COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence1 source 1..2353801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..1578 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013309.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene dnaA CDS 2345..3529 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 gene dnaN CDS 3533..4714 product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013310.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recF CDS 4698..5294 product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855338.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 5442..7541 product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855339.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene gyrB CDS complement(7563..7997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013314.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(8157..8603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS complement(8605..10461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 10585..11580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(11636..11908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(11905..12111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013316.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 12178..14727 product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene gyrA CDS 14731..15075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(15507..16607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 tRNA 16995..17069 product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 tRNA 17087..17160 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 17368..19071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 19195..20034 product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013774.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 20031..21560 product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 21820..25836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 26154..30488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(30784..31221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777020.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(31275..33368) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014501.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(33365..33979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855924.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS 34076..34630 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014502.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(34643..35413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 35718..36668 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803922.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 36665..38923 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene metE CDS 39144..40109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 40285..40785 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005116126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 40859..41527 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855383.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS complement(41748..43157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS complement(43517..43792) product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861074.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene crgA CDS complement(43835..45910) product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013340.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene pknB CDS complement(45911..47452) product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS complement(47453..48907) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013342.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(48904..50256) product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013343.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(50253..51608) product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013344.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(51605..52054) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861086.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(52065..52949) product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861088.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 tRNA 53129..53213 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS 54342..63959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(64108..65127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 65378..65929 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS 66430..67758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS 67827..69179 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 69172..70365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(70346..70729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 70822..71508 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014184.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(71505..72677) product globin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015425.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 72735..74357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 74415..75659 product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 75670..76827 product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821341.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS complement(76806..77381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 77573..78571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(78661..79971) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015415.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS 80013..80600 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895024.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS 80610..81968 product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453446.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 gene amn CDS complement(81972..83201) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015206.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 83338..84270 product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011896407.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 84267..85340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 85267..86157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS complement(86092..86877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(86878..87849) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 88000..89643 product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013418.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(89618..90616) product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013419.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS 90626..91375 product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283863.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(91358..92809) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014015.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 92898..93542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(93523..95652) product ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013422.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS 95651..96193 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859391.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene thpR CDS complement(96190..97611) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS 97727..98371 product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013424.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS 98368..98940 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013426.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 98937..99647 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856628.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 CDS complement(99644..100669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS 100687..100974 product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857164.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 100974..101657 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857162.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(101654..102301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(102295..104175) product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013430.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(104168..105019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(105024..108212) product arabinosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013456.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(108214..110043) product galactan 5-O-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857673.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS complement(110064..110708) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(110705..111292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 111466..112140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 112137..113528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068715.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS complement(113611..114375) product decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013458.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(114388..115791) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863441.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(115807..116079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857667.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS 116060..116851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013461.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS 116863..117291 product arabinogalactan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420627.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(117278..118207) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013464.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 118235..119242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS complement(119330..120136) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013466.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS complement(120154..121041) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 121147..122358 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013468.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(122355..123290) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857642.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 123421..123567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00960 tRNA 123653..123740 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 123937..127689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(127756..128253) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 tRNA 128339..128429 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 tRNA 128432..128505 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS complement(128704..131178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 131317..132678 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096453796.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene mgtE tRNA 132777..132852 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 133116..138587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 138771..140957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(140971..141975) product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 142026..142508 product tRNA adenosine deaminase-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863394.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS 142505..142972 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855650.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene tadA CDS 143049..143276 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752909.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 tRNA 143315..143402 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 143512..145875 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS 145872..147119 product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene tgt CDS complement(147177..148529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(149090..149731) product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863385.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 149730..150671 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene gluQRS CDS complement(150674..152398) product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 tRNA complement(152530..152618) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 152858..154138 product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 154149..156317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 156357..156719 product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230627.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS 156783..157409 product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013500.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 157513..158604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(158601..159314) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013501.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(159307..160605) product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013502.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(160616..161608) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013503.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(161623..162867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(162924..164735) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015439406.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene leuA CDS complement(164918..165769) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013505.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 165860..167125 product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855724.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 167137..168162 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013506.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(168285..169802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(169828..170385) product YdhK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242997.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(170410..170949) product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(170962..171276) product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863340.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(171279..171545) product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013517.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS complement(171549..171986) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(171986..173533) product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271326.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS complement(173533..173994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(173998..176907) product DUF4040 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013521.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 177056..178444 product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013522.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 178808..182038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(182125..182871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 tRNA complement(183111..183187) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(183272..184177) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 184193..184642 product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863321.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS complement(184639..187062) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013529.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 187242..187601 product WhiB family transcriptional regulator WhcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855789.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene whcA CDS 187608..187772 product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855791.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 187773..188228 product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230563.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 188269..189081 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285704.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(189256..189939) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855810.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 190204..190977 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078343767.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene nth CDS 190974..191507 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 191508..192206 product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013541.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 192217..193404 product MarP family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013542.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS complement(193394..193951) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013544.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 194071..195096 product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262593.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(195104..195916) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013545.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS 196054..197112 product CpaE-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013546.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS 197113..198234 product TadA family conjugal transfer-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013547.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 198231..198974 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013548.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 198971..199519 product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731085.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 199533..199754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 199754..200023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863285.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 200024..200338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(200351..202696) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013550.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS 202877..203080 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862487.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(203125..203751) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013527.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 203864..206758 product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013552.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene topA CDS 206913..207950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(208005..209528) product class III adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285716.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 209611..210765 product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013555.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 tRNA 210831..210906 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 211057..211458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 211687..212010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(212141..212542) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 CDS complement(212569..212958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01700 note possible pseudo, frameshifted CDS complement(213403..215028) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227752.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS 215082..215906 product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056756.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 215916..217010 product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863269.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 217011..217631 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013561.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(217628..217987) product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013565.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(217984..218673) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013566.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS complement(218687..219484) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776102.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(219487..220350) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013572.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene rfbA CDS complement(220366..221694) product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013573.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(221696..222679) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene rfbB CDS complement(222686..223864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013578.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(223861..225108) product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013579.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(225120..227087) product prolyl oligopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013580.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS complement(227089..228210) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 228311..228463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(228556..229662) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS 229682..230074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS 230067..231479 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene lpdA CDS complement(231974..232438) product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776962.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 232705..233478 product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855465.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 233500..235578 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013606.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 235578..236327 product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013607.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 236428..236796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013608.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS 236874..238163 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 238178..238720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 238726..239040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(239055..239834) product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS complement(239844..240572) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013626.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(240653..241144) product DUF2505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 241163..242170 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(242480..244225) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(244250..245944) product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855494.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 246076..247074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 247202..248464 product D-inositol-3-phosphate glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene mshA CDS complement(248474..249493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(249630..250787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(250840..251952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 252004..252846 product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 252859..254034 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855497.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 254036..254725 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013630.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(254742..255650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013633.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 255768..256649 product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265553.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS 256649..257569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855504.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 257601..258410 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855505.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene proC CDS 258589..258780 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855509.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS complement(259264..260271) product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855543.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 260356..260592 product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 260639..261964 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 261965..262846 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013637.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 gene hemC CDS 263268..265004 product bifunctional uroporphyrinogen-III C-methyltransferase/uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 265053..266054 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013646.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene hemB CDS 266047..266661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS 266665..267186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 267183..269789 product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013648.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 269801..270850 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265560.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 gene hemE CDS 270850..272298 product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013650.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(272295..272711) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS complement(272708..273115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 273214..273975 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(274175..274981) product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804286.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 275032..276357 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265562.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene hemL CDS 276358..276960 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039673525.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS 276969..277541 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855585.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS 277542..278315 product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS 278316..279980 product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013653.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 280005..280988 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855590.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene ccsB CDS 280988..282007 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533607.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene galE CDS 282004..282261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(282484..282813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 282842..283153 product DUF4229 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082868777.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(283155..283913) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013333.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS complement(283914..284930) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855379.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS complement(284927..285904) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013332.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(285971..286873) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015084.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 CDS 287238..288413 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031811.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 288413..289402 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(289399..290370) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013659.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 290410..291249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855600.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 291260..292636 product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 292629..293315 product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(293377..293724) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013515.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS 293807..294895 product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265757.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene arsB CDS 294892..295311 product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(295308..295943) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463838.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 295966..296961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 297075..297386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS complement(297353..297808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(298047..299186) product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013660.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene menE CDS complement(299183..299992) product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261910.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 300103..301092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 301146..302258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS 302255..302893 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 302960..303661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 303661..305076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(305083..306054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 306280..307590 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(307587..308519) product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860502.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 308918..309709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 309713..310111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 310403..311365 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013669.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS 311416..312996 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 313067..313633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS 313634..315250 product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013670.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene menD CDS 315274..315663 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013671.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 316219..317532 product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854169.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 317565..318242 product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(318143..319066) product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(319063..319788) product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777095.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS complement(319785..320708) product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS complement(320745..320981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 321075..321764 product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(321761..322981) product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013675.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 323077..324102 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013676.