCUS_62670 7671413 7672315 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228625.1 protein_id gnl|my_center|LOCUS_62670 7673638 7672562 gene locus_tag LOCUS_62680 7673638 7672562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62680 7674714 7673776 gene locus_tag LOCUS_62690 7674714 7673776 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_62690 7675111 7674956 gene locus_tag LOCUS_62700 7675111 7674956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62700 7675315 7675133 gene locus_tag LOCUS_62710 7675315 7675133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62710 7675674 7675327 gene locus_tag LOCUS_62720 7675674 7675327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 7676125 7676445 gene locus_tag LOCUS_62730 7676125 7676445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 7676639 7676424 gene locus_tag LOCUS_62740 7676639 7676424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 7676589 7677377 gene locus_tag LOCUS_62750 7676589 7677377 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_62750 7677715 7677948 gene locus_tag LOCUS_62760 7677715 7677948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62760 7678388 7678300 gene locus_tag LOCUS_t00690 7678388 7678300 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7679753 7678467 gene locus_tag LOCUS_62770 gene serS 7679753 7678467 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247131.1 protein_id gnl|my_center|LOCUS_62770 7680412 7679831 gene locus_tag LOCUS_62780 gene pdxT 7680412 7679831 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238799.1 protein_id gnl|my_center|LOCUS_62780 7681451 7680570 gene locus_tag LOCUS_62790 gene pdxS 7681451 7680570 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_62790 7682879 7681539 gene locus_tag LOCUS_62800 gene dacA 7682879 7681539 CDS product D-alanyl-D-alanine carboxypeptidase DacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011053075.1 protein_id gnl|my_center|LOCUS_62800 7684491 7683034 gene locus_tag LOCUS_62810 gene guaB 7684491 7683034 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_62810 7685372 7685151 gene locus_tag LOCUS_62820 7685372 7685151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 7685803 7685692 gene locus_tag LOCUS_r00170 7685803 7685692 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7688868 7685942 gene locus_tag LOCUS_r00180 7688868 7685942 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7690604 7689054 gene locus_tag LOCUS_r00190 7690604 7689054 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7691232 7691035 gene locus_tag LOCUS_62830 7691232 7691035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62830 7692466 7691138 gene locus_tag LOCUS_62840 gene ltrA 7692466 7691138 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 protein_id gnl|my_center|LOCUS_62840 7694689 7693169 gene locus_tag LOCUS_62850 gene lysS 7694689 7693169 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_62850 7695304 7694828 gene locus_tag LOCUS_62860 gene greA 7695304 7694828 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_62860 7696563 7695544 gene locus_tag LOCUS_62870 gene dusB 7696563 7695544 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912251.1 protein_id gnl|my_center|LOCUS_62870 7697079 7696576 gene locus_tag LOCUS_62880 gene folK 7697079 7696576 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059445.1 protein_id gnl|my_center|LOCUS_62880 7697485 7697126 gene locus_tag LOCUS_62890 gene folB 7697485 7697126 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_62890 7698364 7697501 gene locus_tag LOCUS_62900 gene folP 7698364 7697501 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 protein_id gnl|my_center|LOCUS_62900 7699299 7698361 gene locus_tag LOCUS_62910 gene pabC 7699299 7698361 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909893.1 protein_id gnl|my_center|LOCUS_62910 7699874 7699296 gene locus_tag LOCUS_62920 gene pabA 7699874 7699296 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602293.1 protein_id gnl|my_center|LOCUS_62920 7701502 7699871 gene locus_tag LOCUS_62930 gene trpE 7701502 7699871 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_62930 7701700 7702860 gene locus_tag LOCUS_62940 7701700 7702860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62940 7702975 7704423 gene locus_tag LOCUS_62950 7702975 7704423 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485467.1 protein_id gnl|my_center|LOCUS_62950 7704518 7704898 gene locus_tag LOCUS_62960 7704518 7704898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272592.1 protein_id gnl|my_center|LOCUS_62960 7706102 7705164 gene locus_tag LOCUS_62970 gene cysK 7706102 7705164 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244491.1 protein_id gnl|my_center|LOCUS_62970 7707207 7706239 gene locus_tag LOCUS_62980 7707207 7706239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 7708110 7707232 gene locus_tag LOCUS_62990 gene hslO 7708110 7707232 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148598.1 protein_id gnl|my_center|LOCUS_62990 7708955 7708191 gene locus_tag LOCUS_63000 7708955 7708191 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_63000 7709851 7708952 gene locus_tag LOCUS_63010 gene nadC 7709851 7708952 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_63010 7711457 7709844 gene locus_tag LOCUS_63020 gene nadB 7711457 7709844 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119573.1 protein_id gnl|my_center|LOCUS_63020 7712439 7711501 gene locus_tag LOCUS_63030 gene nadA 7712439 7711501 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_63030 7712593 7712727 gene locus_tag LOCUS_63040 7712593 7712727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63040 7712816 7713355 gene locus_tag LOCUS_63050 7712816 7713355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63050 7713289 7714905 gene locus_tag LOCUS_63060 7713289 7714905 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966776.1 protein_id gnl|my_center|LOCUS_63060 7715023 7715568 gene locus_tag LOCUS_63070 7715023 7715568 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438320.1 protein_id gnl|my_center|LOCUS_63070 7715561 7716727 gene locus_tag LOCUS_63080 7715561 7716727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 7718846 7716828 gene locus_tag LOCUS_63090 gene ftsH 7718846 7716828 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079659.1 protein_id gnl|my_center|LOCUS_63090 7719493 7718951 gene locus_tag LOCUS_63100 7719493 7718951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_63100 7720959 7719517 gene locus_tag LOCUS_63110 gene tilS 7720959 7719517 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391652.1 protein_id gnl|my_center|LOCUS_63110 7721906 7720983 gene locus_tag LOCUS_63120 gene prkT 7721906 7720983 CDS product serine/threonine protein kinase PrkT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966278.1 protein_id gnl|my_center|LOCUS_63120 7722642 7721890 gene locus_tag LOCUS_63130 7722642 7721890 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068698953.1 protein_id gnl|my_center|LOCUS_63130 7722829 7722674 gene locus_tag LOCUS_63140 7722829 7722674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 7723716 7722982 gene locus_tag LOCUS_63150 7723716 7722982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63150 7726428 7723729 gene locus_tag LOCUS_63160 7726428 7723729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 7727567 7726692 gene locus_tag LOCUS_63170 7727567 7726692 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027325.1 protein_id gnl|my_center|LOCUS_63170 7727687 7728859 gene locus_tag LOCUS_63180 7727687 7728859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63180 7729656 7729063 gene locus_tag LOCUS_63190 7729656 7729063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63190 7732303 7729697 gene locus_tag LOCUS_63200 gene spoIIE 7732303 7729697 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243026.1 protein_id gnl|my_center|LOCUS_63200 7732681 7733361 gene locus_tag LOCUS_63210 7732681 7733361 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_63210 7734059 7733601 gene locus_tag LOCUS_63220 7734059 7733601 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218379.1 protein_id gnl|my_center|LOCUS_63220 7734520 7734203 gene locus_tag LOCUS_63230 7734520 7734203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 7735263 7734640 gene locus_tag LOCUS_63240 7735263 7734640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 7735541 7735260 gene locus_tag LOCUS_63250 gene yabP 7735541 7735260 CDS product sporulation protein YabP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059104.1 protein_id gnl|my_center|LOCUS_63250 7735944 7735663 gene locus_tag LOCUS_63260 7735944 7735663 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234876.1 protein_id gnl|my_center|LOCUS_63260 7736220 7735948 gene locus_tag LOCUS_63270 7736220 7735948 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_63270 7737895 7736411 gene locus_tag LOCUS_63280 gene mazG 7737895 7736411 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014237.1 protein_id gnl|my_center|LOCUS_63280 7740649 7738985 gene locus_tag LOCUS_63290 7740649 7738985 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044001.1 protein_id gnl|my_center|LOCUS_63290 7743198 7741078 gene locus_tag LOCUS_63300 7743198 7741078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 7745720 7743366 gene locus_tag LOCUS_63310 7745720 7743366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63310 7748571 7746193 gene locus_tag LOCUS_63320 7748571 7746193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63320 7749466 7748624 gene locus_tag LOCUS_63330 7749466 7748624 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_63330 7750420 7749473 gene locus_tag LOCUS_63340 7750420 7749473 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_63340 7752109 7750736 gene locus_tag LOCUS_63350 7752109 7750736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 7754378 7752216 gene locus_tag LOCUS_63360 7754378 7752216 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929205.1 protein_id gnl|my_center|LOCUS_63360 7755553 7754534 gene locus_tag LOCUS_63370 7755553 7754534 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_63370 7756284 7755742 gene locus_tag LOCUS_63380 gene spoVT 7756284 7755742 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_63380 7763176 7756601 gene locus_tag LOCUS_63390 7763176 7756601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63390 7764102 7763413 gene locus_tag LOCUS_63400 7764102 7763413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63400 7772651 7764165 gene locus_tag LOCUS_63410 7772651 7764165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63410 7780310 7772679 gene locus_tag LOCUS_63420 7780310 7772679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 7785809 7780413 gene locus_tag LOCUS_63430 7785809 7780413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63430 7787099 7786311 gene locus_tag LOCUS_63440 7787099 7786311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 7787808 7787122 gene locus_tag LOCUS_63450 gene ureG 7787808 7787122 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021389.1 protein_id gnl|my_center|LOCUS_63450 7788532 7787843 gene locus_tag LOCUS_63460 7788532 7787843 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 protein_id gnl|my_center|LOCUS_63460 7790261 7788549 gene locus_tag LOCUS_63470 gene ureC 7790261 7788549 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_63470 7790631 7790254 gene locus_tag LOCUS_63480 7790631 7790254 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_63480 7791021 7790719 gene locus_tag LOCUS_63490 7791021 7790719 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099389.1 protein_id gnl|my_center|LOCUS_63490 7791982 7791002 gene locus_tag LOCUS_63500 7791982 7791002 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215631.1 protein_id gnl|my_center|LOCUS_63500 7792710 7792003 gene locus_tag LOCUS_63510 gene urtE 7792710 7792003 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_63510 7793473 7792697 gene locus_tag LOCUS_63520 gene urtD 7793473 7792697 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105136.1 protein_id gnl|my_center|LOCUS_63520 7794536 7793424 gene locus_tag LOCUS_63530 gene urtC 7794536 7793424 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_63530 7795490 7794588 gene locus_tag LOCUS_63540 gene urtB 7795490 7794588 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894361.1 protein_id gnl|my_center|LOCUS_63540 7796869 7795601 gene locus_tag LOCUS_63550 gene urtA 7796869 7795601 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 protein_id gnl|my_center|LOCUS_63550 7797340 7798971 gene locus_tag LOCUS_63560 7797340 7798971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 7798985 7799797 gene locus_tag LOCUS_63570 7798985 7799797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 7799938 7800504 gene locus_tag LOCUS_63580 7799938 7800504 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_63580 7800510 7801295 gene locus_tag LOCUS_63590 7800510 7801295 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027262.1 protein_id gnl|my_center|LOCUS_63590 7802889 7801714 gene locus_tag LOCUS_63600 7802889 7801714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63600 7806400 7802876 gene locus_tag LOCUS_63610 gene mfd 7806400 7802876 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 protein_id gnl|my_center|LOCUS_63610 7806740 7806510 gene locus_tag LOCUS_63620 7806740 7806510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 7807520 7806912 gene locus_tag LOCUS_63630 gene pth 7807520 7806912 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_63630 7807586 7807789 gene locus_tag LOCUS_63640 7807586 7807789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63640 7808940 7808293 gene locus_tag LOCUS_63650 7808940 7808293 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_63650 7810105 7809149 gene locus_tag LOCUS_63660 7810105 7809149 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_63660 7811617 7810193 gene locus_tag LOCUS_63670 gene glmU 7811617 7810193 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_63670 7812065 7811778 gene locus_tag LOCUS_63680 gene spoVG 7812065 7811778 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454041.1 protein_id gnl|my_center|LOCUS_63680 7813300 7812473 gene locus_tag LOCUS_63690 gene purR 7813300 7812473 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078543208.1 protein_id gnl|my_center|LOCUS_63690 7814284 7813427 gene locus_tag LOCUS_63700 gene ispE 7814284 7813427 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_63700 7814667 7814482 gene locus_tag LOCUS_63710 7814667 7814482 CDS product small, acid-soluble spore protein, alpha/beta type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218333.1 protein_id gnl|my_center|LOCUS_63710 7815088 7814816 gene locus_tag LOCUS_63720 7815088 7814816 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218330.1 protein_id gnl|my_center|LOCUS_63720 7816125 7815241 gene locus_tag LOCUS_63730 gene prtG 7816125 7815241 CDS product sporulation-specific protease PrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243478.1 protein_id gnl|my_center|LOCUS_63730 7817141 7816227 gene locus_tag LOCUS_63740 gene rsmA 7817141 7816227 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_63740 7817854 7817138 gene locus_tag LOCUS_63750 gene rnmV 7817854 7817138 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692835.1 protein_id gnl|my_center|LOCUS_63750 7819384 7818233 gene locus_tag LOCUS_63760 7819384 7818233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 7820859 7820062 gene locus_tag LOCUS_63770 7820859 7820062 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_63770 7822233 7820941 gene locus_tag LOCUS_63780 7822233 7820941 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243873.1 protein_id gnl|my_center|LOCUS_63780 7822551 7822799 gene locus_tag LOCUS_63790 7822551 7822799 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391595.1 protein_id gnl|my_center|LOCUS_63790 7823952 7822891 gene locus_tag LOCUS_63800 gene rsmI 7823952 7822891 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267808.1 protein_id gnl|my_center|LOCUS_63800 7824729 7823956 gene locus_tag LOCUS_63810 7824729 7823956 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055361.1 protein_id gnl|my_center|LOCUS_63810 7825367 7824984 gene locus_tag LOCUS_63820 gene yabA 7825367 7824984 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412056.1 protein_id gnl|my_center|LOCUS_63820 7826222 7825422 gene locus_tag LOCUS_63830 7826222 7825422 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272429.1 protein_id gnl|my_center|LOCUS_63830 7827247 7826264 gene locus_tag LOCUS_63840 gene holB 7827247 7826264 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_63840 7827747 7827304 gene locus_tag LOCUS_63850 7827747 7827304 CDS product YaaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966249.1 protein_id gnl|my_center|LOCUS_63850 7828102 7827773 gene locus_tag LOCUS_63860 7828102 7827773 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832200.1 protein_id gnl|my_center|LOCUS_63860 7828884 7828246 gene locus_tag LOCUS_63870 gene tmk 7828884 7828246 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_63870 7830527 7828932 gene locus_tag LOCUS_63880 7830527 7828932 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721321.1 protein_id gnl|my_center|LOCUS_63880 7831990 7830524 gene locus_tag LOCUS_63890 7831990 7830524 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 protein_id gnl|my_center|LOCUS_63890 7832323 7832138 gene locus_tag LOCUS_63900 7832323 7832138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 7832481 7833008 gene locus_tag LOCUS_63910 7832481 7833008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 7833404 7833293 gene locus_tag LOCUS_r00200 7833404 7833293 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7836469 7833543 gene locus_tag LOCUS_r00210 7836469 7833543 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7838205 7836655 gene locus_tag LOCUS_r00220 7838205 7836655 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 7839602 7838544 gene locus_tag LOCUS_63920 7839602 7838544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63920 7842144 7839631 gene locus_tag LOCUS_63930 gene gyrA 7842144 7839631 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282851.1 protein_id gnl|my_center|LOCUS_63930 7842397 7842239 gene locus_tag LOCUS_63940 7842397 7842239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63940 7842354 7843091 gene locus_tag LOCUS_63950 7842354 7843091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 7845075 7843150 gene locus_tag LOCUS_63960 gene gyrB 7845075 7843150 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_63960 7845351 7845103 gene locus_tag LOCUS_63970 gene remB 7845351 7845103 CDS product extracellular matrix regulator RemB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219266.1 protein_id gnl|my_center|LOCUS_63970 7846495 7845377 gene locus_tag LOCUS_63980 gene recF 7846495 7845377 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 protein_id gnl|my_center|LOCUS_63980 7846783 7846565 gene locus_tag LOCUS_63990 gene yaaA 7846783 7846565 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821364.1 protein_id gnl|my_center|LOCUS_63990 7847936 7846794 gene locus_tag LOCUS_64000 gene dnaN 7847936 7846794 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_64000 7849489 7848137 gene locus_tag LOCUS_64010 gene dnaA 7849489 