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 tRNA 324167..324251 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(324358..325497) product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 tRNA 325896..325969 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 326007..326079 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 tRNA 326143..326218 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 326240..326560 product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013677.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene secE CDS 326676..327731 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013678.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene nusG CDS 327903..328331 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene rplK CDS 328396..329103 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene rplA CDS complement(329173..330246) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS 330449..331381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 331462..332880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 332877..333731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 333743..334480 product anchored repeat-type ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399434.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 334473..335342 product anchored repeat-type ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115980.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 335339..337555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS 337974..338195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS 338498..339019 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013688.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene rplJ CDS 339072..339461 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rplL CDS 339553..340491 product DUF3068 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031512298.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 340827..344306 product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 344391..348389 product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013691.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 348553..348771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(348786..349421) product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013693.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 349533..350105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS 350102..350599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 350590..351270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS complement(351210..352541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 352767..353138 product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854221.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene rpsL CDS 353142..353609 product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854222.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene rpsG CDS 353812..355932 product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854224.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene fusA CDS 356269..357459 product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013696.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 gene tuf CDS 357545..357943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(358003..358785) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(358810..360015) product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261158.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 gene istA CDS 360135..360377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(360374..360934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(360931..361611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(361595..362575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(362575..362775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(362818..363120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(363124..363684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS 364275..364580 product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854291.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene rpsJ CDS 364617..365273 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 gene rplC CDS 365270..365935 product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854293.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene rplD CDS 365936..366241 product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854294.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene rplW CDS 366284..367117 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene rplB CDS 367134..367409 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene rpsS CDS 367413..367772 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene rplV CDS 367772..368515 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854298.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene rpsC CDS 368519..368935 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene rplP CDS 368935..369174 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene rpmC CDS 369177..369461 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854306.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 gene rpsQ CDS 369758..371623 product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015000.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene glmS CDS complement(371850..372725) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028065.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS complement(372793..373614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(373637..375229) product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS complement(375222..377021) product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776427.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(377095..377886) product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254775.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 378302..378670 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854312.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene rplN CDS 378674..378988 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854314.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene rplX CDS 378988..379575 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854317.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene rplE CDS 380007..381524 product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228504.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(381531..382286) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene fdhD CDS 382330..383355 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(383359..383793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS 383968..384681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 384789..385115 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031460.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 385112..386248 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS complement(386261..387493) product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857726.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 CDS 387845..388243 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene rpsH CDS 388263..388799 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene rplF CDS 388802..389206 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854346.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene rplR CDS 389247..389891 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene rpsE CDS 389897..390082 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene rpmD CDS 390090..390587 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013717.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene rplO CDS 391052..392380 product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854402.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene secY CDS 392380..392925 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854403.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 393005..393796 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene map CDS 393848..394645 product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 394811..395029 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene infA CDS 395145..395573 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854425.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene rpsM CDS 395577..395978 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854428.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene rpsK CDS 396005..396610 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene rpsD CDS 396723..397736 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 397783..398286 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS 398396..399226 product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854437.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene truA CDS 399269..401386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 401428..402642 product type VII secretion protein EccB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013736.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene eccB CDS complement(402650..403723) product type VII secretion-associated serine protease mycosin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013739.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene mycP CDS complement(403725..405038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(405183..405368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 405307..408600 product type VII secretion protein EccCa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382017.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 gene eccCa CDS 408597..409490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03730 CDS 409597..409908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS 409919..410203 product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 410501..410944 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854535.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene rplM CDS 410944..411489 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene rpsI CDS complement(411548..412618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 412768..414117 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene glmM CDS 414226..414552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 414549..415712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS 415706..415993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(416022..416876) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 416957..417607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013979.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 417615..418682 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013748.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene alr CDS 418683..419150 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854549.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene tsaE CDS 419161..419664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 419664..420296 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013751.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene tsaB CDS 420293..420769 product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860686.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene rimI CDS 420766..421815 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013752.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene tsaD CDS 421881..422342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860693.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 422498..422797 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854559.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene groES CDS 422803..424410 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013754.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene groL CDS complement(424480..424791) product WhiB family transcriptional regulator WhcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854562.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene whcB CDS 425068..425544 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(425583..426722) product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 427034..427984 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(427981..428352) product DUF5319 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447882.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 428488..430011 product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene guaB CDS 430021..431175 product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013758.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 431196..432488 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 432614..434167 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013761.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene guaA CDS complement(434190..435242) product two-component system EsrSR regulator EsrI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013762.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene esrI CDS 435355..436482 product two-component system sensor histidine kinase EsrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074469750.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene esrS CDS 436479..437102 product two-component system response regulator EsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854586.1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene esrR CDS complement(437099..438970) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015121.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 439098..440729 product TIGR04028 family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 440730..441713 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015119.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 441710..442585 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863669.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 442582..444186 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015118.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS 444179..445381 product alkylhydroperoxidase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015117.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(445393..445878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 note possible pseudo, frameshifted CDS complement(446078..446494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 446731..447360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 447357..448910 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013767.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS complement(448911..449498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013768.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 449638..450519 product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(450707..451477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(451489..452190) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854626.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(452187..453215) product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854632.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(453216..454106) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(454147..455043) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013784.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 455323..458511 product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013785.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS 458794..459243 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860754.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS 459240..460643 product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013786.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS complement(460590..461054) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854647.1 transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 461079..461951 product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS 461961..462350 product DUF3017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013790.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 462489..463448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 463481..464542 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385516.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 464552..466210 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 466274..467569 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 467590..468255 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS complement(468252..469388) product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013793.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(469389..470732) product O-acetylhomoserine/O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 470851..471789 product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015309.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(472037..474223) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013800.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 474284..475198 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 475274..476335 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861135.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene bioB CDS 476349..476552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(476571..477254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(477251..477934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(477931..478296) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462187.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 478787..479788 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene trpS CDS complement(479828..481720) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(481717..482076) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 482226..483320 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858295.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(483280..484536) product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013810.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(484537..485673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(485741..486979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS complement(486990..488084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS complement(488081..488368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 488440..489084 product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene upp CDS 489190..489591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 489698..490879 product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013814.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS 490945..492351 product NAD(P)H-quinone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013815.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS complement(492362..492562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS 492582..492782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 492938..496366 product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(496540..497052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 497067..497996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(498005..499789) product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013826.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(499882..500766) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013827.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS 501040..502101 product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(502315..503037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(503044..503442) product DUF3151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013829.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 503550..504071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS 504081..504608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 504620..505141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(505161..505751) product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013831.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(505751..505936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(505947..507461) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863615.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(507556..508821) product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(508978..511158) product catalase CatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 gene catB CDS 511254..511985 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080805.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 512008..512469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(512645..513379) product alpha-acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215019.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 gene alsD CDS 513438..514601 product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013836.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 514606..515109 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858249.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 gene purE CDS 515102..515569 product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(515804..516124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(516218..516877) product TIGR03089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013855.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(516905..518548) product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013391.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(518706..520199) product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013861.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 520383..521330 product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013862.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 521367..522485 product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013863.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 522766..523062 product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014300514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS complement(523066..523539) product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006283667.1 transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 523681..524097 product DUF3499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863575.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 524159..525529 product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863574.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 525555..526553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 526564..527745 product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013865.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene manA CDS complement(527742..528854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 529079..529429 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858196.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS 529434..530042 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858194.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 530094..530777 product two-component system response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013867.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene mtrA CDS 530850..532448 product two-component system sensor histidine kinase MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458538.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene mtrB CDS 532441..534144 product MtrAB system accessory lipoprotein LpqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene lpqB CDS 534155..534781 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564913.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 535281..535973 product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858182.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 gene raiA CDS 536176..538737 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013871.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene secA CDS complement(538764..539204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 539352..539765 product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 539765..540268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS complement(540242..541267) product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene rsgA CDS complement(541267..542562) product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013873.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene aroA CDS 542561..543223 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(543239..543703) product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098459.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene ybaK CDS 543740..544387 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 544387..544665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 545201..546532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(546795..547058) product WhiB family transcriptional regulator WhcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858159.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene whcE CDS 547580..548002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(548036..549247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013875.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS complement(549244..550569) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013876.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 550606..550830 product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080983.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS 550842..552023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS 552034..552765 product TIGR02569 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858145.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS 552843..555905 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013879.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 555898..559209 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013880.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 559206..560282 product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 560287..561063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 561054..563102 product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(563130..563960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013883.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 564075..564518 product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(564528..566012) product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858132.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 566106..567113 product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013885.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(567114..567848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(567859..568377) product PPA1309 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858126.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS 568463..571432 product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013886.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 tRNA 571582..571656 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(572180..572707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 572824..573882 product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158408213.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 573879..575048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 575240..575803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 575875..576450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(576520..579393) product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(579402..580394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 580734..580991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(582187..584259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 584409..584747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS complement(585154..585369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 585676..587037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 587692..588714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 588873..589016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 589108..589539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(590817..591773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(591770..592333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(592372..592587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(592714..593367) product organomercurial lyase MerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790334.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene merB CDS complement(593402..594826) product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296234.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene merA CDS 594935..595162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 595176..595886 product IS6-like element IS1628 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014005.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS 595952..596200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(596387..596821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS complement(596839..597939) product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(597940..598722) product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857587.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS complement(598725..598919) product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857586.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 gene thiS CDS complement(598916..599974) product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861894.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene thiO CDS complement(600136..600801) product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776709.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS complement(600794..601045) product Rho termination factor N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS complement(601124..602041) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 602152..602319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 602360..604102 product BCCT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015032.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(604135..604530) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015352.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS complement(604541..605806) product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS 605874..606785 product S1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096454783.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(606795..607595) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013899.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 CDS complement(607603..609402) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014273.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene thiC CDS 609566..610666 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863507.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene prfB CDS complement(610680..612008) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 612376..613932 product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819989.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 613936..614478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 614486..615871 product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259259.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene accC CDS 615949..616872 product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(616869..618029) product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703349.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 618333..619643 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080443.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS 619681..620907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 620965..622338 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731470.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 622563..623255 product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858089.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene ftsE CDS 623258..624160 product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858086.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene ftsX CDS 624177..624674 product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene smpB CDS 624702..625352 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776539.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 tmRNA 625417..625806 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(625867..626934) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015375.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 627167..627826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 627932..628489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 628655..629260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(629303..629941) product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859257.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(629941..630684) product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859254.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 630760..631545 product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223757.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 631542..632321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 632374..633405 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777018.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 633416..634390 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 634383..635381 product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863478.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 635378..636133 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013906.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 rRNA 636728..638242 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 rRNA 638650..641716 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00020 rRNA 641894..641999 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00030 CDS 642063..642425 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(642653..643306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS complement(643318..644958) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858302.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 644994..645212 product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(645209..646390) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230150.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(646390..647268) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223991.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 647335..650151 product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031757.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS complement(650148..652196) product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 652250..652444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858306.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS complement(652727..653449) product DUF3235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862355.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 653703..654086 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858310.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS complement(654102..654605) product DUF2771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858312.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(654617..655411) product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858314.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 655451..656131 product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104387.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 656190..657659 product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265630.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 657660..658460 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862361.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(658457..659302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858320.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(659321..660322) product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013912.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene sepH CDS 660532..661827 product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013914.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 661976..662335 product FKBP-type peptidyl-prolyl cis-trans isomerase FkpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene fkpA CDS 662345..663172 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 663381..663719 product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803959.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 663723..665372 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013917.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(665432..666295) product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013919.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS complement(666282..666980) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015232.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 tRNA 667102..667175 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(667203..668240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804243.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 668356..669669 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013686.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(669653..669937) product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013923.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(669939..670418) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013924.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS complement(670415..671212) product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(671209..671982) product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862394.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS 672049..676659 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013925.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(676683..678230) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(678322..678549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 678561..679403 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862398.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(679333..679986) product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013926.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(680002..681120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 note possible pseudo, internal stop codon CDS complement(681139..681489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 note possible pseudo, internal stop codon CDS complement(681489..683126) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene pgi CDS 683394..683576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 note possible pseudo, frameshifted CDS complement(683584..683877) product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858377.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 683945..686257 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013929.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene pcrA CDS complement(686262..686960) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(687279..688019) product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013932.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS 688266..689561 product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565006.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 689572..690156 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858391.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene purN CDS 690149..691687 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013935.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene purH CDS 691702..692571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 692581..693153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 693165..693977 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(693974..694657) product TetR/AcrR family transcriptional regulator AmtR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013937.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene amtR CDS complement(694805..695053) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858407.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene rpsR CDS complement(695068..695373) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene rpsN CDS complement(695377..695541) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 gene rpmG CDS complement(695541..695777) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene rpmB CDS 696216..696485 product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858446.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS 696507..696680 product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858448.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene rpmF CDS 696789..697487 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878347.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS 697484..698965 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013941.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS 699067..700332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 700384..700944 product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 700968..701165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS complement(701195..701596) product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013943.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene mscL CDS complement(701607..702251) product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005066393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(702286..702864) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092258658.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS 702940..703914 product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858460.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 703933..705264 product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 705273..705920 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186458539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 706034..707236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858464.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 tRNA 707312..707385 product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 707486..707830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(707849..708472) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015424.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 708525..708932 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013947.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 708925..709554 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(709555..711087) product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013949.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS 711242..712099 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858478.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 gene rsmI CDS 712205..714010 product glycine betaine transporter BetP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265645.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 gene betP CDS 714083..715939 product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013952.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene metG CDS complement(715944..716828) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(716840..717232) product DUF3806 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855570.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 717245..718081 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013965.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS 718182..719321 product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS 719322..720176 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene rsmA CDS 720166..721113 product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045756603.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 721132..722949 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS 722951..723283 product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(723355..723504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 723467..724636 product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014042.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 724646..725425 product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 725528..726589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(726586..727671) product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225132.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(727737..729485) product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255177.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(729489..731042) product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105456.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(731039..731794) product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105454.1 transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(731854..732519) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973419.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS 732679..733530 product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013972.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene ppk2 CDS complement(733531..734097) product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265466.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(734094..734840) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 734912..735895 product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(735904..737514) product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054753.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 737694..739145 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013988.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS 739148..739594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS complement(739572..740702) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(740703..741899) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537490.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS 742081..746160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 repeat_region 743981..744129 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agccgtcgcccacgacgtct CDS 746175..748586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 748638..749693 product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031610.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(749690..750487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 750581..750994 product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS complement(750997..752127) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014224.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(752255..752440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 752566..754080 product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288051.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(754081..754419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 754519..755694 product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013999.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 755722..756606 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS 756655..757920 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015243.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 757917..758594 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015244.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene bioD CDS 758591..759463 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854943.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(759460..761091) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013982.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS 761139..761678 product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015486.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(761675..762244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(762255..762935) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013986.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 gene pth CDS 762832..763722 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013987.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(763871..764665) product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567937.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(764671..765228) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265655.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene pth CDS complement(765304..765951) product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013990.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(766087..767421) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141748518.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(767411..768427) product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013481.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene hisC CDS complement(768424..769773) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812351.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(769777..770223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS complement(770303..771280) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860060.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(771285..772727) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013993.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 gene glmU CDS complement(772788..774014) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013994.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 774065..775561 product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013995.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS complement(775612..777456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(777544..778179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07290 tRNA complement(778200..778272) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 778446..779003 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014009.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 CDS 779009..782641 product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856733.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene mfd CDS complement(782872..783492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(783614..784939) product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208142.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 tRNA 785098..785172 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(785175..785381) product DUF3253 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035426.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(785381..785755) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804266.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(785752..786624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS complement(786635..786832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 786862..787326 product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804934.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(787319..788245) product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085957470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS 788368..789183 product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014027.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(789255..789782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014028.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS complement(789823..790344) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014029.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene greA CDS complement(790451..790909) product DUF4307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856773.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 791008..791880 product mycothiol conjugate amidase Mca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014030.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene mca CDS 791881..792180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 792199..792978 product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS complement(792979..793911) product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856789.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene coaA CDS 794016..795308 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene glyA CDS complement(795305..795733) product DUF5997 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856795.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 795705..796310 product LysR family transcriptional regulator substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014037.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 796364..796945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 797060..797590 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014038.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS complement(797595..799154) product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859734.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(799148..799765) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013614.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(799784..800287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 CDS complement(800354..801754) product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856814.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 801858..802550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(802559..803569) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856830.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene glpX CDS 803614..804270 product DUF4245 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014052.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(804239..804523) product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856839.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS complement(804535..805776) product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014055.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene xseA CDS 805872..806849 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878272.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS complement(806856..807533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS complement(807545..808591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS complement(808623..810029) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014057.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 810100..811188 product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014061.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene ychF CDS 811207..811611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 811617..813623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 813610..814344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 814633..814980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(815934..816233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(816255..816728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS 817102..818076 product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706828.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(818615..820426) product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS complement(820504..820863) product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(821080..821439) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223962.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(821487..821696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 821763..822044 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 822031..822339 product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(822353..822943) product putative glycolipid-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(822992..823444) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776269.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene arfB CDS complement(823736..824794) product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777023.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS 824949..825764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 825878..826945 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184001.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene chrA CDS 826951..827373 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888981.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 827383..828021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 828038..829138 product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085612.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(829121..830161) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229874.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(830158..830832) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 830922..831761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 831742..832590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(832587..833720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(833738..835714) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013569.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS complement(835785..836327) product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(836353..837885) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS complement(837994..839079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS complement(839165..839659) product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 839711..840484 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015246.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(840505..841257) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814657.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(841261..842346) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976079.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS complement(842350..843591) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527856.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(843706..844590) product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804341.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 844626..846911 product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804342.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(846918..847079) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 847143..847634 product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014075.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS complement(847638..848369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 848453..848965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(848972..850375) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775824.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(850443..851894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS complement(852036..852455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS complement(852509..853561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS complement(853583..854491) product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 854606..854965 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 855098..855691 product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858584.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 855692..857023 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862124.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 857020..857781 product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014105.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 857778..858245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014106.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(858232..860199) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(860196..861272) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(861285..862268) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138444.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(862402..864108) product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(864473..865009) product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858618.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(865013..865759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 865850..867766 product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene typA CDS 867832..869460 product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 869457..870329 product N-acetyl-1-D-myo-inositol-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858626.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene mshB CDS 870326..870649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 870618..870986 product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858631.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 870990..872090 product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903345.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 gene dapC CDS 872150..872713 product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858634.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 872801..873889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(873832..874383) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS complement(874373..875347) product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 gene dapD CDS complement(875353..876717) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene aroP CDS complement(876717..878114) product aromatic amino acid transport protein AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014125.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 gene aroP CDS complement(878164..879096) product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014126.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 879126..880217 product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 gene dapE CDS 880221..881006 product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 880999..881850 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene folP CDS 881859..882563 product glucosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855018.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 882574..882882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 882898..883068 product DUF3117 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS 883095..883958 product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014130.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(883962..885362) product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(885359..886516) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855006.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene glgA CDS 886584..887801 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene glgC CDS complement(887798..888484) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863800.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 888549..889142 product RNA polymerase sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene sigE CDS 889164..889532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS 889543..889956 product Sec-independent protein translocase subunit TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854998.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene tatB CDS complement(889949..891151) product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854996.