7848137 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_64010 7850067 7850201 gene locus_tag LOCUS_64020 gene rpmH 7850067 7850201 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_64020 7850294 7850737 gene locus_tag LOCUS_64030 gene rnpA 7850294 7850737 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723727.1 protein_id gnl|my_center|LOCUS_64030 7850943 7851800 gene locus_tag LOCUS_64040 gene yidC 7850943 7851800 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723726.1 protein_id gnl|my_center|LOCUS_64040 7851724 7852341 gene locus_tag LOCUS_64050 7851724 7852341 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966995.1 protein_id gnl|my_center|LOCUS_64050 7852448 7853824 gene locus_tag LOCUS_64060 gene mnmE 7852448 7853824 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393757.1 protein_id gnl|my_center|LOCUS_64060 7853862 7855760 gene locus_tag LOCUS_64070 gene mnmG 7853862 7855760 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_64070 7855760 7856488 gene locus_tag LOCUS_64080 gene rsmG 7855760 7856488 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355977.1 protein_id gnl|my_center|LOCUS_64080 7856992 7857750 gene locus_tag LOCUS_64090 gene noc 7856992 7857750 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799016.1 protein_id gnl|my_center|LOCUS_64090 7857804 7858577 gene locus_tag LOCUS_64100 gene soj 7857804 7858577 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_64100 7858558 7859412 gene locus_tag LOCUS_64110 gene spo0J 7858558 7859412 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 protein_id gnl|my_center|LOCUS_64110 7859571 7860737 gene locus_tag LOCUS_64120 7859571 7860737 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272645.1 protein_id gnl|my_center|LOCUS_64120 7860813 7861304 gene locus_tag LOCUS_64130 7860813 7861304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64130 7861896 7861279 gene locus_tag LOCUS_64140 gene yyaC 7861896 7861279 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393985.1 protein_id gnl|my_center|LOCUS_64140 7862006 7862251 gene locus_tag LOCUS_64150 7862006 7862251 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434250.1 protein_id gnl|my_center|LOCUS_64150 7862267 7863184 gene locus_tag LOCUS_64160 7862267 7863184 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364812.1 protein_id gnl|my_center|LOCUS_64160 7863188 7863418 gene locus_tag LOCUS_64170 7863188 7863418 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728659.1 protein_id gnl|my_center|LOCUS_64170 7863512 7863602 gene locus_tag LOCUS_t00700 7863512 7863602 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7864127 7863873 gene locus_tag LOCUS_64180 7864127 7863873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 7865409 7864198 gene locus_tag LOCUS_64190 gene khtU 7865409 7864198 CDS product K(+)/H(+) antiporter subunit KhtU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233272.1 protein_id gnl|my_center|LOCUS_64190 7865905 7865411 gene locus_tag LOCUS_64200 7865905 7865411 CDS product cation:proton antiporter regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393559.1 protein_id gnl|my_center|LOCUS_64200 7866625 7866263 gene locus_tag LOCUS_64210 7866625 7866263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64210 7867215 7867030 gene locus_tag LOCUS_64220 7867215 7867030 CDS product YjzC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531421.1 protein_id gnl|my_center|LOCUS_64220 7867386 7867670 gene locus_tag LOCUS_64230 gene rpsF 7867386 7867670 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_64230 7867752 7868303 gene locus_tag LOCUS_64240 gene ssb 7867752 7868303 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721668.1 protein_id gnl|my_center|LOCUS_64240 7868327 7868659 gene locus_tag LOCUS_64250 7868327 7868659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 7869957 7868989 gene locus_tag LOCUS_64260 gene xerA 7869957 7868989 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_64260 7870106 7870756 gene locus_tag LOCUS_64270 7870106 7870756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 7870756 7871184 gene locus_tag LOCUS_64280 7870756 7871184 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_64280 7871220 7872818 gene locus_tag LOCUS_64290 7871220 7872818 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943215.1 protein_id gnl|my_center|LOCUS_64290 7872985 7873425 gene locus_tag LOCUS_64300 7872985 7873425 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948776.1 protein_id gnl|my_center|LOCUS_64300 7873490 7875523 gene locus_tag LOCUS_64310 7873490 7875523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 7875812 7876123 gene locus_tag LOCUS_64320 7875812 7876123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64320 7876131 7877036 gene locus_tag LOCUS_64330 7876131 7877036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 7877052 7879022 gene locus_tag LOCUS_64340 7877052 7879022 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_64340 7879019 7879462 gene locus_tag LOCUS_64350 gene rplI 7879019 7879462 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724881.1 protein_id gnl|my_center|LOCUS_64350 7879467 7880843 gene locus_tag LOCUS_64360 gene dnaB 7879467 7880843 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_64360 7881106 7882392 gene locus_tag LOCUS_64370 gene purA 7881106 7882392 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243325.1 protein_id gnl|my_center|LOCUS_64370 7882569 7882772 gene locus_tag LOCUS_64380 7882569 7882772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 7882769 7883188 gene locus_tag LOCUS_64390 7882769 7883188 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548042.1 protein_id gnl|my_center|LOCUS_64390 7883139 7884038 gene locus_tag LOCUS_64400 7883139 7884038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 protein_id gnl|my_center|LOCUS_64400 7884028 7885092 gene locus_tag LOCUS_64410 7884028 7885092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64410 7885420 7886175 gene locus_tag LOCUS_64420 7885420 7886175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64420 7886300 7887862 gene locus_tag LOCUS_64430 7886300 7887862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64430 7888012 7888752 gene locus_tag LOCUS_64440 gene walR 7888012 7888752 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_64440 7888749 7890581 gene locus_tag LOCUS_64450 gene walK 7888749 7890581 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 protein_id gnl|my_center|LOCUS_64450 7890578 7891873 gene locus_tag LOCUS_64460 7890578 7891873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 7891917 7892687 gene locus_tag LOCUS_64470 7891917 7892687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 7892822 7893628 gene locus_tag LOCUS_64480 7892822 7893628 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522833.1 protein_id gnl|my_center|LOCUS_64480 7893830 7893633 gene locus_tag LOCUS_64490 7893830 7893633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64490 7893976 7895286 gene locus_tag LOCUS_64500 7893976 7895286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 7895328 7895495 gene locus_tag LOCUS_64510 7895328 7895495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64510 7896126 7896815 gene locus_tag LOCUS_64520 7896126 7896815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 7898587 7897118 gene locus_tag LOCUS_64530 7898587 7897118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387434.1 protein_id gnl|my_center|LOCUS_64530 7899291 7898584 gene locus_tag LOCUS_64540 7899291 7898584 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867618.1 protein_id gnl|my_center|LOCUS_64540 7899758 7901503 gene locus_tag LOCUS_64550 7899758 7901503 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953783.1 protein_id gnl|my_center|LOCUS_64550 7901605 7903653 gene locus_tag LOCUS_64560 gene bmrD 7901605 7903653 CDS product multidrug resistance ABC transporter ATP-binding protein/permease BmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233292.1 protein_id gnl|my_center|LOCUS_64560 7903672 7904211 gene locus_tag LOCUS_64570 7903672 7904211 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_64570 7904391 7905266 gene locus_tag LOCUS_64580 7904391 7905266 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243397.1 protein_id gnl|my_center|LOCUS_64580 7905664 7907670 gene locus_tag LOCUS_64590 7905664 7907670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64590 7907898 7908200 gene locus_tag LOCUS_64600 7907898 7908200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64600 7908325 7909395 gene locus_tag LOCUS_64610 7908325 7909395 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228694.1 protein_id gnl|my_center|LOCUS_64610 7909826 7909452 gene locus_tag LOCUS_64620 7909826 7909452 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 protein_id gnl|my_center|LOCUS_64620 7910242 7909910 gene locus_tag LOCUS_64630 7910242 7909910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64630 7910409 7910618 gene locus_tag LOCUS_64640 7910409 7910618 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_64640 7911660 7911034 gene locus_tag LOCUS_64650 gene rutB 7911660 7911034 CDS product pyrimidine utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266760.1 protein_id gnl|my_center|LOCUS_64650 7911786 7912778 gene locus_tag LOCUS_64660 7911786 7912778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64660 7912786 7913754 gene locus_tag LOCUS_64670 7912786 7913754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 7913969 7913772 gene locus_tag LOCUS_64680 7913969 7913772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 7915410 7914022 gene locus_tag LOCUS_64690 7915410 7914022 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727401.1 protein_id gnl|my_center|LOCUS_64690 7915698 7916675 gene locus_tag LOCUS_64700 7915698 7916675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034325.1 protein_id gnl|my_center|LOCUS_64700 7916805 7918463 gene locus_tag LOCUS_64710 7916805 7918463 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173726.1 protein_id gnl|my_center|LOCUS_64710 7918514 7919458 gene locus_tag LOCUS_64720 7918514 7919458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727399.1 protein_id gnl|my_center|LOCUS_64720 7919556 7920458 gene locus_tag LOCUS_64730 7919556 7920458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090643.1 protein_id gnl|my_center|LOCUS_64730 7920471 7921544 gene locus_tag LOCUS_64740 7920471 7921544 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_64740 7921573 7922502 gene locus_tag LOCUS_64750 7921573 7922502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64750 7922781 7924031 gene locus_tag LOCUS_64760 7922781 7924031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64760 7924155 7925813 gene locus_tag LOCUS_64770 7924155 7925813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 7925942 7926919 gene locus_tag LOCUS_64780 7925942 7926919 CDS product iron-hydroxamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732576.1 protein_id gnl|my_center|LOCUS_64780 7926935 7927150 gene locus_tag LOCUS_64790 7926935 7927150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 7927391 7927963 gene locus_tag LOCUS_64800 7927391 7927963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64800 7928356 7929897 gene locus_tag LOCUS_64810 gene gerSA 7928356 7929897 CDS product spore germination protein GerSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528995.1 protein_id gnl|my_center|LOCUS_64810 7929897 7931000 gene locus_tag LOCUS_64820 7929897 7931000 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166516.1 protein_id gnl|my_center|LOCUS_64820 7930997 7932115 gene locus_tag LOCUS_64830 7930997 7932115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64830 7933131 7932217 gene locus_tag LOCUS_64840 7933131 7932217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64840 7934702 7933314 gene locus_tag LOCUS_64850 gene thrC 7934702 7933314 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942338.1 protein_id gnl|my_center|LOCUS_64850 7934887 7936557 gene locus_tag LOCUS_64860 7934887 7936557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 7937869 7936709 gene locus_tag LOCUS_64870 7937869 7936709 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704492.1 protein_id gnl|my_center|LOCUS_64870 7938867 7937866 gene locus_tag LOCUS_64880 7938867 7937866 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222782.1 protein_id gnl|my_center|LOCUS_64880 7939744 7939040 gene locus_tag LOCUS_64890 7939744 7939040 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_64890 7939999 7942185 gene locus_tag LOCUS_64900 7939999 7942185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64900 7942210 7942443 gene locus_tag LOCUS_64910 7942210 7942443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64910 7942476 7943306 gene locus_tag LOCUS_64920 gene tatC 7942476 7943306 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886426.1 protein_id gnl|my_center|LOCUS_64920 7943417 7945159 gene locus_tag LOCUS_64930 7943417 7945159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64930 7945156 7946847 gene locus_tag LOCUS_64940 7945156 7946847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64940 7946960 7948648 gene locus_tag LOCUS_64950 7946960 7948648 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_64950 7948751 7949650 gene locus_tag LOCUS_64960 7948751 7949650 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972692.1 protein_id gnl|my_center|LOCUS_64960 7949704 7950552 gene locus_tag LOCUS_64970 7949704 7950552 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_64970 7950560 7951741 gene locus_tag LOCUS_64980 7950560 7951741 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844973.1 protein_id gnl|my_center|LOCUS_64980 7951773 7953521 gene locus_tag LOCUS_64990 7951773 7953521 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229240.1 protein_id gnl|my_center|LOCUS_64990 7953527 7955119 gene locus_tag LOCUS_65000 7953527 7955119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 7955158 7957839 gene locus_tag LOCUS_65010 7955158 7957839 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_65010 7957912 7958649 gene locus_tag LOCUS_65020 7957912 7958649 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_65020 7958899 7959045 gene locus_tag LOCUS_65030 7958899 7959045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65030 7959170 7959322 gene locus_tag LOCUS_65040 7959170 7959322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65040 7962720 7959370 gene locus_tag LOCUS_65050 7962720 7959370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65050 7964044 7962758 gene locus_tag LOCUS_65060 7964044 7962758 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_65060 7964724 7964044 gene locus_tag LOCUS_65070 7964724 7964044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_65070 7964928 7965734 gene locus_tag LOCUS_65080 7964928 7965734 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837702.1 protein_id gnl|my_center|LOCUS_65080 7965731 7966411 gene locus_tag LOCUS_65090 7965731 7966411 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_65090 7966473 7968851 gene locus_tag LOCUS_65100 7966473 7968851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65100 7969216 7970328 gene locus_tag LOCUS_65110 7969216 7970328 CDS product IS4-like element ISDha2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272302.1 protein_id gnl|my_center|LOCUS_65110 7971070 7970654 gene locus_tag LOCUS_65120 7971070 7970654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 7971976 7971107 gene locus_tag LOCUS_65130 7971976 7971107 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411240.1 protein_id gnl|my_center|LOCUS_65130 7972182 7972562 gene locus_tag LOCUS_65140 7972182 7972562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65140 7973362 7972559 gene locus_tag LOCUS_65150 7973362 7972559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 7973942 7975384 gene locus_tag LOCUS_65160 7973942 7975384 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_65160 7975953 7977293 gene locus_tag LOCUS_65170 7975953 7977293 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525207.1 protein_id gnl|my_center|LOCUS_65170 7977382 7978221 gene locus_tag LOCUS_65180 7977382 7978221 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963515.1 protein_id gnl|my_center|LOCUS_65180 7978249 7979199 gene locus_tag LOCUS_65190 7978249 7979199 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385217.1 protein_id gnl|my_center|LOCUS_65190 7979217 7980041 gene locus_tag LOCUS_65200 7979217 7980041 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385216.1 protein_id gnl|my_center|LOCUS_65200 7980028 7981053 gene locus_tag LOCUS_65210 7980028 7981053 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_65210 7981056 7981973 gene locus_tag LOCUS_65220 gene murQ 7981056 7981973 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431390.1 protein_id gnl|my_center|LOCUS_65220 7982220 7983704 gene locus_tag LOCUS_65230 7982220 7983704 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425823.1 protein_id gnl|my_center|LOCUS_65230 7983786 7984910 gene locus_tag LOCUS_65240 7983786 7984910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 7984932 7985429 gene locus_tag LOCUS_65250 7984932 7985429 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000559853.1 protein_id gnl|my_center|LOCUS_65250 7986549 7985686 gene locus_tag LOCUS_65260 7986549 7985686 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225309.1 protein_id gnl|my_center|LOCUS_65260 7986705 7987289 gene locus_tag LOCUS_65270 7986705 7987289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65270 7987490 7990261 gene locus_tag LOCUS_65280 7987490 7990261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65280 7991289 7990351 gene locus_tag LOCUS_65290 7991289 7990351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65290 7991581 7992063 gene locus_tag LOCUS_65300 gene rlmH 7991581 7992063 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_65300 7992219 7992917 gene locus_tag LOCUS_65310 7992219 7992917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65310 7993690 7992902 gene locus_tag LOCUS_65320 7993690 7992902 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 protein_id gnl|my_center|LOCUS_65320 7993640 7993855 gene locus_tag LOCUS_65330 7993640 7993855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 7994154 7993834 gene locus_tag LOCUS_65340 7994154 7993834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 7994327 7994509 gene locus_tag LOCUS_65350 7994327 7994509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65350 7994745 7994518 gene locus_tag LOCUS_65360 7994745 7994518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 7994810 7995397 gene locus_tag LOCUS_65370 7994810 7995397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 7996057 7995914 gene locus_tag LOCUS_65380 7996057 7995914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 7996214 7997473 gene locus_tag LOCUS_65390 7996214 7997473 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928656.1 protein_id gnl|my_center|LOCUS_65390 7997486 7998103 gene locus_tag LOCUS_65400 7997486 7998103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65400 7998595 7999500 gene locus_tag LOCUS_65410 7998595 7999500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 7999773 8000708 gene locus_tag LOCUS_65420 7999773 8000708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 8000705 8001913 gene locus_tag LOCUS_65430 