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 891150..891659 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 891652..892374 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014136.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS complement(892462..896196) product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014138.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS complement(896320..899847) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS complement(899924..900847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 900929..902512 product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854963.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 902616..903422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(903419..903943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014145.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 904100..905308 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014146.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 905305..906309 product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015421.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(906387..907370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 907681..908463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS 908469..909167 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015418.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS 909158..910306 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(910316..913333) product DUF3427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(913333..913722) product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS complement(913776..914735) product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015483.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 914858..916159 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014881.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene hisD CDS complement(916212..917624) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014160.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 917521..917778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(918039..919388) product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083499.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS complement(919579..920559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 920687..922768 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 922650..923588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS complement(923828..924310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS complement(924344..924943) product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014166.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(924950..926518) product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene putP CDS 926685..929789 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014168.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 929782..930600 product 2-oxo acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854920.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 930658..931809 product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014169.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 CDS 931813..934461 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014170.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS 934473..934946 product MarR family transcriptional regulator RosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861276.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene rosR CDS 935036..935266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(935263..936072) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648073.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 936927..937286 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 937283..937885 product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053546291.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 tRNA complement(938225..938301) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS complement(938510..939184) product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804907.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(939185..940738) product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727053.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 CDS complement(940735..941520) product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892015.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS complement(941612..943282) product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028722.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS 943353..945098 product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014179.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene argS CDS 945099..946463 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014180.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene lysA CDS 946550..947902 product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854900.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 947915..948844 product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014183.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene thrB CDS complement(948906..950051) product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904127.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(950073..951821) product long-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854869.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS 952054..953850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS 953850..954929 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854866.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene prfA CDS 954916..955761 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014198.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene prmC CDS 955787..956443 product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861324.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 956450..957613 product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014199.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS 957600..958031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854858.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 958387..959181 product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene atpB CDS 959279..959524 product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854855.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 959572..960144 product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014201.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 960150..960983 product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854845.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 961025..962656 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene atpA CDS 962708..963676 product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 963680..965191 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014204.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene atpD CDS 965203..965571 product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861337.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS 965707..966186 product DUF2550 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854831.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 966170..966901 product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014205.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene nucS CDS 966901..967188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014206.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS 967199..967501 product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854825.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 967508..968341 product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014209.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(968338..970527) product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014214.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene glgB CDS complement(970536..972563) product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014215.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS 972657..973499 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014216.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS 973547..974392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854804.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS 974370..975521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014217.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS 975531..976640 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014220.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS 976683..977756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(977765..978661) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014223.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 978884..979072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS complement(979283..979573) product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855480.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS complement(979608..981554) product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777103.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS 981504..981962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS 981959..983020 product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861382.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene mnmA CDS 983031..983888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 983885..984268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS complement(984265..984939) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS 984986..987037 product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014227.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene ligA CDS complement(987034..987699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861389.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 987782..988921 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 988990..989289 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854761.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene gatC CDS 989296..990777 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene gatA CDS 990752..992062 product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854772.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 992073..993104 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854754.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(993101..993949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(993946..994335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 994538..995056 product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(995193..996068) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898939.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene nadC CDS complement(996075..997028) product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224102.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene nadA CDS 996969..997400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(997358..998161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(998161..998676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS 998755..999702 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09480 CDS 999733..1001241 product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854737.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene gatB CDS complement(1001533..1002948) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS 1003128..1003943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(1003952..1005790) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854128.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene ilvD CDS complement(1005803..1006345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 1006627..1008453 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014246.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS 1008456..1008974 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286979.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene ilvN CDS 1009048..1010064 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854117.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene ilvC CDS complement(1010129..1010725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 1010987..1011895 product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014254.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 1011918..1013687 product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014255.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS 1013687..1014544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS 1014605..1015621 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014258.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 1015626..1017080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014256.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 1017123..1018988 product cyclic nucleotide-binding/CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014260.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 1018990..1019556 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014261.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 1019624..1020382 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(1020388..1021503) product isochorismate synthase MenF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 1021628..1022641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(1022916..1023344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 1024173..1025597 product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020447895.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene gltX tRNA 1025754..1025826 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 1025856..1025929 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 1026116..1027225 product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 1027311..1028381 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013644.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS 1028439..1029998 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855561.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS 1029998..1031047 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013642.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 tRNA 1031122..1031195 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(1031341..1032480) product IS1249 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053543917.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 1032720..1033472 product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 1033552..1034127 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014279.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 1034210..1035583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1035652..1037649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS 1037786..1039480 product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014996.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(1039565..1041754) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(1041751..1044330) product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068489.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(1044429..1045115) product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014280.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS 1045177..1046598 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014281.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene leuC CDS 1046611..1047201 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014282.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene leuD CDS complement(1047214..1047675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS complement(1047681..1048145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS complement(1048170..1049180) product bifunctional NUDIX hydrolase/histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858854.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 1049283..1050281 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 1050303..1051343 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014285.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS complement(1051344..1052336) product DUF3515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014286.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 1052269..1053276 product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858840.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 1053276..1053917 product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893765.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 CDS 1053942..1055486 product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858835.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS 1055487..1057589 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1057602..1058198 product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858829.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene rsmD CDS 1058199..1058675 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858828.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene coaD CDS 1058675..1059412 product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857192.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(1059561..1060334) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858826.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(1060334..1061299) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858824.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(1061302..1062201) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(1062318..1062956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS complement(1062979..1064187) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(1064184..1064639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 1064842..1066200 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004345327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene purB CDS complement(1066246..1067127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(1067174..1068544) product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262088.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene dcuC CDS 1068721..1070718 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 1070810..1071178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 tRNA 1071256..1071330 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 1071390..1074014 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene polA CDS complement(1074429..1075661) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS 1075969..1077432 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014303.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 gene rpsA CDS 1077559..1078164 product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene coaE CDS 1078233..1078583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 1078653..1080752 product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948572.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene uvrB CDS 1080768..1081226 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284441.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 1081286..1081729 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014315.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(1081732..1083885) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208400581.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(1083962..1085002) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014318.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(1085090..1085683) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 1085736..1088627 product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014319.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene uvrA CDS 1088994..1089440 product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014321.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene infC CDS 1089474..1089668 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858721.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene rpmI CDS 1089722..1090105 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene rplT CDS complement(1090187..1091572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(1091736..1092371) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030258.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(1092445..1092609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(1092745..1093737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 1094030..1094740 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858706.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS 1094875..1095945 product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897202.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene pheS CDS 1095960..1098467 product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014330.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene pheT CDS 1098523..1099578 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene argC CDS 1099634..1100794 product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014333.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene argJ CDS 1100807..1101742 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858695.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene argB CDS 1101739..1102917 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014334.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS 1102922..1103863 product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014335.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene argF CDS 1103860..1104357 product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858683.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 1104438..1105652 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858678.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 1105656..1107092 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014337.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene argH CDS 1107142..1108317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014338.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 1108314..1109909 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014339.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS 1109896..1110546 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014340.1 transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS 1110543..1110722 product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS 1110735..1111997 product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene tyrS rRNA 1112639..1114153 product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00040 rRNA 1114554..1117623 product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00050 rRNA 1117807..1117912 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00060 CDS 1118974..1119420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS 1119339..1120013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 1120018..1121001 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014344.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 1120992..1121177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 1121214..1122038 product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856296.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 1122039..1122959 product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856294.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 1122981..1124708 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014346.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene recN CDS 1124752..1125993 product putative cytokinetic ring protein SteA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014347.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene steA CDS 1126008..1126856 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014348.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS 1126876..1127523 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014349.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 1127527..1128447 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene xerD CDS 1128493..1129632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 1129694..1130563 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 1130563..1131384 product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 1131440..1131997 product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856269.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene scpB CDS 1132009..1132938 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856268.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS 1132939..1133640 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396322.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene cmk CDS 1133637..1135280 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328343.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene der CDS 1135285..1135998 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(1135995..1136777) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS 1136936..1137739 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894906.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 1137818..1138753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS 1138788..1139333 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013406.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(1139338..1139595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 1139476..1140270 product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963142.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(1140267..1141496) product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187394984.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(1141499..1141795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 1141913..1142272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 tRNA complement(1142317..1142391) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS complement(1142504..1142902) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(1142902..1144128) product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 1144238..1146529 product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014367.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene secA2 CDS 1146617..1147042 product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856253.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 CDS 1147063..1147824 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS 1147824..1148384 product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863762.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS 1148503..1149069 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856248.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(1149256..1150719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014368.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(1150769..1151626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309556.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(1151626..1152678) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014370.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(1152675..1154069) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014371.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(1154087..1155397) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856236.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(1155440..1156909) product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856232.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene gndA CDS 1156962..1157411 product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(1157412..1158482) product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005059676.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene corA CDS complement(1158688..1159563) product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 gene pflA CDS complement(1159567..1159818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS complement(1159864..1162038) product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112605.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene pflB CDS complement(1162244..1163581) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863745.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 1163716..1165035 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014384.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(1165187..1165897) product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863737.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(1165905..1166252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467698.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 1166402..1166749 product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863735.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(1166832..1167827) product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856192.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(1167832..1169409) product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014392.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene lnt CDS complement(1169410..1170000) product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014393.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(1169979..1170701) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014397.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS complement(1170694..1171809) product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 1171836..1172399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(1172396..1175158) product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014399.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(1175164..1176174) product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856179.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene tatC CDS complement(1176184..1176447) product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene tatA CDS complement(1176483..1177409) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(1177409..1178362) product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014403.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(1178369..1179736) product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene pafA CDS complement(1179765..1179953) product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856167.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(1179964..1181463) product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014405.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene dop CDS 1181530..1183014 product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855213.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1183122..1183997) product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 gene pdxS CDS 1184068..1185438 product pyridoxine biosynthesis transcriptional regulator PdxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013887.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene pdxR CDS 1185457..1186509 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS complement(1186499..1188019) product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265753.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene arc CDS complement(1188049..1188882) product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860005.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(1188898..1190109) product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285177.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 1190136..1190966 product RecB family exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(1190963..1192630) product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(1192636..1193946) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095257.