8000705 8001913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 8002597 8001881 gene locus_tag LOCUS_65440 8002597 8001881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65440 8003014 8002847 gene locus_tag LOCUS_65450 8003014 8002847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 8003625 8003314 gene locus_tag LOCUS_65460 8003625 8003314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65460 8003942 8003763 gene locus_tag LOCUS_65470 8003942 8003763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65470 8004751 8007510 gene locus_tag LOCUS_65480 8004751 8007510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65480 8007524 8012200 gene locus_tag LOCUS_65490 8007524 8012200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 8012209 8012805 gene locus_tag LOCUS_65500 8012209 8012805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 8013109 8013729 gene locus_tag LOCUS_65510 8013109 8013729 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339495.1 protein_id gnl|my_center|LOCUS_65510 8014596 8014384 gene locus_tag LOCUS_65520 8014596 8014384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65520 8014872 8014606 gene locus_tag LOCUS_65530 8014872 8014606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65530 8019589 8014889 gene locus_tag LOCUS_65540 8019589 8014889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 8021139 8019661 gene locus_tag LOCUS_65550 8021139 8019661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 8021525 8024074 gene locus_tag LOCUS_65560 8021525 8024074 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_65560 8024215 8027466 gene locus_tag LOCUS_65570 8024215 8027466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65570 8027514 8027738 gene locus_tag LOCUS_65580 8027514 8027738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 8028679 8027897 gene locus_tag LOCUS_65590 8028679 8027897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931033.1 protein_id gnl|my_center|LOCUS_65590 8029494 8028676 gene locus_tag LOCUS_65600 8029494 8028676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966753.1 protein_id gnl|my_center|LOCUS_65600 8030623 8029508 gene locus_tag LOCUS_65610 8030623 8029508 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067352.1 protein_id gnl|my_center|LOCUS_65610 8032105 8030660 gene locus_tag LOCUS_65620 8032105 8030660 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810317.1 protein_id gnl|my_center|LOCUS_65620 8032671 8032129 gene locus_tag LOCUS_65630 8032671 8032129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65630 8033152 8035185 gene locus_tag LOCUS_65640 8033152 8035185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65640 8035313 8037082 gene locus_tag LOCUS_65650 8035313 8037082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65650 8038254 8037415 gene locus_tag LOCUS_65660 8038254 8037415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65660 8039748 8038369 gene locus_tag LOCUS_65670 8039748 8038369 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152603799.1 protein_id gnl|my_center|LOCUS_65670 8041029 8040058 gene locus_tag LOCUS_65680 8041029 8040058 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_65680 8041472 8041041 gene locus_tag LOCUS_65690 8041472 8041041 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721389.1 protein_id gnl|my_center|LOCUS_65690 8041757 8045476 gene locus_tag LOCUS_65700 8041757 8045476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65700 8046618 8045746 gene locus_tag LOCUS_65710 8046618 8045746 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_65710 8047568 8046714 gene locus_tag LOCUS_65720 8047568 8046714 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_65720 8047734 8047588 gene locus_tag LOCUS_65730 8047734 8047588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 8047831 8048217 gene locus_tag LOCUS_65740 8047831 8048217 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973561.1 protein_id gnl|my_center|LOCUS_65740 8048278 8049099 gene locus_tag LOCUS_65750 8048278 8049099 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243106.1 protein_id gnl|my_center|LOCUS_65750 8049418 8049570 gene locus_tag LOCUS_65760 8049418 8049570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 8049567 8049728 gene locus_tag LOCUS_65770 8049567 8049728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65770 8049818 8050468 gene locus_tag LOCUS_65780 8049818 8050468 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947953.1 protein_id gnl|my_center|LOCUS_65780 8050649 8051563 gene locus_tag LOCUS_65790 gene cmrA 8050649 8051563 CDS product AraC family transcriptional regulator CmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_65790 8051669 8052724 gene locus_tag LOCUS_65800 8051669 8052724 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223769.1 protein_id gnl|my_center|LOCUS_65800 8053445 8052780 gene locus_tag LOCUS_65810 8053445 8052780 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965313.1 protein_id gnl|my_center|LOCUS_65810 8054190 8053513 gene locus_tag LOCUS_65820 8054190 8053513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 8054239 8054814 gene locus_tag LOCUS_65830 8054239 8054814 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229392.1 protein_id gnl|my_center|LOCUS_65830 8055035 8055886 gene locus_tag LOCUS_65840 8055035 8055886 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_65840 8056029 8056352 gene locus_tag LOCUS_65850 8056029 8056352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65850 8056416 8057216 gene locus_tag LOCUS_65860 8056416 8057216 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225866.1 protein_id gnl|my_center|LOCUS_65860 8057815 8057267 gene locus_tag LOCUS_65870 8057815 8057267 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861376.1 protein_id gnl|my_center|LOCUS_65870 8058600 8057812 gene locus_tag LOCUS_65880 8058600 8057812 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435498.1 protein_id gnl|my_center|LOCUS_65880 8059318 8062371 gene locus_tag LOCUS_65890 8059318 8062371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 8062961 8062482 gene locus_tag LOCUS_65900 8062961 8062482 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228449.1 protein_id gnl|my_center|LOCUS_65900 8063047 8064048 gene locus_tag LOCUS_65910 8063047 8064048 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227431.1 protein_id gnl|my_center|LOCUS_65910 8065538 8064147 gene locus_tag LOCUS_65920 8065538 8064147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65920 8066253 8065570 gene locus_tag LOCUS_65930 8066253 8065570 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_65930 8066525 8066253 gene locus_tag LOCUS_65940 8066525 8066253 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272543.1 protein_id gnl|my_center|LOCUS_65940 8066981 8066685 gene locus_tag LOCUS_65950 8066981 8066685 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246006.1 protein_id gnl|my_center|LOCUS_65950 8067192 8066992 gene locus_tag LOCUS_65960 8067192 8066992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229842.1 protein_id gnl|my_center|LOCUS_65960 8068359 8067223 gene locus_tag LOCUS_65970 8068359 8067223 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229843.1 protein_id gnl|my_center|LOCUS_65970 8068742 8068356 gene locus_tag LOCUS_65980 8068742 8068356 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967868.1 protein_id gnl|my_center|LOCUS_65980 8069004 8068756 gene locus_tag LOCUS_65990 8069004 8068756 CDS product spore coat protein F-like protein YraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229845.1 protein_id gnl|my_center|LOCUS_65990 8069192 8069491 gene locus_tag LOCUS_66000 8069192 8069491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 8069613 8070701 gene locus_tag LOCUS_66010 8069613 8070701 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210042844.1 protein_id gnl|my_center|LOCUS_66010 8070911 8071435 gene locus_tag LOCUS_66020 8070911 8071435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 8071544 8072986 gene locus_tag LOCUS_66030 8071544 8072986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976504.1 protein_id gnl|my_center|LOCUS_66030 8073010 8073897 gene locus_tag LOCUS_66040 8073010 8073897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 8073875 8075398 gene locus_tag LOCUS_66050 8073875 8075398 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084425723.1 protein_id gnl|my_center|LOCUS_66050 8075478 8076440 gene locus_tag LOCUS_66060 8075478 8076440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 8076603 8077100 gene locus_tag LOCUS_66070 gene snaB 8076603 8077100 CDS product sulfur-containing aminoacid acetyltransferase SnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242734.1 protein_id gnl|my_center|LOCUS_66070 8077698 8077222 gene locus_tag LOCUS_66080 8077698 8077222 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801045.1 protein_id gnl|my_center|LOCUS_66080 8078200 8077721 gene locus_tag LOCUS_66090 8078200 8077721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66090 8078342 8079301 gene locus_tag LOCUS_66100 8078342 8079301 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 protein_id gnl|my_center|LOCUS_66100 8079399 8079968 gene locus_tag LOCUS_66110 8079399 8079968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 8080075 8081196 gene locus_tag LOCUS_66120 8080075 8081196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990019.1 protein_id gnl|my_center|LOCUS_66120 8081196 8081876 gene locus_tag LOCUS_66130 8081196 8081876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_66130 8081970 8084321 gene locus_tag LOCUS_66140 8081970 8084321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 8084471 8086210 gene locus_tag LOCUS_66150 gene abc-f 8084471 8086210 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 protein_id gnl|my_center|LOCUS_66150 8086454 8086212 gene locus_tag LOCUS_66160 8086454 8086212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 8087084 8087272 gene locus_tag LOCUS_66170 8087084 8087272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 8087578 8090094 gene locus_tag LOCUS_66180 8087578 8090094 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076003404.1 protein_id gnl|my_center|LOCUS_66180 8093351 8090364 gene locus_tag LOCUS_66190 8093351 8090364 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942800.1 protein_id gnl|my_center|LOCUS_66190 8094492 8093452 gene locus_tag LOCUS_66200 8094492 8093452 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459090.1 protein_id gnl|my_center|LOCUS_66200 8094747 8098685 gene locus_tag LOCUS_66210 8094747 8098685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 8098834 8100903 gene locus_tag LOCUS_66220 8098834 8100903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66220 8101664 8100951 gene locus_tag LOCUS_66230 8101664 8100951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66230 8103499 8101661 gene locus_tag LOCUS_66240 8103499 8101661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66240 8105511 8103661 gene locus_tag LOCUS_66250 8105511 8103661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66250 8105711 8107936 gene locus_tag LOCUS_66260 gene secDF 8105711 8107936 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245970.1 protein_id gnl|my_center|LOCUS_66260 8108947 8107967 gene locus_tag LOCUS_66270 8108947 8107967 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755047.1 protein_id gnl|my_center|LOCUS_66270 8109048 8109470 gene locus_tag LOCUS_66280 8109048 8109470 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146729243.1 protein_id gnl|my_center|LOCUS_66280 8109575 8110054 gene locus_tag LOCUS_66290 8109575 8110054 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801045.1 protein_id gnl|my_center|LOCUS_66290 8110081 8110548 gene locus_tag LOCUS_66300 8110081 8110548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963451.1 protein_id gnl|my_center|LOCUS_66300 8111059 8110733 gene locus_tag LOCUS_66310 8111059 8110733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66310 8111721 8112650 gene locus_tag LOCUS_66320 8111721 8112650 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_66320 8112715 8113293 gene locus_tag LOCUS_66330 8112715 8113293 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168663.1 protein_id gnl|my_center|LOCUS_66330 8113286 8113786 gene locus_tag LOCUS_66340 8113286 8113786 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529580.1 protein_id gnl|my_center|LOCUS_66340 8114779 8113811 gene locus_tag LOCUS_66350 8114779 8113811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66350 8115764 8114847 gene locus_tag LOCUS_66360 8115764 8114847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66360 8116625 8115999 gene locus_tag LOCUS_66370 8116625 8115999 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246741.1 protein_id gnl|my_center|LOCUS_66370 8116809 8117945 gene locus_tag LOCUS_66380 8116809 8117945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66380 8117989 8119020 gene locus_tag LOCUS_66390 8117989 8119020 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_66390 8119208 8120542 gene locus_tag LOCUS_66400 8119208 8120542 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122964585.1 protein_id gnl|my_center|LOCUS_66400 8120612 8121493 gene locus_tag LOCUS_66410 8120612 8121493 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_66410 8121486 8122319 gene locus_tag LOCUS_66420 8121486 8122319 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_66420 8122342 8123565 gene locus_tag LOCUS_66430 8122342 8123565 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018209152.1 protein_id gnl|my_center|LOCUS_66430 8123593 8125536 gene locus_tag LOCUS_66440 8123593 8125536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 8125544 8126821 gene locus_tag LOCUS_66450 8125544 8126821 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_66450 8126870 8127607 gene locus_tag LOCUS_66460 8126870 8127607 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_66460 8127653 8128816 gene locus_tag LOCUS_66470 gene nagA 8127653 8128816 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230828.1 protein_id gnl|my_center|LOCUS_66470 8129337 8128894 gene locus_tag LOCUS_66480 8129337 8128894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66480 8129437 8129814 gene locus_tag LOCUS_66490 8129437 8129814 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184510.1 protein_id gnl|my_center|LOCUS_66490 8130486 8132048 gene locus_tag LOCUS_66500 8130486 8132048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66500 8132584 8132216 gene locus_tag LOCUS_66510 8132584 8132216 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_66510 8132732 8133460 gene locus_tag LOCUS_66520 8132732 8133460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 8133482 8133928 gene locus_tag LOCUS_66530 8133482 8133928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66530 8134407 8134015 gene locus_tag LOCUS_66540 8134407 8134015 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230381.1 protein_id gnl|my_center|LOCUS_66540 8136090 8134426 gene locus_tag LOCUS_66550 8136090 8134426 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979494.1 protein_id gnl|my_center|LOCUS_66550 8138341 8136095 gene locus_tag LOCUS_66560 8138341 8136095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 8138611 8139513 gene locus_tag LOCUS_66570 8138611 8139513 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989568.1 protein_id gnl|my_center|LOCUS_66570 8140527 8139541 gene locus_tag LOCUS_66580 gene yfmE 8140527 8139541 CDS product Fe(3+)-citrate ABC transporter permease YfmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243506.1 protein_id gnl|my_center|LOCUS_66580 8141558 8140524 gene locus_tag LOCUS_66590 gene fecD 8141558 8140524 CDS product Fe(3+) dicitrate ABC transporter permease FecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243835.1 protein_id gnl|my_center|LOCUS_66590 8142570 8141563 gene locus_tag LOCUS_66600 8142570 8141563 CDS product Fe(3+) dicitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214661.1 protein_id gnl|my_center|LOCUS_66600 8143469 8142663 gene locus_tag LOCUS_66610 8143469 8142663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66610 8144014 8143466 gene locus_tag LOCUS_66620 8144014 8143466 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966770.1 protein_id gnl|my_center|LOCUS_66620 8144130 8145176 gene locus_tag LOCUS_66630 8144130 8145176 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966769.1 protein_id gnl|my_center|LOCUS_66630 8145298 8145975 gene locus_tag LOCUS_66640 8145298 8145975 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781969.1 protein_id gnl|my_center|LOCUS_66640 8145972 8147351 gene locus_tag LOCUS_66650 8145972 8147351 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990020.1 protein_id gnl|my_center|LOCUS_66650 8147419 8148546 gene locus_tag LOCUS_66660 8147419 8148546 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990019.1 protein_id gnl|my_center|LOCUS_66660 8148543 8149220 gene locus_tag LOCUS_66670 8148543 8149220 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723280.1 protein_id gnl|my_center|LOCUS_66670 8150234 8149281 gene locus_tag LOCUS_66680 8150234 8149281 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947043.1 protein_id gnl|my_center|LOCUS_66680 8151096 8150488 gene locus_tag LOCUS_66690 8151096 8150488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66690 8153008 8151461 gene locus_tag LOCUS_66700 8153008 8151461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66700 8154764 8153001 gene locus_tag LOCUS_66710 8154764 8153001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 8156619 8154925 gene locus_tag LOCUS_66720 8156619 8154925 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286015.1 protein_id gnl|my_center|LOCUS_66720 8157540 8156659 gene locus_tag LOCUS_66730 8157540 8156659 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_66730 8158518 8157553 gene locus_tag LOCUS_66740 gene rmgP 8158518 8157553 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_66740 8158727 8160010 gene locus_tag LOCUS_66750 8158727 8160010 CDS product DUF1963 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344436.1 protein_id gnl|my_center|LOCUS_66750 8160075 8160881 gene locus_tag LOCUS_66760 8160075 8160881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66760 8160941 8161918 gene locus_tag LOCUS_66770 8160941 8161918 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105579.1 protein_id gnl|my_center|LOCUS_66770 8162055 8162849 gene locus_tag LOCUS_66780 8162055 8162849 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727914.1 protein_id gnl|my_center|LOCUS_66780 8164714 8162924 gene locus_tag LOCUS_66790 8164714 8162924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66790 8164781 8165062 gene locus_tag LOCUS_66800 8164781 8165062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 8165391 8165756 gene locus_tag LOCUS_66810 8165391 8165756 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948232.1 protein_id gnl|my_center|LOCUS_66810 8166325 8167005 gene locus_tag LOCUS_66820 gene crp 8166325 8167005 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647998.1 protein_id gnl|my_center|LOCUS_66820 8167036 8167875 gene locus_tag LOCUS_66830 8167036 8167875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261606.1 protein_id gnl|my_center|LOCUS_66830 8167808 8168572 gene locus_tag LOCUS_66840 8167808 8168572 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_66840 