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(1194046..1195485) product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014409.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene aspA CDS complement(1195540..1196208) product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS complement(1196201..1196599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856129.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS complement(1196624..1197844) product cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene mshC CDS complement(1197855..1198712) product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856127.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 1198915..1199823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208396105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 1199836..1200915 product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014420.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(1200912..1201268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856120.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(1201279..1201812) product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856119.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(1201834..1203639) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS complement(1203640..1205091) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066565740.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 tRNA 1205311..1205397 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS 1205650..1206291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 1206295..1207971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS 1208283..1208927 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856111.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS 1208948..1209523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014430.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(1209495..1210769) product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014431.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(1210770..1211198) product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862316.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(1211220..1211990) product DUF3097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014432.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 1212103..1212855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014433.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(1212852..1213889) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226767.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(1213908..1215671) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014435.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(1216220..1216696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 1216894..1219683 product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170844367.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene can CDS 1219776..1220327 product TetR/AcrR family transcriptional regulator AcnR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene acnR CDS 1220365..1221087 product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014437.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS complement(1221084..1221761) product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856099.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 1221794..1222063 product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856097.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 1222073..1223437 product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856096.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS complement(1223434..1223679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(1223936..1224232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(1224306..1224719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 1224948..1225640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 1225769..1227370 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015008.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(1227396..1229024) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014443.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1229059..1229178) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(1229248..1229622) product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856083.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(1229625..1230092) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856080.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(1230089..1231321) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014447.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 CDS complement(1231321..1232076) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856078.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene sufC CDS complement(1232089..1233252) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014448.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene sufD CDS complement(1233253..1234698) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862284.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene sufB CDS complement(1234691..1235449) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862282.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 CDS 1235572..1237284 product polyprenol phosphomannose-dependent alpha 1,6 mannosyltransferase MptB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265766.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene mptB CDS 1237277..1238203 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014450.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 1238203..1238967 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014451.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1239016..1239966 product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014452.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 1239968..1240924 product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856060.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(1240921..1241835) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211271337.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 1241959..1244166 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856055.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene tkt CDS 1244176..1245267 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856053.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene tal CDS 1245269..1246807 product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856051.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene zwf CDS 1246825..1247754 product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 1247744..1248427 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862263.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene pgl CDS complement(1248451..1248687) product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014464.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene secG CDS complement(1248769..1249542) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 gene tpiA CDS complement(1249557..1250768) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862252.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 gene pgk CDS complement(1250860..1251870) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene gap CDS complement(1252109..1253077) product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862248.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene whiA CDS complement(1253128..1254093) product uridine diphosphate-N-acetylglucosamine-binding protein YvcK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014467.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene yvcK CDS complement(1254128..1254985) product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856023.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rapZ CDS complement(1255095..1257155) product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014468.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 gene uvrC CDS complement(1257159..1257692) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014469.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS complement(1257770..1258255) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856018.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene ribH CDS complement(1258279..1259532) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856016.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(1259544..1260131) product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(1260112..1261110) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014471.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene ribD CDS complement(1261107..1261769) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014472.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene rpe CDS complement(1261780..1263258) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014473.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS complement(1263255..1264184) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862229.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene fmt CDS complement(1264198..1264716) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856004.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene def CDS complement(1264730..1266739) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014474.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 1266876..1267859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 1267875..1268234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 1268238..1269095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(1269092..1270309) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856000.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene metK CDS complement(1270455..1271717) product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014475.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 gene coaBC CDS complement(1271798..1272115) product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855993.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene rpoZ CDS complement(1272130..1272717) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855988.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 gene gmk CDS complement(1272720..1273148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS complement(1273266..1274093) product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene pyrF CDS complement(1274093..1277476) product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene carB CDS complement(1277500..1277979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS complement(1277983..1279266) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014479.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(1279263..1280213) product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862210.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(1280210..1280785) product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862208.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene pyrR CDS 1280916..1282247 product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 1282244..1282726 product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 1282726..1283202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS complement(1283199..1284041) product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727285.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(1284155..1284736) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 gene nusB CDS complement(1284736..1285299) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855973.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene efp CDS complement(1285351..1286442) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(1286442..1286876) product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene aroQ CDS complement(1286879..1287931) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014486.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene aroB CDS complement(1287963..1288631) product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855969.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(1288628..1289851) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855968.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene aroC CDS complement(1289889..1290314) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111373.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(1290325..1291143) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014493.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(1291147..1292295) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014494.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene mltG CDS complement(1292298..1292786) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014495.1 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene ruvX CDS complement(1292930..1295596) product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene alaS CDS complement(1295670..1297031) product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855936.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(1297044..1298306) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014497.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 CDS complement(1298314..1300146) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014498.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene aspS CDS 1300397..1301242 product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014499.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS 1301296..1302018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 1302074..1303468 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(1303465..1304772) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014509.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene hisS CDS complement(1304812..1305372) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014510.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 1305554..1306513 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728734.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS 1306656..1306943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(1307176..1309431) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013569.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(1309617..1311893) product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855910.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(1311941..1312516) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014514.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS complement(1312534..1314156) product peptide ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS complement(1314170..1315381) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014516.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene secF CDS complement(1315384..1317288) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855902.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene secD CDS complement(1317445..1318521) product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 gene ruvB CDS complement(1318534..1319148) product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227122.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene ruvA CDS complement(1319145..1319678) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014519.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene ruvC CDS complement(1319793..1320545) product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(1320612..1321067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855892.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(1321064..1322152) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859886.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(1322158..1323102) product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014523.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(1323103..1323738) product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859882.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS complement(1323731..1324351) product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(1324335..1326389) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855874.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene thrS CDS complement(1326499..1327728) product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859878.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS complement(1327741..1328337) product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014526.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(1328348..1328920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 tRNA complement(1329178..1329250) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 1329487..1329562 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 tRNA 1329582..1329654 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 tRNA 1329689..1329764 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 tRNA 1329807..1329880 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA 1329896..1329968 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA 1330003..1330078 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(1330119..1331093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(1331096..1332556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 1332671..1333333 product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1333422..1334606 product arabinofuranan 3-O-arabinosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 gene aftC CDS 1334603..1335004 product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857328.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 gene msrB CDS complement(1335058..1335759) product chlorite dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 1335888..1336526 product DUF3000 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014739.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 1336539..1337744 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(1337741..1339678) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene dxs CDS complement(1339768..1341045) product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS complement(1341046..1342038) product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014743.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1342124..1342624) product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014744.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene dut CDS 1342823..1343287 product DUF3093 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS complement(1343368..1343661) product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857344.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS 1343828..1344586 product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014747.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene ppgK CDS 1344754..1346271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(1346357..1346998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS complement(1347047..1348810) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859837.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(1348807..1349064) product DUF3039 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005389816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 1349113..1349538 product DUF3099 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014750.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 1349566..1351125 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014751.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS 1351142..1351576 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859832.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene dtd CDS 1351688..1352689 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014752.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS 1352826..1353503 product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014753.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 1353541..1354530 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene galE CDS complement(1354564..1355571) product DUF4192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066566054.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 1355916..1357001 product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859825.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 1357035..1359575 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286432.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(1359869..1360522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS 1360798..1361292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 1361294..1361956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(1362228..1362749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 1362921..1364168 product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015567.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 1364315..1367746 product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702416.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(1367838..1368362) product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730168.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(1368401..1368997) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064030.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 1369115..1370071 product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014757.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 1370087..1374052 product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014759.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene hrpA CDS complement(1374068..1374406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 1375176..1375856 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857389.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene lexA CDS 1375907..1376695 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014761.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 1376780..1377049 product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(1377126..1378391) product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014768.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 1378486..1379262 product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015274.1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene nagB CDS complement(1379259..1380755) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene hflX CDS 1380865..1381617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014770.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 1381637..1382152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(1382162..1382971) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014772.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 gene dapF CDS complement(1382968..1383867) product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014773.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene miaA CDS complement(1383864..1384673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 1384567..1385919 product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014775.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 1385933..1387021 product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014776.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(1387090..1387737) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908059.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS complement(1387722..1389248) product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857429.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene miaB CDS complement(1389273..1390421) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene bioF CDS complement(1390418..1391134) product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496779.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(1391182..1391763) product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene recX CDS complement(1391764..1392891) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene recA CDS complement(1393126..1393314) product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857447.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 1393340..1393951 product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857452.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene bioY CDS 1393957..1394646 product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS 1394643..1395248 product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857456.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(1395325..1399629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(1399787..1400635) product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857458.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS complement(1400707..1401069) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861658.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1401093..1401632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(1401629..1402189) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857464.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene pgsA CDS 1402218..1402502 product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857466.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(1402513..1403688) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014789.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(1404121..1407213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS complement(1407368..1407994) product TIGR03085 family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857475.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(1408005..1408472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1408531..1409064) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(1409070..1411193) product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(1411196..1412128) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014792.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene dapA CDS complement(1412141..1412773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(1412774..1413517) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014794.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene dapB CDS complement(1413560..1413739) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS 1413861..1414283 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 1414293..1414535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 1414659..1415435 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 1415469..1416362 product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226842.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(1416427..1417797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(1417781..1418362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 1418598..1419659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 1419758..1421341 product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015326.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(1421415..1423703) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014796.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(1423855..1424124) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene rpsO CDS complement(1424228..1425190) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(1425187..1426155) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014798.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 1426187..1427080 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014799.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 gene truB CDS complement(1427247..1427909) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857486.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(1427909..1428709) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857487.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS complement(1428706..1430010) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897397.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS complement(1430036..1431028) product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS complement(1431021..1431461) product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861694.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene rbfA CDS complement(1431579..1434437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS complement(1434543..1434875) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13460 CDS complement(1435018..1436037) product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene nusA CDS complement(1436034..1436585) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014804.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene rimP CDS 1436584..1437432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(1437454..1439274) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 1439240..1439959 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene yaaA CDS 1439962..1440687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 1440781..1441902 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014224.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 1441936..1442673 product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854640.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(1442670..1442924) product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene yoeB CDS complement(1442924..1443175) product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(1443216..1444157) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS complement(1444258..1444998) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014811.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene cobA CDS 1445023..1446228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(1446235..1447746) product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014814.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene mqo CDS 1447878..1448885 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 1448927..1450354 product mycothione reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014816.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene mtr CDS 1450675..1451061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 1451113..1451565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS complement(1451695..1452594) product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172769613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene map CDS complement(1452649..1454463) product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857527.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(1454465..1455646) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456766.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene ispG CDS complement(1455649..1456848) product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014824.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS complement(1456864..1458009) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014825.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene dxr CDS 1458214..1458747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(1459084..1460187) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861738.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene rlmN CDS complement(1460253..1461203) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857552.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(1461210..1461767) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014829.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene frr CDS 1461845..1462927 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568791.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 CDS complement(1462924..1463649) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284182.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene pyrH CDS complement(1463851..1464669) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene tsf CDS complement(1464866..1465813) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014831.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene rpsB CDS 1466087..1466653 product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014832.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS complement(1466616..1467509) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857565.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS complement(1467534..1468709) product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861752.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene dprA CDS complement(1468710..1470236) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014834.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(1470223..1470603) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014835.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(1471086..1471391) product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(1471388..1472044) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982719.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(1472049..1472921) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014836.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene lepB CDS complement(1472970..1473317) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014838.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene rplS CDS complement(1473432..1475720) product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014841.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(1475757..1477142) product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074061.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS complement(1477238..1478302) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050816932.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene trmD CDS complement(1478295..1478795) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014847.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene rimM CDS complement(1479076..1479594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 1479967..1482120 product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013830.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS complement(1482332..1483960) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014851.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene ffh CDS complement(1484074..1485681) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029703265.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene ftsY CDS complement(1485738..1486085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(1486110..1489568) product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014857.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene smc CDS complement(1489593..1490078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS complement(1490075..1490359) product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856367.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(1490387..1491889) product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863416.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS complement(1491943..1492449) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229065.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1492472..1493293) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene mutM CDS complement(1493286..1494053) product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861938.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene rnc CDS complement(1494050..1494595) product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861940.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(1494606..1495328) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(1495355..1496701) product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856385.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 gene gdhA CDS 1496802..1497926 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014866.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(1497896..1498285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856390.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 1498284..1499657 product DUF4921 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014867.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS 1499661..1500914 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014868.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 1500974..1503358 product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 gene malP CDS complement(1503359..1503817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 1503847..1505688 product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene pabB CDS 1505681..1506421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(1506583..1509009) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036462788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(1509022..1510446) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014873.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene pyk CDS complement(1510439..1511455) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014874.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 gene lgt CDS complement(1511437..1512255) product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene trpC CDS complement(1512301..1513002) product TIGR02234 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014875.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1513006..1513818) product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861968.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(1513823..1514452) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224143.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene hisH CDS complement(1514480..1515778) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856421.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 CDS complement(1515780..1515959) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 1516061..1517107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS complement(1517108..1517563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(1517617..1518408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS 1518586..1519134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS 1519127..1521325 product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014885.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene glgX CDS 1521325..1522716 product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856453.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS 1522771..1523352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 1523354..1525726 product malto-oligosyltrehalose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014893.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene treY CDS 1525741..1526790 product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856459.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1526792..1527175) product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014897.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(1527177..1527410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(1527430..1528071) product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014898.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS complement(1528076..1529377) product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862033.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene ilvA CDS 1529513..1531372 product choice-of-anchor I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 tRNA complement(1531727..1531817) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 1532085..1532603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS complement(1532678..1536238) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856475.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene dnaE CDS complement(1536296..1537564) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015552.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(1537565..1538302) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855103.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(1538303..1539985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS complement(1540097..1540591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS complement(1540592..1541521) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856488.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(1541511..1542020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS 1542093..1543031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS complement(1543028..1543618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860404.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 1543693..1544583 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860401.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(1544572..1545963) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014912.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(1545998..1547296) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929823.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS complement(1547727..1550903) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014916.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 gene ileS CDS complement(1551145..1552110) product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860384.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(1552237..1552548) product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014917.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(1552567..1553061) product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856516.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(1553100..1553798) product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856518.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(1553791..1554516) product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene pgeF CDS complement(1554531..1555769) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014920.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene ftsZ CDS complement(1555855..1556502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(1556504..1557925) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066569796.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene murC CDS complement(1557922..1559004) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856529.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene murG CDS complement(1559012..1560199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 note possible pseudo, internal stop codon, frameshifted CDS 1560081..1560299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(1560464..1561867) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014923.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene murD CDS complement(1561864..1562964) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene mraY CDS complement(1563001..1564521) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014925.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS complement(1564518..1566002) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856539.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS complement(1566024..1568006) product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014926.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS complement(1568105..1568758) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014927.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1568780..1569793) product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860361.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene rsmH CDS complement(1569985..1570419) product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856549.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene mraZ CDS complement(1570834..1571226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(1571317..1571754) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 1571907..1572470 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856553.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 1572508..1573596 product geranylgeranyl pyrophosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856555.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene idsA CDS 1573596..1575101 product alpha-(1->6)-mannopyranosyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856557.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(1575004..1575339) product Rv2175c family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856558.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 1575392..1576744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(1577634..1579022) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(1579103..1579612) product polyadenylate-specific 3'-exoribonuclease AS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856583.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS complement(1579613..1579828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(1579825..1580553) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014941.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(1580568..1581503) product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(1581533..1582681) product GDP-mannose-dependent monoacylated alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014943.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene pimB CDS complement(1582665..1583687) product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014944.1 transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(1583847..1584611) product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(1585136..1586767) product cytochrome bc1 complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856609.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene qcrB CDS complement(1586767..1587987) product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014946.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS complement(1587984..1588832) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172768931.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS complement(1588896..1589489) product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1589921..1590352) product cytochrome c oxidase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014950.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(1590371..1591465) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014951.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 1591811..1593733 product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014952.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene asnB CDS 1593795..1594781 product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894804.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(1594846..1595190) product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856623.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 1595331..1596044 product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856624.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 1596048..1597034 product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014954.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene cobT CDS complement(1597031..1598137) product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014956.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 1598207..1599694 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(1599795..1600214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856631.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 1600325..1602490 product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014958.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene sucB CDS 1602563..1604248 product dihydroxyacetone kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049825762.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 1604324..1607137 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729226.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene gcvP CDS 1607150..1608223 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973526.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene gcvT CDS 1608226..1608612 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973527.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene gcvH CDS 1608641..1609426 product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856633.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene lipB CDS 1609432..1610475 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene lipA CDS 1610512..1611309 product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859641.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 1611306..1612595 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123926043.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(1612592..1613068) product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856936.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 1613143..1614579 product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014960.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene glnA CDS 1614656..1615255 product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230540.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS 1615419..1616345 product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066568686.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS complement(1616399..1617433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS complement(1617522..1618076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS complement(1618073..1618576) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859635.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 1618625..1619347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(1619328..1620344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(1620415..1620567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(1620592..1622043) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014964.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene thrC CDS complement(1622133..1622297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(1622316..1622615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS complement(1622777..1625791) product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014971.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(1625788..1627122) product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856962.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 CDS 1627205..1628779 product CYTH and CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856966.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(1628786..1628992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 1629075..1630235 product galactokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856970.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 CDS complement(1630251..1631636) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 CDS complement(1632249..1633391) product bifunctional RNase H/acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859605.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(1633395..1634075) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014976.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(1634085..1635218) product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014977.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 1635255..1635887 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856980.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS 1635877..1636353 product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 1636402..1637304 product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856984.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 1637329..1637757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 tRNA 1638140..1638215 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(1638334..1638747) product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS 1638925..1641741 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene aceE CDS complement(1642118..1642996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS 1643014..1643307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 1643304..1644110 product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859582.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS complement(1644479..1645123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS complement(1645215..1646609) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731470.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS complement(1646599..1646919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(1647174..1648091) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014098.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(1648121..1648963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(1649012..1649827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(1650096..1651085) product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014308.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(1651078..1652520) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(1652652..1653449) product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857011.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1653579..1654217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(1654401..1655054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 1655138..1656790 product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 1656946..1657632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 1657598..1658728 product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 1658956..1659570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(1659638..1659823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS complement(1660091..1660732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS complement(1660772..1661035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 tRNA 1661169..1661242 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 CDS 1661388..1661828 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194559634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 1661865..1662443 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 1662649..1663647 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 1663771..1663953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(1663960..1664928) product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439110.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 1665362..1666177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 1666465..1667775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS complement(1667908..1669308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(1669766..1670419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 note possible pseudo, frameshifted CDS complement(1670493..1673066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS complement(1673069..1675441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(1675868..1676974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(1677094..1677915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(1677899..1678408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(1678823..1680103) product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(1680214..1681464) product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776761.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene wecC CDS complement(1681461..1682294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(1683000..1683698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 tRNA complement(1684331..1684405) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 CDS complement(1684482..1685612) product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776765.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene wecB CDS 1685738..1686010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014998.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(1686023..1686946) product exopolyphosphatase Ppx2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568167.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene ppx2 CDS complement(1686943..1687515) product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014021.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 tRNA 1687531..1687608 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS complement(1688371..1689306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS complement(1689293..1690129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(1690289..1691563) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856756.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene eno CDS complement(1691624..1692385) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014019.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 CDS 1692733..1693149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS complement(1693163..1693804) product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014016.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 1693767..1694447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 1694679..1695068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(1695321..1697357) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857029.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene dnaG CDS 1697356..1697748 product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726744.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 1697748..1698020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(1698102..1698452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(1698455..1698844) product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013440.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(1698954..1699973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 CDS 1699855..1700124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 1700349..1702061 product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880806.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 1702045..1702302 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 1702293..1703228 product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(1703243..1704544) product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 1704565..1706580 product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015004.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(1706753..1707211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1707208..1707714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015006.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(1707725..1709155) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 1709275..1709757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 1709773..1710210 product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015007.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS complement(1710211..1710948) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015010.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS complement(1710949..1711674) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene recO CDS complement(1711664..1712656) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015011.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene era CDS 1712796..1713833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(1713914..1714765) product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349874.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene pdxY CDS complement(1714775..1715839) product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694824.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS complement(1715899..1717215) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(1717212..1717790) product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015012.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene ybeY CDS complement(1717787..1718809) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015013.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(1718821..1719528) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015014.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(1719525..1720658) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015015.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene dnaJ CDS complement(1720669..1721682) product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859450.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene hrcA CDS complement(1721692..1722810) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015017.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene hemW CDS complement(1722821..1723489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859444.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS complement(1723577..1725427) product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859440.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 1725460..1727604 product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015019.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene malQ CDS complement(1727622..1727762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS complement(1727787..1727951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(1727951..1729192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS complement(1729288..1731243) product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015021.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 1731276..1732049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(1732046..1732441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 1732514..1734394 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015020.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(1734403..1734798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(1734791..1734994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 1735130..1736260 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS 1736348..1737778 product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015030.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene brnQ CDS 1737793..1738776 product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 1738897..1739676 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898123.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS 1739705..1741114 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015037.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS 1741111..1742034 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1742031..1742810 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 1742797..1744128 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 1744152..1745048 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015041.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 1745154..1745402 product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890776.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 1745399..1746328 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 1746325..1747077 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061295975.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 1747074..1748063 product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(1748074..1749252) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(1749252..1750469) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480161.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 1750486..1752477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(1752478..1754352) product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015054.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene lepA CDS 1754480..1755268 product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803896.