8168599 8169651 gene locus_tag LOCUS_66850 8168599 8169651 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963433.1 protein_id gnl|my_center|LOCUS_66850 8169677 8170606 gene locus_tag LOCUS_66860 8169677 8170606 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_66860 8171101 8170721 gene locus_tag LOCUS_66870 gene merR 8171101 8170721 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640387.1 protein_id gnl|my_center|LOCUS_66870 8171193 8172023 gene locus_tag LOCUS_66880 8171193 8172023 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092776.1 protein_id gnl|my_center|LOCUS_66880 8172114 8172410 gene locus_tag LOCUS_66890 8172114 8172410 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968126.1 protein_id gnl|my_center|LOCUS_66890 8172410 8172793 gene locus_tag LOCUS_66900 gene glxB 8172410 8172793 CDS product methylglyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243237.1 protein_id gnl|my_center|LOCUS_66900 8174164 8174769 gene locus_tag LOCUS_66910 8174164 8174769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66910 8176823 8174766 gene locus_tag LOCUS_66920 8176823 8174766 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243269.1 protein_id gnl|my_center|LOCUS_66920 8177040 8177378 gene locus_tag LOCUS_66930 gene ytxJ 8177040 8177378 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073516751.1 protein_id gnl|my_center|LOCUS_66930 8177931 8177461 gene locus_tag LOCUS_66940 8177931 8177461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66940 8178451 8178128 gene locus_tag LOCUS_66950 8178451 8178128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66950 8178849 8179313 gene locus_tag LOCUS_66960 8178849 8179313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963451.1 protein_id gnl|my_center|LOCUS_66960 8180018 8179611 gene locus_tag LOCUS_66970 8180018 8179611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66970 8180165 8180527 gene locus_tag LOCUS_66980 8180165 8180527 CDS product nucleotide excision repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048949.1 protein_id gnl|my_center|LOCUS_66980 8180671 8180595 gene locus_tag LOCUS_t00710 8180671 8180595 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8181424 8180795 gene locus_tag LOCUS_66990 8181424 8180795 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966784.1 protein_id gnl|my_center|LOCUS_66990 8181567 8182997 gene locus_tag LOCUS_67000 8181567 8182997 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027644.1 protein_id gnl|my_center|LOCUS_67000 8183437 8184411 gene locus_tag LOCUS_67010 8183437 8184411 CDS product DUF1835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112344.1 protein_id gnl|my_center|LOCUS_67010 8184538 8185509 gene locus_tag LOCUS_67020 8184538 8185509 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124128.1 protein_id gnl|my_center|LOCUS_67020 8186126 8185527 gene locus_tag LOCUS_67030 8186126 8185527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67030 8187090 8186266 gene locus_tag LOCUS_67040 8187090 8186266 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963219.1 protein_id gnl|my_center|LOCUS_67040 8187325 8187858 gene locus_tag LOCUS_67050 8187325 8187858 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245457.1 protein_id gnl|my_center|LOCUS_67050 8188470 8187868 gene locus_tag LOCUS_67060 8188470 8187868 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205505.1 protein_id gnl|my_center|LOCUS_67060 8188650 8189036 gene locus_tag LOCUS_67070 8188650 8189036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67070 8189033 8189383 gene locus_tag LOCUS_67080 8189033 8189383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67080 8189398 8190171 gene locus_tag LOCUS_67090 8189398 8190171 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_67090 8190669 8190220 gene locus_tag LOCUS_67100 8190669 8190220 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_67100 8191406 8190660 gene locus_tag LOCUS_67110 8191406 8190660 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_67110 8191527 8191955 gene locus_tag LOCUS_67120 gene lrpB 8191527 8191955 CDS product transcriptional regulator LrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246612.1 protein_id gnl|my_center|LOCUS_67120 8192029 8192493 gene locus_tag LOCUS_67130 8192029 8192493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67130 8193113 8192529 gene locus_tag LOCUS_67140 8193113 8192529 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080680.1 protein_id gnl|my_center|LOCUS_67140 8193259 8194101 gene locus_tag LOCUS_67150 8193259 8194101 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275478.1 protein_id gnl|my_center|LOCUS_67150 8194173 8195207 gene locus_tag LOCUS_67160 8194173 8195207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67160 8196733 8195315 gene locus_tag LOCUS_67170 8196733 8195315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 8197682 8196828 gene locus_tag LOCUS_67180 8197682 8196828 CDS product DUF817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399435.1 protein_id gnl|my_center|LOCUS_67180 8197900 8197679 gene locus_tag LOCUS_67190 8197900 8197679 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231396.1 protein_id gnl|my_center|LOCUS_67190 8198384 8197911 gene locus_tag LOCUS_67200 8198384 8197911 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809113.1 protein_id gnl|my_center|LOCUS_67200 8199307 8198546 gene locus_tag LOCUS_67210 8199307 8198546 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242574.1 protein_id gnl|my_center|LOCUS_67210 8199696 8199325 gene locus_tag LOCUS_67220 8199696 8199325 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014481997.1 protein_id gnl|my_center|LOCUS_67220 8199854 8200258 gene locus_tag LOCUS_67230 8199854 8200258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 8200305 8202236 gene locus_tag LOCUS_67240 8200305 8202236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67240 8202491 8202838 gene locus_tag LOCUS_67250 8202491 8202838 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265538.1 protein_id gnl|my_center|LOCUS_67250 8202845 8204104 gene locus_tag LOCUS_67260 8202845 8204104 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528639.1 protein_id gnl|my_center|LOCUS_67260 8204244 8205194 gene locus_tag LOCUS_67270 8204244 8205194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67270 8205471 8205184 gene locus_tag LOCUS_67280 8205471 8205184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67280 8206064 8205729 gene locus_tag LOCUS_67290 8206064 8205729 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_67290 8209808 8206122 gene locus_tag LOCUS_67300 8209808 8206122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67300 8212004 8209863 gene locus_tag LOCUS_67310 8212004 8209863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67310 8212863 8212018 gene locus_tag LOCUS_67320 8212863 8212018 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331328.1 protein_id gnl|my_center|LOCUS_67320 8213773 8212880 gene locus_tag LOCUS_67330 8213773 8212880 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776866.1 protein_id gnl|my_center|LOCUS_67330 8215284 8213851 gene locus_tag LOCUS_67340 8215284 8213851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67340 8217044 8215431 gene locus_tag LOCUS_67350 8217044 8215431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67350 8218831 8217041 gene locus_tag LOCUS_67360 8218831 8217041 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831078.1 protein_id gnl|my_center|LOCUS_67360 8219803 8219150 gene locus_tag LOCUS_67370 8219803 8219150 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_67370 8220073 8221944 gene locus_tag LOCUS_67380 8220073 8221944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 8223142 8221997 gene locus_tag LOCUS_67390 8223142 8221997 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966660.1 protein_id gnl|my_center|LOCUS_67390 8224883 8223150 gene locus_tag LOCUS_67400 8224883 8223150 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966661.1 protein_id gnl|my_center|LOCUS_67400 8225085 8231042 gene locus_tag LOCUS_67410 8225085 8231042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67410 8231284 8233032 gene locus_tag LOCUS_67420 8231284 8233032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 8233029 8234612 gene locus_tag LOCUS_67430 8233029 8234612 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_67430 8234724 8234990 gene locus_tag LOCUS_67440 8234724 8234990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67440 8235136 8235351 gene locus_tag LOCUS_67450 8235136 8235351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67450 8235393 8235965 gene locus_tag LOCUS_67460 8235393 8235965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67460 8236174 8237094 gene locus_tag LOCUS_67470 8236174 8237094 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775693.1 protein_id gnl|my_center|LOCUS_67470 8237111 8238043 gene locus_tag LOCUS_67480 8237111 8238043 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027800.1 protein_id gnl|my_center|LOCUS_67480 8238106 8239707 gene locus_tag LOCUS_67490 8238106 8239707 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906003.1 protein_id gnl|my_center|LOCUS_67490 8240000 8243695 gene locus_tag LOCUS_67500 8240000 8243695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 8243892 8245643 gene locus_tag LOCUS_67510 8243892 8245643 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_67510 8245758 8246654 gene locus_tag LOCUS_67520 8245758 8246654 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582719.1 protein_id gnl|my_center|LOCUS_67520 8246670 8247548 gene locus_tag LOCUS_67530 8246670 8247548 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286008.1 protein_id gnl|my_center|LOCUS_67530 8247666 8249381 gene locus_tag LOCUS_67540 8247666 8249381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67540 8249397 8251022 gene locus_tag LOCUS_67550 8249397 8251022 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922520.1 protein_id gnl|my_center|LOCUS_67550 8251443 8251144 gene locus_tag LOCUS_67560 8251443 8251144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 8251699 8252292 gene locus_tag LOCUS_67570 8251699 8252292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 8252300 8252761 gene locus_tag LOCUS_67580 8252300 8252761 CDS product DUF2269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245243.1 protein_id gnl|my_center|LOCUS_67580 8252907 8255534 gene locus_tag LOCUS_67590 8252907 8255534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 8256395 8256736 gene locus_tag LOCUS_67600 8256395 8256736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67600 8256741 8258477 gene locus_tag LOCUS_67610 8256741 8258477 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_67610 8258477 8260354 gene locus_tag LOCUS_67620 8258477 8260354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_67620 8261537 8260437 gene locus_tag LOCUS_67630 8261537 8260437 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946868.1 protein_id gnl|my_center|LOCUS_67630 8261780 8264197 gene locus_tag LOCUS_67640 gene helD 8261780 8264197 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035473.1 protein_id gnl|my_center|LOCUS_67640 8264425 8266110 gene locus_tag LOCUS_67650 8264425 8266110 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_67650 8266366 8266863 gene locus_tag LOCUS_67660 8266366 8266863 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_67660 8266844 8267725 gene locus_tag LOCUS_67670 8266844 8267725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67670 8267923 8268348 gene locus_tag LOCUS_67680 8267923 8268348 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048550.1 protein_id gnl|my_center|LOCUS_67680 8268425 8269516 gene locus_tag LOCUS_67690 8268425 8269516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67690 8270010 8269609 gene locus_tag LOCUS_67700 gene exsC 8270010 8269609 CDS product exosporium protein ExsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148807.1 protein_id gnl|my_center|LOCUS_67700 8270155 8270673 gene locus_tag LOCUS_67710 8270155 8270673 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_67710 8271267 8271995 gene locus_tag LOCUS_67720 8271267 8271995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 8272034 8273362 gene locus_tag LOCUS_67730 8272034 8273362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67730 8274069 8273419 gene locus_tag LOCUS_67740 8274069 8273419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 8274190 8274062 gene locus_tag LOCUS_67750 8274190 8274062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67750 8274424 8275119 gene locus_tag LOCUS_67760 8274424 8275119 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230050.1 protein_id gnl|my_center|LOCUS_67760 8275116 8276189 gene locus_tag LOCUS_67770 8275116 8276189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 8276394 8276810 gene locus_tag LOCUS_67780 8276394 8276810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67780 8276897 8277475 gene locus_tag LOCUS_67790 gene comR 8276897 8277475 CDS product TetR family copper-responsive transcriptional repressor ComR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001578163.1 protein_id gnl|my_center|LOCUS_67790 8277546 8278106 gene locus_tag LOCUS_67800 8277546 8278106 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966655.1 protein_id gnl|my_center|LOCUS_67800 8278240 8278956 gene locus_tag LOCUS_67810 8278240 8278956 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_67810 8279917 8279027 gene locus_tag LOCUS_67820 8279917 8279027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67820 8280227 8280676 gene locus_tag LOCUS_67830 8280227 8280676 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057349.1 protein_id gnl|my_center|LOCUS_67830 8280837 8280664 gene locus_tag LOCUS_67840 8280837 8280664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67840 8281303 8280890 gene locus_tag LOCUS_67850 8281303 8280890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 8281494 8282366 gene locus_tag LOCUS_67860 8281494 8282366 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_67860 8284976 8282439 gene locus_tag LOCUS_67870 8284976 8282439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67870 8287007 8285181 gene locus_tag LOCUS_67880 gene yesM 8287007 8285181 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_67880 8288590 8287010 gene locus_tag LOCUS_67890 8288590 8287010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_67890 8290320 8288731 gene locus_tag LOCUS_67900 8290320 8288731 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_67900 8291255 8290365 gene locus_tag LOCUS_67910 8291255 8290365 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_67910 8292192 8291266 gene locus_tag LOCUS_67920 8292192 8291266 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_67920 8293617 8292349 gene locus_tag LOCUS_67930 8293617 8292349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67930 8293853 8294449 gene locus_tag LOCUS_67940 8293853 8294449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 8295381 8294428 gene locus_tag LOCUS_67950 gene cah 8295381 8294428 CDS product cephalosporin C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246400.1 protein_id gnl|my_center|LOCUS_67950 8295845 8296045 gene locus_tag LOCUS_67960 8295845 8296045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 8301564 8296042 gene locus_tag LOCUS_67970 8301564 8296042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67970 8303589 8301883 gene locus_tag LOCUS_67980 8303589 8301883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67980 8305316 8303709 gene locus_tag LOCUS_67990 8305316 8303709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67990 8307132 8305354 gene locus_tag LOCUS_68000 gene yesM 8307132 8305354 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_68000 8307282 8308223 gene locus_tag LOCUS_68010 8307282 8308223 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_68010 8308240 8309112 gene locus_tag LOCUS_68020 8308240 8309112 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_68020 8312761 8310554 gene locus_tag LOCUS_68030 8312761 8310554 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_68030 8313016 8313990 gene locus_tag LOCUS_68040 8313016 8313990 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931171.1 protein_id gnl|my_center|LOCUS_68040 8314062 8316857 gene locus_tag LOCUS_68050 8314062 8316857 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_68050 8317063 8318463 gene locus_tag LOCUS_68060 8317063 8318463 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_68060 8318489 8319688 gene locus_tag LOCUS_68070 8318489 8319688 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243672.1 protein_id gnl|my_center|LOCUS_68070 8319685 8319906 gene locus_tag LOCUS_68080 8319685 8319906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 8319931 8321028 gene locus_tag LOCUS_68090 8319931 8321028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 8321100 8321936 gene locus_tag LOCUS_68100 8321100 8321936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68100 8321947 8322126 gene locus_tag LOCUS_68110 8321947 8322126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68110 8323652 8322303 gene locus_tag LOCUS_68120 8323652 8322303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68120 8324544 8323699 gene locus_tag LOCUS_68130 8324544 8323699 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383582.1 protein_id gnl|my_center|LOCUS_68130 8325449 8324562 gene locus_tag LOCUS_68140 8325449 8324562 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_68140 8326814 8325522 gene locus_tag LOCUS_68150 8326814 8325522 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359868.1 protein_id gnl|my_center|LOCUS_68150 8327087 8328613 gene locus_tag LOCUS_68160 8327087 8328613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68160 8328629 8329348 gene locus_tag LOCUS_68170 gene vraR 8328629 8329348 CDS product two-component system response regulator VraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830439.1 protein_id gnl|my_center|LOCUS_68170 8329358 8329525 gene locus_tag LOCUS_68180 8329358 8329525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68180 8329741 8330223 gene locus_tag LOCUS_68190 8329741 8330223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68190 8330274 8331041 gene locus_tag LOCUS_68200 8330274 8331041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68200 8331133 8331723 gene locus_tag LOCUS_68210 8331133 8331723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68210 8331748 8332320 gene locus_tag LOCUS_68220 gene lepB 8331748 8332320 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_68220 8333004 8332357 gene locus_tag LOCUS_68230 8333004 8332357 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694643.1 protein_id gnl|my_center|LOCUS_68230 8333150 8334712 gene locus_tag LOCUS_68240 8333150 8334712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68240 8334705 8335133 gene locus_tag LOCUS_68250 8334705 8335133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68250 8335120 8336235 gene locus_tag LOCUS_68260 8335120 8336235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68260 8337179 8336295 gene locus_tag LOCUS_68270 8337179 8336295 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_68270 8337316 8338548 gene locus_tag LOCUS_68280 8337316 8338548 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_68280 8339486 8338785 gene locus_tag LOCUS_68290 