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 1755302..1755808 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 1755997..1756260 product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 gene rpsT CDS 1756352..1757338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(1757335..1757982) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015055.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS complement(1757979..1758914) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015057.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene holA CDS 1759147..1767900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(1767911..1769476) product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(1769480..1770133) product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(1770227..1771027) product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015060.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(1771028..1771660) product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859329.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(1771664..1772173) product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859327.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene rsfS CDS complement(1772203..1772829) product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015061.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene nadD CDS complement(1772830..1773228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(1773228..1774166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(1774176..1775462) product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859321.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 1775515..1775769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(1775766..1776674) product D-isomer specific 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859319.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(1776693..1777808) product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 gene proB CDS complement(1777830..1779335) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015064.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene obgE CDS complement(1779426..1779770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(1779791..1780096) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859302.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene rplU CDS complement(1780281..1783016) product translation initiation factor IF-2 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015068.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(1783203..1783730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 1783615..1783848 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(1783899..1784309) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859294.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene ndk CDS complement(1784338..1784670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS 1784669..1786078 product 4-coumarate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029620.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS complement(1786075..1786500) product DUF4233 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567665.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS complement(1786497..1787990) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567661.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1787991..1790702) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015075.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1790725..1791678) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015079.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 1791771..1792547 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(1792566..1793846) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015085.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene clpX CDS 1793956..1794717 product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015088.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene pcaD CDS 1794793..1795431 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(1795494..1796114) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859221.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(1796145..1796741) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859220.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(1797167..1798540) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 gene tig tRNA complement(1798620..1798696) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA complement(1798835..1798909) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 CDS 1798993..1799802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 1799863..1800636 product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223550.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 1800646..1801575 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056737.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 1801575..1803038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 1803193..1804230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS complement(1804290..1805045) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS complement(1805053..1806828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(1806825..1807940) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119846.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS complement(1807937..1808932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 1808903..1809727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 1809724..1810587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 1810563..1811669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS complement(1811674..1812141) product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859211.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(1812147..1812764) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS 1812798..1815191 product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015108.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene pepN CDS complement(1815178..1816320) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015127.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 1816386..1817342 product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727594.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 1817326..1817739 product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(1817736..1818362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567537.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1818363..1818776) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS complement(1818786..1820456) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015133.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene ettA CDS complement(1820575..1821282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(1821380..1823362) product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015135.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 tRNA 1823418..1823492 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 CDS 1823590..1823715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 1823715..1823948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS 1824155..1825537 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS 1825685..1826173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 1826170..1826490 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921216.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS 1826501..1827307 product mycolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015148.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene cmrA CDS 1827308..1827937 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene orn tRNA 1827985..1828060 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 CDS complement(1828197..1828496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(1828630..1829349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 1829808..1830236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(1830170..1830373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 1830751..1831335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 1831543..1831701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(1831643..1832389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 1832707..1833603 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081119.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(1834253..1835449) product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015151.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 tRNA 1835661..1835734 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS 1835897..1836463 product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015162.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(1836470..1837114) product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015525.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(1837214..1838083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(1838110..1838385) product DUF3618 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015163.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 1838471..1838956 product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015164.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene bcp CDS complement(1839084..1844138) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 tRNA complement(1844844..1844926) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 1845073..1845525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857998.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS 1845522..1845899 product DUF3817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857996.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS complement(1845956..1846330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(1846353..1846952) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015172.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene rdgB CDS complement(1846946..1847674) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857993.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene rph CDS complement(1847697..1848464) product 3',5'-cyclic adenosine monophosphate phosphodiesterase CpdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857989.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene cdpA CDS complement(1848498..1849331) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene murI CDS complement(1849342..1850175) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS complement(1850457..1850996) product DUF2017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857980.1 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(1851006..1851398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 1851397..1852743 product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015184.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 1852747..1854711 product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015186.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS complement(1854701..1855420) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(1855512..1857269) product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene ctaD CDS complement(1857537..1858526) product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015189.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene nrdF CDS 1858678..1859391 product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567723.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(1859487..1861652) product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857952.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene nrdE CDS complement(1861663..1862184) product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857951.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 gene nrdI CDS complement(1862363..1862593) product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857948.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 gene nrdH CDS complement(1862913..1863035) product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 gene ykgO CDS 1863150..1863974 product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015194.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 gene nadE CDS complement(1863971..1864384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(1864377..1864763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(1864792..1865595) product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015195.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS complement(1865588..1865980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 1866081..1866782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(1866889..1867485) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776012.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 1867545..1868624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 tRNA complement(1868727..1868800) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 tRNA complement(1868820..1868893) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(1869011..1869745) product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857927.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1869804..1870286) product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223188.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(1870305..1871930) product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene pgm CDS 1871929..1873458 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 1873469..1873807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 1873800..1874168 product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860253.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 1874188..1874538 product fluoride efflux transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 1874531..1874896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(1874902..1877430) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(1877431..1878222) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 rRNA complement(1878844..1878949) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00070 rRNA complement(1879129..1882198) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00080 rRNA complement(1882599..1884113) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00090 CDS complement(1884683..1885942) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015212.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene murA CDS complement(1885978..1886826) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857068.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1887084..1888025 product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066567803.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 gene cysK CDS 1888033..1888734 product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006286028.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene cysE CDS complement(1888735..1889025) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 tRNA complement(1889082..1889155) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00480 tRNA complement(1889183..1889257) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00490 CDS complement(1889385..1891337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 tRNA complement(1891526..1891602) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00500 tRNA complement(1891603..1891676) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00510 CDS complement(1891764..1892570) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856259.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene zupT tRNA complement(1892651..1892725) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00520 CDS complement(1892778..1894286) product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015219.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 1894476..1895636 product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858945.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene dusB CDS 1895665..1896396 product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015220.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene phoU CDS complement(1896464..1897240) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015221.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene pstB CDS complement(1897278..1898240) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene pstA CDS complement(1898257..1899327) product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858938.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene pstC CDS complement(1899483..1900634) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015224.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene pstS CDS complement(1900799..1901566) product mycothiol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene mshD CDS 1901450..1901656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS 1901670..1902431 product LmeA family phospholipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS 1902424..1903083 product FABP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(1903080..1904000) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015228.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 1903999..1905051 product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015229.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 1905183..1905383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(1905436..1906503) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863129.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 gene purM CDS complement(1906504..1908021) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene purF CDS complement(1908037..1908417) product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863125.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS 1908442..1909449 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015231.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(1909472..1911748) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015233.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene purL CDS complement(1911756..1912430) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene purQ CDS complement(1912427..1912657) product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene purS CDS 1912879..1917258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 1917479..1918276 product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015260.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 1918288..1918959 product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015261.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 1918956..1919774 product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015262.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(1919771..1920445) product DUF2334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS 1920588..1922063 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(1922060..1924141) product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015237.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(1924138..1925034) product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 1925132..1925581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(1925585..1927018) product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173328348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 gene purB CDS complement(1927018..1928322) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene purD CDS 1928297..1928713 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015240.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(1928691..1930067) product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015245.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(1930082..1930798) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863097.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 tRNA complement(1930926..1931001) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00530 CDS 1931086..1932522 product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853939.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 1932576..1932938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 1932939..1934216 product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730872.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 1934213..1934596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 1934593..1935288 product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863055.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 gene otsB CDS 1935270..1936040 product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015255.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(1936015..1936947) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863034.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 gene rlmB CDS complement(1936951..1938276) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015271.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene cysS CDS complement(1938288..1938845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(1938846..1939406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(1939416..1940621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS complement(1940732..1941217) product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015288.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene ispF CDS complement(1941214..1942680) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066564999.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(1942835..1943512) product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015289.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene ispD CDS complement(1943514..1944104) product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS 1944286..1944816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS 1944903..1946255 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015292.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene radA CDS complement(1946248..1946931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015294.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 CDS complement(1946941..1947561) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853851.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 1947677..1948441 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015296.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(1948420..1948590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 1948681..1950087 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS complement(1950030..1952771) product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015301.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS complement(1952796..1953203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(1953200..1954015) product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS complement(1954090..1955781) product phosphoenolpyruvate-utilizing N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104530.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(1955774..1957831) product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(1957911..1959422) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene lysS CDS complement(1959439..1960698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(1960719..1961510) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015311.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1961511..1962212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1962213..1963031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(1963033..1963440) product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853810.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(1963497..1963955) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015314.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene folK CDS complement(1963959..1964330) product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853806.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene folB CDS complement(1964323..1965165) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173664572.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene folP CDS complement(1965169..1965744) product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015316.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 gene folE CDS complement(1965737..1968049) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015317.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene ftsH CDS complement(1968061..1968660) product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene hpt CDS complement(1968805..1968963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(1969208..1970098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(1970122..1971012) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene tilS CDS complement(1971012..1972265) product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015319.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene dacB CDS 1972340..1972873 product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015320.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(1972938..1974608) product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777012.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(1974685..1976787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 CDS complement(1976818..1977633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(1977804..1978673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(1978795..1979511) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 1979510..1979806 product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS 1979850..1980299 product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015324.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS 1980373..1984167 product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015325.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(1984195..1984338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(1984369..1984791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1984927..1985811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(1985947..1986618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(1986723..1987403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(1987487..1987993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(1988108..1989892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18680 CDS complement(1989953..1990810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(1990794..1992212) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(1992329..1993849) product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947058.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS complement(1993959..1999685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(2000148..2001047) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853756.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 gene ppk2 CDS complement(2001148..2001294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(2001340..2001474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(2001884..2003524) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862917.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene groL CDS 2003972..2005315 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015336.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS 2005483..2008467 product Na+/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 2008468..2008962 product Na(+)/H(+) antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS 2008952..2010748 product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853718.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 2010748..2011260 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015339.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2011262..2011540 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862899.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 2011537..2011917 product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853711.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene mnhG CDS complement(2011907..2013037) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853704.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(2013241..2014302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(2014361..2014585) product DUF3263 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2014601..2015179 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS 2015198..2016220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS 2016223..2016819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 CDS 2016825..2017616 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853692.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 2017613..2019073 product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(2019216..2020217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2020411..2021142) product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853677.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(2021135..2022076) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015345.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS complement(2022069..2022548) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876872.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS 2022586..2023971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 2024052..2024984 product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015348.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 2024981..2027368 product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015349.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 CDS complement(2027657..2030074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(2030079..2033888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2034495..2035700) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS complement(2035701..2037032) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853660.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene pta CDS complement(2037129..2038304) product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853648.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene purT CDS complement(2038846..2040135) product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015361.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 CDS 2040188..2040985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853637.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 2041313..2042179 product PRC and DUF2382 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027446.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(2042254..2043372) product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853634.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(2043519..2044553) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015363.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 gene fbaA CDS complement(2044603..2045799) product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167382136.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(2045948..2046628) product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031511861.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2046621..2047148) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862850.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene pyrE CDS complement(2047153..2048061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(2048091..2048933) product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015366.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(2048955..2049377) product DUF4265 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015369.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(2049388..2050419) product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015397.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene adhP CDS 2050548..2051366 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729713.