8339486 8338785 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965648.1 protein_id gnl|my_center|LOCUS_68290 8339946 8342123 gene locus_tag LOCUS_68300 8339946 8342123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 8342855 8342250 gene locus_tag LOCUS_68310 8342855 8342250 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641140.1 protein_id gnl|my_center|LOCUS_68310 8342978 8343547 gene locus_tag LOCUS_68320 8342978 8343547 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088195.1 protein_id gnl|my_center|LOCUS_68320 8343600 8344820 gene locus_tag LOCUS_68330 8343600 8344820 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890714.1 protein_id gnl|my_center|LOCUS_68330 8344965 8345993 gene locus_tag LOCUS_68340 8344965 8345993 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003019.1 protein_id gnl|my_center|LOCUS_68340 8346068 8347270 gene locus_tag LOCUS_68350 8346068 8347270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_68350 8347381 8348637 gene locus_tag LOCUS_68360 gene hmpA 8347381 8348637 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947707.1 protein_id gnl|my_center|LOCUS_68360 8349161 8348655 gene locus_tag LOCUS_68370 8349161 8348655 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600586.1 protein_id gnl|my_center|LOCUS_68370 8349700 8349236 gene locus_tag LOCUS_68380 8349700 8349236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68380 8349896 8350387 gene locus_tag LOCUS_68390 8349896 8350387 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_68390 8351428 8350529 gene locus_tag LOCUS_68400 8351428 8350529 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447171.1 protein_id gnl|my_center|LOCUS_68400 8352108 8351644 gene locus_tag LOCUS_68410 8352108 8351644 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537140.1 protein_id gnl|my_center|LOCUS_68410 8352332 8353513 gene locus_tag LOCUS_68420 8352332 8353513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68420 8356745 8353593 gene locus_tag LOCUS_68430 8356745 8353593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68430 8357051 8358079 gene locus_tag LOCUS_68440 8357051 8358079 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_68440 8358288 8360576 gene locus_tag LOCUS_68450 8358288 8360576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68450 8360608 8362314 gene locus_tag LOCUS_68460 8360608 8362314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68460 8362445 8362894 gene locus_tag LOCUS_68470 8362445 8362894 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512998.1 protein_id gnl|my_center|LOCUS_68470 8363007 8363648 gene locus_tag LOCUS_68480 8363007 8363648 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227736.1 protein_id gnl|my_center|LOCUS_68480 8363880 8363623 gene locus_tag LOCUS_68490 8363880 8363623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68490 8363846 8365654 gene locus_tag LOCUS_68500 8363846 8365654 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966661.1 protein_id gnl|my_center|LOCUS_68500 8365651 8366793 gene locus_tag LOCUS_68510 8365651 8366793 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966660.1 protein_id gnl|my_center|LOCUS_68510 8366814 8366966 gene locus_tag LOCUS_68520 8366814 8366966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68520 8366983 8369631 gene locus_tag LOCUS_68530 8366983 8369631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68530 8369654 8371339 gene locus_tag LOCUS_68540 8369654 8371339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 8371581 8374727 gene locus_tag LOCUS_68550 8371581 8374727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68550 8374729 8375607 gene locus_tag LOCUS_68560 8374729 8375607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 8376659 8376042 gene locus_tag LOCUS_68570 8376659 8376042 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943862.1 protein_id gnl|my_center|LOCUS_68570 8376837 8378018 gene locus_tag LOCUS_68580 8376837 8378018 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020016.1 protein_id gnl|my_center|LOCUS_68580 8378252 8379280 gene locus_tag LOCUS_68590 8378252 8379280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 8380055 8379366 gene locus_tag LOCUS_68600 8380055 8379366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68600 8381045 8380206 gene locus_tag LOCUS_68610 8381045 8380206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 8381619 8381029 gene locus_tag LOCUS_68620 8381619 8381029 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_68620 8381798 8383417 gene locus_tag LOCUS_68630 8381798 8383417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68630 8383600 8383983 gene locus_tag LOCUS_68640 8383600 8383983 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_68640 8384223 8384588 gene locus_tag LOCUS_68650 8384223 8384588 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224339.1 protein_id gnl|my_center|LOCUS_68650 8384615 8385130 gene locus_tag LOCUS_68660 8384615 8385130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68660 8386151 8385234 gene locus_tag LOCUS_68670 8386151 8385234 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_68670 8386617 8390768 gene locus_tag LOCUS_68680 8386617 8390768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68680 8390917 8394897 gene locus_tag LOCUS_68690 8390917 8394897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68690 8395114 8396001 gene locus_tag LOCUS_68700 8395114 8396001 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_68700 8396063 8397658 gene locus_tag LOCUS_68710 8396063 8397658 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906003.1 protein_id gnl|my_center|LOCUS_68710 8397733 8398653 gene locus_tag LOCUS_68720 8397733 8398653 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_68720 8398702 8399820 gene locus_tag LOCUS_68730 gene menC 8398702 8399820 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_68730 8399846 8400799 gene locus_tag LOCUS_68740 8399846 8400799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 8400847 8401680 gene locus_tag LOCUS_68750 8400847 8401680 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042382595.1 protein_id gnl|my_center|LOCUS_68750 8401677 8402888 gene locus_tag LOCUS_68760 8401677 8402888 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246319.1 protein_id gnl|my_center|LOCUS_68760 8403011 8405263 gene locus_tag LOCUS_68770 8403011 8405263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68770 8408485 8405471 gene locus_tag LOCUS_68780 8408485 8405471 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_68780 8409668 8408847 gene locus_tag LOCUS_68790 8409668 8408847 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_68790 8410627 8409665 gene locus_tag LOCUS_68800 8410627 8409665 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_68800 8412041 8410650 gene locus_tag LOCUS_68810 8412041 8410650 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972798.1 protein_id gnl|my_center|LOCUS_68810 8412714 8412487 gene locus_tag LOCUS_68820 8412714 8412487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68820 8414543 8412810 gene locus_tag LOCUS_68830 8414543 8412810 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_68830 8416089 8414551 gene locus_tag LOCUS_68840 8416089 8414551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68840 8418950 8416356 gene locus_tag LOCUS_68850 8418950 8416356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68850 8419178 8419543 gene locus_tag LOCUS_68860 8419178 8419543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68860 8420228 8419665 gene locus_tag LOCUS_68870 8420228 8419665 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_68870 8420380 8421120 gene locus_tag LOCUS_68880 8420380 8421120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68880 8421295 8422257 gene locus_tag LOCUS_68890 8421295 8422257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68890 8422329 8422565 gene locus_tag LOCUS_68900 8422329 8422565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68900 8424488 8422542 gene locus_tag LOCUS_68910 8424488 8422542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 8425570 8424635 gene locus_tag LOCUS_68920 8425570 8424635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68920 8425771 8426691 gene locus_tag LOCUS_68930 8425771 8426691 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733114.1 protein_id gnl|my_center|LOCUS_68930 8426810 8428249 gene locus_tag LOCUS_68940 8426810 8428249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68940 8429205 8428348 gene locus_tag LOCUS_68950 gene ytbE 8429205 8428348 CDS product aldo/keto reductase YtbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229455.1 protein_id gnl|my_center|LOCUS_68950 8430454 8429228 gene locus_tag LOCUS_68960 8430454 8429228 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229456.1 protein_id gnl|my_center|LOCUS_68960 8430596 8430955 gene locus_tag LOCUS_68970 8430596 8430955 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229458.1 protein_id gnl|my_center|LOCUS_68970 8430967 8432040 gene locus_tag LOCUS_68980 gene rlmN 8430967 8432040 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356987.1 protein_id gnl|my_center|LOCUS_68980 8432670 8432080 gene locus_tag LOCUS_68990 8432670 8432080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 8432944 8432558 gene locus_tag LOCUS_69000 8432944 8432558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69000 8433989 8433123 gene locus_tag LOCUS_69010 8433989 8433123 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948435.1 protein_id gnl|my_center|LOCUS_69010 8434592 8434080 gene locus_tag LOCUS_69020 8434592 8434080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69020 8435515 8434775 gene locus_tag LOCUS_69030 8435515 8434775 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122046.1 protein_id gnl|my_center|LOCUS_69030 8435643 8436524 gene locus_tag LOCUS_69040 gene ytlI 8435643 8436524 CDS product LysR family transcriptional regulator YtlI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398915.1 protein_id gnl|my_center|LOCUS_69040 8436597 8437136 gene locus_tag LOCUS_69050 8436597 8437136 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438330.1 protein_id gnl|my_center|LOCUS_69050 8437129 8437863 gene locus_tag LOCUS_69060 8437129 8437863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69060 8438795 8437935 gene locus_tag LOCUS_69070 8438795 8437935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974354.1 protein_id gnl|my_center|LOCUS_69070 8439414 8441498 gene locus_tag LOCUS_69080 8439414 8441498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69080 8442535 8441633 gene locus_tag LOCUS_69090 8442535 8441633 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_69090 8443976 8442711 gene locus_tag LOCUS_69100 8443976 8442711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 8447425 8444003 gene locus_tag LOCUS_69110 8447425 8444003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69110 8448410 8447547 gene locus_tag LOCUS_69120 8448410 8447547 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357554.1 protein_id gnl|my_center|LOCUS_69120 8448540 8449829 gene locus_tag LOCUS_69130 8448540 8449829 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167274874.1 protein_id gnl|my_center|LOCUS_69130 8450801 8449938 gene locus_tag LOCUS_69140 8450801 8449938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69140 8450968 8452422 gene locus_tag LOCUS_69150 gene uxaC 8450968 8452422 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 protein_id gnl|my_center|LOCUS_69150 8452419 8453975 gene locus_tag LOCUS_69160 8452419 8453975 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_69160 8453972 8455642 gene locus_tag LOCUS_69170 8453972 8455642 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_69170 8456097 8455873 gene locus_tag LOCUS_69180 8456097 8455873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 8455978 8457681 gene locus_tag LOCUS_69190 8455978 8457681 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383260.1 protein_id gnl|my_center|LOCUS_69190 8458164 8459930 gene locus_tag LOCUS_69200 gene yesM 8458164 8459930 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_69200 8459958 8461508 gene locus_tag LOCUS_69210 8459958 8461508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 8462114 8463460 gene locus_tag LOCUS_69220 8462114 8463460 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243860.1 protein_id gnl|my_center|LOCUS_69220 8463760 8464662 gene locus_tag LOCUS_69230 8463760 8464662 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233835.1 protein_id gnl|my_center|LOCUS_69230 8464664 8465560 gene locus_tag LOCUS_69240 8464664 8465560 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233833.1 protein_id gnl|my_center|LOCUS_69240 8465587 8466615 gene locus_tag LOCUS_69250 gene yesR 8465587 8466615 CDS product rhamnogalacturonyl hydrolase YesR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243366.1 protein_id gnl|my_center|LOCUS_69250 8468860 8467352 gene locus_tag LOCUS_69260 8468860 8467352 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391264.1 protein_id gnl|my_center|LOCUS_69260 8469309 8468857 gene locus_tag LOCUS_69270 8469309 8468857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69270 8469593 8469447 gene locus_tag LOCUS_69280 8469593 8469447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 8469739 8470209 gene locus_tag LOCUS_69290 gene greA 8469739 8470209 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_69290 8470346 8470603 gene locus_tag LOCUS_69300 8470346 8470603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69300 8470691 8471233 gene locus_tag LOCUS_69310 8470691 8471233 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245116.1 protein_id gnl|my_center|LOCUS_69310 8471431 8471574 gene locus_tag LOCUS_69320 8471431 8471574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 8471782 8472420 gene locus_tag LOCUS_69330 8471782 8472420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69330 8472672 8472448 gene locus_tag LOCUS_69340 8472672 8472448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 8472804 8473094 gene locus_tag LOCUS_69350 8472804 8473094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69350 8473356 8473195 gene locus_tag LOCUS_69360 8473356 8473195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69360 8473550 8473374 gene locus_tag LOCUS_69370 8473550 8473374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69370 8473737 8474753 gene locus_tag LOCUS_69380 8473737 8474753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69380 8475506 8474775 gene locus_tag LOCUS_69390 8475506 8474775 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227429.1 protein_id gnl|my_center|LOCUS_69390 8476596 8475643 gene locus_tag LOCUS_69400 8476596 8475643 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_69400 8477840 8476728 gene locus_tag LOCUS_69410 8477840 8476728 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_69410 8478269 8477937 gene locus_tag LOCUS_69420 8478269 8477937 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948422.1 protein_id gnl|my_center|LOCUS_69420 8478503 8480623 gene locus_tag LOCUS_69430 8478503 8480623 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243331.1 protein_id gnl|my_center|LOCUS_69430 8481448 8483538 gene locus_tag LOCUS_69440 8481448 8483538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69440 8483712 8484980 gene locus_tag LOCUS_69450 8483712 8484980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69450 8486354 8485197 gene locus_tag LOCUS_69460 8486354 8485197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 8487610 8486375 gene locus_tag LOCUS_69470 8487610 8486375 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554710.1 protein_id gnl|my_center|LOCUS_69470 8488813 8487650 gene locus_tag LOCUS_69480 8488813 8487650 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975879.1 protein_id gnl|my_center|LOCUS_69480 8489555 8488818 gene locus_tag LOCUS_69490 8489555 8488818 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_69490 8489765 8490631 gene locus_tag LOCUS_69500 8489765 8490631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69500 8490853 8492427 gene locus_tag LOCUS_69510 8490853 8492427 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398776.1 protein_id gnl|my_center|LOCUS_69510 8492531 8494861 gene locus_tag LOCUS_69520 8492531 8494861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 8495207 8495061 gene locus_tag LOCUS_69530 8495207 8495061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69530 8497204 8495168 gene locus_tag LOCUS_69540 8497204 8495168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045679460.1 protein_id gnl|my_center|LOCUS_69540 8498109 8497234 gene locus_tag LOCUS_69550 8498109 8497234 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_69550 8499084 8498131 gene locus_tag LOCUS_69560 gene rmgP 8499084 8498131 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_69560 8500577 8499810 gene locus_tag LOCUS_69570 8500577 8499810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368275.1 protein_id gnl|my_center|LOCUS_69570 8502314 8500698 gene locus_tag LOCUS_69580 8502314 8500698 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_69580 8504109 8502307 gene locus_tag LOCUS_69590 gene yesM 8504109 8502307 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_69590 8504269 8505675 gene locus_tag LOCUS_69600 8504269 8505675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69600 8505742 8506623 gene locus_tag LOCUS_69610 8505742 8506623 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_69610 8506620 8507438 gene locus_tag LOCUS_69620 8506620 8507438 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_69620 8507454 8509490 gene locus_tag LOCUS_69630 8507454 8509490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69630 8509506 8510393 gene locus_tag LOCUS_69640 8509506 8510393 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_69640 8510573 8513002 gene locus_tag LOCUS_69650 8510573 8513002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69650 8513279 8514628 gene locus_tag LOCUS_69660 8513279 8514628 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723363.1 protein_id gnl|my_center|LOCUS_69660 8516627 8515926 gene locus_tag LOCUS_69670 8516627 8515926 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_69670 8518399 8516600 gene locus_tag LOCUS_69680 8518399 8516600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69680 8519262 8518372 gene locus_tag LOCUS_69690 8519262 8518372 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181780.1 protein_id gnl|my_center|LOCUS_69690 8520152 8519259 gene locus_tag LOCUS_69700 8520152 8519259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69700 8522200 8520185 gene locus_tag LOCUS_69710 8522200 8520185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69710 8523865 8522855 gene locus_tag LOCUS_69720 gene bsdA 8523865 8522855 CDS product transcriptional regulator BsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246552.1 protein_id gnl|my_center|LOCUS_69720 8523994 8525103 gene locus_tag LOCUS_69730 8523994 8525103 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_69730 8525203 8526330 gene locus_tag LOCUS_69740 8525203 8526330 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_69740 8526340 8527242 gene locus_tag LOCUS_69750 8526340 8527242 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705854.1 protein_id gnl|my_center|LOCUS_69750 8528193 8527312 gene locus_tag LOCUS_69760 8528193 8527312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_69760 8531100 8528197 gene locus_tag LOCUS_69770 8531100 8528197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69770 8532185 8531127 gene locus_tag LOCUS_69780 gene macA 8532185 8531127 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216705.1 protein_id gnl|my_center|LOCUS_69780 8532861 8532169 gene locus_tag LOCUS_69790 8532861 8532169 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523242.1 protein_id gnl|my_center|LOCUS_69790 8533242 8534192 gene locus_tag LOCUS_69800 8533242 8534192 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289657.1 protein_id gnl|my_center|LOCUS_69800 8534208 8535137 gene locus_tag LOCUS_69810 8534208 8535137 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289655.1 protein_id gnl|my_center|LOCUS_69810 8535220 8536746 gene locus_tag LOCUS_69820 8535220 8536746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003737090.1 protein_id gnl|my_center|LOCUS_69820 8536903 8538633 gene locus_tag LOCUS_69830 8536903 8538633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69830 8538637 8539398 gene locus_tag LOCUS_69840 8538637 8539398 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_69840 8539406 8540359 gene locus_tag LOCUS_69850 8539406 8540359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69850 8540389 8540919 gene locus_tag LOCUS_69860 8540389 8540919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69860 8542374 8540935 gene locus_tag LOCUS_69870 8542374 8540935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69870 8542497 8545049 gene locus_tag LOCUS_69880 8542497 8545049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 8545966 8545133 gene locus_tag LOCUS_69890 8545966 8545133 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582925.1 protein_id gnl|my_center|LOCUS_69890 8546853 8545966 gene locus_tag LOCUS_69900 8546853 8545966 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757159.1 protein_id gnl|my_center|LOCUS_69900 8546986 8548833 gene locus_tag LOCUS_69910 8546986 8548833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69910 8548826 8550547 gene locus_tag LOCUS_69920 8548826 8550547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 8551400 8550705 gene locus_tag LOCUS_69930 8551400 8550705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886395.1 protein_id gnl|my_center|LOCUS_69930 8552316 8551372 gene locus_tag LOCUS_69940 8552316 8551372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221097.1 protein_id gnl|my_center|LOCUS_69940 8553443 8552472 gene locus_tag LOCUS_69950 gene ycbM 8553443 8552472 CDS product two-component system sensor histidine kinase YcbM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246497.1 protein_id gnl|my_center|LOCUS_69950 8554148 8553444 gene locus_tag LOCUS_69960 8554148 8553444 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018035.1 protein_id gnl|my_center|LOCUS_69960 8554558 8555904 gene locus_tag LOCUS_69970 8554558 8555904 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525207.1 protein_id gnl|my_center|LOCUS_69970 8556052 8558217 gene locus_tag LOCUS_69980 8556052 8558217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69980 8558458 8558949 gene locus_tag LOCUS_69990 8558458 8558949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69990 8559713 8564500 gene locus_tag LOCUS_70000 8559713 8564500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70000 8564631 8564957 gene locus_tag LOCUS_70010 8564631 8564957 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017800955.1 protein_id gnl|my_center|LOCUS_70010 8564962 8565447 gene locus_tag LOCUS_70020 8564962 8565447 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707865.1 protein_id gnl|my_center|LOCUS_70020 8565444 8565863 gene locus_tag LOCUS_70030 8565444 8565863 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_70030 8566565 8565876 gene locus_tag LOCUS_70040 8566565 8565876 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_70040 8566802 8567842 gene locus_tag LOCUS_70050 8566802 8567842 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_70050 8568001 8568912 gene locus_tag LOCUS_70060 8568001 8568912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70060 8570338 8569247 gene locus_tag LOCUS_70070 8570338 8569247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70070 8571569 8570331 gene locus_tag LOCUS_70080 gene pepT 8571569 8570331 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_70080 8571794 8573287 gene locus_tag LOCUS_70090 8571794 8573287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70090 8573794 8573378 gene locus_tag LOCUS_70100 8573794 8573378 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175078.1 protein_id gnl|my_center|LOCUS_70100 8574024 8574395 gene locus_tag LOCUS_70110 8574024 8574395 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805188.1 protein_id gnl|my_center|LOCUS_70110 8574392 8575288 gene locus_tag LOCUS_70120 8574392 8575288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804332.1 protein_id gnl|my_center|LOCUS_70120 8575285 8575983 gene locus_tag LOCUS_70130 8575285 8575983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70130 8576414 8575989 gene locus_tag LOCUS_70140 8576414 8575989 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532827.1 protein_id gnl|my_center|LOCUS_70140 8577096 8577596 gene locus_tag LOCUS_70150 8577096 8577596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70150 8578127 8578594 gene locus_tag LOCUS_70160 8578127 8578594 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977090.1 protein_id gnl|my_center|LOCUS_70160 8578811 8580118 gene locus_tag LOCUS_70170 8578811 8580118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229240.1 protein_id gnl|my_center|LOCUS_70170 8580118 8581026 gene locus_tag LOCUS_70180 gene hpnK 8580118 8581026 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_70180 8581208 8581077 gene locus_tag LOCUS_70190 8581208 8581077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70190 8581451 8581281 gene locus_tag LOCUS_70200 8581451 8581281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70200 8585957 8581587 gene locus_tag LOCUS_70210 8585957 8581587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 8587363 8586017 gene locus_tag LOCUS_70220 8587363 8586017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70220 8589204 8587669 gene locus_tag LOCUS_70230 8589204 8587669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70230 8590990 8589197 gene locus_tag LOCUS_70240 8590990 8589197 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_70240 8591871 8591044 gene locus_tag LOCUS_70250 8591871 8591044 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227577.1 protein_id gnl|my_center|LOCUS_70250 8592771 8591872 gene locus_tag LOCUS_70260 8592771 8591872 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227578.1 protein_id gnl|my_center|LOCUS_70260 8592897 8593085 gene locus_tag LOCUS_70270 8592897 8593085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 8593024 8594379 gene locus_tag LOCUS_70280 8593024 8594379 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461355.1 protein_id gnl|my_center|LOCUS_70280 8594614 8595045 gene locus_tag LOCUS_70290 8594614 8595045 CDS product DUF1641 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220510.1 protein_id gnl|my_center|LOCUS_70290 8595082 8596263 gene locus_tag LOCUS_70300 8595082 8596263 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043202.1 protein_id gnl|my_center|LOCUS_70300 8596875 8596324 gene locus_tag LOCUS_70310 8596875 8596324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70310 8597238 8598245 gene locus_tag LOCUS_70320 8597238 8598245 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989509.1 protein_id gnl|my_center|LOCUS_70320 8598356 8598640 gene locus_tag LOCUS_70330 8598356 8598640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70330 8598795 8601302 gene locus_tag LOCUS_70340 8598795 8601302 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139603260.1 protein_id gnl|my_center|LOCUS_70340 8601934 8601299 gene locus_tag LOCUS_70350 8601934 8601299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 8602381 8603523 gene locus_tag LOCUS_70360 8602381 8603523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 8603661 8603939 gene locus_tag LOCUS_70370 8603661 8603939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70370 8604706 8604197 gene locus_tag LOCUS_70380 8604706 8604197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70380 8605650 8604754 gene locus_tag LOCUS_70390 8605650 8604754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 8605543 8605755 gene locus_tag LOCUS_70400 8605543 8605755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 8605844 8606668 gene locus_tag LOCUS_70410 8605844 8606668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 8607874 8607044 gene locus_tag LOCUS_70420 8607874 8607044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 8608079 8608951 gene locus_tag LOCUS_70430 8608079 8608951 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754235.1 protein_id gnl|my_center|LOCUS_70430 8609015 8610655 gene locus_tag LOCUS_70440 8609015 8610655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70440 8610691 8611773 gene locus_tag LOCUS_70450 8610691 8611773 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705962.1 protein_id gnl|my_center|LOCUS_70450 8611786 8613573 gene locus_tag LOCUS_70460 gene yesM 8611786 8613573 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_70460 8614624 8616516 gene locus_tag LOCUS_70470 8614624 8616516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 8617015 8618346 gene locus_tag LOCUS_70480 gene megL 8617015 8618346 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_70480 8618398 8619489 gene locus_tag LOCUS_70490 8618398 8619489 CDS product glycoside hydrolase family 105 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705962.1 protein_id gnl|my_center|LOCUS_70490 8619623 8619486 gene locus_tag LOCUS_70500 8619623 8619486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70500 8619672 8620565 gene locus_tag LOCUS_70510 gene rmgP 8619672 8620565 CDS product polygalacturonan/rhamnogalacturonan ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229209.1 protein_id gnl|my_center|LOCUS_70510 8620559 8621539 gene locus_tag LOCUS_70520 8620559 8621539 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_70520 8621620 8623266 gene locus_tag LOCUS_70530 8621620 8623266 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244341.1 protein_id gnl|my_center|LOCUS_70530 8623361 8625070 gene locus_tag LOCUS_70540 8623361 8625070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70540 8625122 8626123 gene locus_tag LOCUS_70550 8625122 8626123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 8626261 8628027 gene locus_tag LOCUS_70560 8626261 8628027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70560 8628002 8629771 gene locus_tag LOCUS_70570 8628002 8629771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70570 8630319 8631659 gene locus_tag LOCUS_70580 8630319 8631659 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836857.1 protein_id gnl|my_center|LOCUS_70580 8631745 8632665 gene locus_tag LOCUS_70590 8631745 8632665 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235624137.1 protein_id gnl|my_center|LOCUS_70590 8632667 8633491 gene locus_tag LOCUS_70600 8632667 8633491 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_70600 8633794 8636559 gene locus_tag LOCUS_70610 8633794 8636559 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_70610 8636556 8637290 gene locus_tag LOCUS_70620 8636556 8637290 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119544.1 protein_id gnl|my_center|LOCUS_70620 8637287 8638264 gene locus_tag LOCUS_70630 8637287 8638264 CDS product C-terminal binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062075126.1 protein_id gnl|my_center|LOCUS_70630 8638286 8639050 gene locus_tag LOCUS_70640 8638286 8639050 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810029.1 protein_id gnl|my_center|LOCUS_70640 8640184 8639243 gene locus_tag LOCUS_70650 8640184 8639243 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187436936.1 protein_id gnl|my_center|LOCUS_70650 8641191 8640385 gene locus_tag LOCUS_70660 8641191 8640385 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_70660 8641309 8642217 gene locus_tag LOCUS_70670 8641309 8642217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70670 8642833 8642249 gene locus_tag LOCUS_70680 8642833 8642249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 8643090 8644640 gene locus_tag LOCUS_70690 8643090 8644640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 8646267 8645200 gene locus_tag LOCUS_70700 8646267 8645200 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250607.1 protein_id gnl|my_center|LOCUS_70700 8647377 8646331 gene locus_tag LOCUS_70710 8647377 8646331 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210196.1 protein_id gnl|my_center|LOCUS_70710 8647503 8648267 gene locus_tag LOCUS_70720 8647503 8648267 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459298.1 protein_id gnl|my_center|LOCUS_70720 8648283 8648741 gene locus_tag LOCUS_70730 8648283 8648741 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808679.1 protein_id gnl|my_center|LOCUS_70730 8650346 8649186 gene locus_tag LOCUS_70740 8650346 8649186 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030728.1 protein_id gnl|my_center|LOCUS_70740 8652119 8650716 gene locus_tag LOCUS_70750 8652119 8650716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70750 8655064 8652578 gene locus_tag LOCUS_70760 8655064 8652578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70760 8655366 8656373 gene locus_tag LOCUS_70770 8655366 8656373 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706159.1 protein_id gnl|my_center|LOCUS_70770 8656393 8657364 gene locus_tag LOCUS_70780 8656393 8657364 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584023.1 protein_id gnl|my_center|LOCUS_70780 8657390 8658688 gene locus_tag LOCUS_70790 gene celF 8657390 8658688 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145749.1 protein_id gnl|my_center|LOCUS_70790 8659358 8663617 gene locus_tag LOCUS_70800 8659358 8663617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70800 8663935 8665578 gene locus_tag LOCUS_70810 8663935 8665578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70810 8665998 8667455 gene locus_tag LOCUS_70820 8665998 8667455 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164993978.1 protein_id gnl|my_center|LOCUS_70820 8667525 8667827 gene locus_tag LOCUS_70830 8667525 8667827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70830 >Feature sequence2 263 1600 gene locus_tag LOCUS_70840 263 1600 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972759.1 protein_id gnl|my_center|LOCUS_70840 1695 2612 gene locus_tag LOCUS_70850 1695 2612 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971641.1 protein_id gnl|my_center|LOCUS_70850 2625 3437 gene locus_tag LOCUS_70860 2625 3437 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312430.1 protein_id gnl|my_center|LOCUS_70860 3460 5295 gene locus_tag LOCUS_70870 gene yesM 3460 5295 CDS product two-component system sensor histidine kinase YesM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243833.1 protein_id gnl|my_center|LOCUS_70870 5311 6912 gene locus_tag LOCUS_70880 5311 6912 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393603.1 protein_id gnl|my_center|LOCUS_70880 6967 8244 gene locus_tag LOCUS_70890 6967 8244 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970436.1 protein_id gnl|my_center|LOCUS_70890 8930 8568 gene locus_tag LOCUS_70900 8930 8568 CDS product DUF3889 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228776.1 protein_id gnl|my_center|LOCUS_70900 9161 9970 gene locus_tag LOCUS_70910 9161 9970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70910 10689 10069 gene locus_tag LOCUS_70920 10689 10069 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_70920 10864 12267 gene locus_tag LOCUS_70930 10864 12267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 12813 15716 gene locus_tag LOCUS_70940 12813 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70940 15831 18149 gene locus_tag LOCUS_70950 15831 18149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70950 18313 18963 gene locus_tag LOCUS_70960 18313 18963 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185393.1 protein_id gnl|my_center|LOCUS_70960 19673 21001 gene locus_tag LOCUS_70970 gene ltrA 19673 21001 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272711.1 protein_id gnl|my_center|LOCUS_70970 21403 24477 gene locus_tag LOCUS_70980 21403 24477 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459091.1 protein_id gnl|my_center|LOCUS_70980 24481 25641 gene locus_tag LOCUS_70990 24481 25641 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136609070.1 protein_id gnl|my_center|LOCUS_70990 27094 25943 gene locus_tag LOCUS_71000 27094 25943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71000 28116 27148 gene locus_tag LOCUS_71010 28116 27148 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712215.1 protein_id gnl|my_center|LOCUS_71010 28482 28234 gene locus_tag LOCUS_71020 28482 28234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71020 28484 29164 gene locus_tag LOCUS_71030 gene modA 28484 29164 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 protein_id gnl|my_center|LOCUS_71030 29177 29836 gene locus_tag LOCUS_71040 gene modB 29177 29836 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906541.1 protein_id gnl|my_center|LOCUS_71040 32087 29931 gene locus_tag LOCUS_71050 32087 29931 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047982.1 protein_id gnl|my_center|LOCUS_71050 32331 33071 gene locus_tag LOCUS_71060 gene frlR 32331 33071 CDS product transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228628.1 protein_id gnl|my_center|LOCUS_71060 33275 34099 gene locus_tag LOCUS_71070 gene frlD 33275 34099 CDS product fructosamine kinase FrlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228626.1 protein_id gnl|my_center|LOCUS_71070 34369 35151 gene locus_tag LOCUS_71080 gene frlD 34369 35151 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853353.1 protein_id gnl|my_center|LOCUS_71080 35221 36093 gene locus_tag LOCUS_71090 35221 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71090 36081 36509 gene locus_tag LOCUS_71100 36081 36509 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211334279.1 protein_id gnl|my_center|LOCUS_71100 36530 37375 gene locus_tag LOCUS_71110 36530 37375 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_71110 37372 38208 gene locus_tag LOCUS_71120 37372 38208 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_71120 38253 39104 gene locus_tag LOCUS_71130 38253 39104 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_71130 39119 39958 gene locus_tag LOCUS_71140 39119 39958 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970333.1 protein_id gnl|my_center|LOCUS_71140 40026 40946 gene locus_tag LOCUS_71150 40026 40946 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214518.1 protein_id gnl|my_center|LOCUS_71150 40977 41714 gene locus_tag LOCUS_71160 40977 41714 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_71160 41740 42468 gene locus_tag LOCUS_71170 41740 42468 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268107.1 protein_id gnl|my_center|LOCUS_71170 42419 43072 gene locus_tag LOCUS_71180 42419 43072 