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene panB CDS complement(2051524..2052318) product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092170.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene panC CDS 2052484..2053647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS complement(2053663..2056209) product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015370.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene clpB CDS complement(2057255..2058586) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS 2058664..2059686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2059676..2060527) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2060619..2060870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 2060867..2062012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 2062071..2063837 product pyruvate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 2064151..2064939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970517.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(2065133..2065543) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015387.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(2065565..2066749) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015388.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene dnaJ CDS complement(2066895..2067590) product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015389.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene grpE CDS complement(2067605..2069446) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015390.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene dnaK CDS complement(2069691..2071211) product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015386.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 2071354..2072757 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015391.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 2072802..2073326 product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228555.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS complement(2073646..2074224) product nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS complement(2074231..2075163) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(2075165..2075803) product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015402.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(2075814..2077109) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862775.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS complement(2077109..2078023) product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015403.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS complement(2078041..2078820) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853541.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(2078817..2079077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(2079074..2080732) product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 2080971..2082338 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015406.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS 2082358..2083524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 2083521..2084657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 2084654..2085316 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776062.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 2085399..2086250 product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230971.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 2086268..2086963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS 2086960..2088198 product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014749.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 2088303..2090009 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 2090006..2091958 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776694.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS 2092071..2093354 product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS 2093367..2093738 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 2093731..2094669 product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064375.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 2094684..2094905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS 2094969..2095577 product DUF1707 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 CDS 2095599..2096840 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862691.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS complement(2096837..2098381) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085191.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2098707..2100254) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285120.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 CDS complement(2100374..2101702) product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS 2101893..2103104 product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(2103143..2103706) product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene dcd tRNA 2103768..2103839 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00540 CDS complement(2103902..2104192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS complement(2104192..2104767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 2105017..2105820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 2105970..2107493 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015456.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS complement(2107539..2109272) product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015435.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 CDS complement(2109322..2110506) product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS 2110529..2110819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 2110826..2113732 product DUF3367 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003853429.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(2113639..2114691) product trehalose corynomycolate mycolyl acetyltransferase TmaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015440.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene tmaT CDS 2114729..2115382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS 2115366..2116790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 2116952..2117188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2117530..2117982 product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS complement(2117957..2119012) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015443.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 2119138..2119842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 2119869..2120627 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015445.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 CDS complement(2120669..2122495) product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015446.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS 2122727..2123539 product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene trmB CDS 2123542..2124216 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857880.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 2124227..2126530 product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015449.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 2126520..2127515 product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015450.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 2127625..2129025 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013737.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 2129036..2130328 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013738.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 2130330..2130689 product DUF3054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857875.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 CDS complement(2130859..2132400) product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857874.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS complement(2132397..2137121) product polyketide synthase Pks13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015451.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene pks13 CDS complement(2137157..2138974) product FadD32-like long-chain-fatty-acid--AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015452.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(2139011..2139967) product cutinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015453.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(2139992..2140483) product DUF732 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015454.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(2140483..2142438) product protein PS1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015455.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS complement(2142753..2143766) product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015457.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(2143833..2145644) product beta-(1->2)-arabinofuranosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015458.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene aftB CDS complement(2145670..2146665) product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015459.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(2146665..2147183) product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015460.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(2147173..2149122) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284777.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 2149239..2150864 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011897243.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 2150892..2151230 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 2151362..2152291 product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013789.1 transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(2152298..2153065) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(2153065..2154063) product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186009675.1 transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(2154060..2155079) product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978367.1 transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(2155086..2155988) product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013801.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS complement(2156300..2157889) product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014364.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS complement(2158090..2159280) product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015466.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 gene glf CDS 2159440..2161371 product LGFP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015467.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(2161368..2162828) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857839.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 gene glpK CDS 2163121..2164002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS complement(2163999..2164832) product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015468.1 transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(2164837..2165667) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015469.1 transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(2165667..2166920) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene serS CDS 2167001..2167729 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862621.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 2167739..2168839 product septum formation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857824.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 2168842..2169189 product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862613.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(2169186..2169608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(2169630..2170457) product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862609.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene pheA CDS complement(2170454..2171287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS complement(2171366..2172280) product DUF2891 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027115.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 2172298..2172996 product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857812.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS 2173028..2174317 product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197702410.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS 2174446..2174715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(2174967..2176442) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(2176514..2177089) product CueP family metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015531.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS 2177493..2178215 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015530.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS 2178212..2179339 product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015529.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2179451..2179777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(2179939..2181492) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 2181684..2183183 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(2183195..2184145) product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777037.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 gene hutG CDS 2184183..2184917 product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223166.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS 2184951..2186492 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 gene hutH CDS 2186829..2187995 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228153.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS 2188016..2189146 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005186.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS 2189180..2190580 product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS 2190804..2192495 product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777035.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS 2192587..2193780 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223171.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 gene hutI CDS complement(2193865..2194995) product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014327.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene ugpC CDS complement(2195029..2196351) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014326.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(2196395..2197390) product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014325.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(2197391..2198353) product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265737.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(2198686..2199609) product DUF5926 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006284785.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(2199647..2200336) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(2200345..2201103) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545848.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 2201169..2203085 product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015484.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(2203086..2203739) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 gene msrA CDS 2203830..2204432 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862560.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 CDS 2204556..2205728 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS complement(2205734..2207209) product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015502.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 2207298..2207933 product DUF6474 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015503.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS complement(2207965..2208603) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 CDS complement(2208581..2209858) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015505.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 2209857..2210402 product DUF2020 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS 2210414..2211352 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(2211357..2211509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858985.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(2211512..2212333) product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(2212358..2212984) product TetR/AcrR family transcriptional regulator MbcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015509.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene mcbR CDS complement(2213097..2213366) product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(2213469..2214365) product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015511.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(2214424..2214570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 2214569..2215573 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015513.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS 2215905..2217110 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261158.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene istA CDS 2217135..2217917 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 rRNA complement(2218439..2218544) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00100 rRNA complement(2218723..2221790) product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00110 rRNA complement(2222195..2223709) product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00120 CDS complement(2224282..2225280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(2225280..2226038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS complement(2226035..2226409) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015515.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 2226594..2227979 product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015516.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(2228296..2229279) product rod-shaped morphology protein RsmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855053.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene rsmP CDS complement(2229368..2229739) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene trxA CDS 2229861..2230061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2230074..2230274 product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860938.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2230296..2232551 product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013619.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS complement(2232567..2232755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 2232908..2233513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(2233510..2235027) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene dnaB CDS 2235426..2235833 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(2235804..2237876) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013953.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(2238060..2238734) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015412.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(2238734..2239420) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(2239423..2239821) product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967510.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(2239830..2240117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS complement(2240178..2240939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(2241072..2241524) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene rplI CDS complement(2241573..2242217) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(2242269..2242556) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene rpsF CDS complement(2243004..2243192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2243196..2244746) product glycosyltransferase family 87 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS complement(2244747..2247014) product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS complement(2247117..2247491) product DUF5318 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 2247550..2248011 product MarR family transcriptional regulator CarR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855083.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene carR CDS 2248082..2249056 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 2249067..2249525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861203.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(2249497..2250405) product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015551.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(2250455..2250769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20930 CDS complement(2250845..2252338) product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 2252364..2253170 product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855116.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 2253186..2254766 product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418280.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 2254759..2255715 product ArsO family NAD(P)H-dependent flavin-containing monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014413.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS 2256069..2257049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 2257059..2258222 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015561.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS complement(2258132..2258638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS complement(2258649..2259290) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803688.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(2259290..2260294) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803689.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 CDS 2260359..2261504 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 2261501..2262103 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803691.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 2262114..2262656 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS 2262738..2264162 product C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052501.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene dcuC CDS 2264180..2265520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS complement(2265585..2265869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(2265911..2266276) product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857248.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS complement(2266273..2266791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 2266803..2267753 product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015197.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(2267743..2268798) product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014758.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2269190..2272018) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015573.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene leuS CDS 2272277..2272693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS complement(2272697..2274016) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666700.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2274093..2274596) product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014033.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2274639..2276936) product LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230690.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS complement(2277395..2277652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(2277671..2279011) product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265565.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(2279065..2280426) product HAAAP family serine/threonine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071199.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 2280762..2281397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 CDS complement(2281427..2281687) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21220 CDS 2282224..2282889 product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013426.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(2283100..2283435) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21240 CDS 2283540..2284745 product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015261158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene istA CDS 2284770..2285552 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899614.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS complement(2285612..2285872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(2286216..2286470) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(2286546..2286764) product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265556.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS complement(2286988..2287374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 2287566..2288504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS 2288703..2289506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS complement(2289575..2291911) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006768748.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS complement(2291918..2298292) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013858.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS complement(2298375..2299340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS complement(2299356..2299703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS complement(2299955..2300854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(2301645..2302031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(2302060..2302791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS complement(2302766..2302987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS complement(2303174..2303821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS 2303709..2303939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2303883..2305079) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105930.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 gene gltS CDS complement(2305239..2306117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS complement(2306271..2307266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(2308201..2312778) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013859.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(2312783..2315650) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013860.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 2315846..2316703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(2317042..2318481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 2318587..2319033 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 2319194..2319610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 2319804..2320229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(2320294..2321007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(2321070..2322764) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013327.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(2322987..2324219) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015579.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 2324325..2324756 product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855171.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 2324763..2324972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 2325157..2326659 product anthranilate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015581.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS 2326656..2327267 product anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855176.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS 2327260..2328279 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855178.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene trpD CDS 2328272..2329633 product bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015582.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 gene trpCF CDS 2329644..2330837 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567953.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene trpB CDS 2330838..2331653 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567954.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene trpA CDS 2331650..2332015 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855195.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 2332016..2332957 product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855200.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 2332967..2333269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015617.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 2333839..2335098 product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005092091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS complement(2335105..2335545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS complement(2335724..2336071) product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015618.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS complement(2336068..2336778) product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015619.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS complement(2336778..2337380) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855283.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS complement(2337373..2338863) product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS 2338927..2339658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS 2339655..2342075 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015621.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS 2342072..2345383 product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015622.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS 2345457..2346020 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015623.1 transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS 2346116..2347033 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855300.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 gene trxB CDS 2347044..2347367 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 gene trxA CDS 2347411..2348589 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855304.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2348586..2349629) product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855307.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2349633..2350574) product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855308.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(2350575..2351153) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855311.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 gene rsmG CDS complement(2351288..2352253) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855313.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene yidC CDS complement(2352263..2352550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(2352550..2352843) product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860977.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene rnpA CDS complement(2352920..2353057) product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777159.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 gene rpmH CDS 2353518..2353778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870