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462042.1 protein_id gnl|my_center|LOCUS_71180 43105 43929 gene locus_tag LOCUS_71190 gene frlC 43105 43929 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_71190 43959 45188 gene locus_tag LOCUS_71200 43959 45188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71200 45223 46674 gene locus_tag LOCUS_71210 45223 46674 CDS product malate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338924.1 protein_id gnl|my_center|LOCUS_71210 46655 48073 gene locus_tag LOCUS_71220 gene aspA 46655 48073 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 protein_id gnl|my_center|LOCUS_71220 48182 49186 gene locus_tag LOCUS_71230 gene frlB 48182 49186 CDS product fructosamine deglycase FrlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243688.1 protein_id gnl|my_center|LOCUS_71230 49340 51352 gene locus_tag LOCUS_71240 gene tet 49340 51352 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_71240 51946 51458 gene locus_tag LOCUS_71250 51946 51458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71250 52191 52766 gene locus_tag LOCUS_71260 52191 52766 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_71260 52959 53936 gene locus_tag LOCUS_71270 52959 53936 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_71270 54787 53933 gene locus_tag LOCUS_71280 54787 53933 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721325.1 protein_id gnl|my_center|LOCUS_71280 56901 54784 gene locus_tag LOCUS_71290 56901 54784 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989503.1 protein_id gnl|my_center|LOCUS_71290 58168 56918 gene locus_tag LOCUS_71300 58168 56918 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732671.1 protein_id gnl|my_center|LOCUS_71300 59750 58155 gene locus_tag LOCUS_71310 59750 58155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355763.1 protein_id gnl|my_center|LOCUS_71310 61317 59782 gene locus_tag LOCUS_71320 61317 59782 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721321.1 protein_id gnl|my_center|LOCUS_71320 62474 61350 gene locus_tag LOCUS_71330 62474 61350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189823.1 protein_id gnl|my_center|LOCUS_71330 62623 62787 gene locus_tag LOCUS_71340 62623 62787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71340 62887 63369 gene locus_tag LOCUS_71350 62887 63369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71350 63366 66563 gene locus_tag LOCUS_71360 63366 66563 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185141306.1 protein_id gnl|my_center|LOCUS_71360 68970 67579 gene locus_tag LOCUS_71370 gene fumC 68970 67579 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456604.1 protein_id gnl|my_center|LOCUS_71370 70181 69204 gene locus_tag LOCUS_71380 70181 69204 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810847.1 protein_id gnl|my_center|LOCUS_71380 70593 71381 gene locus_tag LOCUS_71390 70593 71381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886450.1 protein_id gnl|my_center|LOCUS_71390 71401 72243 gene locus_tag LOCUS_71400 71401 72243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_71400 72260 73096 gene locus_tag LOCUS_71410 72260 73096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886451.1 protein_id gnl|my_center|LOCUS_71410 73233 74318 gene locus_tag LOCUS_71420 73233 74318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71420 74413 75753 gene locus_tag LOCUS_71430 74413 75753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71430 75806 76567 gene locus_tag LOCUS_71440 75806 76567 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144270.1 protein_id gnl|my_center|LOCUS_71440 76613 78349 gene locus_tag LOCUS_71450 76613 78349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243936.1 protein_id gnl|my_center|LOCUS_71450 78342 80159 gene locus_tag LOCUS_71460 78342 80159 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244082.1 protein_id gnl|my_center|LOCUS_71460 80201 81127 gene locus_tag LOCUS_71470 gene cysK 80201 81127 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762273.1 protein_id gnl|my_center|LOCUS_71470 81144 82754 gene locus_tag LOCUS_71480 81144 82754 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_71480 82950 83963 gene locus_tag LOCUS_71490 82950 83963 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964016.1 protein_id gnl|my_center|LOCUS_71490 84924 84082 gene locus_tag LOCUS_71500 84924 84082 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_71500 85144 86388 gene locus_tag LOCUS_71510 gene fabF 85144 86388 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_71510 86538 87698 gene locus_tag LOCUS_71520 gene purT 86538 87698 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246432.1 protein_id gnl|my_center|LOCUS_71520 89461 87776 gene locus_tag LOCUS_71530 89461 87776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71530 89704 89495 gene locus_tag LOCUS_71540 89704 89495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71540 90891 89701 gene locus_tag LOCUS_71550 90891 89701 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461855.1 protein_id gnl|my_center|LOCUS_71550 92434 90884 gene locus_tag LOCUS_71560 92434 90884 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233683.1 protein_id gnl|my_center|LOCUS_71560 92590 92931 gene locus_tag LOCUS_71570 92590 92931 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242640.1 protein_id gnl|my_center|LOCUS_71570 93210 93872 gene locus_tag LOCUS_71580 93210 93872 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722624.1 protein_id gnl|my_center|LOCUS_71580 94899 93988 gene locus_tag LOCUS_71590 94899 93988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71590 95273 94899 gene locus_tag LOCUS_71600 95273 94899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71600 95573 95812 gene locus_tag LOCUS_71610 95573 95812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71610 96078 97073 gene locus_tag LOCUS_71620 gene cyoA 96078 97073 CDS product ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036356.1 protein_id gnl|my_center|LOCUS_71620 97087 99045 gene locus_tag LOCUS_71630 gene qoxB 97087 99045 CDS product cytochrome aa3 quinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227407.1 protein_id gnl|my_center|LOCUS_71630 99045 99665 gene locus_tag LOCUS_71640 99045 99665 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706742.1 protein_id gnl|my_center|LOCUS_71640 99667 100008 gene locus_tag LOCUS_71650 99667 100008 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208652.1 protein_id gnl|my_center|LOCUS_71650 102439 100907 gene locus_tag LOCUS_71660 102439 100907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71660 103686 102442 gene locus_tag LOCUS_71670 103686 102442 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_71670 104535 103705 gene locus_tag LOCUS_71680 104535 103705 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776867.1 protein_id gnl|my_center|LOCUS_71680 105428 104556 gene locus_tag LOCUS_71690 105428 104556 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055566.1 protein_id gnl|my_center|LOCUS_71690 106892 105507 gene locus_tag LOCUS_71700 106892 105507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71700 109287 106918 gene locus_tag LOCUS_71710 109287 106918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71710 112381 109316 gene locus_tag LOCUS_71720 112381 109316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71720 113736 112576 gene locus_tag LOCUS_71730 113736 112576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71730 115553 113733 gene locus_tag LOCUS_71740 115553 113733 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_71740 116726 115833 gene locus_tag LOCUS_71750 gene mneP 116726 115833 CDS product manganese transporter MneP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244477.1 protein_id gnl|my_center|LOCUS_71750 117239 118693 gene locus_tag LOCUS_71760 117239 118693 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_71760 118716 119669 gene locus_tag LOCUS_71770 118716 119669 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888673.1 protein_id gnl|my_center|LOCUS_71770 119666 120532 gene locus_tag LOCUS_71780 119666 120532 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919474.1 protein_id gnl|my_center|LOCUS_71780 121176 122651 gene locus_tag LOCUS_71790 121176 122651 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 protein_id gnl|my_center|LOCUS_71790 123754 122687 gene locus_tag LOCUS_71800 123754 122687 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461666.1 protein_id gnl|my_center|LOCUS_71800 123901 124824 gene locus_tag LOCUS_71810 123901 124824 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_71810 125537 124896 gene locus_tag LOCUS_71820 125537 124896 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975554.1 protein_id gnl|my_center|LOCUS_71820 125691 126521 gene locus_tag LOCUS_71830 gene ytbE 125691 126521 CDS product aldo/keto reductase YtbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229455.1 protein_id gnl|my_center|LOCUS_71830 126652 127077 gene locus_tag LOCUS_71840 gene saiR 126652 127077 CDS product Rrf2-family transcriptional regulator SaiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093215.1 protein_id gnl|my_center|LOCUS_71840 127224 127535 gene locus_tag LOCUS_71850 gene trxA 127224 127535 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_71850 128724 128020 gene locus_tag LOCUS_71860 128724 128020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71860 128987 129364 gene locus_tag LOCUS_71870 128987 129364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71870 129428 130141 gene locus_tag LOCUS_71880 129428 130141 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_71880 130138 131226 gene locus_tag LOCUS_71890 130138 131226 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836930.1 protein_id gnl|my_center|LOCUS_71890 131230 132501 gene locus_tag LOCUS_71900 131230 132501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71900 133934 132531 gene locus_tag LOCUS_71910 133934 132531 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973776.1 protein_id gnl|my_center|LOCUS_71910 135493 133931 gene locus_tag LOCUS_71920 135493 133931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71920 136056 135490 gene locus_tag LOCUS_71930 136056 135490 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438330.1 protein_id gnl|my_center|LOCUS_71930 136517 136374 gene locus_tag LOCUS_71940 136517 136374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71940 136628 137626 gene locus_tag LOCUS_71950 136628 137626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71950 137782 138882 gene locus_tag LOCUS_71960 gene ychF 137782 138882 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_71960 139609 139181 gene locus_tag LOCUS_71970 139609 139181 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243994.1 protein_id gnl|my_center|LOCUS_71970 139768 140223 gene locus_tag LOCUS_71980 139768 140223 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029332115.1 protein_id gnl|my_center|LOCUS_71980 140276 141520 gene locus_tag LOCUS_71990 140276 141520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233759.1 protein_id gnl|my_center|LOCUS_71990 141703 142545 gene locus_tag LOCUS_72000 141703 142545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72000 142725 144521 gene locus_tag LOCUS_72010 142725 144521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_72010 144659 144444 gene locus_tag LOCUS_72020 144659 144444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72020 145732 145229 gene locus_tag LOCUS_72030 145732 145229 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284980.1 protein_id gnl|my_center|LOCUS_72030 146793 145810 gene locus_tag LOCUS_72040 146793 145810 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053995180.1 protein_id gnl|my_center|LOCUS_72040 147956 146790 gene locus_tag LOCUS_72050 147956 146790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72050 148083 148967 gene locus_tag LOCUS_72060 148083 148967 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809600.1 protein_id gnl|my_center|LOCUS_72060 149046 150128 gene locus_tag LOCUS_72070 gene prfA 149046 150128 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887065.1 protein_id gnl|my_center|LOCUS_72070 150331 150804 gene locus_tag LOCUS_72080 150331 150804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72080 151765 150920 gene locus_tag LOCUS_72090 151765 150920 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530905.1 protein_id gnl|my_center|LOCUS_72090 151919 153313 gene locus_tag LOCUS_72100 151919 153313 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230065.1 protein_id gnl|my_center|LOCUS_72100 153539 154471 gene locus_tag LOCUS_72110 gene prmC 153539 154471 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267061.1 protein_id gnl|my_center|LOCUS_72110 154585 155313 gene locus_tag LOCUS_72120 gene spoIIR 154585 155313 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227654.1 protein_id gnl|my_center|LOCUS_72120 155429 156523 gene locus_tag LOCUS_72130 155429 156523 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557353.1 protein_id gnl|my_center|LOCUS_72130 156759 157316 gene locus_tag LOCUS_72140 156759 157316 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227661.1 protein_id gnl|my_center|LOCUS_72140 157373 157954 gene locus_tag LOCUS_72150 157373 157954 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393870.1 protein_id gnl|my_center|LOCUS_72150 158920 158033 gene locus_tag LOCUS_72160 158920 158033 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391725.1 protein_id gnl|my_center|LOCUS_72160 159671 159057 gene locus_tag LOCUS_72170 159671 159057 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862908.1 protein_id gnl|my_center|LOCUS_72170 159945 160403 gene locus_tag LOCUS_72180 gene rpiB 159945 160403 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_72180 160429 161028 gene locus_tag LOCUS_72190 160429 161028 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136366.1 protein_id gnl|my_center|LOCUS_72190 161180 162430 gene locus_tag LOCUS_72200 gene glyA 161180 162430 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_72200 162841 163923 gene locus_tag LOCUS_72210 162841 163923 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_72210 164098 164766 gene locus_tag LOCUS_72220 164098 164766 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110287.1 protein_id gnl|my_center|LOCUS_72220 164936 165340 gene locus_tag LOCUS_72230 164936 165340 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220090.1 protein_id gnl|my_center|LOCUS_72230 165365 165880 gene locus_tag LOCUS_72240 165365 165880 CDS product DUF4178 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051742.1 protein_id gnl|my_center|LOCUS_72240 165877 166656 gene locus_tag LOCUS_72250 165877 166656 CDS product DUF4247 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054401985.1 protein_id gnl|my_center|LOCUS_72250 166784 167530 gene locus_tag LOCUS_72260 166784 167530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72260 167927 168100 gene locus_tag LOCUS_72270 167927 168100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72270 169450 168404 gene locus_tag LOCUS_72280 gene namA 169450 168404 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732493.1 protein_id gnl|my_center|LOCUS_72280 170875 169550 gene locus_tag LOCUS_72290 170875 169550 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230095.1 protein_id gnl|my_center|LOCUS_72290 171320 171009 gene locus_tag LOCUS_72300 171320 171009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72300 172118 171432 gene locus_tag LOCUS_72310 172118 171432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72310 172294 172923 gene locus_tag LOCUS_72320 gene upp 172294 172923 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_72320 172956 174095 gene locus_tag LOCUS_72330 gene wecB 172956 174095 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 protein_id gnl|my_center|LOCUS_72330 174455 174706 gene locus_tag LOCUS_72340 174455 174706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72340 174706 175113 gene locus_tag LOCUS_72350 174706 175113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72350 175091 175870 gene locus_tag LOCUS_72360 gene atpB 175091 175870 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242621.1 protein_id gnl|my_center|LOCUS_72360 175906 176127 gene locus_tag LOCUS_72370 gene atpE 175906 176127 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052064.1 protein_id gnl|my_center|LOCUS_72370 176243 176728 gene locus_tag LOCUS_72380 gene atpF 176243 176728 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732516.1 protein_id gnl|my_center|LOCUS_72380 176725 177270 gene locus_tag LOCUS_72390 gene atpH 176725 177270 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064683.1 protein_id gnl|my_center|LOCUS_72390 177304 178827 gene locus_tag LOCUS_72400 gene atpA 177304 178827 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243657.1 protein_id gnl|my_center|LOCUS_72400 178919 179794 gene locus_tag LOCUS_72410 gene atpG 178919 179794 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_72410 179871 181277 gene locus_tag LOCUS_72420 gene atpD 179871 181277 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032600.1 protein_id gnl|my_center|LOCUS_72420 181302 181703 gene locus_tag LOCUS_72430 181302 181703 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_72430 181838 182848 gene locus_tag LOCUS_72440 181838 182848 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168520.1 protein_id gnl|my_center|LOCUS_72440 182933 183394 gene locus_tag LOCUS_72450 gene mrgA 182933 183394 CDS product metalloregulation DNA-binding stress protein MgrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228537.1 protein_id gnl|my_center|LOCUS_72450 183640 187827 gene locus_tag LOCUS_72460 183640 187827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72460 188049 195389 gene locus_tag LOCUS_72470 188049 195389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72470 195922 198042 gene locus_tag LOCUS_72480 195922 198042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72480 198083 198334 gene locus_tag LOCUS_72490 198083 198334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72490 198564 199967 gene locus_tag LOCUS_72500 gene murA 198564 199967 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227695.1 protein_id gnl|my_center|LOCUS_72500 200135 201454 gene locus_tag LOCUS_72510 200135 201454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72510 201650 202267 gene locus_tag LOCUS_72520 201650 202267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72520 202431 203573 gene locus_tag LOCUS_72530 202431 203573 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_72530 203779 204066 gene locus_tag LOCUS_72540 gene spoIIID 203779 204066 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221804.1 protein_id gnl|my_center|LOCUS_72540 204159 205154 gene locus_tag LOCUS_72550 204159 205154 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457984.1 protein_id gnl|my_center|LOCUS_72550 205183 206049 gene locus_tag LOCUS_72560 gene flgF 205183 206049 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816186.1 protein_id gnl|my_center|LOCUS_72560 206071 206916 gene locus_tag LOCUS_72570 gene flgG 206071 206916 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_72570 207049 207282 gene locus_tag LOCUS_72580 207049 207282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72580 207530 208048 gene locus_tag LOCUS_72590 gene pgsA 207530 208048 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_72590 208238 208684 gene locus_tag LOCUS_72600 gene fabZ 208238 208684 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829953.1 protein_id gnl|my_center|LOCUS_72600 208775 210478 gene locus_tag LOCUS_72610 208775 210478 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 protein_id gnl|my_center|LOCUS_72610 210937 212985 gene locus_tag LOCUS_72620 210937 212985 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871314.1 protein_id gnl|my_center|LOCUS_72620 213116 214393 gene locus_tag LOCUS_72630 213116 214393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72630 214396 215163 gene locus_tag LOCUS_72640 214396 215163 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290748.1 protein_id gnl|my_center|LOCUS_72640 215296 216441 gene locus_tag LOCUS_72650 215296 216441 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722780.1 protein_id gnl|my_center|LOCUS_72650 216674 220453 gene locus_tag LOCUS_72660 216674 220453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72660 221022 223778 gene locus_tag LOCUS_72670 221022 223778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72670 223947 226097 gene locus_tag LOCUS_72680 223947 226097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72680 226236 227747 gene locus_tag LOCUS_72690 226236 227747 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_72690 227760 230183 gene locus_tag LOCUS_72700 227760 230183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72700 230199 231176 gene locus_tag LOCUS_72710 gene rfbN 230199 231176 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_72710 231196 231684 gene locus_tag LOCUS_72720 231196 231684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72720 231700 232677 gene locus_tag LOCUS_72730 231700 232677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72730 233500 234756 gene locus_tag LOCUS_72740 233500 234756 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705992.1 protein_id gnl|my_center|LOCUS_72740 234749 235813 gene locus_tag LOCUS_72750 234749 235813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72750 235797 237239 gene locus_tag LOCUS_72760 235797 237239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72760 237236 239449 gene locus_tag LOCUS_72770 237236 239449 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 protein_id gnl|my_center|LOCUS_72770 239464 240207 gene locus_tag LOCUS_72780 239464 240207 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676157.1 protein_id gnl|my_center|LOCUS_72780 240232 240783 gene locus_tag LOCUS_72790 gene rfbC 240232 240783 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_72790 240799 241815 gene locus_tag LOCUS_72800 gene rfbB 240799 241815 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_72800 241819 242673 gene locus_tag LOCUS_72810 gene rfbD 241819 242673 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_72810 242677 243639 gene locus_tag LOCUS_72820 242677 243639 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877828.1 protein_id gnl|my_center|LOCUS_72820 243680 245704 gene locus_tag LOCUS_72830 243680 245704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72830 245734 246144 gene locus_tag LOCUS_72840 245734 246144 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_72840 246165 246719 gene locus_tag LOCUS_72850 246165 246719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72850 246716 247804 gene locus_tag LOCUS_72860 246716 247804 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057184.1 protein_id gnl|my_center|LOCUS_72860 247794 248726 gene locus_tag LOCUS_72870 247794 248726 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_72870 249199 249474 gene locus_tag LOCUS_72880 249199 249474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72880 249628 250833 gene locus_tag LOCUS_72890 gene metK 249628 250833 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_72890 250979 255331 gene locus_tag LOCUS_72900 250979 255331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72900 255463 256173 gene locus_tag LOCUS_72910 255463 256173 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110492.1 protein_id gnl|my_center|LOCUS_72910 256261 258456 gene locus_tag LOCUS_72920 256261 258456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_72920 258615 259394 gene locus_tag LOCUS_72930 258615 259394 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_72930 259375 260070 gene locus_tag LOCUS_72940 259375 260070 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986981.1 protein_id gnl|my_center|LOCUS_72940 260096 261916 gene locus_tag LOCUS_72950 260096 261916 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272023.1 protein_id gnl|my_center|LOCUS_72950 261962 263077 gene locus_tag LOCUS_72960 261962 263077 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_72960 263077 263718 gene locus_tag LOCUS_72970 263077 263718 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_72970 263715 264695 gene locus_tag LOCUS_72980 263715 264695 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_72980 264692 265405 gene locus_tag LOCUS_72990 264692 265405 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392275.1 protein_id gnl|my_center|LOCUS_72990 265443 265619 gene locus_tag LOCUS_73000 265443 265619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_73000 265678 266895 gene locus_tag LOCUS_73010 265678 266895 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704930.1 protein_id gnl|my_center|LOCUS_73010 266940 267821 gene locus_tag LOCUS_73020 266940 267821 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_73020 267860 268603 gene locus_tag LOCUS_73030 267860 268603 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_73030 268603 269676 gene locus_tag LOCUS_73040 268603 269676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73040 269704 270789 gene locus_tag LOCUS_73050 gene gmd 269704 270789 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_73050 270801 271733 gene locus_tag LOCUS_73060 270801 271733 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_73060 271776 273095 gene locus_tag LOCUS_73070 271776 273095 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_73070 273117 274280 gene locus_tag LOCUS_73080 273117 274280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73080 274309 275409 gene locus_tag LOCUS_73090 274309 275409 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_73090 275968 275639 gene locus_tag LOCUS_73100 275968 275639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73100 277182 278540 gene locus_tag LOCUS_73110 277182 278540 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046233294.1 protein_id gnl|my_center|LOCUS_73110 278627 279790 gene locus_tag LOCUS_73120 278627 279790 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_73120 279912 280589 gene locus_tag LOCUS_73130 279912 280589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73130 280791 280612 gene locus_tag LOCUS_73140 280791 280612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73140 281075 281302 gene locus_tag LOCUS_73150 281075 281302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73150 281324 282310 gene locus_tag LOCUS_73160 281324 282310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73160 282350 282919 gene locus_tag LOCUS_73170 282350 282919 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287389.1 protein_id gnl|my_center|LOCUS_73170 283142 285850 gene locus_tag LOCUS_73180 283142 285850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73180 285999 287177 gene locus_tag LOCUS_73190 gene degS 285999 287177 CDS product two-component sensor histidine kinase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227983.1 protein_id gnl|my_center|LOCUS_73190 287167 287901 gene locus_tag LOCUS_73200 gene degU 287167 287901 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_73200 288244 288831 gene locus_tag LOCUS_73210 288244 288831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73210 289029 291179 gene locus_tag LOCUS_73220 289029 291179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73220 291176 291940 gene locus_tag LOCUS_73230 291176 291940 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_73230 292016 292408 gene locus_tag LOCUS_73240 292016 292408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73240 292477 292764 gene locus_tag LOCUS_73250 292477 292764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73250 292790 293293 gene locus_tag LOCUS_73260 292790 293293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73260 293313 294884 gene locus_tag LOCUS_73270 gene flgK 293313 294884 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_73270 294904 295824 gene locus_tag LOCUS_73280 gene flgL 294904 295824 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_73280 295842 296423 gene locus_tag LOCUS_73290 295842 296423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73290 296590 297054 gene locus_tag LOCUS_73300 gene fliW 296590 297054 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460794.1 protein_id gnl|my_center|LOCUS_73300 297059 297310 gene locus_tag LOCUS_73310 gene csrA 297059 297310 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960595.1 protein_id gnl|my_center|LOCUS_73310 297461 299077 gene locus_tag LOCUS_73320 297461 299077 CDS product FliC/FljB family flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079698.1 protein_id gnl|my_center|LOCUS_73320 299205 299795 gene locus_tag LOCUS_73330 299205 299795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73330 299792 301708 gene locus_tag LOCUS_73340 299792 301708 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392283.1 protein_id gnl|my_center|LOCUS_73340 301903 302757 gene locus_tag LOCUS_73350 301903 302757 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_73350 302754 303677 gene locus_tag LOCUS_73360 302754 303677 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088736.1 protein_id gnl|my_center|LOCUS_73360 303670 304383 gene locus_tag LOCUS_73370 303670 304383 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088737.1 protein_id gnl|my_center|LOCUS_73370 304376 305197 gene locus_tag LOCUS_73380 304376 305197 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_73380 305296 305712 gene locus_tag LOCUS_73390 305296 305712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73390 305744 307594 gene locus_tag LOCUS_73400 305744 307594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73400 307650 308048 gene locus_tag LOCUS_73410 gene fliS 307650 308048 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392287.1 protein_id gnl|my_center|LOCUS_73410 308041 308391 gene locus_tag LOCUS_73420 308041 308391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73420 308551 309546 gene locus_tag LOCUS_73430 308551 309546 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_73430 309543 310736 gene locus_tag LOCUS_73440 309543 310736 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_73440 310733 311902 gene locus_tag LOCUS_73450 gene neuC 310733 311902 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_73450 311899 312981 gene locus_tag LOCUS_73460 311899 312981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73460 312988 314082 gene locus_tag LOCUS_73470 gene neuB 312988 314082 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261003.1 protein_id gnl|my_center|LOCUS_73470 314066 315082 gene locus_tag LOCUS_73480 314066 315082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73480 315087 315752 gene locus_tag LOCUS_73490 315087 315752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73490 315930 316133 gene locus_tag LOCUS_73500 gene cspC 315930 316133 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_73500 316357 316917 gene locus_tag LOCUS_73510 gene raiA 316357 316917 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_73510 317024 317965 gene locus_tag LOCUS_73520 317024 317965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73520 318096 320612 gene locus_tag LOCUS_73530 gene secA 318096 320612 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579368.1 protein_id gnl|my_center|LOCUS_73530 320889 321920 gene locus_tag LOCUS_73540 gene prfB 320889 321920 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_73540 322143 323150 gene locus_tag LOCUS_73550 322143 323150 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_73550 323592 324674 gene locus_tag LOCUS_73560 gene argC 323592 324674 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245768.1 protein_id gnl|my_center|LOCUS_73560 324697 325923 gene locus_tag LOCUS_73570 gene argJ 324697 325923 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163580248.1 protein_id gnl|my_center|LOCUS_73570 325940 326722 gene locus_tag LOCUS_73580 gene argB 325940 326722 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124653.1 protein_id gnl|my_center|LOCUS_73580 326784 327965 gene locus_tag LOCUS_73590 326784 327965 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_73590 328468 329430 gene locus_tag LOCUS_73600 gene argF 328468 329430 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_73600 329558 330796 gene locus_tag LOCUS_73610 329558 330796 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938394.1 protein_id gnl|my_center|LOCUS_73610 330818 330988 gene locus_tag LOCUS_73620 330818 330988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73620 331253 332668 gene locus_tag LOCUS_73630 gene argH 331253 332668 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041296.1 protein_id gnl|my_center|LOCUS_73630 332953 333780 gene locus_tag LOCUS_73640 332953 333780 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192784.1 protein_id gnl|my_center|LOCUS_73640 334043 335026 gene locus_tag LOCUS_73650 334043 335026 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142819.1 protein_id gnl|my_center|LOCUS_73650 335963 335076 gene locus_tag LOCUS_73660 335963 335076 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050603.1 protein_id gnl|my_center|LOCUS_73660 336142 337287 gene locus_tag LOCUS_73670 336142 337287 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973976.1 protein_id gnl|my_center|LOCUS_73670 337335 338984 gene locus_tag LOCUS_73680 337335 338984 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_73680 338981 340159 gene locus_tag LOCUS_73690 338981 340159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73690 340171 340806 gene locus_tag LOCUS_73700 340171 340806 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_73700 342527 340866 gene locus_tag LOCUS_73710 342527 340866 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_73710 342812 343498 gene locus_tag LOCUS_73720 gene ftsE 342812 343498 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228039.1 protein_id gnl|my_center|LOCUS_73720 343488 344402 gene locus_tag LOCUS_73730 gene ftsX 343488 344402 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645021.1 protein_id gnl|my_center|LOCUS_73730 344442 345620 gene locus_tag LOCUS_73740 344442 345620 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_73740 346166 347680 gene locus_tag LOCUS_73750 gene minJ 346166 347680 CDS product cell division topological determinant MinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242631.1 protein_id gnl|my_center|LOCUS_73750 347974 348327 gene locus_tag LOCUS_73760 347974 348327 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706751.1 protein_id gnl|my_center|LOCUS_73760 348327 348644 gene locus_tag LOCUS_73770 348327 348644 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002474345.1 protein_id gnl|my_center|LOCUS_73770 349833 348712 gene locus_tag LOCUS_73780 349833 348712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_73780 350934 349840 gene locus_tag LOCUS_73790 350934 349840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73790 351102 351698 gene locus_tag LOCUS_73800 351102 351698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73800 352526 351726 gene locus_tag LOCUS_73810 352526 351726 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_73810 353319 352486 gene locus_tag LOCUS_73820 353319 352486 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_73820 353474 355462 gene locus_tag LOCUS_73830 gene uvrB 353474 355462 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_73830 355881 356810 gene locus_tag LOCUS_73840 355881 356810 CDS product IS1595-like element ISRsp21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076611897.1 protein_id gnl|my_center|LOCUS_73840 357276 360140 gene locus_tag LOCUS_73850 gene uvrA 357276 360140 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_73850 360325 361020 gene locus_tag LOCUS_73860 gene rpiA 360325 361020 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364539.1 protein_id gnl|my_center|LOCUS_73860 364632 361096 gene locus_tag LOCUS_73870 364632 361096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73870 366202 364763 gene locus_tag LOCUS_73880 366202 364763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73880 366192 366434 gene locus_tag LOCUS_73890 366192 366434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73890 367332 366460 gene locus_tag LOCUS_73900 367332 366460 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_73900 368280 367363 gene locus_tag LOCUS_73910 368280 367363 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_73910 369326 368325 gene locus_tag LOCUS_73920 369326 368325 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_73920 369455 370330 gene locus_tag LOCUS_73930 369455 370330 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_73930 370362 371789 gene locus_tag LOCUS_73940 370362 371789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73940 371776 372501 gene locus_tag LOCUS_73950 371776 372501 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_73950 372600 373310 gene locus_tag LOCUS_73960 372600 373310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73960 373307 374899 gene locus_tag LOCUS_73970 373307 374899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73970 375477 374962 gene locus_tag LOCUS_73980 375477 374962 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_73980 375767 375973 gene locus_tag LOCUS_73990 375767 375973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_73990 376137 377270 gene locus_tag LOCUS_74000 376137 377270 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385251.1 protein_id gnl|my_center|LOCUS_74000 377291 379204 gene locus_tag LOCUS_74010 377291 379204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74010 379354 381873 gene locus_tag LOCUS_74020 379354 381873 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_74020 382113 383462 gene locus_tag LOCUS_74030 382113 383462 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_74030 383484 384359 gene locus_tag LOCUS_74040 gene galU 383484 384359 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757774.1 protein_id gnl|my_center|LOCUS_74040 384822 385583 gene locus_tag LOCUS_74050 384822 385583 CDS product heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272088.1 protein_id gnl|my_center|LOCUS_74050 385610 388093 gene locus_tag LOCUS_74060 gene pcrA 385610 388093 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233919.1 protein_id gnl|my_center|LOCUS_74060 388558 388163 gene locus_tag LOCUS_74070 388558 388163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_74070 388679 390715 gene locus_tag LOCUS_74080 gene ligA 388679 390715 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048227.1 protein_id gnl|my_center|LOCUS_74080 >Feature sequence3 51 1601 gene locus_tag LOCUS_r00230 51 1601 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence4